mutation predictions | marginal predictions | summary statistics | genome diff | command line log
|
breseq version 0.35.4 revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Predicted mutations | |||||
|---|---|---|---|---|---|
| evidence | position | mutation | annotation | gene | description |
| RA | 92,573 | Δ1 bp | coding (1161/1767 nt) | ftsI → | peptidoglycan DD‑transpeptidase FtsI |
| RA | 362,976 | G→C | D68E (GAC→GAG) | lacY ← | lactose permease |
| RA | 366,409 | C→T | intergenic (‑104/+19) | lacZ ← / ← lacI | beta‑galactosidase/DNA‑binding transcriptional repressor LacI |
| RA | 697,144 | (T)8→9 | intergenic (‑11/+369) | metT ← / ← asnB | tRNA‑Met/asparagine synthetase B |
| RA | 926,186 | +T | intergenic (‑215/+39) | serW ← / ← infA | tRNA‑Ser/translation initiation factor IF‑1 |
| RA | 985,846 | (A)8→7 | intergenic (‑137/+48) | aspC ← / ← ompF | aspartate aminotransferase/outer membrane porin F |
| RA | 1,015,515 | (T)7→6 | intergenic (+56/‑200) | pqiC → / → rmf | intermembrane transport lipoprotein PqiC/ribosome modulation factor |
| RA | 1,437,231 | (T)9→10 | intergenic (+2/+29) | micC → / ← ydbK | small regulatory RNA MicC/putative pyruvate‑flavodoxin oxidoreductase |
| JC | 1,489,690 | Δ3 bp | intergenic (+19/+21) | aldA → / ← gapC | aldehyde dehydrogenase A/glyceraldehyde‑3‑phosphate dehydrogenase |
| RA | 1,920,205 | (T)7→6 | intergenic (+62/‑18) | yebT → / → rsmF | intermembrane transport protein YebT/16S rRNA m(5)C1407 methyltransferase |
| MC JC | 1,962,903 | Δ15,600 bp | IS1‑mediated | [flhE]–flhD | 15 genes [flhE], flhA, flhB, cheZ, cheY, cheB, cheR, tap, tar, cheW, cheA, motB, motA, flhC, flhD |
| RA | 2,286,328 | (T)7→6 | intergenic (+41/+62) | proL → / ← yejO | tRNA‑Pro/adhesin‑like autotransporter YejO |
| RA | 2,313,176 | (T)8→7 | noncoding (93/93 nt) | micF → | small regulatory RNA MicF |
| JC | 2,980,730 | Δ3 bp | intergenic (‑95/+32) | ygeA ← / ← araE | amino acid racemase/arabinose:H(+) symporter |
| JC | 3,123,126 | (CCGTTATTTTTCAGCAAAATGCAGG)1→2 | coding (680/2172 nt) | glcB ← | malate synthase G |
| RA | 3,439,602 | (T)7→6 | intergenic (‑93/+14) | yhdN ← / ← rplQ | conserved protein YhdN/50S ribosomal subunit protein L17 |
| RA | 3,564,097 | (A)7→6 | intergenic (‑92/+37) | yzgL ← / ← glgP | putative uncharacterized protein YzgL/glycogen phosphorylase |
| RA | 3,818,781 | C→A | intergenic (+197/‑93) | dinD → / → yicG | DNA damage‑inducible protein D/conserved inner membrane protein YicG |
| MC JC | 4,188,960 | Δ9 bp | coding (3611‑3619/4224 nt) | rpoC → | RNA polymerase subunit beta' |
| RA | 4,296,381 | +GC | intergenic (+587/+55) | gltP → / ← yjcO | glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO |
| RA | 4,392,261 | (A)8→9 | intergenic (+112/‑99) | orn → / → glyV | oligoribonuclease/tRNA‑Gly |
| Unassigned missing coverage evidence | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | NC_000913 | 164538 | 164623 | 86 | 13 [12] | [10] 18 | hrpB/mrcB | putative ATP‑dependent RNA helicase HrpB/peptidoglycan glycosyltransferase/peptidoglycan DD‑transpeptidase MrcB |
| * | * | ÷ | NC_000913 | 283373 | 284430 | 1058 | 13 [11] | [12] 13 | yagF | CP4‑6 prophage; D‑xylonate dehydratase |
| * | * | ÷ | NC_000913 | 287416 | 287829 | 414 | 15 [12] | [12] 13 | yagH | CP4‑6 prophage; putative xylosidase/arabinosidase |
| * | * | ÷ | NC_000913 | 288276 | 288694 | 419 | 13 [12] | [12] 13 | [yagH]–[xynR] | [yagH],[xynR] |
| * | * | ÷ | NC_000913 | 523679 | 524053 | 375 | 13 [12] | [12] 13 | rhsD | protein RhsD |
| * | * | ÷ | NC_000913 | 1873040 | 1886125 | 13086 | 48 [0] | [0] 160 | [dgcJ]–[yeaX] | [dgcJ],yeaK,yoaI,yeaL,nimR,nimT,yeaO,yoaF,dgcP,yoaK,yoaJ,yeaQ,yoaG,yeaR,leuE,dmlR,dmlA,yeaV,yeaW,[yeaX] |
| * | * | ÷ | NC_000913 | 3046007 | 3046067 | 61 | 14 [8] | [12] 21 | ygfF/gcvP | putative NAD(P)‑binding oxidoreductase with NAD(P)‑binding Rossmann‑fold domain/glycine decarboxylase |
| * | * | ÷ | NC_000913 | 3239617 | 3239678 | 62 | 15 [10] | [4] 13 | alx/sstT | putative membrane‑bound redox modulator Alx/serine/threonine:Na(+) symporter |
| * | * | ÷ | NC_000913 | 3423819–3424481 | 3424481 | 1–663 | 13 [12] | [12] 13 | [rrlD] | [rrlD] |
| Unassigned new junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | 258632 = | 31 (0.500) | 48 (0.810) +TTT |
18/372 | 1.8 | 61.8% | noncoding (44/768 nt) | IS1 | repeat region |
| ? | NC_000913 | = 279886 | NA (NA) | noncoding (45/768 nt) | IS1 | repeat region | |||||
| * | ? | NC_000913 | = 258675 | NA (NA) | 160 (2.580) | 85/388 | 0.0 | 100% | noncoding (1/768 nt) | IS1 | repeat region |
| ? | NC_000913 | 1886126 = | 0 (0.000) | coding (282/966 nt) | yeaX | carnitine monooxygenase subunit YeaX | |||||
| * | ? | NC_000913 | 366315 = | 4436 (71.480) | 850 (22.790) +77 bp |
161/234 | 0.0 | 38.7% | intergenic (‑10/+113) | lacZ/lacI | beta‑galactosidase/DNA‑binding transcriptional repressor LacI |
| ? | NC_000913 | = 2933013 | 49 (0.790) | coding (1/1149 nt) | fucO | L‑1,2‑propanediol oxidoreductase | |||||
| * | ? | NC_000913 | 381671 = | NA (NA) | 31 (0.510) | 23/382 | 1.3 | 100% | noncoding (412/1331 nt) | IS2 | repeat region |
| ? | NC_000913 | 1468827 = | 0 (0.000) | noncoding (414/1331 nt) | IS2 | repeat region | |||||
| * | ? | NC_000913 | = 657540 | 20 (0.320) | 19 (0.310) | 15/388 | 2.5 | 48.7% | intergenic (+39/+15) | cspE/crcB | transcription antiterminator and regulator of RNA stability/F(‑) channel |
| ? | NC_000913 | 657545 = | 20 (0.320) | intergenic (+44/+10) | cspE/crcB | transcription antiterminator and regulator of RNA stability/F(‑) channel | |||||
| * | ? | NC_000913 | = 688330 | 0 (0.000) | 15 (0.240) | 15/388 | 2.5 | 100% | noncoding (716/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | 688334 = | NA (NA) | noncoding (712/1195 nt) | IS5 | repeat region | |||||
| * | ? | NC_000913 | = 821493 | 22 (0.370) | 21 (0.350) +TTTT |
15/366 | 2.3 | 48.3% | coding (701/714 nt) | ybhM | Bax1‑I family protein YbhM |
| ? | NC_000913 | 821494 = | 23 (0.370) | coding (702/714 nt) | ybhM | Bax1‑I family protein YbhM | |||||
| * | ? | NC_000913 | = 1124916 | 35 (0.580) | 17 (0.280) +AAA |
14/370 | 2.5 | 32.4% | coding (411/1209 nt) | mdtH | multidrug efflux pump MdtH |
| ? | NC_000913 | 1124917 = | 36 (0.580) | coding (410/1209 nt) | mdtH | multidrug efflux pump MdtH | |||||
| * | ? | NC_000913 | = 1434336 | 26 (0.420) | 13 (0.210) | 13/388 | 2.8 | 30.9% | coding (71/114 nt) | ynaM | Rac prophage; protein YnaM |
| ? | NC_000913 | = 1632955 | 32 (0.520) | coding (66/114 nt) | ynfT | Qin prophage; protein YnfT | |||||
| * | ? | NC_000913 | 1446721 = | 71 (1.140) | 26 (0.430) | 23/376 | 1.3 | 29.9% | coding (563/906 nt) | feaR | DNA‑binding transcriptional activator FeaR |
| ? | NC_000913 | = 1570338 | 53 (0.880) | coding (152/1536 nt) | gadC | L‑glutamate:4‑aminobutyrate antiporter | |||||
| * | ? | NC_000913 | 1482626 = | 82 (1.320) | 693 (11.170) | 268/388 | 0.0 | 89.3% | coding (235/606 nt) | azoR | FMN dependent NADH:quinone oxidoreductase |
| ? | NC_000913 | = 1551289 | 84 (1.350) | coding (829/885 nt) | fdnH | formate dehydrogenase N subunit beta | |||||
| * | ? | NC_000913 | = 1500381 | 368 (6.190) | 136 (2.230) +TTT |
68/366 | 0.0 | 26.5% | coding (69/981 nt) | ydcK | putative enzyme YdcK |
| ? | NC_000913 | 1500382 = | 381 (6.140) | coding (68/981 nt) | ydcK | putative enzyme YdcK | |||||
| * | ? | NC_000913 | = 1531824 | 348 (5.790) | 115 (1.880) +AAA |
70/370 | 0.0 | 24.5% | coding (9/1137 nt) | ydcC | H repeat‑associated putative transposase YdcC |
| ? | NC_000913 | 1531825 = | 361 (5.820) | coding (10/1137 nt) | ydcC | H repeat‑associated putative transposase YdcC | |||||
| * | ? | NC_000913 | = 1772238 | 38 (0.610) | 13 (0.210) | 12/380 | 3.0 | 25.7% | coding (1168/1215 nt) | ydiM | putative exporter YdiM |
| ? | NC_000913 | 1772242 = | 38 (0.630) | coding (1172/1215 nt) | ydiM | putative exporter YdiM | |||||
| * | ? | NC_000913 | = 1821865 | 17 (0.270) | 17 (0.270) | 13/388 | 2.8 | 50.0% | intergenic (‑246/+53) | chbB/osmE | N,N'‑diacetylchitobiose‑specific PTS enzyme IIB component/osmotically‑inducible lipoprotein OsmE |
| ? | NC_000913 | 1821869 = | 17 (0.270) | intergenic (‑250/+49) | chbB/osmE | N,N'‑diacetylchitobiose‑specific PTS enzyme IIB component/osmotically‑inducible lipoprotein OsmE | |||||
| * | ? | NC_000913 | = 1873039 | 0 (0.000) | 48 (0.770) | 38/388 | 0.4 | 100% | coding (999/1491 nt) | dgcJ | putative diguanylate cyclase DgcJ |
| ? | NC_000913 | 1978503 = | NA (NA) | noncoding (768/768 nt) | IS1 | repeat region | |||||
| * | ? | NC_000913 | = 1888015 | 59 (0.990) | 21 (0.350) +AAAAAA |
13/360 | 2.6 | 26.5% | intergenic (‑24/+46) | rnd/fadD | RNase D/fatty acyl‑CoA synthetase |
| ? | NC_000913 | 1888016 = | 59 (0.950) | intergenic (‑25/+45) | rnd/fadD | RNase D/fatty acyl‑CoA synthetase | |||||
| * | ? | NC_000913 | = 1925925 | 80 (1.340) | 35 (0.570) +TTT |
24/368 | 1.1 | 30.2% | coding (486/657 nt) | yobB | putative carbon‑nitrogen hydrolase family protein YobB |
| ? | NC_000913 | 1925926 = | 81 (1.310) | coding (487/657 nt) | yobB | putative carbon‑nitrogen hydrolase family protein YobB | |||||
| * | ? | NC_000913 | = 1935423 | 79 (1.310) | 23 (0.380) +TTT |
17/370 | 2.0 | 22.4% | coding (892/1476 nt) | zwf | NADP(+)‑dependent glucose‑6‑phosphate dehydrogenase |
| ? | NC_000913 | 1935424 = | 80 (1.290) | coding (891/1476 nt) | zwf | NADP(+)‑dependent glucose‑6‑phosphate dehydrogenase | |||||
| * | ? | NC_000913 | = 1958445 | 19 (0.310) | 37 (0.600) | 31/388 | 0.7 | 67.3% | noncoding (76/80 nt) | micL | small regulatory RNA MicL‑S |
| ? | NC_000913 | 1958449 = | 17 (0.270) | noncoding (72/80 nt) | micL | small regulatory RNA MicL‑S | |||||
| * | ? | NC_000913 | = 2644811 | 20 (0.330) | 20 (0.330) +TTT |
16/370 | 2.1 | 50.0% | coding (54/432 nt) | ndk | nucleoside diphosphate kinase |
| ? | NC_000913 | 2644812 = | 20 (0.320) | coding (53/432 nt) | ndk | nucleoside diphosphate kinase | |||||
| * | ? | NC_000913 | = 2732856 | 24 (0.400) | 14 (0.230) +TTTTTT |
12/364 | 2.8 | 37.2% | coding (1318/2574 nt) | clpB | ClpB chaperone |
| ? | NC_000913 | 2732857 = | 24 (0.390) | coding (1317/2574 nt) | clpB | ClpB chaperone | |||||
| * | ? | NC_000913 | = 2766856 | 31 (0.500) | 15 (0.250) | 12/380 | 3.0 | 32.8% | coding (939/1074 nt) | rnlA | CP4‑57 prophage; RNase LS, toxin of the RnlAB toxin‑antitoxin system |
| ? | NC_000913 | 2766860 = | 31 (0.510) | coding (943/1074 nt) | rnlA | CP4‑57 prophage; RNase LS, toxin of the RnlAB toxin‑antitoxin system | |||||
| * | ? | NC_000913 | = 3828502 | 32 (0.540) | 20 (0.330) +TTTT |
13/366 | 2.6 | 38.2% | coding (164/1206 nt) | gltS | glutamate:sodium symporter |
| ? | NC_000913 | 3828503 = | 33 (0.530) | coding (163/1206 nt) | gltS | glutamate:sodium symporter | |||||
| * | ? | NC_000913 | = 4060270 | 15 (0.240) | 14 (0.230) | 13/388 | 2.8 | 45.9% | intergenic (+40/‑177) | bipA/yihL | ribosome‑dependent GTPase, ribosome assembly factor/putative transcriptional regulator YihL |
| ? | NC_000913 | 4060276 = | 18 (0.290) | intergenic (+46/‑171) | bipA/yihL | ribosome‑dependent GTPase, ribosome assembly factor/putative transcriptional regulator YihL | |||||