![]() |
breseq version 0.32.0 revision 6ff6de7d1b87
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
Marginal new junction evidence (lowest skew 10 of 36 shown) | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
* | ? | NC_000913 | = 4296166 | 8 (0.160) | 8 (0.170) | 6/268 | 5.7 | 51.3% | noncoding (333/602 nt) | RIP321 (repetitive extragenic palindromic) element, contains 11 REP sequences and 4 IHF sites | RIP321 (repetitive extragenic palindromic) element, contains 11 REP sequences and 4 IHF sites |
? | NC_000913 | = 4296249 | NA (NA) | noncoding (416/602 nt) | RIP321 (repetitive extragenic palindromic) element, contains 11 REP sequences and 4 IHF sites | RIP321 (repetitive extragenic palindromic) element, contains 11 REP sequences and 4 IHF sites | |||||
* | ? | NC_000913 | = 3943623 | NA (NA) | 7 (0.150) | 6/268 | 5.7 | 17.0% | intergenic (+114/‑80) | gltU/rrlC | tRNA‑Glu/23S ribosomal RNA of rrnC operon |
? | NC_000913 | = 4037456 | 36 (0.730) | intergenic (+122/‑62) | alaT/rrlA | tRNA‑Ala/23S ribosomal RNA of rrnA operon | |||||
* | ? | NC_000913 | 3423374 = | 62 (1.250) | 7 (0.140) | 6/278 | 5.9 | 10.3% | intergenic (+182/+47) | yhdZ/rrfF | putative amino acid ABC transporter ATPase/5S ribosomal RNA of rrnD operon |
? | NC_000913 | 3423663 = | NA (NA) | intergenic (‑10/+3) | thrV/rrfD | tRNA‑Thr/5S ribosomal RNA of rrnD operon | |||||
* | ? | NC_000913 | = 4296249 | NA (NA) | 7 (0.150) | 5/268 | 6.2 | 59.6% | noncoding (416/602 nt) | RIP321 (repetitive extragenic palindromic) element, contains 11 REP sequences and 4 IHF sites | RIP321 (repetitive extragenic palindromic) element, contains 11 REP sequences and 4 IHF sites |
? | NC_000913 | = 4296279 | 5 (0.100) | noncoding (446/602 nt) | RIP321 (repetitive extragenic palindromic) element, contains 11 REP sequences and 4 IHF sites | RIP321 (repetitive extragenic palindromic) element, contains 11 REP sequences and 4 IHF sites | |||||
* | ? | NC_000913 | = 4295940 | 18 (0.360) | 7 (0.150) | 5/268 | 6.2 | 29.0% | noncoding (107/602 nt) | RIP321 (repetitive extragenic palindromic) element, contains 11 REP sequences and 4 IHF sites | RIP321 (repetitive extragenic palindromic) element, contains 11 REP sequences and 4 IHF sites |
? | NC_000913 | = 4296023 | NA (NA) | noncoding (190/602 nt) | RIP321 (repetitive extragenic palindromic) element, contains 11 REP sequences and 4 IHF sites | RIP321 (repetitive extragenic palindromic) element, contains 11 REP sequences and 4 IHF sites | |||||
* | ? | NC_000913 | = 4295917 | 22 (0.440) | 5 (0.110) | 5/268 | 6.2 | 25.7% | noncoding (84/602 nt) | RIP321 (repetitive extragenic palindromic) element, contains 11 REP sequences and 4 IHF sites | RIP321 (repetitive extragenic palindromic) element, contains 11 REP sequences and 4 IHF sites |
? | NC_000913 | = 4296159 | 8 (0.170) | noncoding (326/602 nt) | RIP321 (repetitive extragenic palindromic) element, contains 11 REP sequences and 4 IHF sites | RIP321 (repetitive extragenic palindromic) element, contains 11 REP sequences and 4 IHF sites | |||||
* | ? | NC_000913 | = 3943623 | NA (NA) | 6 (0.130) | 5/268 | 6.2 | 24.9% | intergenic (+114/‑80) | gltU/rrlC | tRNA‑Glu/23S ribosomal RNA of rrnC operon |
? | NC_000913 | = 3943641 | 19 (0.380) | intergenic (+132/‑62) | gltU/rrlC | tRNA‑Glu/23S ribosomal RNA of rrnC operon | |||||
* | ? | NC_000913 | = 2729442 | 33 (0.670) | 17 (0.400) +GTATCAGTCTGCTTCGCAAG |
4/242 | 6.2 | 30.8% | noncoding (1/76 nt) | gltW | tRNA‑Glu |
? | NC_000913 | = 4168264 | 56 (1.130) | intergenic (+65/‑107) | rrsB/gltT | 16S ribosomal RNA of rrnB operon/tRNA‑Glu | |||||
* | ? | NC_000913 | 2729628 = | NA (NA) | 7 (0.150) | 5/272 | 6.3 | NA | noncoding (1528/1542 nt) | rrsG | 16S ribosomal RNA of rrnG operon |
? | NC_000913 | 2729650 = | NA (NA) | noncoding (1506/1542 nt) | rrsG | 16S ribosomal RNA of rrnG operon | |||||
* | ? | NC_000913 | 3423374 = | 62 (1.250) | 7 (0.140) | 5/278 | 6.4 | 16.3% | intergenic (+182/+47) | yhdZ/rrfF | putative amino acid ABC transporter ATPase/5S ribosomal RNA of rrnD operon |
? | NC_000913 | = 3946821 | 11 (0.230) | intergenic (+3/‑50) | rrfC/aspT | 5S ribosomal RNA of rrnC operon/tRNA‑Asp |