mutation predictions | marginal predictions | summary statistics | genome diff | command line log
|
breseq version 0.35.4 revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Predicted mutations | ||||||
|---|---|---|---|---|---|---|
| evidence | seq id | position | mutation | annotation | gene | description |
| RA | AssemblyC74_contig_1 | 65 | T→C | intergenic (–/‑527) | – / → rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Two‑component transcriptional response regulator, OmpR family |
| RA | AssemblyC74_contig_1 | 117 | C→T | intergenic (–/‑475) | – / → rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Two‑component transcriptional response regulator, OmpR family |
| RA | AssemblyC74_contig_1 | 443,483 | (T)6→5 | intergenic (+612/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity → / – | Conserved hypothetical protein ArsC related/– |
| RA | AssemblyC74_contig_12 | 59,062 | T→C | G92G (GGA→GGG) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 ← | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| RA | AssemblyC74_contig_12 | 59,113 | A→G | N75N (AAT→AAC) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 ← | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| RA | AssemblyC74_contig_12 | 59,182 | C→T | L52L (TTG→TTA) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 ← | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| RA | AssemblyC74_contig_12 | 59,248 | C→T | A30A (GCG→GCA) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 ← | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| RA | AssemblyC74_contig_12 | 59,264 | G→T | A25E (GCA→GAA) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 ← | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| RA | AssemblyC74_contig_12 | 59,272 | G→A | T22T (ACC→ACT) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 ← | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| RA | AssemblyC74_contig_15 | 32,991 | A→G | H250H (CAT→CAC) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 ← | Mobile element protein |
| RA | AssemblyC74_contig_2 | 34,600 | C→T | Q37Q (CAG→CAA) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 ← | elongation factor G‑binding protein, putative |
| RA | AssemblyC74_contig_5 | 124,711 | G→A | T333I (ACC→ATC) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 ← | Mg/Co/Ni transporter MgtE, CBS domain‑containing |
| RA | AssemblyC74_contig_8 | 33,002 | T→C | L93P (CTG→CCG) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 → | Transcriptional regulator, repressor of the glutamine synthetase, MerR family |
| Unassigned missing coverage evidence | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | AssemblyC74_contig_11 | 78783 | 78787 | 5 | 212 [1] | [0] NA | [rasttk_feature_annotation_tool=elepa@bvbrc] | [rasttk_feature_annotation_tool=elepa@bvbrc] |
| * | * | ÷ | AssemblyC74_contig_12 | 1 | 18 | 18 | NA [0] | [238] 244 | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Polygalacturonase (EC 3.2.1.15) |
| * | * | ÷ | AssemblyC74_contig_48 | 1 | 21 | 21 | NA [0] | [0] 282 | [rasttk_feature_annotation_tool=annotate_proteins_km er_v2] | [rasttk_feature_annotation_tool=annotate_proteins_km er_v2] |
| Unassigned new junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | AssemblyC74_contig_1 | = 221 | 368 (0.920) | 227 (0.610) | 63/240 | 1.8 | 56.6% | intergenic (–/‑371) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Two‑component transcriptional response regulator, OmpR family |
| ? | AssemblyC74_contig_12 | 8 = | 0 (0.000) | intergenic (–/+152) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Polygalacturonase (EC 3.2.1.15) | |||||
| * | ? | AssemblyC74_contig_1 | 377980 = | 9 (0.020) | 470 (1.290) | 91/254 | 0.1 | 79.8% | intergenic (+144/‑147) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Tyrosyl‑tRNA synthetase (EC 6.1.1.1)/decarboxylase, putative |
| ? | AssemblyC74_contig_22 | = 4386 | 229 (0.700) | intergenic (‑126/‑12) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Transposase/hypothetical protein | |||||
| * | ? | AssemblyC74_contig_1 | = 377987 | 67 (0.170) | 351 (0.970) | 91/254 | 0.1 | 68.9% | intergenic (+151/‑140) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Tyrosyl‑tRNA synthetase (EC 6.1.1.1)/decarboxylase, putative |
| ? | AssemblyC74_contig_22 | 2888 = | 250 (0.760) | intergenic (+101/+80) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein/Transposase | |||||
| * | ? | AssemblyC74_contig_1 | 443129 = | 304 (0.760) | 193 (0.530) | 56/244 | 2.2 | 56.9% | intergenic (+258/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | Conserved hypothetical protein ArsC related/– |
| ? | AssemblyC74_contig_11 | = 78782 | 0 (0.000) | coding (62/66 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_1 | 443402 = | 1145 (2.870) | 239 (0.670) | 65/254 | 1.3 | 29.4% | intergenic (+531/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | Conserved hypothetical protein ArsC related/– |
| ? | AssemblyC74_contig_6 | = 168934 | 0 (0.000) | intergenic (+543/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Phosphate regulon sensor protein PhoR (SphS) (EC 2.7.13.3)/– | |||||
| * | ? | AssemblyC74_contig_1 | = 443528 | 11 (0.030) | 2376 (1.700) +C |
162/252 | 0.0 | 99.8% | intergenic (+657/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | Conserved hypothetical protein ArsC related/– |
| ? | AssemblyC74_contig_39 | = 1643 | 0 (0.000) | intergenic (‑5/–) | rasttk_feature_creation_tool=RNA_reps_SSU_rRNA/– | SSU rRNA ## 16S rRNA, small subunit ribosomal RNA/– | |||||
| * | ? | AssemblyC74_contig_10 | = 98564 | 0 (0.000) | 250 (0.570) | 65/254 | 1.1 | 100% | intergenic (‑281/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– |
| ? | AssemblyC74_contig_50 | 1 = | 0 (0.000) | intergenic (–/‑113) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Aggregation promoting factor | |||||
| * | ? | AssemblyC74_contig_11 | 1 = | 0 (0.000) | 358 (0.400) | 102/254 | 0.1 | 100% | intergenic (–/‑1) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Alcohol dehydrogenase (EC 1.1.1.1) |
| ? | AssemblyC74_contig_45 | = 1002 | 0 (0.000) | intergenic (‑96/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Integrase, catalytic region/– | |||||
| * | ? | AssemblyC74_contig_12 | 58967 = | 448 (1.140) | 128 (1.190) | 28/70 | 0.1 | 67.5% | coding (371/672 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| ? | AssemblyC74_contig_12 | = 59245 | 0 (0.000) | coding (93/672 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog | |||||
| * | ? | AssemblyC74_contig_12 | 59059 = | 208 (0.530) | 640 (1.730) +ATCCTG |
71/242 | 1.2 | 80.0% | coding (279/672 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| ? | AssemblyC74_contig_18 | 27021 = | 127 (0.330) | coding (2179/2232 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_12 | = 59276 | 41 (0.100) | 251 (0.650) | 66/254 | 2.0 | 92.5% | coding (62/672 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| ? | AssemblyC74_contig_18 | = 27075 | 0 (0.000) | intergenic (+1/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– | |||||
| * | ? | AssemblyC74_contig_13 | = 46240 | 0 (0.000) | 204 (0.640) | 60/254 | 1.5 | 56.0% | intergenic (‑38/–) | rasttk_feature_creation_tool=tRNAscan‑SE/– | tRNA‑Ser‑GGA/– |
| ? | AssemblyC74_contig_8 | = 1721 | 321 (0.910) | intergenic (+1/+137) | rasttk_feature_creation_tool=tRNAscan‑SE/rasttk_feature_annotation_tool=annotate_proteins_si milarity | tRNA‑Asn‑GTT/FIG00629206: hypothetical protein | |||||
| * | ? | AssemblyC74_contig_14 | = 41348 | 0 (0.000) | 301 (0.630) | 89/254 | 0.1 | 100% | coding (927/927 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Phage endopeptidase |
| ? | AssemblyC74_contig_33 | 1 = | 0 (0.000) | coding (1/972 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_15 | 1 = | 0 (0.000) | 279 (0.690) | 71/254 | 0.6 | 100% | intergenic (–/+1116) | –/rasttk_feature_annotation_tool=elepa@bvbrc | –/hypothetical protein |
| ? | AssemblyC74_contig_52 | = 702 | 0 (0.000) | intergenic (+23/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Putative transposase InsK for insertion sequence element IS150/– | |||||
| * | ? | AssemblyC74_contig_15 | 32682 = | 641 (2.240) | 191 (0.740) | 71/252 | 0.3 | 33.4% | coding (1059/1284 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Mobile element protein |
| ? | AssemblyC74_contig_30 | 32 = | 125 (0.550) | coding (32/252 nt) | rasttk_feature_annotation_tool=annotate_proteins_si milarity | Mobile element protein | |||||
| * | ? | AssemblyC74_contig_15 | = 36007 | 0 (0.000) | 231 (0.550) | 78/254 | 0.3 | 100% | intergenic (+1/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | FIG00632365: hypothetical protein/– |
| ? | AssemblyC74_contig_37 | = 1750 | 0 (0.000) | intergenic (‑2/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | FIG00632365: hypothetical protein/– | |||||
| * | ? | AssemblyC74_contig_16 | 35042 = | NA (NA) | 125 (0.440) +G |
44/252 | 3.0 | 100% | intergenic (+88/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– |
| ? | AssemblyC74_contig_4 | = 189292 | 0 (0.000) | intergenic (+1/–) | rasttk_feature_annotation_tool=elepa@bvbrc/– | hypothetical protein/– | |||||
| * | ? | AssemblyC74_contig_17 | 1 = | 0 (0.000) | 309 (0.600) | 77/254 | 0.7 | 100% | intergenic (–/‑262) | –/rasttk_feature_annotation_tool=annotate_proteins_si milarity | –/Protein of unknown function DUF421 |
| ? | AssemblyC74_contig_57 | 1 = | 0 (0.000) | intergenic (–/+1) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Mobile element protein | |||||
| * | ? | AssemblyC74_contig_19 | = 19031 | 0 (0.000) | 309 (0.830) | 73/254 | 0.6 | 100% | intergenic (+109/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | Phage lysin, N‑acetylmuramoyl‑L‑alanine amidase (EC 3.5.1.28)/– |
| ? | AssemblyC74_contig_53 | = 622 | 0 (0.000) | coding (1/498 nt) | rasttk_feature_annotation_tool=annotate_proteins_si milarity | Mobile element protein | |||||
| * | ? | AssemblyC74_contig_20 | 1 = | 0 (0.000) | 339 (0.660) | 80/254 | 0.5 | 100% | intergenic (–/+131) | –/rasttk_feature_annotation_tool=annotate_proteins_si milarity | –/Mobile element protein |
| ? | AssemblyC74_contig_57 | = 493 | 0 (0.000) | coding (1/492 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Mobile element protein | |||||
| * | ? | AssemblyC74_contig_20 | = 15862 | 0 (0.000) | 262 (0.290) +40 bp |
63/174 | 0.3 | 100% | intergenic (+12/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Glutathione peroxidase (EC 1.11.1.9) @ Thioredoxin peroxidase (EC 1.11.1.15)/– |
| ? | AssemblyC74_contig_31 | = 3396 | 0 (0.000) | noncoding (118/118 nt) | rasttk_feature_creation_tool=RNA_reps_5S_rRNA | 5S rRNA # 5S ribosomal RNA ‑ 3 prime truncation | |||||
| * | ? | AssemblyC74_contig_21 | 1 = | 0 (0.000) | 226 (0.480) | 68/254 | 0.7 | 100% | intergenic (–/+243) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Sucrose operon repressor ScrR, LacI family |
| ? | AssemblyC74_contig_57 | 1 = | 0 (0.000) | intergenic (–/+1) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Mobile element protein | |||||
| * | ? | AssemblyC74_contig_21 | = 10843 | 0 (0.000) | 277 (0.600) | 71/254 | 0.6 | 100% | intergenic (+54/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Mobile element protein/– |
| ? | AssemblyC74_contig_49 | = 764 | 0 (0.000) | intergenic (+2/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Mobile element protein/– | |||||
| * | ? | AssemblyC74_contig_23 | 1 = | 0 (0.000) | 263 (0.550) | 76/254 | 0.4 | 100% | coding (237/237 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Mobile element protein |
| ? | AssemblyC74_contig_57 | = 493 | 0 (0.000) | coding (1/492 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Mobile element protein | |||||
| * | ? | AssemblyC74_contig_23 | = 9396 | 0 (0.000) | 257 (0.560) | 76/254 | 0.4 | 100% | intergenic (+36/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | DNA‑directed RNA polymerase beta subunit (EC 2.7.7.6)/– |
| ? | AssemblyC74_contig_49 | 1 = | 0 (0.000) | intergenic (–/‑111) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Mobile element protein | |||||
| * | ? | AssemblyC74_contig_24 | 1 = | 0 (0.000) | 271 (0.840) +CTGATGTGTCCGT |
68/228 | 0.8 | 57.4% | coding (1/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein |
| ? | AssemblyC74_contig_24 | = 215 | 448 (1.240) | coding (215/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_24 | 1 = | 0 (0.000) | 170 (0.830) +57 bp |
56/140 | 0.1 | 100% | coding (1/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein |
| ? | AssemblyC74_contig_7 | = 152772 | 0 (0.000) | intergenic (+1/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– | |||||
| * | ? | AssemblyC74_contig_24 | 255 = | 457 (1.270) | 25 (0.370) +103 bp |
11/48 | 1.1 | 23.5% | coding (255/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein |
| ? | AssemblyC74_contig_24 | = 265 | 406 (1.130) | coding (265/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_26 | 1 = | 0 (0.000) | 265 (0.420) | 73/254 | 1.1 | 100% | intergenic (–/‑20) | –/rasttk_feature_creation_tool=tRNAscan‑SE | –/tRNA‑Pro‑TGG |
| ? | AssemblyC74_contig_54 | = 611 | 0 (0.000) | intergenic (+1/–) | rasttk_feature_creation_tool=tRNAscan‑SE/– | tRNA‑Arg‑ACG/– | |||||
| * | ? | AssemblyC74_contig_27 | 1 = | 0 (0.000) | 246 (0.600) | 71/254 | 0.4 | 100% | intergenic (–/‑26) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Undecaprenyl‑phosphate galactosephosphotransferase (EC 2.7.8.6) |
| ? | AssemblyC74_contig_37 | 1 = | 0 (0.000) | intergenic (–/‑435) | –/rasttk_feature_annotation_tool=elepa@bvbrc | –/hypothetical protein | |||||
| * | ? | AssemblyC74_contig_27 | 7574 = | 257 (0.990) | 240 (0.640) | 59/234 | 0.7 | 67.0% | coding (551/705 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | UDP‑N‑acetylglucosamine 2‑epimerase (EC 5.1.3.14) |
| ? | AssemblyC74_contig_37 | 11 = | 0 (0.000) | intergenic (–/‑425) | –/rasttk_feature_annotation_tool=elepa@bvbrc | –/hypothetical protein | |||||
| * | ? | AssemblyC74_contig_27 | = 7726 | 0 (0.000) | 246 (0.670) +CG |
71/250 | 0.4 | 100% | coding (703/705 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | UDP‑N‑acetylglucosamine 2‑epimerase (EC 5.1.3.14) |
| ? | AssemblyC74_contig_41 | = 1330 | 0 (0.000) | coding (1/411 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | UDP‑N‑acetylglucosamine 2‑epimerase (EC 5.1.3.14) | |||||
| * | ? | AssemblyC74_contig_27 | = 7728 | 0 (0.000) | 225 (0.600) | 68/254 | 0.5 | 100% | coding (705/705 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | UDP‑N‑acetylglucosamine 2‑epimerase (EC 5.1.3.14) |
| ? | AssemblyC74_contig_41 | = 1330 | 0 (0.000) | coding (1/411 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | UDP‑N‑acetylglucosamine 2‑epimerase (EC 5.1.3.14) | |||||
| * | ? | AssemblyC74_contig_28 | 1 = | 0 (0.000) | 330 (0.380) | 92/254 | 0.1 | 100% | intergenic (–/‑81) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/hypothetical protein |
| ? | AssemblyC74_contig_45 | = 1002 | 0 (0.000) | intergenic (‑96/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Integrase, catalytic region/– | |||||
| * | ? | AssemblyC74_contig_28 | = 5975 | 0 (0.000) | 291 (1.150) | 88/254 | 0.0 | 71.8% | intergenic (+36/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | YoeB toxin protein/– |
| ? | AssemblyC74_contig_30 | = 330 | 229 (0.990) | intergenic (+78/+111) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Mobile element protein/hypothetical protein | |||||
| * | ? | AssemblyC74_contig_29 | = 4892 | 0 (0.000) | 234 (0.720) | 52/248 | 2.0 | 59.4% | intergenic (‑397/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | ABC‑type antimicrobial peptide transport system, permease component/– |
| ? | AssemblyC74_contig_8 | = 1721 | 320 (0.930) | intergenic (+1/+137) | rasttk_feature_creation_tool=tRNAscan‑SE/rasttk_feature_annotation_tool=annotate_proteins_si milarity | tRNA‑Asn‑GTT/FIG00629206: hypothetical protein | |||||
| * | ? | AssemblyC74_contig_3 | 1 = | 0 (0.000) | 255 (0.590) | 70/254 | 0.7 | 100% | intergenic (–/‑221) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Universal stress protein family |
| ? | AssemblyC74_contig_50 | 1 = | 0 (0.000) | intergenic (–/‑113) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Aggregation promoting factor | |||||
| * | ? | AssemblyC74_contig_3 | = 255127 | 0 (0.000) | 191 (0.220) | 72/254 | 0.6 | 100% | intergenic (‑345/–) | rasttk_feature_annotation_tool=elepa@bvbrc/– | hypothetical protein/– |
| ? | AssemblyC74_contig_45 | = 1002 | 0 (0.000) | intergenic (‑96/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Integrase, catalytic region/– | |||||
| * | ? | AssemblyC74_contig_30 | = 330 | 229 (0.990) | 238 (0.970) | 73/254 | 0.2 | 67.5% | intergenic (+78/+111) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Mobile element protein/hypothetical protein |
| ? | AssemblyC74_contig_36 | = 1754 | 0 (0.000) | intergenic (+133/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– | |||||
| * | ? | AssemblyC74_contig_31 | 1 = | 0 (0.000) | 1254 (0.550) +AGTGT |
134/244 | 0.8 | 100% | intergenic (–/‑269) | –/rasttk_feature_creation_tool=RNA_reps_LSU_rRNA | –/LSU rRNA ## 23S rRNA, large subunit ribosomal RNA |
| ? | AssemblyC74_contig_39 | 1 = | 0 (0.000) | intergenic (–/+65) | –/rasttk_feature_creation_tool=RNA_reps_SSU_rRNA | –/SSU rRNA ## 16S rRNA, small subunit ribosomal RNA | |||||
| * | ? | AssemblyC74_contig_31 | 1 = | 0 (0.000) | 452 (0.380) +TTTAACAACTAATGTTGTT |
72/216 | 0.2 | 72.8% | intergenic (–/‑269) | –/rasttk_feature_creation_tool=RNA_reps_LSU_rRNA | –/LSU rRNA ## 23S rRNA, large subunit ribosomal RNA |
| ? | AssemblyC74_contig_63 | = 176 | 397 (0.810) | intergenic (+2/‑26) | rasttk_feature_creation_tool=tRNAscan‑SE/rasttk_feature_creation_tool=tRNAscan‑SE | tRNA‑Ala‑TGC/tRNA‑Met‑CAT | |||||
| * | ? | AssemblyC74_contig_31 | = 3396 | 0 (0.000) | 303 (0.330) +40 bp |
62/174 | 0.3 | 100% | noncoding (118/118 nt) | rasttk_feature_creation_tool=RNA_reps_5S_rRNA | 5S rRNA # 5S ribosomal RNA ‑ 3 prime truncation |
| ? | AssemblyC74_contig_5 | = 185954 | 0 (0.000) | intergenic (‑299/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | Cof protein:HAD‑superfamily hydrolase, subfamily IIB/– | |||||
| * | ? | AssemblyC74_contig_31 | = 3396 | 0 (0.000) | 843 (0.520) | 127/254 | 0.1 | 100% | noncoding (118/118 nt) | rasttk_feature_creation_tool=RNA_reps_5S_rRNA | 5S rRNA # 5S ribosomal RNA ‑ 3 prime truncation |
| ? | AssemblyC74_contig_54 | 1 = | 0 (0.000) | intergenic (–/‑13) | –/rasttk_feature_creation_tool=tRNAscan‑SE | –/tRNA‑Val‑TAC | |||||
| * | ? | AssemblyC74_contig_31 | = 3396 | 0 (0.000) | 513 (0.410) +TGATGTT |
84/240 | 0.3 | 79.7% | noncoding (118/118 nt) | rasttk_feature_creation_tool=RNA_reps_5S_rRNA | 5S rRNA # 5S ribosomal RNA ‑ 3 prime truncation |
| ? | AssemblyC74_contig_8 | 1645 = | 277 (0.780) | intergenic (‑212/‑2) | rasttk_feature_creation_tool=tRNAscan‑SE/rasttk_feature_creation_tool=tRNAscan‑SE | tRNA‑Thr‑GGT/tRNA‑Asn‑GTT | |||||
| * | ? | AssemblyC74_contig_32 | 1 = | 0 (0.000) | 151 (0.540) +C |
44/252 | 2.4 | 100% | intergenic (–/+1197) | –/rasttk_feature_annotation_tool=annotate_proteins_si milarity | –/Programmed cell death toxin MazF |
| ? | AssemblyC74_contig_40 | = 62 | NA (NA) | intergenic (–/+119) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Cold shock protein of CSP family | |||||
| * | ? | AssemblyC74_contig_32 | = 3311 | 0 (0.000) | 259 (0.720) | 73/254 | 0.3 | 100% | intergenic (+202/–) | rasttk_feature_annotation_tool=elepa@bvbrc/– | hypothetical protein/– |
| ? | AssemblyC74_contig_53 | = 622 | 0 (0.000) | coding (1/498 nt) | rasttk_feature_annotation_tool=annotate_proteins_si milarity | Mobile element protein | |||||
| * | ? | AssemblyC74_contig_33 | 1 = | 0 (0.000) | 386 (0.750) | 97/254 | 0.1 | 100% | coding (1/972 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein |
| ? | AssemblyC74_contig_8 | = 115683 | 0 (0.000) | coding (1791/1791 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Phage capsid and scaffold | |||||
| * | ? | AssemblyC74_contig_33 | = 3075 | 0 (0.000) | 294 (0.620) | 93/254 | 0.1 | 100% | intergenic (+2/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– |
| ? | AssemblyC74_contig_4 | 1 = | 0 (0.000) | intergenic (–/‑2) | –/rasttk_feature_annotation_tool=annotate_proteins_si milarity | –/Phage lysin, N‑acetylmuramoyl‑L‑alanine amidase (EC 3.5.1.28) | |||||
| * | ? | AssemblyC74_contig_33 | = 3075 | 0 (0.000) | 388 (0.780) | 100/254 | 0.1 | 100% | intergenic (+2/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– |
| ? | AssemblyC74_contig_6 | 1 = | 0 (0.000) | intergenic (–/‑63) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/hypothetical protein | |||||
| * | ? | AssemblyC74_contig_34 | 1 = | 0 (0.000) | 276 (0.630) | 89/254 | 0.0 | 100% | intergenic (–/+363) | –/rasttk_feature_creation_tool=tRNAscan‑SE | –/tRNA‑Leu‑CAG |
| ? | AssemblyC74_contig_50 | = 745 | 0 (0.000) | intergenic (+8/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Aggregation promoting factor/– | |||||
| * | ? | AssemblyC74_contig_34 | 2046 = | 123 (0.430) | 145 (0.590) +T |
37/252 | 2.7 | 70.4% | intergenic (‑223/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | PaaD‑like protein (DUF59) involved in Fe‑S cluster assembly/– |
| ? | AssemblyC74_contig_35 | 1 = | 0 (0.000) | intergenic (–/+1) | –/rasttk_feature_annotation_tool=annotate_proteins_si milarity | –/Co‑activator of prophage gene expression IbrA | |||||
| * | ? | AssemblyC74_contig_34 | 2046 = | 123 (0.430) | 118 (0.500) +T |
32/252 | 1.0 | 65.9% | intergenic (‑223/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | PaaD‑like protein (DUF59) involved in Fe‑S cluster assembly/– |
| ? | AssemblyC74_contig_56 | 1 = | 0 (0.000) | intergenic (–/+1) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Co‑activator of prophage gene expression IbrA | |||||
| * | ? | AssemblyC74_contig_34 | = 2107 | 0 (0.000) | 1814 (1.310) | 122/254 | 0.0 | 100% | intergenic (‑284/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | PaaD‑like protein (DUF59) involved in Fe‑S cluster assembly/– |
| ? | AssemblyC74_contig_42 | = 1243 | 0 (0.000) | intergenic (‑13/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Mobile element protein/– | |||||
| * | ? | AssemblyC74_contig_36 | 1 = | 0 (0.000) | 236 (0.600) | 72/254 | 0.2 | 100% | intergenic (–/‑369) | –/rasttk_feature_annotation_tool=elepa@bvbrc | –/hypothetical protein |
| ? | AssemblyC74_contig_64 | = 352 | 0 (0.000) | intergenic (+1/–) | rasttk_feature_annotation_tool=elepa@bvbrc/– | hypothetical protein/– | |||||
| * | ? | AssemblyC74_contig_37 | = 1750 | 0 (0.000) | 265 (0.660) +AAAAAGT |
79/240 | 1.0 | 100% | intergenic (‑2/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | FIG00632365: hypothetical protein/– |
| ? | AssemblyC74_contig_62 | 1 = | 0 (0.000) | intergenic (–/‑1) | –/rasttk_feature_annotation_tool=annotate_proteins_si milarity | –/Mobile element protein | |||||
| * | ? | AssemblyC74_contig_38 | = 1652 | 0 (0.000) | 202 (0.520) | 69/254 | 0.3 | 100% | intergenic (+2/–) | rasttk_feature_annotation_tool=elepa@bvbrc/– | hypothetical protein/– |
| ? | AssemblyC74_contig_46 | = 883 | 0 (0.000) | intergenic (+235/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– | |||||
| * | ? | AssemblyC74_contig_38 | = 1652 | 0 (0.000) | 119 (0.300) | 48/254 | 0.5 | 100% | intergenic (+2/–) | rasttk_feature_annotation_tool=elepa@bvbrc/– | hypothetical protein/– |
| ? | AssemblyC74_contig_59 | = 453 | 0 (0.000) | intergenic (+197/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Transposase, IS4/– | |||||
| * | ? | AssemblyC74_contig_39 | 1 = | 0 (0.000) | 307 (0.210) | 63/250 | 0.9 | 68.7% | intergenic (–/+65) | –/rasttk_feature_creation_tool=RNA_reps_SSU_rRNA | –/SSU rRNA ## 16S rRNA, small subunit ribosomal RNA |
| ? | AssemblyC74_contig_63 | 93 = | 280 (0.580) | intergenic (+11/‑9) | rasttk_feature_creation_tool=tRNAscan‑SE/rasttk_feature_creation_tool=tRNAscan‑SE | tRNA‑Pro‑TGG/tRNA‑Ala‑TGC | |||||
| * | ? | AssemblyC74_contig_40 | 1 = | 0 (0.000) | 749 (0.850) | 120/254 | 0.0 | 100% | intergenic (–/+180) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Cold shock protein of CSP family |
| ? | AssemblyC74_contig_45 | 1 = | 0 (0.000) | coding (906/906 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Integrase, catalytic region | |||||
| * | ? | AssemblyC74_contig_40 | = 1604 | 0 (0.000) | 252 (0.610) | 72/254 | 0.6 | 100% | intergenic (‑113/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– |
| ? | AssemblyC74_contig_52 | = 702 | 0 (0.000) | intergenic (+23/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Putative transposase InsK for insertion sequence element IS150/– | |||||
| * | ? | AssemblyC74_contig_41 | 1 = | 0 (0.000) | 285 (0.720) | 81/254 | 0.1 | 100% | intergenic (–/+2) | –/rasttk_feature_annotation_tool=elepa@bvbrc | –/hypothetical protein |
| ? | AssemblyC74_contig_47 | 1 = | 0 (0.000) | intergenic (–/‑1) | –/rasttk_feature_annotation_tool=elepa@bvbrc | –/hypothetical protein | |||||
| * | ? | AssemblyC74_contig_41 | 1 = | 0 (0.000) | 326 (0.820) | 81/254 | 0.0 | 100% | intergenic (–/+2) | –/rasttk_feature_annotation_tool=elepa@bvbrc | –/hypothetical protein |
| ? | AssemblyC74_contig_51 | 1 = | 0 (0.000) | intergenic (–/‑1) | –/rasttk_feature_annotation_tool=annotate_proteins_si milarity | –/Conserved domain protein | |||||
| * | ? | AssemblyC74_contig_41 | = 246 | 264 (0.540) | 262 (0.530) | 71/254 | 2.5 | 50.0% | intergenic (‑7/+105) | rasttk_feature_annotation_tool=elepa@bvbrc/rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein/hypothetical protein |
| ? | AssemblyC74_contig_41 | 250 = | 261 (0.530) | intergenic (‑11/+101) | rasttk_feature_annotation_tool=elepa@bvbrc/rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein/hypothetical protein | |||||
| * | ? | AssemblyC74_contig_43 | 1 = | 0 (0.000) | 328 (0.620) | 89/254 | 0.1 | 100% | coding (1215/1215 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein |
| ? | AssemblyC74_contig_44 | = 1136 | 0 (0.000) | coding (1/1134 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_43 | 971 = | 275 (0.780) | 253 (0.940) | 55/212 | 0.3 | 68.8% | coding (245/1215 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein |
| ? | AssemblyC74_contig_48 | 22 = | 0 (0.000) | coding (21/843 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Chitinase (EC 3.2.1.14) | |||||
| * | ? | AssemblyC74_contig_43 | 992 = | 231 (0.660) | 560 (1.160) | 92/254 | 0.0 | 82.9% | coding (224/1215 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein |
| ? | AssemblyC74_contig_61 | = 423 | 0 (0.000) | intergenic (‑1/–) | rasttk_feature_annotation_tool=elepa@bvbrc/– | hypothetical protein/– | |||||
| * | ? | AssemblyC74_contig_43 | = 1217 | 0 (0.000) | 907 (1.760) | 80/246 | 0.2 | 73.7% | intergenic (‑2/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– |
| ? | AssemblyC74_contig_44 | 617 = | 647 (0.940) | coding (520/1134 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_44 | 1 = | 0 (0.000) | 282 (0.580) | 77/254 | 0.7 | 100% | intergenic (–/+2) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/hypothetical protein |
| ? | AssemblyC74_contig_65 | = 349 | 0 (0.000) | intergenic (‑1/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– | |||||
| * | ? | AssemblyC74_contig_44 | 1 = | 0 (0.000) | 286 (0.560) | 65/254 | 0.6 | 100% | intergenic (–/+2) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/hypothetical protein |
| ? | AssemblyC74_contig_66 | 1 = | 0 (0.000) | intergenic (–/‑1) | –/rasttk_feature_annotation_tool=elepa@bvbrc | –/hypothetical protein | |||||
| * | ? | AssemblyC74_contig_44 | = 810 | 668 (0.940) | 207 (0.520) +GCACTCTTGTCACCATCAAT |
53/214 | 1.4 | 42.4% | coding (327/1134 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein |
| ? | AssemblyC74_contig_60 | = 439 | 0 (0.000) | coding (438/438 nt) | rasttk_feature_annotation_tool=annotate_proteins_si milarity | FIG00630508: hypothetical protein | |||||
| * | ? | AssemblyC74_contig_44 | = 1136 | 0 (0.000) | 270 (0.540) | 69/254 | 0.2 | 100% | coding (1/1134 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein |
| ? | AssemblyC74_contig_48 | = 844 | 0 (0.000) | coding (843/843 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Chitinase (EC 3.2.1.14) | |||||
| * | ? | AssemblyC74_contig_45 | = 1002 | 0 (0.000) | 322 (0.360) | 82/254 | 0.1 | 100% | intergenic (‑96/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Integrase, catalytic region/– |
| ? | AssemblyC74_contig_55 | 1 = | 0 (0.000) | intergenic (–/–) | –/– | –/– | |||||
| * | ? | AssemblyC74_contig_45 | = 1002 | 0 (0.000) | 347 (0.400) | 87/254 | 0.2 | 100% | intergenic (‑96/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Integrase, catalytic region/– |
| ? | AssemblyC74_contig_9 | 1 = | 0 (0.000) | intergenic (–/+1) | –/rasttk_feature_annotation_tool=annotate_proteins_si milarity | –/Transcriptional regulator SpxA1 | |||||
| * | ? | AssemblyC74_contig_47 | 421 = | NA (NA) | 273 (1.010) +GCATTCATAGAA |
67/230 | 0.2 | NA | coding (420/879 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein |
| ? | AssemblyC74_contig_47 | = 561 | NA (NA) | coding (560/879 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_47 | 452 = | NA (NA) | 416 (1.250) +34 bp |
76/186 | 0.0 | 100% | noncoding (7/29 nt) | direct | CRISPR repeat with sequence actatcgatgtaagtaattgggatacgtc |
| ? | AssemblyC74_contig_61 | 1 = | 0 (0.000) | intergenic (–/+2) | –/rasttk_feature_annotation_tool=elepa@bvbrc | –/hypothetical protein | |||||
| * | ? | AssemblyC74_contig_47 | 487 = | NA (NA) | 171 (0.410) +CTTGTAACATTT |
39/230 | 2.0 | 79.4% | coding (486/879 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein |
| ? | AssemblyC74_contig_61 | 22 = | 49 (0.080) | coding (401/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_47 | = 622 | NA (NA) | 103 (0.270) +GATACGTCAAATGTTACGAA |
35/214 | 2.1 | 27.8% | noncoding (21/29 nt) | direct | CRISPR repeat with sequence agtgtagatgtaagtaattggaatacgtc |
| ? | AssemblyC74_contig_61 | = 87 | 318 (0.520) | coding (336/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_47 | 730 = | NA (NA) | 212 (0.460) | 64/254 | 0.5 | 100% | coding (729/879 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein |
| ? | AssemblyC74_contig_61 | 1 = | 0 (0.000) | intergenic (–/+2) | –/rasttk_feature_annotation_tool=elepa@bvbrc | –/hypothetical protein | |||||
| * | ? | AssemblyC74_contig_47 | = 882 | NA (NA) | 133 (0.510) | 45/254 | 1.8 | 42.8% | intergenic (+2/–) | rasttk_feature_annotation_tool=elepa@bvbrc/– | hypothetical protein/– |
| ? | AssemblyC74_contig_60 | 100 = | 178 (0.780) | coding (99/438 nt) | rasttk_feature_annotation_tool=annotate_proteins_si milarity | FIG00630508: hypothetical protein | |||||
| * | ? | AssemblyC74_contig_49 | 1 = | 0 (0.000) | 360 (0.760) | 73/254 | 0.3 | 100% | intergenic (–/‑111) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Mobile element protein |
| ? | AssemblyC74_contig_55 | = 585 | 0 (0.000) | intergenic (–/–) | –/– | –/– | |||||
| * | ? | AssemblyC74_contig_49 | = 764 | 0 (0.000) | 241 (0.540) | 74/254 | 0.0 | 100% | intergenic (+2/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Mobile element protein/– |
| ? | AssemblyC74_contig_59 | 1 = | 0 (0.000) | intergenic (–/‑31) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Transposase, IS4 | |||||
| * | ? | AssemblyC74_contig_50 | = 745 | 0 (0.000) | 303 (0.690) | 85/254 | 0.2 | 100% | intergenic (+8/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | Aggregation promoting factor/– |
| ? | AssemblyC74_contig_9 | = 104617 | 0 (0.000) | intergenic (+75/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | Putative deoxyribonuclease YcfH/– | |||||
| * | ? | AssemblyC74_contig_51 | = 723 | 0 (0.000) | 209 (0.450) | 63/254 | 0.2 | 56.8% | intergenic (+2/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | Conserved domain protein/– |
| ? | AssemblyC74_contig_61 | = 87 | 318 (0.520) | coding (336/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_52 | 1 = | 0 (0.000) | 243 (0.500) | 71/254 | 0.9 | 100% | intergenic (–/‑1) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Putative transposase InsK for insertion sequence element IS150 |
| ? | AssemblyC74_contig_53 | 1 = | 0 (0.000) | intergenic (–/+2) | –/rasttk_feature_annotation_tool=annotate_proteins_si milarity | –/Mobile element protein | |||||
| * | ? | AssemblyC74_contig_54 | = 611 | 0 (0.000) | 397 (0.570) | 91/254 | 0.1 | 100% | intergenic (+1/–) | rasttk_feature_creation_tool=tRNAscan‑SE/– | tRNA‑Arg‑ACG/– |
| ? | AssemblyC74_contig_63 | 1 = | 0 (0.000) | intergenic (–/‑8) | –/rasttk_feature_creation_tool=tRNAscan‑SE | –/tRNA‑Pro‑TGG | |||||
| * | ? | AssemblyC74_contig_62 | = 391 | 0 (0.000) | 241 (0.590) | 71/254 | 0.3 | 100% | intergenic (+213/–) | rasttk_feature_annotation_tool=annotate_proteins_si milarity/– | Mobile element protein/– |
| ? | AssemblyC74_contig_64 | = 352 | 0 (0.000) | intergenic (+1/–) | rasttk_feature_annotation_tool=elepa@bvbrc/– | hypothetical protein/– | |||||
| * | ? | AssemblyC74_contig_64 | 1 = | 0 (0.000) | 514 (1.240) | 85/254 | 0.0 | 100% | coding (1/351 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein |
| ? | AssemblyC74_contig_66 | = 349 | 0 (0.000) | coding (348/348 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_7 | 44664 = | 368 (0.950) | 197 (1.180) +72 bp |
28/110 | 1.5 | 52.7% | intergenic (‑383/+120) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | N‑acetylglucosamine‑1‑phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine‑1‑phosphate N‑acetyltransferase (EC 2.3.1.157)/Pur operon repressor PurR |
| ? | AssemblyC74_contig_7 | = 44712 | 448 (1.160) | intergenic (‑431/+72) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | N‑acetylglucosamine‑1‑phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine‑1‑phosphate N‑acetyltransferase (EC 2.3.1.157)/Pur operon repressor PurR | |||||