mutation predictions | marginal predictions | summary statistics | genome diff | command line log
|
breseq version 0.35.4 revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Predicted mutations | ||||||
|---|---|---|---|---|---|---|
| evidence | position | mutation | freq | annotation | gene | description |
| RA | 4,009 | T→C | 11.1% | D92D (GAT→GAC) | thrC → | threonine synthase |
| RA | 124,241 | C→T | 100% | Q409* (CAG→TAG) | aceE → | pyruvate dehydrogenase E1 component |
| RA | 151,522 | G→T | 12.7% | A26A (GCC→GCA) | yadK ← | putative fimbrial protein YadK |
| RA | 252,564 | T→C | 15.4% | Y88Y (TAT→TAC) | yafO → | ribosome‑dependent mRNA interferase toxin YafO |
| MC JC | 257,908 | Δ776 bp | 100% | insB9–[crl] | insB9, insA9, [crl] | |
| JC | 439,240 | (TCGGCAAACCGCCGCTACTTT)1→2 | 32.6% | coding (938/1863 nt) | dxs ← | 1‑deoxy‑D‑xylulose‑5‑phosphate synthase |
| RA | 635,361 | G→A | 14.8% | Q6* (CAA→TAA) C403C (TGC→TGT) |
ybdM ← ybdN ← |
ParB‑like nuclease domain‑containing protein YbdM putative PAPS reductase/DUF3440 domain‑containing protein YbdN |
| RA | 672,110 | G→A | 12.2% | T26I (ACC→ATC) | lptE ← | lipopolysaccharide assembly protein LptE |
| RA | 672,113 | T→C | 13.8% | D25G (GAT→GGT) | lptE ← | lipopolysaccharide assembly protein LptE |
| RA | 674,768 | G→T | 100% | R6S (CGC→AGC) | leuS ← | leucine‑‑tRNA ligase |
| RA | 696,470 | C→T | 100% | noncoding (35/75 nt) | glnX ← | tRNA‑Gln |
| RA | 754,446 | A→G | 100% | L8P (CTC→CCC) | gltA ← | citrate synthase |
| RA | 760,485 | G→A | 100% | G594S (GGC→AGC) | sucA → | subunit of E1(0) component of 2‑oxoglutarate dehydrogenase |
| RA | 793,581 | G→T | 19.8% | L70I (CTC→ATC) | modF ← | ABC family protein ModF |
| RA | 882,734 | T→C | 14.9% | M1M (ATG→GTG) † | deoR ← | DNA‑binding transcriptional repressor DeoR |
| RA | 1,020,166 | C→T | 14.4% | intergenic (‑113/+244) | ompA ← / ← sulA | outer membrane porin A/cell division inhibitor SulA |
| RA | 1,151,736 | T→C | 81.7% | V41A (GTT→GCT) | acpP → | acyl carrier protein |
| RA | 1,196,803 | A→C | 13.1% | intergenic (+430/+64) | icd → / ← ymfD | isocitrate dehydrogenase/e14 prophage; putative SAM‑dependent methyltransferase |
| JC JC | 1,293,032 | IS1 (–) +8 bp | 100% | intergenic (‑110/‑488) | hns ← / → tdk | DNA‑binding transcriptional dual regulator H‑NS/thymidine/deoxyuridine kinase |
| MC JC | 1,299,499 | Δ1,199 bp | 100% | insH21 | insH21 | |
| RA | 1,426,178 | A→T | 7.6% | intergenic (+198/‑276) | ydaY → / → ynaA | Rac prophage; putative uncharacterized protein YdaY/Rac prophage; putative prophage tail length tape measure domain‑containing protein YnaA |
| JC JC | 1,572,474 | IS5 (+) +4 bp | 100% | coding (2726‑2729/2796 nt) | pqqL ← | putative zinc peptidase |
| JC JC | 1,907,799 | IS5 (+) +4 bp | 14.8% | intergenic (‑208/+459) | yobF ← / ← yebO | DUF2527 domain‑containing protein YobF/uncharacterized protein YebO |
| MC JC | 1,978,503 | Δ776 bp | 100% | insB‑5–insA‑5 | insB‑5, insA‑5 | |
| JC JC | 1,979,486 | IS5 (+) +4 bp | 100% | intergenic (‑271/‑264) | insA‑5 ← / → uspC | IS1 protein InsA/universal stress protein C |
| RA | 2,132,787 | A→C | 100% | I204S (ATC→AGC) | wcaA ← | putative colanic acid biosynthesis glycosyl transferase |
| RA | 2,173,361 | Δ2 bp | 100% | pseudogene (917‑918/1358 nt) | gatC ← | galactitol‑specific PTS enzyme IIC component |
| RA | 2,368,101 | T→C | 100% | A21A (GCT→GCC) | arnA → | fused UDP‑4‑amino‑4‑deoxy‑L‑arabinose formyltransferase/UDP‑glucuronate dehydrogenase |
| RA | 2,661,821 | C→G | 100% | C104S (TGC→TCC) | iscR ← | DNA‑binding transcriptional dual regulator IscR |
| RA | 2,737,631:1 | +A | 61.5% | coding (33/48 nt) | pheL → | phe operon leader peptide |
| RA | 3,041,634 | A→C | 100% | T108P (ACC→CCC) | ygfZ → | folate‑binding protein |
| RA | 3,560,455:1 | +G | 100% | pseudogene (151/758 nt) | glpR ← | DNA‑binding transcriptional repressor GlpR |
| RA | 3,596,017 | G→A | 10.0% | R129R (CGC→CGT) | livH ← | branched chain amino acid/phenylalanine ABC transporter membrane subunit LivH |
| RA | 3,657,599 | T→A | 10.0% | intergenic (+32/+387) | hdeD → / ← arrS | acid‑resistance membrane protein/small regulatory RNA ArrS |
| RA | 3,657,601 | G→C | 10.0% | intergenic (+34/+385) | hdeD → / ← arrS | acid‑resistance membrane protein/small regulatory RNA ArrS |
| RA | 3,657,603 | T→A | 9.8% | intergenic (+36/+383) | hdeD → / ← arrS | acid‑resistance membrane protein/small regulatory RNA ArrS |
| MC JC | 3,815,859 | Δ82 bp | 100% | [rph] | [rph] | |
| MC JC | 4,001,645 | Δ5 bp | 100% | coding (220‑224/951 nt) | corA → | Ni(2(+))/Co(2(+))/Mg(2(+)) transporter |
| RA | 4,033,610 | G→A | 62.5% | G156S (GGT→AGT) | trkH → | K(+) transporter TrkH |
| RA | 4,184,543 | C→A | 100% | P1100Q (CCG→CAG) | rpoB → | RNA polymerase subunit beta |
| RA | 4,196,219 | A→C | 100% | intergenic (‑120/+113) | thiC ← / ← rsd | phosphomethylpyrimidine synthase/regulator of sigma D |
| RA | 4,296,060 | C→T | 24.4% | intergenic (+266/+376) | gltP → / ← yjcO | glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO |
| RA | 4,296,380:1 | +CG | 100% | intergenic (+586/+56) | gltP → / ← yjcO | glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO |
| RA | 4,605,176 | T→C | 12.5% | Q163R (CAG→CGG) | fhuF ← | hydroxamate siderophore iron reductase |
| Unassigned missing coverage evidence | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | NC_000913 | 366222 | 366390 | 169 | 9 [7] | [7] 8 | [lacZ] | [lacZ] |
| * | * | ÷ | NC_000913 | 3423760–3424234 | 3424531–3424238 | 5–772 | 8 [7] | [7] 9 | [rrfD]–[rrlD] | [rrfD],[rrlD] |
| Unassigned new junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | = 216058 | NA (NA) | 4 (0.150) | 4/250 | NT | NA | noncoding (32/34 nt) | other | REP16a |
| ? | NC_000913 | = 1068451 | NA (NA) | noncoding (2/34 nt) | other | REP92b | |||||
| * | ? | NC_000913 | = 315572 | NA (NA) | 3 (0.110) | 3/244 | NT | NA | noncoding (344/1255 nt) | IS3 | repeat region |
| ? | NC_000913 | = 315588 | NA (NA) | noncoding (360/1255 nt) | IS3 | repeat region | |||||
| * | ? | NC_000913 | = 315852 | NA (NA) | 31 (1.110) | 10/256 | NT | NA | noncoding (624/1255 nt) | IS3 | repeat region |
| ? | NC_000913 | = 315875 | NA (NA) | noncoding (647/1255 nt) | IS3 | repeat region | |||||
| * | ? | NC_000913 | = 354605 | NA (NA) | 5 (0.180) | 4/250 | NT | NA | noncoding (6/28 nt) | other | REPt26a |
| ? | NC_000913 | = 354653 | NA (NA) | noncoding (13/36 nt) | other | REP26b | |||||
| * | ? | NC_000913 | 566777 = | NA (NA) | 1239 (43.470) | 234/262 | NT | 98.0% | noncoding (1/1258 nt) | IS3 | repeat region |
| ? | NC_000913 | = 572471 | 25 (0.870) | coding (6/456 nt) | ybcN | DLP12 prophage; DNA base‑flipping protein | |||||
| * | ? | NC_000913 | = 572471 | 25 (0.870) | 8 (0.380) +34 bp |
8/196 | NT | 35.1% | coding (6/456 nt) | ybcN | DLP12 prophage; DNA base‑flipping protein |
| ? | NC_000913 | = 2170235 | 15 (0.520) | noncoding (65/1258 nt) | IS3 | repeat region | |||||
| * | ? | NC_000913 | = 918154 | 21 (0.730) | 4 (0.140) | 4/264 | NT | 17.0% | coding (967/993 nt) | ybjX | DUF535 domain‑containing protein YbjX |
| ? | NC_000913 | = 918201 | 18 (0.630) | coding (920/993 nt) | ybjX | DUF535 domain‑containing protein YbjX | |||||
| * | ? | NC_000913 | 1207790 = | 4 (0.140) | 13 (0.520) | 10/232 | NT | 85.2% | coding (290/630 nt) | ycfK | e14 prophage; protein StfP |
| ? | NC_000913 | 1209619 = | 1 (0.040) | pseudogene (37/537 nt) | stfE | e14 prophage; putative side tail fiber protein fragment | |||||
| * | ? | NC_000913 | = 1207805 | 4 (0.140) | 14 (0.560) | 13/232 | NT | 86.1% | coding (305/630 nt) | ycfK | e14 prophage; protein StfP |
| ? | NC_000913 | = 1209602 | 1 (0.040) | pseudogene (54/537 nt) | stfE | e14 prophage; putative side tail fiber protein fragment | |||||
| * | ? | NC_000913 | = 2063478 | 33 (1.150) | 3 (0.110) | 3/252 | NT | 9.0% | coding (990/1080 nt) | cobT | nicotinate‑nucleotide‑‑dimethylbenzimidazole phosphoribosyltransferase |
| ? | NC_000913 | = 2063498 | 29 (1.060) | coding (970/1080 nt) | cobT | nicotinate‑nucleotide‑‑dimethylbenzimidazole phosphoribosyltransferase | |||||
| * | ? | NC_000913 | 2894073 = | 23 (0.800) | 3 (0.110) | 3/256 | NT | 11.9% | coding (155/261 nt) | ygcO | putative 4Fe‑4S cluster‑containing protein |
| ? | NC_000913 | 2894099 = | 22 (0.790) | coding (181/261 nt) | ygcO | putative 4Fe‑4S cluster‑containing protein | |||||