![]() |
breseq version 0.35.4 revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Predicted mutations | |||||
|---|---|---|---|---|---|
| evidence | position | mutation | annotation | gene | description |
| MC JC | 257,908 | Δ776 bp | insB9–[crl] | insB9, insA9, [crl] | |
| RA | 889,923 | A→G | intergenic (‑104/‑166) | ybjL ← / → ybjM | putative transport protein YbjL/putative inner membrane protein |
| RA | 1,196,220 | C→T | H366H (CAC→CAT) | icd → | isocitrate dehydrogenase |
| RA | 1,196,232 | C→T | T370T (ACC→ACT) | icd → | isocitrate dehydrogenase |
| RA | 1,196,245 | T→C | L375M (TTA→CTG) | icd → | isocitrate dehydrogenase |
| RA | 1,196,247 | A→G | L375M (TTA→CTG) | icd → | isocitrate dehydrogenase |
| RA | 1,264,930 | A→G | E406G (GAA→GGA) | hemA → | glutamyl‑tRNA reductase |
| RA | 1,678,604 | G→T | A60S (GCA→TCA) | ydgH → | DUF1471 domain‑containing protein YdgH |
| JC JC | 1,879,829 | Δ1 bp :: IS186 (–) +6 bp :: Δ1 bp | coding (115‑120/360 nt) | yeaR ← | DUF1971 domain‑containing protein YeaR |
| MC JC | 1,978,503 | Δ776 bp | insB‑5–insA‑5 | insB‑5, insA‑5 | |
| RA | 2,173,363 | Δ2 bp | pseudogene (915‑916/1358 nt) | gatC ← | galactitol‑specific PTS enzyme IIC component |
| RA | 3,045,328 | C→A | E192* (GAA→TAA) | ygfF ← | putative NAD(P)‑binding oxidoreductase with NAD(P)‑binding Rossmann‑fold domain |
| RA | 3,281,284 | G→C | pseudogene (163/504 nt) | agaA → | putative truncated N‑acetylgalactosamine‑6‑phosphate deacetylase |
| RA | 3,354,487 | C→T | intergenic (‑437/‑238) | yhcC ← / → gltB | radical SAM family oxidoreductase YhcC/glutamate synthase subunit GltB |
| RA | 3,560,455 | +G | pseudogene (151/758 nt) | glpR ← | DNA‑binding transcriptional repressor GlpR |
| MC JC | 3,693,260 | Δ11 bp | coding (1967‑1977/2619 nt) | bcsA ← | cellulose synthase catalytic subunit |
| RA | 3,815,883 | +C | coding (667/687 nt) | rph ← | truncated RNase PH |
| JC | 3,919,003 | (AGTGGAGGTAGAAAACGTCGCCCGGGAAT)1→2 | coding (855/1542 nt) | atpA ← | ATP synthase F1 complex subunit alpha |
| RA | 4,109,248 | G→T | V139F (GTT→TTT) | sbp → | sulfate/thiosulfate ABC transporter periplasmic binding protein Sbp |
| RA | 4,233,852 | C→T | A32V (GCT→GTT) | pgi → | glucose‑6‑phosphate isomerase |
| RA | 4,261,710 | C→A | S14R (AGC→AGA) | dusA → | tRNA‑dihydrouridine synthase A |
| RA | 4,296,381 | +GC | intergenic (+587/+55) | gltP → / ← yjcO | glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO |
| RA | 4,392,311 | C→A | intergenic (+162/‑49) | orn → / → glyV | oligoribonuclease/tRNA‑Gly |
| RA | 4,396,909 | C→A | S282Y (TCC→TAC) | amiB → | N‑acetylmuramoyl‑L‑alanine amidase B |
| Unassigned missing coverage evidence | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | NC_000913 | 696755 | 696862 | 108 | 23 [18] | [0] 52 | glnW | glnW |
| * | * | ÷ | NC_000913 | 1196255 | 1211431 | 15177 | 25 [20] | [21] 26 | [icd]–[icdC] | [icd],ymfD,ymfE,lit,intE,xisE,ymfH,ymfI,ymfJ,ymfK,ymfT,ymfL,ymfM,oweE,ymfN,aaaE,ymfR,beeE,jayE,ymfQ,ycfK,tfaP,tfaE,stfE,pinE,mcrA,[icdC] |
| * | * | ÷ | NC_000913 | 3102950 | 3104055 | 1106 | 24 [22] | [22] 24 | [mutY] | [mutY] |
| * | * | ÷ | NC_000913 | 3423768–3424233 | 3424531–3424238 | 6–764 | 24 [20] | [22] 23 | [rrfD]–[rrlD] | [rrfD],[rrlD] |
| Unassigned new junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | 696863 = | 0 (0.000) | 46 (0.580) +GAAGAAACAATC |
21/252 | 2.2 | 49.7% | intergenic (‑33/+2) | glnW/glnU | tRNA‑Gln/tRNA‑Gln |
| ? | NC_000913 | = 697134 | 102 (1.170) | intergenic (‑1/+379) | metT/asnB | tRNA‑Met/asparagine synthetase B | |||||
| * | ? | NC_000913 | = 1299498 | 0 (0.000) | 136 (1.600) | 77/268 | 0.0 | 100% | intergenic (+253/‑33) | ychE/insH21 | putative inner membrane protein/IS5 transposase and trans‑activator |
| ? | NC_000913 | 1300698 = | 0 (0.000) | intergenic (+151/‑484) | insH21/oppA | IS5 transposase and trans‑activator/oligopeptide ABC transporter periplasmic binding protein | |||||
| * | ? | NC_000913 | 3363001 = | 134 (1.530) | 102 (1.170) | 59/274 | 0.2 | 60.2% | coding (195/2382 nt) | yhcD | putative fimbrial usher protein YhcD |
| ? | NC_000913 | 3766087 = | 2 (0.020) | coding (3905/4134 nt) | rhsA | rhs element protein RhsA | |||||
| * | ? | NC_000913 | = 3653230 | NA (NA) | 104 (1.190) | 63/276 | 0.1 | 97.2% | noncoding (1/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | = 3766089 | 3 (0.030) | coding (3907/4134 nt) | rhsA | rhs element protein RhsA | |||||