![]() |
breseq version 0.35.4 revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Marginal read alignment evidence (highest frequency 20 of 485 shown, sorted by frequency from high to low) | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | ref | new | freq | score (cons/poly) | reads | annotation | genes | product | ||
| * | CP009974 | 5,105,264 | 0 | G | A | 76.5% | ‑1.0 / 14.7 | 34 | A196A (GCC→GCT) | RPPX_22650 | benzene 1,2‑dioxygenase |
| * | CP009974 | 5,105,267 | 0 | A | T | 76.5% | ‑1.0 / 17.1 | 34 | G195G (GGT→GGA) | RPPX_22650 | benzene 1,2‑dioxygenase |
| * | CP009974 | 5,105,270 | 0 | G | A | 76.5% | ‑1.0 / 12.9 | 34 | R194R (CGC→CGT) | RPPX_22650 | benzene 1,2‑dioxygenase |
| * | CP009974 | 5,105,288 | 0 | T | G | 75.8% | ‑0.2 / 11.4 | 33 | E188D (GAA→GAC) | RPPX_22650 | benzene 1,2‑dioxygenase |
| * | CP009974 | 5,105,285 | 0 | G | A | 75.0% | ‑0.3 / 14.3 | 33 | G189G (GGC→GGT) | RPPX_22650 | benzene 1,2‑dioxygenase |
| * | CP009974 | 4,165,116 | 0 | A | . | 74.6% | 87.1 / 82.1 | 63 | intergenic (‑310/‑165) | RPPX_18525/RPPX_18530 | transporter/16S ribosomal RNA |
| * | CP009974 | 1,160,779 | 0 | C | T | 73.8% | 840.7 / 281.0 | 452 | intergenic (+4302/‑10981) | RPPX_05120/RPPX_05130 | hypothetical protein/channel protein TolC |
| * | CP009974 | 3,847,581 | 0 | T | C | 73.1% | 484.0 / 296.3 | 406 | intergenic (+94/‑246) | RPPX_17150/RPPX_17155 | tRNA‑dihydrouridine synthase C/heat‑shock protein |
| * | CP009974 | 3,105,408 | 0 | A | G | 71.9% | 761.0 / 309.8 | 407 | intergenic (+129/+146) | RPPX_13820/mscL | ferredoxin‑NADP reductase/large‑conductance mechanosensitive channel |
| * | CP009974 | 3,771,883 | 0 | A | . | 71.9% | 461.5 / inf | 226 | noncoding (76/76 nt) | RPPX_16845 | tRNA‑Glu |
| * | CP009974 | 5,598,979 | 0 | C | T | 71.8% | 703.1 / inf | 467 | G235G (GGC→GGT) | RPPX_24920 | hypothetical protein |
| * | CP009974 | 1,897,249 | 0 | G | A | 71.0% | 264.3 / 262.6 | 335 | intergenic (‑5027/‑3570) | RPPX_08470/RPPX_08480 | tryptophan synthase subunit beta/hypothetical protein |
| * | CP009974 | 769,806 | 0 | T | C | 70.7% | 210.5 / 164.7 | 233 | intergenic (‑228/+240) | RPPX_03350/RPPX_03355 | acetolactate synthase/5S ribosomal RNA |
| * | CP009974 | 1,277,671 | 0 | G | A | 70.5% | 445.4 / 288.9 | 411 | intergenic (+140/+98) | RPPX_05635/RPPX_05640 | aldehyde dehydrogenase/mechanosensitive ion channel protein MscS |
| * | CP009974 | 1,897,591 | 0 | T | C | 70.5% | 4791.4 / inf | 4518 | intergenic (‑5369/‑3228) | RPPX_08470/RPPX_08480 | tryptophan synthase subunit beta/hypothetical protein |
| * | CP009974 | 3,837,710 | 0 | A | . | 70.2% | 18.2 / 90.1 | 59 | intergenic (+261/‑290) | RPPX_17095/RPPX_17100 | proteophosphoglycan precursor/cupin |
| * | CP009974 | 904,275 | 0 | C | A | 70.0% | 416.2 / 221.3 | 238 | intergenic (‑435/‑339) | RPPX_03940/RPPX_03945 | phosphoribosylformylglycinamidine synthase/murein transglycosylase |
| * | CP009974 | 314,751 | 0 | C | G | 70.0% | 187.3 / 134.6 | 140 | intergenic (‑287/‑237) | RPPX_01275/RPPX_01280 | aldehyde oxidase/thiol:disulfide interchange protein |
| * | CP009974 | 1,897,195 | 0 | G | A | 69.5% | 236.9 / 269.9 | 332 | intergenic (‑4973/‑3624) | RPPX_08470/RPPX_08480 | tryptophan synthase subunit beta/hypothetical protein |
| * | CP009974 | 3,837,711 | 0 | C | T | 69.5% | ‑1.9 / 40.0 | 59 | intergenic (+262/‑289) | RPPX_17095/RPPX_17100 | proteophosphoglycan precursor/cupin |
| Marginal new junction evidence (lowest skew 10 of 692 shown) | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | CP009974 | 1895750 = | 335 (0.920) | 450 (1.380) +GCCGGTCAGCACGTC |
159/270 | 1.1 | 17.3% | intergenic (‑3528/‑5069) | RPPX_08470/RPPX_08480 | tryptophan synthase subunit beta/hypothetical protein |
| ? | CP009974 | 1897573 = | 4435 (12.190) | intergenic (‑5351/‑3246) | RPPX_08470/RPPX_08480 | tryptophan synthase subunit beta/hypothetical protein | |||||
| * | ? | CP009974 | = 1157317 | 0 (0.000) | 303 (1.310) +54 bp |
92/192 | 3.7 | 73.1% | intergenic (+840/‑14443) | RPPX_05120/RPPX_05130 | hypothetical protein/channel protein TolC |
| ? | CP009974 | 1160771 = | 349 (0.960) | intergenic (+4294/‑10989) | RPPX_05120/RPPX_05130 | hypothetical protein/channel protein TolC | |||||
| * | ? | CP009974 | = 3844204 | 310 (0.850) | 133 (0.630) +63 bp |
82/174 | 3.8 | 42.2% | intergenic (+1/‑42) | RPPX_17125/RPPX_17130 | tRNA‑Ala/tRNA‑Glu |
| ? | CP009974 | 3844237 = | 320 (0.880) | intergenic (+34/‑9) | RPPX_17125/RPPX_17130 | tRNA‑Ala/tRNA‑Glu | |||||
| * | ? | CP009974 | 418657 = | 1 (0.000) | 173 (0.670) +AAGAAGC |
102/214 | 4.0 | 96.7% | intergenic (‑236/+415) | RPPX_01715/RPPX_01720 | hypothetical protein/lipoprotein |
| ? | CP009974 | = 4147133 | 12 (0.040) | intergenic (+385/‑636) | RPPX_18425/RPPX_18430 | enoyl‑CoA hydratase/conjugal transfer protein TraR | |||||
| * | ? | CP009974 | 1157207 = | 0 (0.000) | 352 (1.780) | 75/164 | 4.2 | 100% | intergenic (+730/‑14553) | RPPX_05120/RPPX_05130 | hypothetical protein/channel protein TolC |
| ? | CP009974 | = 1158025 | NA (NA) | intergenic (+1548/‑13735) | RPPX_05120/RPPX_05130 | hypothetical protein/channel protein TolC | |||||
| * | ? | CP009974 | = 904270 | 229 (0.630) | 266 (0.750) +ATT |
134/294 | 5.5 | 53.0% | intergenic (‑430/‑344) | RPPX_03940/RPPX_03945 | phosphoribosylformylglycinamidine synthase/murein transglycosylase |
| ? | CP009974 | = 904364 | 252 (0.690) | intergenic (‑524/‑250) | RPPX_03940/RPPX_03945 | phosphoribosylformylglycinamidine synthase/murein transglycosylase | |||||
| * | ? | CP009974 | 3148569 = | 194 (0.530) | 195 (0.620) +CGGCCCCTTCGCGGGTAAAA |
116/260 | 5.7 | 49.8% | intergenic (+96/+116) | RPPX_14035/RPPX_14040 | membrane protein/bifunctional glyoxylate/hydroxypyruvate reductase B |
| ? | CP009974 | = 3148644 | 260 (0.710) | intergenic (+171/+41) | RPPX_14035/RPPX_14040 | membrane protein/bifunctional glyoxylate/hydroxypyruvate reductase B | |||||
| * | ? | CP009974 | 3763892 = | 115 (0.320) | 133 (0.610) | 77/182 | 5.8 | 79.1% | intergenic (‑225/+284) | RPPX_16805/RPPX_16810 | protease HtpX/aminotransferase |
| ? | CP009974 | 3764115 = | 1 (0.000) | intergenic (‑448/+61) | RPPX_16805/RPPX_16810 | protease HtpX/aminotransferase | |||||
| * | ? | CP009974 | = 1897308 | 25 (0.070) | 766 (2.230) | 127/284 | 5.8 | 98.3% | intergenic (‑5086/‑3511) | RPPX_08470/RPPX_08480 | tryptophan synthase subunit beta/hypothetical protein |
| ? | CP009974 | 1897966 = | 3 (0.010) | intergenic (‑5744/‑2853) | RPPX_08470/RPPX_08480 | tryptophan synthase subunit beta/hypothetical protein | |||||
| * | ? | CP009974 | 1277582 = | 348 (0.960) | 250 (0.690) +C |
134/298 | 5.8 | 41.6% | intergenic (+51/+187) | RPPX_05635/RPPX_05640 | aldehyde dehydrogenase/mechanosensitive ion channel protein MscS |
| ? | CP009974 | 4286484 = | 358 (0.980) | intergenic (+340/+304) | RPPX_19070/RPPX_19075 | LacI family transcriptional regulator/hypothetical protein | |||||