mutation predictions | marginal predictions | summary statistics | genome diff | command line log
|
breseq version 0.35.4 revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Predicted mutations | ||||||
|---|---|---|---|---|---|---|
| evidence | seq id | position | mutation | annotation | gene | description |
| RA | AssemblyC74_contig_1 | 443,483 | (T)6→5 | intergenic (+612/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity → / – | Conserved hypothetical protein ArsC related/– |
| RA | AssemblyC74_contig_12 | 59,062 | T→C | G92G (GGA→GGG) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 ← | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| RA | AssemblyC74_contig_12 | 59,113 | A→G | N75N (AAT→AAC) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 ← | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| RA | AssemblyC74_contig_12 | 59,182 | C→T | L52L (TTG→TTA) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 ← | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| RA | AssemblyC74_contig_12 | 59,194 | 2 bp→TA | coding (143‑144/672 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 ← | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| RA | AssemblyC74_contig_12 | 59,224 | 2 bp→TG | coding (113‑114/672 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 ← | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| RA | AssemblyC74_contig_12 | 59,248 | C→T | A30A (GCG→GCA) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 ← | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| RA | AssemblyC74_contig_12 | 59,264 | G→T | A25E (GCA→GAA) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 ← | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| RA | AssemblyC74_contig_12 | 59,272 | G→A | T22T (ACC→ACT) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 ← | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| Unassigned missing coverage evidence | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | AssemblyC74_contig_11 | 78783 | 78787 | 5 | 203 [0] | [0] NA | [rasttk_feature_annotation_tool=elepa@bvbrc] | [rasttk_feature_annotation_tool=elepa@bvbrc] |
| * | * | ÷ | AssemblyC74_contig_12 | 1 | 7 | 7 | NA [0] | [0] 212 | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Polygalacturonase (EC 3.2.1.15) |
| * | * | ÷ | AssemblyC74_contig_12 | 59277 | 59337 | 61 | 286 [30] | [0] NA | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| * | * | ÷ | AssemblyC74_contig_35 | 1903–2040 | 2041 | 2–139 | 153 [144] | [0] NA | rasttk_feature_annotation_tool=annotate_proteins_si milarity | rasttk_feature_annotation_tool=annotate_proteins_si milarity |
| * | * | ÷ | AssemblyC74_contig_48 | 1 | 21 | 21 | NA [0] | [0] 286 | [rasttk_feature_annotation_tool=annotate_proteins_km er_v2] | [rasttk_feature_annotation_tool=annotate_proteins_km er_v2] |
| * | * | ÷ | AssemblyC74_contig_7 | 1 | 1 | 1 | NA [0] | [0] 205 | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Lysyl‑tRNA synthetase (class II) (EC 6.1.1.6) |
| Unassigned new junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | AssemblyC74_contig_1 | = 221 | 313 (1.000) | 200 (0.680) | 63/242 | 1.2 | 57.5% | intergenic (–/‑371) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Two‑component transcriptional response regulator, OmpR family |
| ? | AssemblyC74_contig_12 | 8 = | 0 (0.000) | intergenic (–/+152) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Polygalacturonase (EC 3.2.1.15) | |||||
| * | ? | AssemblyC74_contig_1 | = 261 | 278 (0.890) | 204 (0.650) | 56/254 | 2.3 | 59.7% | intergenic (–/‑331) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Two‑component transcriptional response regulator, OmpR family |
| ? | AssemblyC74_contig_7 | 2 = | 0 (0.000) | intergenic (–/+269) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Lysyl‑tRNA synthetase (class II) (EC 6.1.1.6) | |||||
| * | ? | AssemblyC74_contig_1 | = 377977 | 210 (0.670) | 124 (0.410) | 52/256 | 2.4 | 33.1% | intergenic (+141/‑150) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Tyrosyl‑tRNA synthetase (EC 6.1.1.1)/decarboxylase, putative |
| ? | AssemblyC74_contig_22 | 2888 = | 291 (0.980) | intergenic (+101/+80) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein/Transposase | |||||
| * | ? | AssemblyC74_contig_1 | 443129 = | 273 (0.880) | 176 (0.610) | 56/246 | 1.8 | 57.3% | intergenic (+258/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | Conserved hypothetical protein ArsC related/– |
| ? | AssemblyC74_contig_11 | = 78782 | 0 (0.000) | coding (62/66 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_1 | 443402 = | 1089 (3.490) | 230 (0.800) | 65/256 | 1.0 | 29.7% | intergenic (+531/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | Conserved hypothetical protein ArsC related/– |
| ? | AssemblyC74_contig_6 | = 168934 | 0 (0.000) | intergenic (+543/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Phosphate regulon sensor protein PhoR (SphS) (EC 2.7.13.3)/– | |||||
| * | ? | AssemblyC74_contig_1 | = 443528 | 10 (0.030) | 1894 (1.710) +C |
138/254 | 0.0 | 99.7% | intergenic (+657/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | Conserved hypothetical protein ArsC related/– |
| ? | AssemblyC74_contig_39 | = 1643 | 0 (0.000) | intergenic (‑5/–) | rasttk_feature_creation_tool=RNA_reps_SSU_rRNA/– | SSU rRNA ## 16S rRNA, small subunit ribosomal RNA/– | |||||
| * | ? | AssemblyC74_contig_10 | = 98564 | 0 (0.000) | 240 (0.650) | 54/256 | 1.6 | 100% | intergenic (‑281/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– |
| ? | AssemblyC74_contig_50 | 1 = | 0 (0.000) | intergenic (–/‑113) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Aggregation promoting factor | |||||
| * | ? | AssemblyC74_contig_11 | 1 = | 0 (0.000) | 293 (0.370) | 102/256 | 0.0 | 100% | intergenic (–/‑1) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Alcohol dehydrogenase (EC 1.1.1.1) |
| ? | AssemblyC74_contig_45 | = 1002 | 0 (0.000) | intergenic (‑96/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Integrase, catalytic region/– | |||||
| * | ? | AssemblyC74_contig_12 | 58967 = | 326 (1.040) | 103 (1.190) | 27/72 | 0.1 | 69.6% | coding (371/672 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| ? | AssemblyC74_contig_12 | = 59245 | 0 (0.000) | coding (93/672 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog | |||||
| * | ? | AssemblyC74_contig_12 | 59059 = | 131 (0.420) | 476 (1.610) +ATCCTG |
62/244 | 1.4 | 80.0% | coding (279/672 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| ? | AssemblyC74_contig_18 | 27021 = | 119 (0.390) | coding (2179/2232 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_12 | = 59276 | 30 (0.100) | 252 (0.810) | 57/256 | 2.2 | 94.4% | coding (62/672 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| ? | AssemblyC74_contig_18 | = 27075 | 0 (0.000) | intergenic (+1/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– | |||||
| * | ? | AssemblyC74_contig_13 | = 46240 | 0 (0.000) | 141 (0.540) | 50/256 | 2.2 | 56.6% | intergenic (‑38/–) | rasttk_feature_creation_tool=tRNAscan‑SE/– | tRNA‑Ser‑GGA/– |
| ? | AssemblyC74_contig_8 | = 1721 | 216 (0.780) | intergenic (+1/+137) | rasttk_feature_creation_tool=tRNAscan‑SE/rasttk_feature_annotation_tool=annotate_proteins_si milarity | tRNA‑Asn‑GTT/FIG00629206: hypothetical protein | |||||
| * | ? | AssemblyC74_contig_14 | = 41348 | 0 (0.000) | 202 (0.530) | 72/256 | 0.4 | 100% | coding (927/927 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Phage endopeptidase |
| ? | AssemblyC74_contig_33 | 1 = | 0 (0.000) | coding (1/972 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_15 | 1 = | 0 (0.000) | 291 (0.680) | 70/256 | 0.9 | 100% | intergenic (–/+1116) | –/rasttk_feature_annotation_tool=elepa@bvbrc | –/hypothetical protein |
| ? | AssemblyC74_contig_52 | = 702 | 0 (0.000) | intergenic (+23/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Putative transposase InsK for insertion sequence element IS150/– | |||||
| * | ? | AssemblyC74_contig_15 | 32682 = | 674 (2.070) | 283 (0.950) | 81/254 | 0.1 | 41.7% | coding (1059/1284 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Mobile element protein |
| ? | AssemblyC74_contig_30 | 32 = | 124 (0.450) | coding (32/252 nt) | rasttk_feature_annotation_tool=annotate_proteins_si milarity | Mobile element protein | |||||
| * | ? | AssemblyC74_contig_15 | = 36007 | 0 (0.000) | 297 (0.610) | 87/256 | 0.2 | 100% | intergenic (+1/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | FIG00632365: hypothetical protein/– |
| ? | AssemblyC74_contig_37 | = 1750 | 0 (0.000) | intergenic (‑2/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | FIG00632365: hypothetical protein/– | |||||
| * | ? | AssemblyC74_contig_16 | 21870 = | 242 (0.950) | 277 (0.980) | 62/256 | 1.2 | 69.6% | coding (264/387 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein |
| ? | AssemblyC74_contig_24 | = 8654 | 0 (0.000) | intergenic (+132/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | 1,4‑dihydroxy‑2‑naphthoate polyprenyltransferase (EC 2.5.1.74)/– | |||||
| * | ? | AssemblyC74_contig_16 | = 35103 | 0 (0.000) | 670 (0.870) | 109/256 | 0.0 | 100% | intergenic (+149/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– |
| ? | AssemblyC74_contig_45 | 1 = | 0 (0.000) | coding (906/906 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Integrase, catalytic region | |||||
| * | ? | AssemblyC74_contig_17 | 1 = | 0 (0.000) | 252 (0.610) | 70/256 | 0.7 | 100% | intergenic (–/‑262) | –/rasttk_feature_annotation_tool=annotate_proteins_si milarity | –/Protein of unknown function DUF421 |
| ? | AssemblyC74_contig_57 | 1 = | 0 (0.000) | intergenic (–/+1) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Mobile element protein | |||||
| * | ? | AssemblyC74_contig_17 | = 32032 | 0 (0.000) | 200 (0.730) +A |
40/254 | 2.6 | 79.8% | intergenic (+380/–) | rasttk_feature_annotation_tool=elepa@bvbrc/– | hypothetical protein/– |
| ? | AssemblyC74_contig_34 | 2046 = | 102 (0.390) | intergenic (‑223/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | PaaD‑like protein (DUF59) involved in Fe‑S cluster assembly/– | |||||
| * | ? | AssemblyC74_contig_19 | = 19031 | 0 (0.000) | 266 (0.700) | 78/256 | 0.3 | 100% | intergenic (+109/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | Phage lysin, N‑acetylmuramoyl‑L‑alanine amidase (EC 3.5.1.28)/– |
| ? | AssemblyC74_contig_53 | = 622 | 0 (0.000) | coding (1/498 nt) | rasttk_feature_annotation_tool=annotate_proteins_si milarity | Mobile element protein | |||||
| * | ? | AssemblyC74_contig_2 | 1 = | 0 (0.000) | 165 (0.620) +A |
45/254 | 1.9 | 76.5% | intergenic (–/+1) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/hypothetical protein |
| ? | AssemblyC74_contig_34 | 2046 = | 102 (0.390) | intergenic (‑223/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | PaaD‑like protein (DUF59) involved in Fe‑S cluster assembly/– | |||||
| * | ? | AssemblyC74_contig_2 | 242781 = | 279 (1.010) | 93 (0.680) +64 bp |
29/128 | 1.3 | 42.9% | intergenic (+57/‑806) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Exodeoxyribonuclease III (EC 3.1.11.2)/DNA polymerase III, epsilon subunit and related 3'‑5' exonucleases |
| ? | AssemblyC74_contig_2 | = 242837 | 220 (0.790) | intergenic (+113/‑750) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Exodeoxyribonuclease III (EC 3.1.11.2)/DNA polymerase III, epsilon subunit and related 3'‑5' exonucleases | |||||
| * | ? | AssemblyC74_contig_20 | 1 = | 0 (0.000) | 260 (0.640) | 63/256 | 1.3 | 100% | intergenic (–/+131) | –/rasttk_feature_annotation_tool=annotate_proteins_si milarity | –/Mobile element protein |
| ? | AssemblyC74_contig_57 | = 493 | 0 (0.000) | coding (1/492 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Mobile element protein | |||||
| * | ? | AssemblyC74_contig_20 | = 15862 | 0 (0.000) | 222 (0.300) +40 bp |
55/176 | 0.3 | 100% | intergenic (+12/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Glutathione peroxidase (EC 1.11.1.9) @ Thioredoxin peroxidase (EC 1.11.1.15)/– |
| ? | AssemblyC74_contig_31 | = 3396 | 0 (0.000) | noncoding (118/118 nt) | rasttk_feature_creation_tool=RNA_reps_5S_rRNA | 5S rRNA # 5S ribosomal RNA ‑ 3 prime truncation | |||||
| * | ? | AssemblyC74_contig_21 | 1 = | 0 (0.000) | 209 (0.530) | 63/256 | 0.9 | 100% | intergenic (–/+243) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Sucrose operon repressor ScrR, LacI family |
| ? | AssemblyC74_contig_57 | 1 = | 0 (0.000) | intergenic (–/+1) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Mobile element protein | |||||
| * | ? | AssemblyC74_contig_21 | = 10843 | 0 (0.000) | 250 (0.630) | 71/256 | 0.4 | 100% | intergenic (+54/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Mobile element protein/– |
| ? | AssemblyC74_contig_49 | = 764 | 0 (0.000) | intergenic (+2/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Mobile element protein/– | |||||
| * | ? | AssemblyC74_contig_23 | 1 = | 0 (0.000) | 250 (0.650) | 68/256 | 0.5 | 100% | coding (237/237 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Mobile element protein |
| ? | AssemblyC74_contig_57 | = 493 | 0 (0.000) | coding (1/492 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Mobile element protein | |||||
| * | ? | AssemblyC74_contig_23 | = 9396 | 0 (0.000) | 206 (0.530) | 69/256 | 0.5 | 100% | intergenic (+36/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | DNA‑directed RNA polymerase beta subunit (EC 2.7.7.6)/– |
| ? | AssemblyC74_contig_49 | 1 = | 0 (0.000) | intergenic (–/‑111) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Mobile element protein | |||||
| * | ? | AssemblyC74_contig_24 | 1 = | 0 (0.000) | 208 (0.750) +CTGACGTGTCCGT |
57/230 | 1.2 | 60.9% | coding (1/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein |
| ? | AssemblyC74_contig_24 | = 215 | 297 (0.960) | coding (215/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_24 | 1 = | 0 (0.000) | 135 (0.780) +57 bp |
49/142 | 0.2 | 100% | coding (1/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein |
| ? | AssemblyC74_contig_7 | = 152772 | 0 (0.000) | intergenic (+1/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– | |||||
| * | ? | AssemblyC74_contig_25 | = 8555 | 0 (0.000) | 172 (0.680) +A |
41/254 | 2.4 | 77.3% | intergenic (+310/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– |
| ? | AssemblyC74_contig_34 | 2046 = | 102 (0.390) | intergenic (‑223/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | PaaD‑like protein (DUF59) involved in Fe‑S cluster assembly/– | |||||
| * | ? | AssemblyC74_contig_26 | 1 = | 0 (0.000) | 217 (0.440) | 69/256 | 1.0 | 100% | intergenic (–/‑20) | –/rasttk_feature_creation_tool=tRNAscan‑SE | –/tRNA‑Pro‑TGG |
| ? | AssemblyC74_contig_54 | = 611 | 0 (0.000) | intergenic (+1/–) | rasttk_feature_creation_tool=tRNAscan‑SE/– | tRNA‑Arg‑ACG/– | |||||
| * | ? | AssemblyC74_contig_27 | 1 = | 0 (0.000) | 315 (0.670) | 70/256 | 0.7 | 100% | intergenic (–/‑26) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Undecaprenyl‑phosphate galactosephosphotransferase (EC 2.7.8.6) |
| ? | AssemblyC74_contig_37 | 1 = | 0 (0.000) | intergenic (–/‑435) | –/rasttk_feature_annotation_tool=elepa@bvbrc | –/hypothetical protein | |||||
| * | ? | AssemblyC74_contig_27 | 7574 = | 273 (0.920) | 280 (0.650) | 58/236 | 1.1 | 69.0% | coding (551/705 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | UDP‑N‑acetylglucosamine 2‑epimerase (EC 5.1.3.14) |
| ? | AssemblyC74_contig_37 | 11 = | 0 (0.000) | intergenic (–/‑425) | –/rasttk_feature_annotation_tool=elepa@bvbrc | –/hypothetical protein | |||||
| * | ? | AssemblyC74_contig_27 | = 7726 | 1 (0.000) | 290 (0.680) +CG |
74/252 | 0.4 | 99.8% | coding (703/705 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | UDP‑N‑acetylglucosamine 2‑epimerase (EC 5.1.3.14) |
| ? | AssemblyC74_contig_41 | = 1330 | 0 (0.000) | coding (1/411 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | UDP‑N‑acetylglucosamine 2‑epimerase (EC 5.1.3.14) | |||||
| * | ? | AssemblyC74_contig_27 | = 7728 | 0 (0.000) | 303 (0.700) | 72/256 | 0.6 | 100% | coding (705/705 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | UDP‑N‑acetylglucosamine 2‑epimerase (EC 5.1.3.14) |
| ? | AssemblyC74_contig_41 | = 1330 | 0 (0.000) | coding (1/411 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | UDP‑N‑acetylglucosamine 2‑epimerase (EC 5.1.3.14) | |||||
| * | ? | AssemblyC74_contig_28 | 1 = | 0 (0.000) | 376 (0.470) | 93/256 | 0.1 | 100% | intergenic (–/‑81) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/hypothetical protein |
| ? | AssemblyC74_contig_45 | = 1002 | 0 (0.000) | intergenic (‑96/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Integrase, catalytic region/– | |||||
| * | ? | AssemblyC74_contig_28 | = 5975 | 0 (0.000) | 285 (0.980) | 86/256 | 0.1 | 66.4% | intergenic (+36/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | YoeB toxin protein/– |
| ? | AssemblyC74_contig_30 | = 330 | 289 (1.050) | intergenic (+78/+111) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Mobile element protein/hypothetical protein | |||||
| * | ? | AssemblyC74_contig_29 | = 4892 | 0 (0.000) | 233 (0.880) | 60/250 | 1.0 | 68.3% | intergenic (‑397/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | ABC‑type antimicrobial peptide transport system, permease component/– |
| ? | AssemblyC74_contig_8 | = 1721 | 216 (0.790) | intergenic (+1/+137) | rasttk_feature_creation_tool=tRNAscan‑SE/rasttk_feature_annotation_tool=annotate_proteins_si milarity | tRNA‑Asn‑GTT/FIG00629206: hypothetical protein | |||||
| * | ? | AssemblyC74_contig_3 | 1 = | 0 (0.000) | 228 (0.620) | 63/256 | 0.8 | 100% | intergenic (–/‑221) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Universal stress protein family |
| ? | AssemblyC74_contig_50 | 1 = | 0 (0.000) | intergenic (–/‑113) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Aggregation promoting factor | |||||
| * | ? | AssemblyC74_contig_3 | = 255127 | 0 (0.000) | 180 (0.240) | 65/256 | 0.7 | 100% | intergenic (‑345/–) | rasttk_feature_annotation_tool=elepa@bvbrc/– | hypothetical protein/– |
| ? | AssemblyC74_contig_45 | = 1002 | 0 (0.000) | intergenic (‑96/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Integrase, catalytic region/– | |||||
| * | ? | AssemblyC74_contig_30 | = 330 | 289 (1.050) | 233 (0.800) | 79/256 | 0.2 | 61.7% | intergenic (+78/+111) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Mobile element protein/hypothetical protein |
| ? | AssemblyC74_contig_36 | = 1754 | 0 (0.000) | intergenic (+133/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– | |||||
| * | ? | AssemblyC74_contig_31 | 1 = | 0 (0.000) | 1004 (0.550) +AGTGT |
133/246 | 0.6 | 100% | intergenic (–/‑269) | –/rasttk_feature_creation_tool=RNA_reps_LSU_rRNA | –/LSU rRNA ## 23S rRNA, large subunit ribosomal RNA |
| ? | AssemblyC74_contig_39 | 1 = | 0 (0.000) | intergenic (–/+65) | –/rasttk_feature_creation_tool=RNA_reps_SSU_rRNA | –/SSU rRNA ## 16S rRNA, small subunit ribosomal RNA | |||||
| * | ? | AssemblyC74_contig_31 | 1 = | 0 (0.000) | 443 (0.460) +TTTAACAACTAATGTTGTT |
66/218 | 0.1 | 76.4% | intergenic (–/‑269) | –/rasttk_feature_creation_tool=RNA_reps_LSU_rRNA | –/LSU rRNA ## 23S rRNA, large subunit ribosomal RNA |
| ? | AssemblyC74_contig_63 | = 176 | 322 (0.770) | intergenic (+2/‑26) | rasttk_feature_creation_tool=tRNAscan‑SE/rasttk_feature_creation_tool=tRNAscan‑SE | tRNA‑Ala‑TGC/tRNA‑Met‑CAT | |||||
| * | ? | AssemblyC74_contig_31 | = 3396 | 0 (0.000) | 261 (0.350) +40 bp |
68/176 | 0.0 | 100% | noncoding (118/118 nt) | rasttk_feature_creation_tool=RNA_reps_5S_rRNA | 5S rRNA # 5S ribosomal RNA ‑ 3 prime truncation |
| ? | AssemblyC74_contig_5 | = 185954 | 0 (0.000) | intergenic (‑299/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | Cof protein:HAD‑superfamily hydrolase, subfamily IIB/– | |||||
| * | ? | AssemblyC74_contig_31 | = 3396 | 0 (0.000) | 724 (0.570) | 127/256 | 0.0 | 100% | noncoding (118/118 nt) | rasttk_feature_creation_tool=RNA_reps_5S_rRNA | 5S rRNA # 5S ribosomal RNA ‑ 3 prime truncation |
| ? | AssemblyC74_contig_54 | 1 = | 0 (0.000) | intergenic (–/‑13) | –/rasttk_feature_creation_tool=tRNAscan‑SE | –/tRNA‑Val‑TAC | |||||
| * | ? | AssemblyC74_contig_31 | = 3396 | 0 (0.000) | 411 (0.410) +TGATGTT |
70/242 | 0.5 | 78.5% | noncoding (118/118 nt) | rasttk_feature_creation_tool=RNA_reps_5S_rRNA | 5S rRNA # 5S ribosomal RNA ‑ 3 prime truncation |
| ? | AssemblyC74_contig_8 | 1645 = | 239 (0.860) | intergenic (‑212/‑2) | rasttk_feature_creation_tool=tRNAscan‑SE/rasttk_feature_creation_tool=tRNAscan‑SE | tRNA‑Thr‑GGT/tRNA‑Asn‑GTT | |||||
| * | ? | AssemblyC74_contig_32 | = 3311 | 0 (0.000) | 301 (0.760) | 84/256 | 0.2 | 100% | intergenic (+202/–) | rasttk_feature_annotation_tool=elepa@bvbrc/– | hypothetical protein/– |
| ? | AssemblyC74_contig_53 | = 622 | 0 (0.000) | coding (1/498 nt) | rasttk_feature_annotation_tool=annotate_proteins_si milarity | Mobile element protein | |||||
| * | ? | AssemblyC74_contig_33 | 1 = | 0 (0.000) | 224 (0.560) | 78/256 | 0.4 | 100% | coding (1/972 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein |
| ? | AssemblyC74_contig_8 | = 115683 | 0 (0.000) | coding (1791/1791 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Phage capsid and scaffold | |||||
| * | ? | AssemblyC74_contig_33 | = 3075 | 0 (0.000) | 245 (0.640) | 89/256 | 0.0 | 100% | intergenic (+2/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– |
| ? | AssemblyC74_contig_4 | 1 = | 0 (0.000) | intergenic (–/‑2) | –/rasttk_feature_annotation_tool=annotate_proteins_si milarity | –/Phage lysin, N‑acetylmuramoyl‑L‑alanine amidase (EC 3.5.1.28) | |||||
| * | ? | AssemblyC74_contig_33 | = 3075 | 0 (0.000) | 307 (0.780) | 78/256 | 0.3 | 100% | intergenic (+2/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– |
| ? | AssemblyC74_contig_6 | 1 = | 0 (0.000) | intergenic (–/‑63) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/hypothetical protein | |||||
| * | ? | AssemblyC74_contig_34 | 1 = | 0 (0.000) | 241 (0.630) | 79/256 | 0.1 | 100% | intergenic (–/+363) | –/rasttk_feature_creation_tool=tRNAscan‑SE | –/tRNA‑Leu‑CAG |
| ? | AssemblyC74_contig_50 | = 745 | 0 (0.000) | intergenic (+8/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Aggregation promoting factor/– | |||||
| * | ? | AssemblyC74_contig_34 | 2046 = | 102 (0.390) | 184 (0.470) | 42/256 | 2.3 | 78.3% | intergenic (‑223/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | PaaD‑like protein (DUF59) involved in Fe‑S cluster assembly/– |
| ? | AssemblyC74_contig_52 | 1 = | 0 (0.000) | intergenic (–/‑1) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Putative transposase InsK for insertion sequence element IS150 | |||||
| * | ? | AssemblyC74_contig_34 | 2046 = | 102 (0.390) | 156 (0.640) +T |
35/254 | 2.3 | 75.5% | intergenic (‑223/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | PaaD‑like protein (DUF59) involved in Fe‑S cluster assembly/– |
| ? | AssemblyC74_contig_56 | 1 = | 0 (0.000) | intergenic (–/+1) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Co‑activator of prophage gene expression IbrA | |||||
| * | ? | AssemblyC74_contig_34 | = 2107 | 0 (0.000) | 1779 (1.350) | 119/256 | 0.0 | 100% | intergenic (‑284/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | PaaD‑like protein (DUF59) involved in Fe‑S cluster assembly/– |
| ? | AssemblyC74_contig_42 | = 1243 | 0 (0.000) | intergenic (‑13/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Mobile element protein/– | |||||
| * | ? | AssemblyC74_contig_36 | 1 = | 0 (0.000) | 276 (0.650) | 85/256 | 0.2 | 100% | intergenic (–/‑369) | –/rasttk_feature_annotation_tool=elepa@bvbrc | –/hypothetical protein |
| ? | AssemblyC74_contig_64 | = 352 | 0 (0.000) | intergenic (+1/–) | rasttk_feature_annotation_tool=elepa@bvbrc/– | hypothetical protein/– | |||||
| * | ? | AssemblyC74_contig_37 | = 1750 | 0 (0.000) | 292 (0.650) +AAAAAGT |
85/242 | 0.9 | 100% | intergenic (‑2/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | FIG00632365: hypothetical protein/– |
| ? | AssemblyC74_contig_62 | 1 = | 0 (0.000) | intergenic (–/‑1) | –/rasttk_feature_annotation_tool=annotate_proteins_si milarity | –/Mobile element protein | |||||
| * | ? | AssemblyC74_contig_38 | = 1652 | 0 (0.000) | 184 (0.540) | 65/256 | 0.3 | 100% | intergenic (+2/–) | rasttk_feature_annotation_tool=elepa@bvbrc/– | hypothetical protein/– |
| ? | AssemblyC74_contig_46 | = 883 | 0 (0.000) | intergenic (+235/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– | |||||
| * | ? | AssemblyC74_contig_38 | = 1652 | 0 (0.000) | 133 (0.380) | 59/256 | 0.1 | 100% | intergenic (+2/–) | rasttk_feature_annotation_tool=elepa@bvbrc/– | hypothetical protein/– |
| ? | AssemblyC74_contig_59 | = 453 | 0 (0.000) | intergenic (+197/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Transposase, IS4/– | |||||
| * | ? | AssemblyC74_contig_39 | 1 = | 0 (0.000) | 231 (0.200) | 54/252 | 0.9 | 66.7% | intergenic (–/+65) | –/rasttk_feature_creation_tool=RNA_reps_SSU_rRNA | –/SSU rRNA ## 16S rRNA, small subunit ribosomal RNA |
| ? | AssemblyC74_contig_63 | 93 = | 231 (0.560) | intergenic (+11/‑9) | rasttk_feature_creation_tool=tRNAscan‑SE/rasttk_feature_creation_tool=tRNAscan‑SE | tRNA‑Pro‑TGG/tRNA‑Ala‑TGC | |||||
| * | ? | AssemblyC74_contig_40 | = 1604 | 0 (0.000) | 210 (0.540) | 61/256 | 1.0 | 100% | intergenic (‑113/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– |
| ? | AssemblyC74_contig_52 | = 702 | 0 (0.000) | intergenic (+23/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Putative transposase InsK for insertion sequence element IS150/– | |||||
| * | ? | AssemblyC74_contig_41 | 1 = | 0 (0.000) | 315 (0.700) | 90/256 | 0.0 | 100% | intergenic (–/+2) | –/rasttk_feature_annotation_tool=elepa@bvbrc | –/hypothetical protein |
| ? | AssemblyC74_contig_47 | 1 = | 0 (0.000) | intergenic (–/‑1) | –/rasttk_feature_annotation_tool=elepa@bvbrc | –/hypothetical protein | |||||
| * | ? | AssemblyC74_contig_41 | 1 = | 0 (0.000) | 357 (0.800) | 91/256 | 0.0 | 100% | intergenic (–/+2) | –/rasttk_feature_annotation_tool=elepa@bvbrc | –/hypothetical protein |
| ? | AssemblyC74_contig_51 | 1 = | 0 (0.000) | intergenic (–/‑1) | –/rasttk_feature_annotation_tool=annotate_proteins_si milarity | –/Conserved domain protein | |||||
| * | ? | AssemblyC74_contig_43 | 1 = | 0 (0.000) | 328 (0.510) | 86/256 | 0.1 | 100% | coding (1215/1215 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein |
| ? | AssemblyC74_contig_44 | = 1136 | 0 (0.000) | coding (1/1134 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_43 | 971 = | 296 (0.740) | 247 (0.810) | 56/214 | 0.4 | 66.7% | coding (245/1215 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein |
| ? | AssemblyC74_contig_48 | 22 = | 0 (0.000) | coding (21/843 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Chitinase (EC 3.2.1.14) | |||||
| * | ? | AssemblyC74_contig_43 | 992 = | 259 (0.640) | 579 (1.120) | 88/256 | -0.0 | 81.7% | coding (224/1215 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein |
| ? | AssemblyC74_contig_61 | = 423 | 0 (0.000) | intergenic (‑1/–) | rasttk_feature_annotation_tool=elepa@bvbrc/– | hypothetical protein/– | |||||
| * | ? | AssemblyC74_contig_43 | = 1217 | 0 (0.000) | 1035 (1.680) | 86/248 | 0.1 | 74.0% | intergenic (‑2/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– |
| ? | AssemblyC74_contig_44 | 617 = | 729 (0.860) | coding (520/1134 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_44 | 1 = | 0 (0.000) | 305 (0.510) | 76/256 | 0.9 | 100% | intergenic (–/+2) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/hypothetical protein |
| ? | AssemblyC74_contig_65 | = 349 | 0 (0.000) | intergenic (‑1/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– | |||||
| * | ? | AssemblyC74_contig_44 | 1 = | 0 (0.000) | 275 (0.470) | 66/256 | 0.4 | 100% | intergenic (–/+2) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/hypothetical protein |
| ? | AssemblyC74_contig_66 | 1 = | 0 (0.000) | intergenic (–/‑1) | –/rasttk_feature_annotation_tool=elepa@bvbrc | –/hypothetical protein | |||||
| * | ? | AssemblyC74_contig_44 | = 810 | 795 (0.910) | 229 (0.470) +GCACTCTTGTCACCATCAAT |
52/216 | 0.0 | 40.6% | coding (327/1134 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein |
| ? | AssemblyC74_contig_60 | = 439 | 0 (0.000) | coding (438/438 nt) | rasttk_feature_annotation_tool=annotate_proteins_si milarity | FIG00630508: hypothetical protein | |||||
| * | ? | AssemblyC74_contig_44 | = 1136 | 0 (0.000) | 304 (0.510) | 80/256 | 0.1 | 100% | coding (1/1134 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein |
| ? | AssemblyC74_contig_48 | = 844 | 0 (0.000) | coding (843/843 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Chitinase (EC 3.2.1.14) | |||||
| * | ? | AssemblyC74_contig_45 | = 1002 | 0 (0.000) | 228 (0.300) | 69/256 | 0.2 | 100% | intergenic (‑96/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Integrase, catalytic region/– |
| ? | AssemblyC74_contig_55 | 1 = | 0 (0.000) | intergenic (–/–) | –/– | –/– | |||||
| * | ? | AssemblyC74_contig_45 | = 1002 | 0 (0.000) | 300 (0.390) | 80/256 | 0.2 | 100% | intergenic (‑96/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Integrase, catalytic region/– |
| ? | AssemblyC74_contig_9 | 1 = | 0 (0.000) | intergenic (–/+1) | –/rasttk_feature_annotation_tool=annotate_proteins_si milarity | –/Transcriptional regulator SpxA1 | |||||
| * | ? | AssemblyC74_contig_47 | 418 = | NA (NA) | 42 (0.090) | 6/254 | 2.7 | 84.0% | coding (417/879 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein |
| ? | AssemblyC74_contig_61 | 4 = | 8 (0.010) | coding (419/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_47 | 421 = | NA (NA) | 237 (0.790) +GCATTCATAGAA |
48/232 | 1.4 | NA | coding (420/879 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein |
| ? | AssemblyC74_contig_47 | = 561 | NA (NA) | coding (560/879 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_47 | 452 = | NA (NA) | 156 (0.640) +34 bp |
44/188 | 0.8 | NA | noncoding (7/29 nt) | direct | CRISPR repeat with sequence actatcgatgtaagtaattgggatacgtc |
| ? | AssemblyC74_contig_47 | = 882 | NA (NA) | intergenic (+2/–) | rasttk_feature_annotation_tool=elepa@bvbrc/– | hypothetical protein/– | |||||
| * | ? | AssemblyC74_contig_47 | 452 = | NA (NA) | 299 (0.850) +34 bp |
69/188 | -0.0 | 100% | noncoding (7/29 nt) | direct | CRISPR repeat with sequence actatcgatgtaagtaattgggatacgtc |
| ? | AssemblyC74_contig_61 | 1 = | 0 (0.000) | intergenic (–/+2) | –/rasttk_feature_annotation_tool=elepa@bvbrc | –/hypothetical protein | |||||
| * | ? | AssemblyC74_contig_47 | 730 = | NA (NA) | 147 (0.310) | 44/256 | 0.0 | 100% | coding (729/879 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein |
| ? | AssemblyC74_contig_61 | 1 = | 0 (0.000) | intergenic (–/+2) | –/rasttk_feature_annotation_tool=elepa@bvbrc | –/hypothetical protein | |||||
| * | ? | AssemblyC74_contig_49 | 1 = | 0 (0.000) | 275 (0.700) | 71/256 | 0.2 | 100% | intergenic (–/‑111) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Mobile element protein |
| ? | AssemblyC74_contig_55 | = 585 | 0 (0.000) | intergenic (–/–) | –/– | –/– | |||||
| * | ? | AssemblyC74_contig_49 | = 764 | 0 (0.000) | 182 (0.480) | 60/256 | 0.1 | 100% | intergenic (+2/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Mobile element protein/– |
| ? | AssemblyC74_contig_59 | 1 = | 0 (0.000) | intergenic (–/‑31) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Transposase, IS4 | |||||
| * | ? | AssemblyC74_contig_50 | = 745 | 0 (0.000) | 254 (0.680) | 78/256 | 0.2 | 100% | intergenic (+8/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Aggregation promoting factor/– |
| ? | AssemblyC74_contig_9 | = 104617 | 0 (0.000) | intergenic (+75/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | Putative deoxyribonuclease YcfH/– | |||||
| * | ? | AssemblyC74_contig_51 | = 723 | 0 (0.000) | 238 (0.500) | 62/256 | 0.0 | 65.5% | intergenic (+2/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | Conserved domain protein/– |
| ? | AssemblyC74_contig_61 | = 87 | 251 (0.400) | coding (336/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_52 | 1 = | 0 (0.000) | 241 (0.470) | 78/256 | 0.8 | 100% | intergenic (–/‑1) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Putative transposase InsK for insertion sequence element IS150 |
| ? | AssemblyC74_contig_53 | 1 = | 0 (0.000) | intergenic (–/+2) | –/rasttk_feature_annotation_tool=annotate_proteins_si milarity | –/Mobile element protein | |||||
| * | ? | AssemblyC74_contig_54 | = 611 | 0 (0.000) | 314 (0.570) | 86/256 | 0.0 | 100% | intergenic (+1/–) | rasttk_feature_creation_tool=tRNAscan‑SE/– | tRNA‑Arg‑ACG/– |
| ? | AssemblyC74_contig_63 | 1 = | 0 (0.000) | intergenic (–/‑8) | –/rasttk_feature_creation_tool=tRNAscan‑SE | –/tRNA‑Pro‑TGG | |||||
| * | ? | AssemblyC74_contig_60 | 1 = | 0 (0.000) | 254 (0.550) | 57/256 | 0.0 | 92.2% | intergenic (–/‑1) | –/rasttk_feature_annotation_tool=annotate_proteins_si milarity | –/FIG00630508: hypothetical protein |
| ? | AssemblyC74_contig_61 | 22 = | 43 (0.070) | coding (401/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_61 | 22 = | 43 (0.070) | 159 (0.310) | 51/210 | 0.0 | 49.8% | coding (401/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein |
| ? | AssemblyC74_contig_61 | = 99 | 285 (0.550) | coding (324/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_61 | = 81 | 246 (0.390) | 112 (0.210) +GTCATATTCGTAACATTT |
45/220 | 0.0 | 25.6% | coding (342/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein |
| ? | AssemblyC74_contig_61 | 175 = | 512 (0.810) | coding (248/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_62 | = 391 | 0 (0.000) | 263 (0.610) | 77/256 | 0.8 | 100% | intergenic (+213/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | Mobile element protein/– |
| ? | AssemblyC74_contig_64 | = 352 | 0 (0.000) | intergenic (+1/–) | rasttk_feature_annotation_tool=elepa@bvbrc/– | hypothetical protein/– | |||||
| * | ? | AssemblyC74_contig_64 | 1 = | 0 (0.000) | 521 (1.230) | 86/256 | 0.1 | 100% | coding (1/351 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein |
| ? | AssemblyC74_contig_66 | = 349 | 0 (0.000) | coding (348/348 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||