mutation predictions | marginal predictions | summary statistics | genome diff | command line log
|
breseq version 0.35.4 revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Predicted mutations | ||||||
|---|---|---|---|---|---|---|
| evidence | position | mutation | freq | annotation | gene | description |
| RA | 9,907 | A→C | 6.5% | intergenic (+14/+21) | mog → / ← satP | molybdopterin adenylyltransferase/acetate/succinate:H(+) symporter |
| RA | 9,908 | G→T | 8.1% | intergenic (+15/+20) | mog → / ← satP | molybdopterin adenylyltransferase/acetate/succinate:H(+) symporter |
| RA | 53,376 | G→A | 8.0% | P14L (CCC→CTC) | pdxA ← | 4‑hydroxythreonine‑4‑phosphate dehydrogenase |
| RA | 53,379 | T→C | 8.8% | E13G (GAG→GGG) | pdxA ← | 4‑hydroxythreonine‑4‑phosphate dehydrogenase |
| RA | 78,830 | T→A | 6.9% | intergenic (+31/+18) | setA → / ← leuD | sugar exporter SetA/3‑isopropylmalate dehydratase subunit LeuD |
| RA | 78,831 | T→A | 6.9% | intergenic (+32/+17) | setA → / ← leuD | sugar exporter SetA/3‑isopropylmalate dehydratase subunit LeuD |
| RA | 125,387 | C→T | 100% | Q791* (CAG→TAG) | aceE → | pyruvate dehydrogenase E1 component |
| RA | 167,291 | G→A | 7.4% | intergenic (+27/‑193) | mrcB → / → fhuA | peptidoglycan glycosyltransferase/peptidoglycan DD‑transpeptidase MrcB/ferrichrome outer membrane transporter/phage receptor |
| RA | 167,293 | G→C | 8.2% | intergenic (+29/‑191) | mrcB → / → fhuA | peptidoglycan glycosyltransferase/peptidoglycan DD‑transpeptidase MrcB/ferrichrome outer membrane transporter/phage receptor |
| RA | 167,295 | T→C | 7.3% | intergenic (+31/‑189) | mrcB → / → fhuA | peptidoglycan glycosyltransferase/peptidoglycan DD‑transpeptidase MrcB/ferrichrome outer membrane transporter/phage receptor |
| MC JC | 257,908 | Δ776 bp | 100% | insB9–[crl] | insB9, insA9, [crl] | |
| RA | 481,225 | T→G | 8.7% | intergenic (‑517/+29) | tomB ← / ← acrB | protein that modulates Hha toxicity/multidrug efflux pump RND permease AcrB |
| RA | 506,394 | C→T | 7.0% | A494V (GCG→GTG) | ushA → | 5'‑nucleotidase/UDP‑sugar hydrolase |
| RA | 696,470 | C→T | 100% | noncoding (35/75 nt) | glnX ← | tRNA‑Gln |
| JC JC | 710,682 | IS5 (–) +4 bp | 73.6% | coding (41‑44/87 nt) | uof ← | RyhB‑regulated fur leader peptide |
| RA | 759,250 | G→T | 100% | R182L (CGC→CTC) | sucA → | subunit of E1(0) component of 2‑oxoglutarate dehydrogenase |
| RA | 770,682 | A→C | 12.0% | intergenic (+71/‑776) | mngB → / → cydA | alpha‑mannosidase/cytochrome bd‑I ubiquinol oxidase subunit I |
| RA | 781,668 | C→T | 6.5% | intergenic (+16/‑417) | lysQ → / → nadA | tRNA‑Lys/quinolinate synthase |
| RA | 781,670 | A→T | 6.6% | intergenic (+18/‑415) | lysQ → / → nadA | tRNA‑Lys/quinolinate synthase |
| RA | 781,672 | A→G | 6.7% | intergenic (+20/‑413) | lysQ → / → nadA | tRNA‑Lys/quinolinate synthase |
| RA | 786,458 | Δ1 bp | 100% | coding (826/1053 nt) | aroG → | 3‑deoxy‑7‑phosphoheptulonate synthase, Phe‑sensitive |
| RA | 866,530 | T→C | 8.1% | intergenic (‑166/‑38) | moeA ← / → iaaA | molybdopterin molybdotransferase/isoaspartyl dipeptidase proenzyme |
| RA | 915,081 | G→C | 10.5% | intergenic (‑224/+271) | lysO ← / ← aqpZ | L‑lysine exporter/water channel AqpZ |
| RA | 1,151,873 | T→A | 7.7% | intergenic (+22/‑66) | acpP → / → fabF | acyl carrier protein/beta‑ketoacyl‑[acyl carrier protein] synthase II |
| RA | 1,151,874 | T→A | 8.0% | intergenic (+23/‑65) | acpP → / → fabF | acyl carrier protein/beta‑ketoacyl‑[acyl carrier protein] synthase II |
| RA | 1,159,335 | G→T | 6.0% | intergenic (+33/+27) | ptsG → / ← fhuE | glucose‑specific PTS enzyme IIBC component/ferric coprogen/ferric rhodotorulic acid outer membrane transporter |
| RA | 1,159,336 | A→C | 6.7% | intergenic (+34/+26) | ptsG → / ← fhuE | glucose‑specific PTS enzyme IIBC component/ferric coprogen/ferric rhodotorulic acid outer membrane transporter |
| RA | 1,196,220 | C→T | 53.1% | H366H (CAC→CAT) | icd → | isocitrate dehydrogenase |
| RA | 1,196,232 | C→T | 47.7% | T370T (ACC→ACT) | icd → | isocitrate dehydrogenase |
| RA | 1,196,245 | T→C | 35.4% | L375L (TTA→CTA) ‡ | icd → | isocitrate dehydrogenase |
| RA | 1,196,247 | A→G | 36.7% | L375L (TTA→TTG) ‡ | icd → | isocitrate dehydrogenase |
| RA | 1,211,612 | A→T | 9.9% | intergenic (+35/+68) | icdC → / ← iraM | protein IcdC/anti‑adaptor protein IraM, inhibitor of sigma(S) proteolysis |
| RA | 1,233,154 | T→A | 9.3% | intergenic (‑124/+22) | dsbB ← / ← nhaB | protein thiol:quinone oxidoreductase DsbB/Na(+):H(+) antiporter NhaB |
| RA | 1,233,157 | T→A | 9.1% | intergenic (‑127/+19) | dsbB ← / ← nhaB | protein thiol:quinone oxidoreductase DsbB/Na(+):H(+) antiporter NhaB |
| RA | 1,273,229 | A→T | 6.2% | intergenic (+27/+17) | chaC → / ← ychN | glutathione‑specific gamma‑glutamylcyclotransferase/DsrE/F sulfur relay family protein YchN |
| RA | 1,285,193 | T→A | 7.1% | W19R (TGG→AGG) | narJ → | nitrate reductase 1 molybdenum cofactor assembly chaperone |
| JC JC | 1,293,032 | IS1 (–) +8 bp | 100% | intergenic (‑110/‑488) | hns ← / → tdk | DNA‑binding transcriptional dual regulator H‑NS/thymidine/deoxyuridine kinase |
| MC JC | 1,299,499 | Δ1,199 bp | 100% | insH21 | insH21 | |
| RA | 1,309,041 | T→C | 6.9% | D410G (GAC→GGC) | kch ← | K(+) channel Kch |
| RA | 1,344,036 | G→C | 7.0% | T104S (ACT→AGT) | yciT ← | putative DNA‑binding transcriptional regulator YciT |
| RA | 1,376,207 | C→A | 9.1% | A58A (GCC→GCA) | ycjR → | putative ketohexose‑3‑epimerase YcjR |
| RA | 1,382,000 | C→T | 10.1% | C18C (TGC→TGT) | ompG → | outer membrane porin G |
| RA | 1,382,003 | A→G | 13.7% | A19A (GCA→GCG) | ompG → | outer membrane porin G |
| RA | 1,482,224 | T→G | 8.1% | intergenic (+23/+31) | ynbD → / ← azoR | putative phosphatase/FMN dependent NADH:quinone oxidoreductase |
| RA | 1,524,458:1 | +T | 8.9% | intergenic (+90/+23) | yncE → / ← ansP | PQQ‑like domain‑containing protein YncE/L‑asparagine transporter |
| RA | 1,524,463 | Δ1 bp | 8.7% | intergenic (+95/+18) | yncE → / ← ansP | PQQ‑like domain‑containing protein YncE/L‑asparagine transporter |
| RA | 1,557,194 | A→C | 12.2% | L282R (CTG→CGG) | ddpF ← | putative D,D‑dipeptide ABC transporter ATP‑binding subunit DdpF |
| RA | 1,557,197 | G→T | 11.4% | P281Q (CCG→CAG) | ddpF ← | putative D,D‑dipeptide ABC transporter ATP‑binding subunit DdpF |
| RA | 1,674,955 | A→T | 7.0% | intergenic (+8/+17) | tqsA → / ← pntB | autoinducer 2 exporter/pyridine nucleotide transhydrogenase subunit beta |
| RA | 1,674,958 | A→T | 7.4% | intergenic (+11/+14) | tqsA → / ← pntB | autoinducer 2 exporter/pyridine nucleotide transhydrogenase subunit beta |
| RA | 1,703,251 | A→T | 10.5% | intergenic (+17/+17) | add → / ← ydgJ | adenosine deaminase/putative oxidoreductase YdgJ |
| RA | 1,703,252 | A→T | 10.0% | intergenic (+18/+16) | add → / ← ydgJ | adenosine deaminase/putative oxidoreductase YdgJ |
| RA | 1,764,427 | G→A | 33.2% | intergenic (‑41/+286) | sufA ← / ← rydB | iron‑sulfur cluster insertion protein SufA/small regulatory RNA RydB |
| RA | 1,865,682 | G→C | 5.4% | intergenic (‑46/+44) | yeaE ← / ← mipA | methylglyoxal reductase YeaE/scaffolding protein that interacts with murein polymerase and murein hydrolase |
| RA | 1,948,179 | T→A | 6.6% | intergenic (‑28/+1) | yebC ← / ← nudB | putative transcriptional regulator YebC/dihydroneopterin triphosphate diphosphatase |
| RA | 1,948,180 | T→A | 6.6% | *151C (TGA→TGT) | nudB ← | dihydroneopterin triphosphate diphosphatase |
| MC JC | 1,978,503 | Δ776 bp | 100% | insB‑5–insA‑5 | insB‑5, insA‑5 | |
| JC JC | 1,979,486 | IS5 (+) +4 bp | 100% | intergenic (‑271/‑264) | insA‑5 ← / → uspC | IS1 protein InsA/universal stress protein C |
| RA | 2,132,787 | A→C | 100% | I204S (ATC→AGC) | wcaA ← | putative colanic acid biosynthesis glycosyl transferase |
| RA | 2,173,361 | Δ2 bp | 100% | pseudogene (917‑918/1358 nt) | gatC ← | galactitol‑specific PTS enzyme IIC component |
| RA | 2,373,177 | G→A | 7.7% | G96S (GGC→AGC) | arnF → | undecaprenyl‑phosphate‑alpha‑L‑Ara4N flippase ‑ ArnF subunit |
| RA | 2,373,180 | T→C | 7.7% | W97R (TGG→CGG) | arnF → | undecaprenyl‑phosphate‑alpha‑L‑Ara4N flippase ‑ ArnF subunit |
| RA | 2,383,956 | A→T | 8.9% | intergenic (+32/+39) | elaD → / ← yfbK | protease ElaD/IPR002035/DUF3520 domain‑containing protein YfbK |
| RA | 2,383,959 | A→T | 9.1% | intergenic (+35/+36) | elaD → / ← yfbK | protease ElaD/IPR002035/DUF3520 domain‑containing protein YfbK |
| RA | 2,394,770 | T→C | 17.7% | T93A (ACT→GCT) | nuoL ← | NADH:quinone oxidoreductase subunit L |
| JC | 2,399,711 | Δ123 bp | 38.5% | coding (333‑455/2727 nt) | nuoG ← | NADH:quinone oxidoreductase subunit G |
| RA | 2,432,985 | A→G | 11.1% | intergenic (‑43/+27) | folC ← / ← accD | bifunctional folylpolyglutamate synthetase/dihydrofolate synthetase/acetyl‑CoA carboxyltransferase subunit beta |
| RA | 2,432,990 | G→C | 9.7% | intergenic (‑48/+22) | folC ← / ← accD | bifunctional folylpolyglutamate synthetase/dihydrofolate synthetase/acetyl‑CoA carboxyltransferase subunit beta |
| RA | 2,432,995 | C→T | 8.7% | intergenic (‑53/+17) | folC ← / ← accD | bifunctional folylpolyglutamate synthetase/dihydrofolate synthetase/acetyl‑CoA carboxyltransferase subunit beta |
| JC | 2,436,385 | Δ97 bp | 64.4% | coding (169‑265/1014 nt) | usg ← | putative semialdehyde dehydrogenase Usg |
| RA | 2,440,866 | A→G | 5.9% | L247P (CTG→CCG) | fabB ← | beta‑ketoacyl‑[acyl carrier protein] synthase I |
| RA | 2,621,591 | A→T | 8.2% | Q132L (CAA→CTA) | purM → | phosphoribosylformylglycinamide cyclo‑ligase |
| RA | 2,622,348:1 | +A | 10.0% | coding (115/639 nt) | purN → | phosphoribosylglycinamide formyltransferase 1 |
| RA | 2,622,354 | Δ1 bp | 10.0% | coding (121/639 nt) | purN → | phosphoribosylglycinamide formyltransferase 1 |
| RA | 2,661,969 | C→G | 100% | V55L (GTT→CTT) | iscR ← | DNA‑binding transcriptional dual regulator IscR |
| RA | 2,753,755 | A→G | 6.9% | T51A (ACG→GCG) | bamE → | outer membrane protein assembly factor BamE |
| RA | 2,761,620 | T→G | 11.7% | K641Q (AAG→CAG) | abpB ← | CP4‑57 prophage; putative helicase YfjK |
| RA | 2,761,623 | C→A | 10.5% | V640L (GTA→TTA) | abpB ← | CP4‑57 prophage; putative helicase YfjK |
| RA | 2,929,722 | G→A | 8.5% | V49V (GTG→GTA) | sdaB → | L‑serine deaminase II |
| RA | 2,936,359 | T→A | 10.6% | V259D (GTT→GAT) | fucI → | L‑fucose isomerase |
| RA | 3,007,466 | T→C | 9.8% | intergenic (+14/‑44) | ygeW → / → ygeX | putative carbamoyltransferase YgeW/2,3‑diaminopropionate ammonia‑lyase |
| RA | 3,007,473 | G→A | 9.0% | intergenic (+21/‑37) | ygeW → / → ygeX | putative carbamoyltransferase YgeW/2,3‑diaminopropionate ammonia‑lyase |
| RA | 3,041,632 | T→A | 100% | V107E (GTG→GAG) | ygfZ → | folate‑binding protein |
| RA | 3,156,590 | C→A | 7.4% | intergenic (+72/‑33) | yqhD → / → dkgA | NADPH‑dependent aldehyde reductase YqhD/methylglyoxal reductase DkgA |
| RA | 3,156,591 | T→G | 8.2% | intergenic (+73/‑32) | yqhD → / → dkgA | NADPH‑dependent aldehyde reductase YqhD/methylglyoxal reductase DkgA |
| RA | 3,208,201 | G→A | 8.0% | V60M (GTG→ATG) | ttdT → | L‑tartrate:succinate antiporter |
| RA | 3,288,032 | C→A | 6.5% | intergenic (+22/‑58) | yraH → / → yraI | putative fimbrial protein YraH/putative fimbrial chaperone YraI |
| RA | 3,288,033 | T→G | 6.7% | intergenic (+23/‑57) | yraH → / → yraI | putative fimbrial protein YraH/putative fimbrial chaperone YraI |
| RA | 3,324,952 | A→G | 9.3% | intergenic (‑41/+49) | folP ← / ← ftsH | dihydropteroate synthase/ATP‑dependent zinc metalloprotease FtsH |
| RA | 3,324,955 | A→G | 8.3% | intergenic (‑44/+46) | folP ← / ← ftsH | dihydropteroate synthase/ATP‑dependent zinc metalloprotease FtsH |
| RA | 3,324,956 | C→T | 8.2% | intergenic (‑45/+45) | folP ← / ← ftsH | dihydropteroate synthase/ATP‑dependent zinc metalloprotease FtsH |
| RA | 3,324,959 | C→T | 8.1% | intergenic (‑48/+42) | folP ← / ← ftsH | dihydropteroate synthase/ATP‑dependent zinc metalloprotease FtsH |
| RA | 3,368,142 | A→T | 7.8% | M106L (ATG→TTG) | yhcG → | DUF1016 domain‑containing protein YhcG |
| RA | 3,396,961 | C→A | 11.4% | A279S (GCG→TCG) | rng ← | RNase G |
| RA | 3,396,962 | T→G | 14.4% | R278R (CGA→CGC) | rng ← | RNase G |
| RA | 3,473,614 | C→T | 12.4% | W156* (TGG→TGA) | rpsG ← | 30S ribosomal subunit protein S7 |
| RA | 3,560,455:1 | +G | 100% | pseudogene (151/758 nt) | glpR ← | DNA‑binding transcriptional repressor GlpR |
| RA | 3,577,476 | G→A | 6.9% | G39G (GGC→GGT) | gntK ← | D‑gluconate kinase, thermostable |
| RA | 3,637,645:1 | +T | 100% | coding (4/1500 nt) | pitA → | metal phosphate:H(+) symporter PitA |
| RA | 3,708,427 | G→A | 9.1% | intergenic (‑722/+189) | dppA ← / ← proK | dipeptide ABC transporter periplasmic binding protein/tRNA‑Pro |
| RA | 3,708,428 | T→A | 9.4% | intergenic (‑723/+188) | dppA ← / ← proK | dipeptide ABC transporter periplasmic binding protein/tRNA‑Pro |
| RA | 3,708,429 | T→C | 9.9% | intergenic (‑724/+187) | dppA ← / ← proK | dipeptide ABC transporter periplasmic binding protein/tRNA‑Pro |
| RA | 3,722,300 | G→T | 6.5% | intergenic (+251/+28) | insK → / ← glyS | IS150 conserved protein InsB/glycine‑‑tRNA ligase subunit beta |
| RA | 3,722,301 | A→C | 6.4% | intergenic (+252/+27) | insK → / ← glyS | IS150 conserved protein InsB/glycine‑‑tRNA ligase subunit beta |
| RA | 3,798,234 | A→T | 9.8% | intergenic (+27/+5) | waaL → / ← waaU | O‑antigen ligase/putative ADP‑heptose:LPS heptosyltransferase 4 |
| RA | 3,798,235 | A→T | 9.8% | intergenic (+28/+4) | waaL → / ← waaU | O‑antigen ligase/putative ADP‑heptose:LPS heptosyltransferase 4 |
| MC JC | 3,815,859 | Δ82 bp | 100% | [rph] | [rph] | |
| RA | 3,900,545 | A→T | 7.8% | A11A (GCT→GCA) | yieL ← | putative hydrolase YieL |
| MC JC | 4,001,645 | Δ5 bp | 100% | coding (220‑224/951 nt) | corA → | Ni(2(+))/Co(2(+))/Mg(2(+)) transporter |
| RA | 4,088,091 | G→C | 13.1% | intergenic (+34/+16) | yiiG → / ← frvR | DUF3829 domain‑containing lipoprotein YiiG/putative transcriptional regulator FrvR |
| RA | 4,184,543 | C→A | 100% | P1100Q (CCG→CAG) | rpoB → | RNA polymerase subunit beta |
| RA | 4,270,146 | T→C | 7.7% | intergenic (+19/‑92) | aphA → / → yjbQ | acid phosphatase/phosphotransferase/UPF0047 protein YjbQ |
| RA | 4,296,060 | C→T | 37.1% | intergenic (+266/+376) | gltP → / ← yjcO | glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO |
| RA | 4,296,380:1 | +CG | 100% | intergenic (+586/+56) | gltP → / ← yjcO | glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO |
| RA | 4,561,590 | A→C | 10.6% | L362L (CTT→CTG) | yjiJ ← | putative transporter YjiJ |
| Unassigned missing coverage evidence | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | NC_000913 | 3423735–3424534 | 3424534 | 1–800 | 24 [23] | [23] 24 | [rrfD]–[rrlD] | [rrfD],[rrlD] |
| Unassigned new junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | 225154 = | NA (NA) | 5 (0.100) | 5/252 | NT | NA | noncoding (1384/1542 nt) | rrsH | 16S ribosomal RNA |
| ? | NC_000913 | 225176 = | NA (NA) | noncoding (1406/1542 nt) | rrsH | 16S ribosomal RNA | |||||
| * | ? | NC_000913 | = 315646 | NA (NA) | 7 (0.140) | 7/252 | NT | NA | noncoding (418/1255 nt) | IS3 | repeat region |
| ? | NC_000913 | = 315665 | NA (NA) | noncoding (437/1255 nt) | IS3 | repeat region | |||||
| * | ? | NC_000913 | 315892 = | NA (NA) | 4 (0.080) | 4/256 | NT | NA | noncoding (664/1255 nt) | IS3 | repeat region |
| ? | NC_000913 | 315923 = | NA (NA) | noncoding (695/1255 nt) | IS3 | repeat region | |||||
| * | ? | NC_000913 | 316099 = | NA (NA) | 4 (0.080) | 3/246 | NT | NA | noncoding (871/1255 nt) | IS3 | repeat region |
| ? | NC_000913 | 316185 = | NA (NA) | noncoding (957/1255 nt) | IS3 | repeat region | |||||
| * | ? | NC_000913 | 508581 = | NA (NA) | 3 (0.070) +GTTCAGGCACAAGTTTGTAG |
3/222 | NT | NA | intergenic (+22/+294) | ybaQ/copA | putative DNA‑binding transcriptional regulator YbaQ/Cu(+) exporting P‑type ATPase |
| ? | NC_000913 | 508630 = | NA (NA) | intergenic (+71/+245) | ybaQ/copA | putative DNA‑binding transcriptional regulator YbaQ/Cu(+) exporting P‑type ATPase | |||||
| * | ? | NC_000913 | = 508686 | NA (NA) | 4 (0.080) | 3/248 | NT | NA | noncoding (32/34 nt) | other | REP48c |
| ? | NC_000913 | = 4027405 | NA (NA) | noncoding (2/34 nt) | other | REP291b | |||||
| * | ? | NC_000913 | 566777 = | NA (NA) | 2317 (43.360) | 256/260 | NT | 97.8% | noncoding (1/1258 nt) | IS3 | repeat region |
| ? | NC_000913 | = 572471 | 52 (0.970) | coding (6/456 nt) | ybcN | DLP12 prophage; DNA base‑flipping protein | |||||
| * | ? | NC_000913 | = 572471 | 52 (0.970) | 8 (0.200) +34 bp |
7/194 | NT | 23.8% | coding (6/456 nt) | ybcN | DLP12 prophage; DNA base‑flipping protein |
| ? | NC_000913 | = 2170235 | 17 (0.320) | noncoding (65/1258 nt) | IS3 | repeat region | |||||
| * | ? | NC_000913 | 591569 = | 62 (1.150) | 4 (0.080) | 4/250 | NT | 6.6% | coding (1610/2238 nt) | nfrB | bacteriophage N4 receptor, inner membrane subunit |
| ? | NC_000913 | 591595 = | 54 (1.050) | coding (1584/2238 nt) | nfrB | bacteriophage N4 receptor, inner membrane subunit | |||||
| * | ? | NC_000913 | 644857 = | 48 (0.890) | 3 (0.060) | 3/246 | NT | 6.3% | coding (147/807 nt) | rna | RNase I |
| ? | NC_000913 | 644879 = | 44 (0.870) | coding (125/807 nt) | rna | RNase I | |||||
| * | ? | NC_000913 | 1207790 = | 5 (0.090) | 11 (0.230) | 11/230 | NT | 72.4% | coding (290/630 nt) | ycfK | e14 prophage; protein StfP |
| ? | NC_000913 | 1209619 = | 4 (0.080) | pseudogene (37/537 nt) | stfE | e14 prophage; putative side tail fiber protein fragment | |||||
| * | ? | NC_000913 | = 1207805 | 4 (0.070) | 8 (0.170) | 8/230 | NT | 68.1% | coding (305/630 nt) | ycfK | e14 prophage; protein StfP |
| ? | NC_000913 | = 1209602 | 4 (0.080) | pseudogene (54/537 nt) | stfE | e14 prophage; putative side tail fiber protein fragment | |||||
| * | ? | NC_000913 | = 1234589 | 53 (0.980) | 3 (0.060) | 3/250 | NT | 5.6% | coding (129/1542 nt) | nhaB | Na(+):H(+) antiporter NhaB |
| ? | NC_000913 | = 1234598 | 50 (0.970) | coding (120/1542 nt) | nhaB | Na(+):H(+) antiporter NhaB | |||||
| * | ? | NC_000913 | 1550509 = | 50 (0.930) | 3 (0.060) | 3/248 | NT | 5.9% | coding (49/885 nt) | fdnH | formate dehydrogenase N subunit beta |
| ? | NC_000913 | 1550536 = | 49 (0.960) | coding (76/885 nt) | fdnH | formate dehydrogenase N subunit beta | |||||
| * | ? | NC_000913 | 2026671 = | 39 (0.720) | 3 (0.060) | 3/250 | NT | 7.2% | coding (1347/1695 nt) | dgcQ | putative diguanylate cyclase DgcQ |
| ? | NC_000913 | 2026688 = | 40 (0.780) | coding (1330/1695 nt) | dgcQ | putative diguanylate cyclase DgcQ | |||||
| * | ? | NC_000913 | 2049991 = | 52 (0.970) | 3 (0.060) | 3/252 | NT | 5.9% | coding (5054/7077 nt) | yeeJ | inverse autotransporter adhesin |
| ? | NC_000913 | 2050006 = | 45 (0.870) | coding (5069/7077 nt) | yeeJ | inverse autotransporter adhesin | |||||
| * | ? | NC_000913 | = 2154600 | 36 (0.670) | 3 (0.060) | 3/246 | NT | 7.2% | coding (585/1248 nt) | mdtA | multidrug efflux pump membrane fusion protein MdtA |
| ? | NC_000913 | = 2154615 | 44 (0.870) | coding (600/1248 nt) | mdtA | multidrug efflux pump membrane fusion protein MdtA | |||||
| * | ? | NC_000913 | = 2443842 | NA (NA) | 3 (0.060) | 3/248 | NT | NA | noncoding (28/37 nt) | other | REP171b |
| ? | NC_000913 | = 2443861 | NA (NA) | noncoding (9/37 nt) | other | REP171b | |||||
| * | ? | NC_000913 | = 2533705 | 52 (0.970) | 3 (0.060) | 3/246 | NT | 5.9% | intergenic (+325/‑59) | cysK/ptsH | O‑acetylserine sulfhydrylase A/phosphocarrier protein HPr |
| ? | NC_000913 | = 2533719 | 47 (0.930) | intergenic (+339/‑45) | cysK/ptsH | O‑acetylserine sulfhydrylase A/phosphocarrier protein HPr | |||||
| * | ? | NC_000913 | = 2939618 | 72 (1.340) | 4 (0.070) | 3/260 | NT | 5.3% | coding (251/732 nt) | fucR | DNA‑binding transcriptional activator FucR |
| ? | NC_000913 | = 2939635 | 71 (1.330) | coding (268/732 nt) | fucR | DNA‑binding transcriptional activator FucR | |||||
| * | ? | NC_000913 | 3297649 = | 50 (0.930) | 4 (0.080) | 4/252 | NT | 7.8% | coding (490/1041 nt) | yraQ | permease family protein YraQ |
| ? | NC_000913 | 3297673 = | 47 (0.910) | coding (466/1041 nt) | yraQ | permease family protein YraQ | |||||
| * | ? | NC_000913 | 3423373 = | 70 (1.300) | 4 (0.080) | 4/258 | NT | 6.3% | intergenic (+179/+50) | yhdZ/rrfF | putative ABC transporter ATP‑binding subunit YhdZ/5S ribosomal RNA |
| ? | NC_000913 | 3423668 = | 50 (0.940) | noncoding (120/120 nt) | rrfD | 5S ribosomal RNA | |||||
| * | ? | NC_000913 | = 3571215 | 47 (0.870) | 3 (0.060) | 3/252 | NT | 6.0% | coding (105/1974 nt) | glgX | limit dextrin alpha‑1,6‑glucohydrolase |
| ? | NC_000913 | = 3571246 | 49 (0.950) | coding (74/1974 nt) | glgX | limit dextrin alpha‑1,6‑glucohydrolase | |||||
| * | ? | NC_000913 | 3639740 = | 51 (0.950) | 3 (0.060) | 3/254 | NT | 6.0% | intergenic (‑20/‑371) | uspB/uspA | putative universal stress (ethanol tolerance) protein B/universal stress global stress response regulator |
| ? | NC_000913 | 3639764 = | 45 (0.860) | intergenic (‑44/‑347) | uspB/uspA | putative universal stress (ethanol tolerance) protein B/universal stress global stress response regulator | |||||
| * | ? | NC_000913 | = 3744913 | 57 (1.060) | 3 (0.060) | 3/246 | NT | 5.1% | coding (110/1278 nt) | yiaN | 2,3‑diketo‑L‑gulonate:Na(+) symporter ‑ membrane subunit |
| ? | NC_000913 | = 3744918 | 58 (1.150) | coding (115/1278 nt) | yiaN | 2,3‑diketo‑L‑gulonate:Na(+) symporter ‑ membrane subunit | |||||
| * | ? | NC_000913 | = 3943624 | NA (NA) | 6 (0.120) | 4/248 | NT | 14.3% | intergenic (+114/‑80) | gltU/rrlC | tRNA‑Glu/23S ribosomal RNA |
| ? | NC_000913 | = 4037457 | 38 (0.710) | intergenic (+122/‑62) | alaT/rrlA | tRNA‑Ala/23S ribosomal RNA | |||||
| * | ? | NC_000913 | = 3998036 | 47 (0.870) | 5 (0.090) | 5/258 | NT | 9.0% | coding (54/2163 nt) | uvrD | ssDNA translocase and dsDNA helicase ‑ DNA helicase II |
| ? | NC_000913 | = 3998077 | 55 (1.040) | coding (95/2163 nt) | uvrD | ssDNA translocase and dsDNA helicase ‑ DNA helicase II | |||||
| * | ? | NC_000913 | 4240741 = | 61 (1.130) | 3 (0.060) | 3/242 | NT | 5.1% | intergenic (+6/+38) | psiE/xylE | putative phosphate starvation‑inducible protein/D‑xylose:H(+) symporter |
| ? | NC_000913 | 4240769 = | 55 (1.110) | intergenic (+34/+10) | psiE/xylE | putative phosphate starvation‑inducible protein/D‑xylose:H(+) symporter | |||||
| * | ? | NC_000913 | 4363384 = | 51 (0.950) | 3 (0.060) | 3/246 | NT | 6.4% | coding (1659/1698 nt) | dsbD | protein disulfide oxidoreductase ‑ DsbDreduced |
| ? | NC_000913 | 4363422 = | 40 (0.790) | coding (1621/1698 nt) | dsbD | protein disulfide oxidoreductase ‑ DsbDreduced | |||||
| * | ? | NC_000913 | = 4425443 | 51 (0.950) | 3 (0.060) | 3/256 | NT | 5.7% | coding (326/396 nt) | rpsF | 30S ribosomal subunit protein S6 |
| ? | NC_000913 | = 4425453 | 49 (0.930) | coding (336/396 nt) | rpsF | 30S ribosomal subunit protein S6 | |||||
| * | ? | NC_000913 | = 4509603 | 56 (1.040) | 3 (0.060) | 3/246 | NT | 5.2% | noncoding (597/795 nt) | IS911 | repeat region |
| ? | NC_000913 | = 4509607 | 57 (1.130) | noncoding (601/795 nt) | IS911 | repeat region | |||||
| * | ? | NC_000913 | = 4513647 | 49 (0.910) | 5 (0.100) | 5/254 | NT | 9.2% | coding (662/903 nt) | fecB | ferric citrate ABC transporter periplasmic binding protein |
| ? | NC_000913 | = 4513662 | 51 (0.980) | coding (647/903 nt) | fecB | ferric citrate ABC transporter periplasmic binding protein | |||||