mutation predictions | marginal predictions | summary statistics | genome diff | command line log
|
breseq version 0.29.0 revision 8f9c342918e4
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Predicted mutations | ||||||
|---|---|---|---|---|---|---|
| evidence | position | mutation | freq | annotation | gene | description |
| RA | 107,553 | (T)9→8 | 100% | intergenic (+79/‑152) | lpxC → / → secM | UDP‑3‑O‑acyl N‑acetylglucosamine deacetylase/regulator of secA translation |
| RA | 281,599 | C→T | 63.8% | G129S (GGC→AGC) | yagA ← | CP4‑6 prophage; putative DNA‑binding transcriptional regulator |
| RA | 380,022 | (G)10→9 | 100% | intergenic (‑141/+47) | frmR ← / ← yaiO | regulator protein that represses frmRAB operon/outer membrane protein |
| RA | 410,479 | A→G | 100% | S112S (TCA→TCG) | mak → | manno(fructo)kinase |
| RA | 460,106 | A→T | 51.9% | I407F (ATC→TTC) | lon → | DNA‑binding ATP‑dependent protease La |
| RA | 953,802 | A→G | 100% | V222A (GTA→GCA) | focA ← | formate channel |
| RA | 1,077,116 | T→C | 53.5% | E589E (GAA→GAG) | putA ← | fused DNA‑binding transcriptional regulator/proline dehydrogenase/pyrroline‑5‑carboxylate dehydrogenase |
| RA | 1,143,641 | G→A | 100% | H243Y (CAT→TAT) | rne ← | endoribonuclease; RNA‑binding protein;RNA degradosome binding protein |
| RA | 1,146,997 | G→A | 55.0% | T68T (ACG→ACA) | yceD → | DUF177 family protein |
| RA | 1,246,073 | C→T | 100% | G435D (GGC→GAC) | treA ← | periplasmic trehalase |
| RA | 1,489,197 | C→T | 100% | D322D (GAC→GAT) | aldA → | aldehyde dehydrogenase A, NAD‑linked |
| RA | 1,554,731 | C→T | 50.9% | M313I (ATG→ATA) | maeA ← | malate dehydrogenase, decarboxylating, NAD‑requiring; malic enzyme |
| RA | 1,755,639 | G→A | 100% | intergenic (‑498/‑59) | ydhZ ← / → pykF | uncharacterized protein/pyruvate kinase I |
| RA | 1,799,488 | C→T | 18.1% | V88I (GTT→ATT) | rplT ← | 50S ribosomal subunit protein L20 |
| RA | 1,803,104 | A→G | 20.6% | pseudogene (11/426 nt) | arpB → | pseudogene, ankyrin repeats |
| RA | 1,835,622 | G→A | 32.8% | R36R (CGG→CGA) | ynjA → | carboxymuconolactone decarboxylase family protein |
| RA | 1,868,250 | A→G | 100% | Y448C (TAC→TGC) | yeaG → | protein kinase, endogenous substrate unidentified; autokinase |
| RA | 1,950,296:1 | +C | 16.7% | coding (227/1773 nt) | aspS ← | aspartyl‑tRNA synthetase |
| RA | 1,950,302 | Δ1 bp | 16.9% | coding (221/1773 nt) | aspS ← | aspartyl‑tRNA synthetase |
| RA | 1,950,306 | C→G | 18.3% | G73R (GGC→CGC) | aspS ← | aspartyl‑tRNA synthetase |
| JC JC | 1,979,486 | IS5 (+) +4 bp | 100% | intergenic (‑271/‑264) | insA ← / → uspC | IS1 repressor TnpA/universal stress protein |
| RA | 2,018,260 | (A)8→7 | 100% | coding (315/444 nt) | fliJ → | flagellar protein |
| RA | 2,173,363 | Δ2 bp | 100% | intergenic (‑1/+1) | gatC ← / ← gatC | pseudogene, galactitol‑specific enzyme IIC component of PTS;transport; Transport of small molecules: Carbohydrates, organic acids, alcohols; PTS system galactitol‑specific enzyme IIC/pseudogene, galactitol‑specific enzyme IIC component of PTS;transport; Transport of small molecules: Carbohydrates, organic acids, alcohols; PTS system galactitol‑specific enzyme IIC |
| RA | 2,326,925:1 | (C)6→7 | 100% | coding (817/1185 nt) | atoB → | acetyl‑CoA acetyltransferase |
| RA | 2,470,410 | (T)7→6 | 100% | coding (1280/1332 nt) | gtrS → | serotype‑specific glucosyl transferase, CPS‑53 (KpLE1) prophage |
| RA | 2,516,689 | T→C | 100% | T382A (ACG→GCG) | yfeA ← | putative diguanylate cyclase |
| RA | 2,652,855:1 | (G)6→7 | 100% | coding (362/846 nt) | sseA → | 3‑mercaptopyruvate sulfurtransferase |
| RA | 2,731,312 | G→A | 100% | intergenic (‑155/+288) | rrsG ← / ← clpB | 16S ribosomal RNA of rrnG operon/protein disaggregation chaperone |
| RA | 2,776,420 | T→C | 15.0% | V12A (GTA→GCA) | yfjY → | CP4‑57 prophage; putative DNA repair protein |
| RA | 2,866,592:1 | +C | 100% | coding (960/993 nt) | rpoS ← | RNA polymerase, sigma S (sigma 38) factor |
| RA | 2,966,582 | C→T | 27.2% | G618D (GGC→GAC) | ptsP ← | PEP‑protein phosphotransferase enzyme I; GAF domain containing protein |
| RA | 3,008,075 | A→G | 100% | D189G (GAC→GGC) | ygeX → | 2,3‑diaminopropionate ammonia lyase, PLP‑dependent |
| RA | 3,194,516 | A→G | 100% | K551K (AAA→AAG) | yqiK → | PHB family membrane protein, function unknown |
| RA | 3,227,143 | A→G | 16.2% | T304A (ACC→GCC) | ygjI → | putative transporter |
| RA | 3,277,706 | (A)7→6 | 100% | coding (370/465 nt) | yhaV → | toxin of the SohB(PrlF)‑YhaV toxin‑antitoxin system |
| RA | 3,352,673 | T→C | 100% | E118G (GAA→GGA) | arcB ← | aerobic respiration control sensor histidine protein kinase, cognate to two‑component response regulators ArcA and RssB |
| RA | 3,379,266:1 | (C)7→8 | 100% | coding (732/1128 nt) | zapE ← | divisome ATPase |
| RA | 3,411,299 | T→C | 100% | V10A (GTA→GCA) | fis → | global DNA‑binding transcriptional dual regulator |
| RA | 3,542,503 | G→A | 59.3% | W699* (TGG→TGA) | feoB → | ferrous iron transporter protein B and GTP‑binding protein; membrane protein |
| RA | 3,542,842 | C→T | 15.4% | Q39* (CAA→TAA) | feoC → | putative DNA‑binding transcriptional regulator |
| RA | 3,560,455:1 | +G | 100% | intergenic (‑2/+1) | glpR ← / ← glpR | pseudogene, DNA‑binding transcriptional repressor;regulator; Energy metabolism, carbon: Anaerobic respiration; repressor of the glp operon/pseudogene, DNA‑binding transcriptional repressor;regulator; Energy metabolism, carbon: Anaerobic respiration; repressor of the glp operon |
| MC JC | 3,582,206 | Δ1,222 bp | 100% | IS1‑mediated | [yhhZ]–yrhA | [yhhZ], yrhA |
| JC | 3,596,220 | (TCA)3→2 | 61.9% | coding (182‑184/927 nt) | livH ← | branched‑chain amino acid ABC transporter permease |
| RA | 3,648,144 | (T)7→6 | 100% | intergenic (‑356/‑384) | dinQ ← / → arsR | UV‑inducible membrane toxin, DinQ‑AgrB type I toxin‑antitoxin system/arsenical resistance operon transcriptional repressor; autorepressor |
| MC JC | 3,815,859 | Δ82 bp | 100% | [rph]–[rph] | [rph], [rph] | |
| RA | 3,951,598:1 | +T | 35.8% | pseudogene (57/663 nt) | ilvG → | pseudogene, acetolactate synthase 2 large subunit, valine‑insensitive; acetolactate synthase II, large subunit, cryptic, interrupted |
| RA | 3,966,720 | C→T | 54.7% | R102C (CGC→TGC) | rho → | transcription termination factor |
| RA | 4,121,879 | Δ1 bp | 49.5% | coding (409/531 nt) | hslV ← | peptidase component of the HslUV protease |
| RA | 4,121,880 | Δ1 bp | 49.5% | coding (408/531 nt) | hslV ← | peptidase component of the HslUV protease |
| RA | 4,215,178 | Δ1 bp | 29.9% | coding (899/930 nt) | metA → | homoserine O‑transsuccinylase |
| RA | 4,296,060 | C→T | 100% | intergenic (+266/+376) | gltP → / ← yjcO | glutamate/aspartate:proton symporter/Sel1 family TPR‑like repeat protein |
| RA | 4,296,381:1 | +GC | 100% | intergenic (+587/+55) | gltP → / ← yjcO | glutamate/aspartate:proton symporter/Sel1 family TPR‑like repeat protein |
| RA | 4,337,024 | G→A | 100% | S3L (TCG→TTG) | adiC ← | arginine:agmatine antiporter |
| RA | 4,370,616 | A→G | 56.8% | intergenic (‑204/‑72) | yjeH ← / → groS | putative transporter/Cpn10 chaperonin GroES, small subunit of GroESL |
| RA | 4,397,557 | G→T | 100% | G49V (GGT→GTT) | mutL → | methyl‑directed mismatch repair protein |
| RA | 4,410,053 | (T)9→8 | 100% | intergenic (+47/‑80) | rlmB → / → yjfI | 23S rRNA mG2251 2'‑O‑ribose methyltransferase, SAM‑dependent/DUF2170 family protein |
| RA | 4,465,236 | C→T | 50.4% | P315P (CCG→CCA) | treB ← | trehalose‑specific PTS enzyme: IIB and IIC component |
| RA | 4,494,883:1 | (A)7→8 | 100% | coding (261/564 nt) | idnK → | D‑gluconate kinase, thermosensitive |
| RA | 4,573,528 | A→G | 100% | pseudogene (1115/1503 nt) | yjiT → | pseudogene |
| RA | 4,638,193:1 | (C)6→7 | 100% | coding (16/1353 nt) | creD → | inner membrane protein |
| Unassigned missing coverage evidence | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | NC_000913 | 3423731–3424586 | 3424586 | 1–856 | 49 [48] | [48] 49 | [rrfD]–[rrlD] | [rrfD], [rrlD] |
| * | * | ÷ | NC_000913 | 3762318–3764074 | 3765215–3764077 | 4–2898 | 50 [48] | [46] 49 | rhsA | Rhs protein with putative toxin 55 domain; putative polysaccharide synthesis/export protein; putative neighboring cell growth inhibitor |
| Unassigned new junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | = 16583 | NA (NA) | 5 (0.060) | 4/168 | NT | NA | noncoding (1197/1345 nt) | IS186 | repeat region |
| ? | NC_000913 | = 16604 | NA (NA) | noncoding (1218/1345 nt) | IS186 | repeat region | |||||
| * | ? | NC_000913 | = 50326 | NA (NA) | 3 (0.040) | 3/164 | NT | NA | intergenic (+24/+54) | folA/apaH | dihydrofolate reductase/diadenosine tetraphosphatase |
| ? | NC_000913 | = 50359 | NA (NA) | noncoding (33/37 nt) | REP5 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP5 (repetitive extragenic palindromic) element; contains 1 REP sequences | |||||
| * | ? | NC_000913 | 72136 = | NA (NA) | 6 (0.070) | 6/164 | NT | NA | noncoding (1/85 nt) | REP7 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP7 (repetitive extragenic palindromic) element; contains 2 REP sequences |
| ? | NC_000913 | 72169 = | NA (NA) | noncoding (34/85 nt) | REP7 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP7 (repetitive extragenic palindromic) element; contains 2 REP sequences | |||||
| * | ? | NC_000913 | = 224027 | NA (NA) | 4 (0.050) | 3/166 | NT | NA | noncoding (257/1542 nt) | rrsH | 16S ribosomal RNA of rrnH operon |
| ? | NC_000913 | = 224038 | NA (NA) | noncoding (268/1542 nt) | rrsH | 16S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | 224059 = | NA (NA) | 16 (0.200) | 8/164 | NT | NA | noncoding (289/1542 nt) | rrsH | 16S ribosomal RNA of rrnH operon |
| ? | NC_000913 | 224082 = | NA (NA) | noncoding (312/1542 nt) | rrsH | 16S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | = 224065 | NA (NA) | 8 (0.100) | 3/164 | NT | NA | noncoding (295/1542 nt) | rrsH | 16S ribosomal RNA of rrnH operon |
| ? | NC_000913 | = 224074 | NA (NA) | noncoding (304/1542 nt) | rrsH | 16S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | = 224374 | NA (NA) | 5 (0.060) | 4/164 | NT | NA | noncoding (604/1542 nt) | rrsH | 16S ribosomal RNA of rrnH operon |
| ? | NC_000913 | = 224403 | NA (NA) | noncoding (633/1542 nt) | rrsH | 16S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | 225078 = | NA (NA) | 19 (0.240) | 8/164 | NT | NA | noncoding (1308/1542 nt) | rrsH | 16S ribosomal RNA of rrnH operon |
| ? | NC_000913 | 225100 = | NA (NA) | noncoding (1330/1542 nt) | rrsH | 16S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | = 225084 | NA (NA) | 16 (0.200) | 7/164 | NT | NA | noncoding (1314/1542 nt) | rrsH | 16S ribosomal RNA of rrnH operon |
| ? | NC_000913 | = 225092 | NA (NA) | noncoding (1322/1542 nt) | rrsH | 16S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | 225154 = | NA (NA) | 12 (0.150) | 7/168 | NT | NA | noncoding (1384/1542 nt) | rrsH | 16S ribosomal RNA of rrnH operon |
| ? | NC_000913 | 225176 = | NA (NA) | noncoding (1406/1542 nt) | rrsH | 16S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | 225889 = | NA (NA) | 16 (0.200) | 10/164 | NT | NA | noncoding (131/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon |
| ? | NC_000913 | 225907 = | NA (NA) | noncoding (149/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | = 225998 | NA (NA) | 8 (0.100) | 6/170 | NT | NA | noncoding (240/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon |
| ? | NC_000913 | = 226015 | NA (NA) | noncoding (257/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | 226704 = | NA (NA) | 4 (0.050) | 4/170 | NT | NA | noncoding (946/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon |
| ? | NC_000913 | 226730 = | NA (NA) | noncoding (972/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | = 226707 | 0 (0.000) | 25 (0.300) | 13/170 | NT | 100% | noncoding (949/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon |
| ? | NC_000913 | = 226725 | NA (NA) | noncoding (967/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | 227242 = | NA (NA) | 8 (0.100) | 4/166 | NT | NA | noncoding (1484/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon |
| ? | NC_000913 | 227264 = | NA (NA) | noncoding (1506/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | = 227444 | NA (NA) | 8 (0.100) | 7/168 | NT | NA | noncoding (1686/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon |
| ? | NC_000913 | = 227459 | NA (NA) | noncoding (1701/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | 228016 = | NA (NA) | 12 (0.150) | 10/164 | NT | NA | noncoding (2258/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon |
| ? | NC_000913 | 228041 = | NA (NA) | noncoding (2283/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | = 228108 | NA (NA) | 6 (0.070) | 5/170 | NT | NA | noncoding (2350/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon |
| ? | NC_000913 | = 228124 | NA (NA) | noncoding (2366/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | = 228224 | NA (NA) | 7 (0.090) | 6/166 | NT | NA | noncoding (2466/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon |
| ? | NC_000913 | = 228241 | NA (NA) | noncoding (2483/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | = 257907 | 0 (0.000) | 71 (0.900) | 49/162 | NT | 100% | intergenic (+8/‑769) | crl/crl | pseudogene, sigma factor‑binding protein, RNA polymerase holoenzyme formation stimulator;regulator; Surface structures; transcriptional regulator of cryptic csgA gene for curli surface fibers/pseudogene, sigma factor‑binding protein, RNA polymerase holoenzyme formation stimulator;regulator; Surface structures; transcriptional regulator of cryptic csgA gene for curli surface fibers |
| ? | NC_000913 | 258684 = | 0 (0.000) | pseudogene (9/331 nt) | crl | pseudogene, sigma factor‑binding protein, RNA polymerase holoenzyme formation stimulator;regulator; Surface structures; transcriptional regulator of cryptic csgA gene for curli surface fibers | |||||
| * | ? | NC_000913 | 271440 = | NA (NA) | 4 (0.050) | 4/164 | NT | NA | noncoding (900/1221 nt) | IS30 | repeat region |
| ? | NC_000913 | 271463 = | NA (NA) | noncoding (923/1221 nt) | IS30 | repeat region | |||||
| * | ? | NC_000913 | = 274213 | NA (NA) | 17 (0.210) | 10/168 | NT | NA | noncoding (937/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | = 274218 | NA (NA) | noncoding (932/1195 nt) | IS5 | repeat region | |||||
| * | ? | NC_000913 | 274525 = | NA (NA) | 6 (0.070) | 5/164 | NT | NA | noncoding (625/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | 274559 = | NA (NA) | noncoding (591/1195 nt) | IS5 | repeat region | |||||
| * | ? | NC_000913 | 274620 = | NA (NA) | 10 (0.130) | 8/160 | NT | NA | noncoding (530/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | 274663 = | NA (NA) | noncoding (487/1195 nt) | IS5 | repeat region | |||||
| * | ? | NC_000913 | = 274695 | NA (NA) | 5 (0.060) | 4/170 | NT | NA | noncoding (455/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | = 274727 | NA (NA) | noncoding (423/1195 nt) | IS5 | repeat region | |||||
| * | ? | NC_000913 | 274965 = | NA (NA) | 10 (0.120) | 6/172 | NT | NA | noncoding (185/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | 274991 = | NA (NA) | noncoding (159/1195 nt) | IS5 | repeat region | |||||
| * | ? | NC_000913 | = 275007 | NA (NA) | 15 (0.180) | 9/172 | NT | NA | noncoding (143/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | = 275025 | NA (NA) | noncoding (125/1195 nt) | IS5 | repeat region | |||||
| * | ? | NC_000913 | = 315520 | NA (NA) | 3 (0.040) | 3/164 | NT | NA | noncoding (292/1255 nt) | IS3 | repeat region |
| ? | NC_000913 | = 315537 | NA (NA) | noncoding (309/1255 nt) | IS3 | repeat region | |||||
| * | ? | NC_000913 | = 315572 | NA (NA) | 8 (0.100) | 5/158 | NT | NA | noncoding (344/1255 nt) | IS3 | repeat region |
| ? | NC_000913 | = 315588 | NA (NA) | noncoding (360/1255 nt) | IS3 | repeat region | |||||
| * | ? | NC_000913 | = 315852 | NA (NA) | 12 (0.140) | 8/170 | NT | NA | noncoding (624/1255 nt) | IS3 | repeat region |
| ? | NC_000913 | = 315875 | NA (NA) | noncoding (647/1255 nt) | IS3 | repeat region | |||||
| * | ? | NC_000913 | 315892 = | NA (NA) | 5 (0.060) | 3/172 | NT | NA | noncoding (664/1255 nt) | IS3 | repeat region |
| ? | NC_000913 | 315923 = | NA (NA) | noncoding (695/1255 nt) | IS3 | repeat region | |||||
| * | ? | NC_000913 | 315991 = | NA (NA) | 10 (0.120) | 6/170 | NT | NA | noncoding (763/1255 nt) | IS3 | repeat region |
| ? | NC_000913 | 316014 = | NA (NA) | noncoding (786/1255 nt) | IS3 | repeat region | |||||
| * | ? | NC_000913 | = 316201 | NA (NA) | 10 (0.130) | 5/160 | NT | NA | noncoding (973/1255 nt) | IS3 | repeat region |
| ? | NC_000913 | = 316220 | NA (NA) | noncoding (992/1255 nt) | IS3 | repeat region | |||||
| * | ? | NC_000913 | 361887 = | NA (NA) | 6 (0.070) | 5/164 | NT | NA | noncoding (5/34 nt) | REP30 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP30 (repetitive extragenic palindromic) element; contains 1 REP sequences |
| ? | NC_000913 | 361917 = | NA (NA) | intergenic (‑57/+9) | lacA/lacY | thiogalactoside acetyltransferase/lactose permease | |||||
| * | ? | NC_000913 | 377335 = | NA (NA) | 9 (0.110) | 4/164 | NT | NA | noncoding (1/187 nt) | REP32 (repetitive extragenic palindromic) element; contains 4 REP sequences | REP32 (repetitive extragenic palindromic) element; contains 4 REP sequences |
| ? | NC_000913 | 377368 = | NA (NA) | noncoding (34/187 nt) | REP32 (repetitive extragenic palindromic) element; contains 4 REP sequences | REP32 (repetitive extragenic palindromic) element; contains 4 REP sequences | |||||
| * | ? | NC_000913 | 381663 = | NA (NA) | 7 (0.090) | 5/164 | NT | NA | noncoding (404/1331 nt) | IS2 | repeat region |
| ? | NC_000913 | 381703 = | NA (NA) | noncoding (444/1331 nt) | IS2 | repeat region | |||||
| * | ? | NC_000913 | = 381669 | NA (NA) | 10 (0.120) | 6/164 | NT | NA | noncoding (410/1331 nt) | IS2 | repeat region |
| ? | NC_000913 | = 381695 | NA (NA) | noncoding (436/1331 nt) | IS2 | repeat region | |||||
| * | ? | NC_000913 | = 381837 | NA (NA) | 5 (0.060) | 4/166 | NT | NA | noncoding (578/1331 nt) | IS2 | repeat region |
| ? | NC_000913 | = 381852 | NA (NA) | noncoding (593/1331 nt) | IS2 | repeat region | |||||
| * | ? | NC_000913 | = 381910 | NA (NA) | 13 (0.160) | 7/166 | NT | NA | noncoding (651/1331 nt) | IS2 | repeat region |
| ? | NC_000913 | = 381923 | NA (NA) | noncoding (664/1331 nt) | IS2 | repeat region | |||||
| * | ? | NC_000913 | = 382211 | NA (NA) | 20 (0.240) | 11/168 | NT | NA | noncoding (952/1331 nt) | IS2 | repeat region |
| ? | NC_000913 | = 382218 | NA (NA) | noncoding (959/1331 nt) | IS2 | repeat region | |||||
| * | ? | NC_000913 | 382282 = | NA (NA) | 5 (0.060) | 3/166 | NT | NA | noncoding (1023/1331 nt) | IS2 | repeat region |
| ? | NC_000913 | 382313 = | NA (NA) | noncoding (1054/1331 nt) | IS2 | repeat region | |||||
| * | ? | NC_000913 | = 382287 | NA (NA) | 3 (0.040) | 3/166 | NT | NA | noncoding (1028/1331 nt) | IS2 | repeat region |
| ? | NC_000913 | = 382306 | NA (NA) | noncoding (1047/1331 nt) | IS2 | repeat region | |||||
| * | ? | NC_000913 | 409056 = | NA (NA) | 6 (0.070) | 5/164 | NT | NA | noncoding (5/37 nt) | REP34 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP34 (repetitive extragenic palindromic) element; contains 1 REP sequences |
| ? | NC_000913 | 409089 = | NA (NA) | intergenic (+139/+19) | ykiA/rdgC | pseudogene/nucleoid‑associated ssDNA and dsDNA binding protein; competitive inhibitor of RecA function | |||||
| * | ? | NC_000913 | 474269 = | NA (NA) | 4 (0.050) | 3/166 | NT | NA | intergenic (+17/+32) | amtB/tesB | ammonium transporter/acyl‑CoA thioesterase 2 |
| ? | NC_000913 | 474296 = | NA (NA) | intergenic (+44/+5) | amtB/tesB | ammonium transporter/acyl‑CoA thioesterase 2 | |||||
| * | ? | NC_000913 | = 526253 | NA (NA) | 3 (0.040) | 3/168 | NT | 100% | coding (2993/4281 nt) | rhsD | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor |
| ? | NC_000913 | = 526279 | 0 (0.000) | coding (3019/4281 nt) | rhsD | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor | |||||
| * | ? | NC_000913 | 632112 = | NA (NA) | 4 (0.070) +31 bp |
3/116 | NT | NA | intergenic (+113/‑70) | cstA/ybdD | carbon starvation protein involved in peptide utilization; APC peptide transporter family protein/DUF466 family protein |
| ? | NC_000913 | 4344813 = | NA (NA) | intergenic (+23/+116) | melB/yjdF | melibiose:sodium symporter/DUF2238 family inner membrane protein | |||||
| * | ? | NC_000913 | = 705938 | NA (NA) | 4 (0.050) | 3/166 | NT | NA | intergenic (+48/‑155) | nagE/glnS | N‑acetyl glucosamine specific PTS enzyme IIC, IIB, and IIA components/glutamyl‑tRNA synthetase |
| ? | NC_000913 | = 705965 | NA (NA) | intergenic (+75/‑128) | nagE/glnS | N‑acetyl glucosamine specific PTS enzyme IIC, IIB, and IIA components/glutamyl‑tRNA synthetase | |||||
| * | ? | NC_000913 | = 729987 | NA (NA) | 6 (0.070) | 3/168 | NT | NA | coding (405/4194 nt) | rhsC | Rhs protein with putative toxin domain; putative neighboring cell growth inhibitor |
| ? | NC_000913 | = 730012 | NA (NA) | coding (430/4194 nt) | rhsC | Rhs protein with putative toxin domain; putative neighboring cell growth inhibitor | |||||
| * | ? | NC_000913 | = 730045 | NA (NA) | 4 (0.050) | 3/168 | NT | NA | coding (463/4194 nt) | rhsC | Rhs protein with putative toxin domain; putative neighboring cell growth inhibitor |
| ? | NC_000913 | = 730067 | NA (NA) | coding (485/4194 nt) | rhsC | Rhs protein with putative toxin domain; putative neighboring cell growth inhibitor | |||||
| * | ? | NC_000913 | 734797 = | 48 (0.550) | 9 (0.110) | 3/168 | NT | 28.4% | pseudogene (665/1521 nt) | rhsO | pseudogene, Rhs family |
| ? | NC_000913 | 3622561 = | 0 (0.000) | coding (3370/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor | |||||
| * | ? | NC_000913 | 786696 = | NA (NA) | 6 (0.070) | 3/166 | NT | NA | intergenic (+11/+147) | aroG/gpmA | 3‑deoxy‑D‑arabino‑heptulosonate‑7‑phosphate synthase, phenylalanine repressible/phosphoglyceromutase 1 |
| ? | NC_000913 | 786726 = | NA (NA) | intergenic (+41/+117) | aroG/gpmA | 3‑deoxy‑D‑arabino‑heptulosonate‑7‑phosphate synthase, phenylalanine repressible/phosphoglyceromutase 1 | |||||
| * | ? | NC_000913 | 805804 = | NA (NA) | 4 (0.050) | 4/164 | NT | NA | noncoding (1/178 nt) | REP72 (repetitive extragenic palindromic) element; contains 4 REP sequences | REP72 (repetitive extragenic palindromic) element; contains 4 REP sequences |
| ? | NC_000913 | 805836 = | NA (NA) | noncoding (33/178 nt) | REP72 (repetitive extragenic palindromic) element; contains 4 REP sequences | REP72 (repetitive extragenic palindromic) element; contains 4 REP sequences | |||||
| * | ? | NC_000913 | = 805951 | NA (NA) | 5 (0.060) | 5/164 | NT | NA | noncoding (148/178 nt) | REP72 (repetitive extragenic palindromic) element; contains 4 REP sequences | REP72 (repetitive extragenic palindromic) element; contains 4 REP sequences |
| ? | NC_000913 | = 805981 | NA (NA) | noncoding (178/178 nt) | REP72 (repetitive extragenic palindromic) element; contains 4 REP sequences | REP72 (repetitive extragenic palindromic) element; contains 4 REP sequences | |||||
| * | ? | NC_000913 | 832307 = | NA (NA) | 4 (0.050) | 3/164 | NT | NA | noncoding (19/98 nt) | RIP75 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | RIP75 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site |
| ? | NC_000913 | 2714290 = | NA (NA) | noncoding (8/98 nt) | RIP188 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | RIP188 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | |||||
| * | ? | NC_000913 | 937227 = | NA (NA) | 4 (0.050) | 3/162 | NT | NA | noncoding (4/36 nt) | REP85 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP85 (repetitive extragenic palindromic) element; contains 1 REP sequences |
| ? | NC_000913 | 937261 = | NA (NA) | intergenic (+48/‑111) | ftsK/lolA | DNA translocase at septal ring sorting daughter chromsomes/lipoprotein chaperone | |||||
| * | ? | NC_000913 | 1187036 = | NA (NA) | 3 (0.040) | 3/168 | NT | NA | coding (1193/1227 nt) | pepT | peptidase T |
| ? | NC_000913 | 1187066 = | NA (NA) | coding (1223/1227 nt) | pepT | peptidase T | |||||
| * | ? | NC_000913 | 1207790 = | 40 (0.460) | 11 (0.150) | 11/146 | NT | 25.7% | coding (290/630 nt) | stfP | e14 prophage; uncharacterized protein |
| ? | NC_000913 | 1209619 = | 31 (0.440) | pseudogene (1/501 nt) | stfE | pseudogene, e14 prophage; side tail fiber protein fragment family;Phage or Prophage Related | |||||
| * | ? | NC_000913 | = 1207805 | 42 (0.480) | 19 (0.270) | 15/146 | NT | 36.8% | coding (305/630 nt) | stfP | e14 prophage; uncharacterized protein |
| ? | NC_000913 | = 1209602 | 31 (0.440) | pseudogene (18/501 nt) | stfE | pseudogene, e14 prophage; side tail fiber protein fragment family;Phage or Prophage Related | |||||
| * | ? | NC_000913 | = 1299498 | 0 (0.000) | 75 (0.900) | 53/170 | NT | 100% | intergenic (+253/‑1684) | ychE/oppA | UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein |
| ? | NC_000913 | 1300698 = | 0 (0.000) | intergenic (+1453/‑484) | ychE/oppA | UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein | |||||
| * | ? | NC_000913 | = 1357753 | NA (NA) | 8 (0.100) | 6/160 | NT | NA | intergenic (‑85/+49) | ymjA/puuP | DUF2543 family protein/putrescine importer |
| ? | NC_000913 | = 1357792 | NA (NA) | noncoding (23/30 nt) | REP111 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP111 (repetitive extragenic palindromic) element; contains 1 REP sequences | |||||
| * | ? | NC_000913 | = 1432761 | NA (NA) | 7 (0.080) | 5/170 | NT | NA | coding (351/576 nt) | tfaR | Rac prophage; putative tail fiber assembly protein |
| ? | NC_000913 | = 1432785 | NA (NA) | coding (375/576 nt) | tfaR | Rac prophage; putative tail fiber assembly protein | |||||
| * | ? | NC_000913 | 1665136 = | NA (NA) | 5 (0.070) | 3/156 | NT | NA | noncoding (1/31 nt) | REP125 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP125 (repetitive extragenic palindromic) element; contains 1 REP sequences |
| ? | NC_000913 | 1665167 = | NA (NA) | intergenic (+47/‑148) | dmsD/clcB | twin‑argninine leader‑binding protein for DmsA and TorA/H(+)/Cl(‑) exchange transporter | |||||
| * | ? | NC_000913 | 1852545 = | NA (NA) | 3 (0.040) | 3/156 | NT | NA | intergenic (+17/+76) | pncA/ydjE | nicotinamidase/pyrazinamidase/putative MFS sugar transporter, membrane protein |
| ? | NC_000913 | 1852562 = | NA (NA) | noncoding (1/36 nt) | REP132 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP132 (repetitive extragenic palindromic) element; contains 1 REP sequences | |||||
| * | ? | NC_000913 | 1929923 = | NA (NA) | 6 (0.070) | 5/172 | NT | NA | noncoding (1/84 nt) | REP135 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP135 (repetitive extragenic palindromic) element; contains 2 REP sequences |
| ? | NC_000913 | 1929955 = | NA (NA) | noncoding (33/84 nt) | REP135 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP135 (repetitive extragenic palindromic) element; contains 2 REP sequences | |||||
| * | ? | NC_000913 | = 1978502 | 0 (0.000) | 89 (1.130) | 58/162 | NT | 100% | intergenic (‑305/+16) | flhD/insB1 | flagellar class II regulon transcriptional activator, with FlhC/IS1 transposase B |
| ? | NC_000913 | 1979279 = | 0 (0.000) | intergenic (‑64/‑474) | insA/uspC | IS1 repressor TnpA/universal stress protein | |||||
| * | ? | NC_000913 | = 2066832 | 0 (0.000) | 11 (0.140) | 8/160 | NT | 100% | noncoding (522/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | = 2066857 | NA (NA) | noncoding (497/1195 nt) | IS5 | repeat region | |||||
| * | ? | NC_000913 | = 2139701 | NA (NA) | 5 (0.060) | 4/164 | NT | NA | intergenic (+216/+58) | yegH/asmA | inner membrane protein/suppressor of OmpF assembly mutants; putative outer membrane protein assembly factor; inner membrane‑anchored periplasmic protein |
| ? | NC_000913 | = 2139734 | NA (NA) | noncoding (33/37 nt) | REP146 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP146 (repetitive extragenic palindromic) element; contains 1 REP sequences | |||||
| * | ? | NC_000913 | 2139728 = | NA (NA) | 8 (0.100) | 4/164 | NT | NA | noncoding (27/37 nt) | REP146 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP146 (repetitive extragenic palindromic) element; contains 1 REP sequences |
| ? | NC_000913 | = 4229405 | NA (NA) | noncoding (30/70 nt) | REP312 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP312 (repetitive extragenic palindromic) element; contains 2 REP sequences | |||||
| * | ? | NC_000913 | 2232736 = | NA (NA) | 3 (0.040) | 3/166 | NT | NA | noncoding (1/34 nt) | REP155 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP155 (repetitive extragenic palindromic) element; contains 1 REP sequences |
| ? | NC_000913 | 2232766 = | NA (NA) | noncoding (31/34 nt) | REP155 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP155 (repetitive extragenic palindromic) element; contains 1 REP sequences | |||||
| * | ? | NC_000913 | 2393131 = | NA (NA) | 6 (0.070) | 6/164 | NT | NA | noncoding (1/36 nt) | REP166 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP166 (repetitive extragenic palindromic) element; contains 1 REP sequences |
| ? | NC_000913 | 2393163 = | NA (NA) | noncoding (33/36 nt) | REP166 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP166 (repetitive extragenic palindromic) element; contains 1 REP sequences | |||||
| * | ? | NC_000913 | = 2440342 | NA (NA) | 10 (0.120) | 6/166 | NT | NA | intergenic (‑222/+43) | yfcJ/fabB | putative arabinose efflux transporter/3‑oxoacyl‑[acyl‑carrier‑protein] synthase I |
| ? | NC_000913 | = 2440374 | NA (NA) | noncoding (32/36 nt) | REP170 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP170 (repetitive extragenic palindromic) element; contains 1 REP sequences | |||||
| * | ? | NC_000913 | = 2539674 | NA (NA) | 10 (0.120) | 7/164 | NT | NA | intergenic (‑91/+43) | cysM/cysA | cysteine synthase B (O‑acetylserine sulfhydrolase B)/sulfate/thiosulfate transporter subunit |
| ? | NC_000913 | = 2539688 | NA (NA) | intergenic (‑105/+29) | cysM/cysA | cysteine synthase B (O‑acetylserine sulfhydrolase B)/sulfate/thiosulfate transporter subunit | |||||
| * | ? | NC_000913 | 2568185 = | NA (NA) | 7 (0.100) +ACCCGCTACACACCCCGCAG |
3/138 | NT | NA | noncoding (47/183 nt) | REP178 (repetitive extragenic palindromic) element; contains 4 REP sequences | REP178 (repetitive extragenic palindromic) element; contains 4 REP sequences |
| ? | NC_000913 | = 3217522 | NA (NA) | noncoding (89/89 nt) | REP229 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP229 (repetitive extragenic palindromic) element; contains 2 REP sequences | |||||
| * | ? | NC_000913 | 2617939 = | NA (NA) | 4 (0.050) | 4/164 | NT | NA | intergenic (+2/+136) | yfgD/hda | putative oxidoreductase/ATPase regulatory factor involved in DnaA inactivation |
| ? | NC_000913 | 2617967 = | NA (NA) | intergenic (+30/+108) | yfgD/hda | putative oxidoreductase/ATPase regulatory factor involved in DnaA inactivation | |||||
| * | ? | NC_000913 | = 2618037 | NA (NA) | 3 (0.040) | 3/166 | NT | NA | intergenic (+100/+38) | yfgD/hda | putative oxidoreductase/ATPase regulatory factor involved in DnaA inactivation |
| ? | NC_000913 | = 2618053 | NA (NA) | intergenic (+116/+22) | yfgD/hda | putative oxidoreductase/ATPase regulatory factor involved in DnaA inactivation | |||||
| * | ? | NC_000913 | 2726200 = | NA (NA) | 22 (0.270) | 8/166 | NT | NA | intergenic (‑12/+81) | rrfG/rrlG | 5S ribosomal RNA of rrnG operon/23S ribosomal RNA of rrnG operon |
| ? | NC_000913 | 2726224 = | NA (NA) | intergenic (‑36/+57) | rrfG/rrlG | 5S ribosomal RNA of rrnG operon/23S ribosomal RNA of rrnG operon | |||||
| * | ? | NC_000913 | 2727847 = | NA (NA) | 5 (0.060) | 5/170 | NT | NA | noncoding (1338/2904 nt) | rrlG | 23S ribosomal RNA of rrnG operon |
| ? | NC_000913 | 2727872 = | NA (NA) | noncoding (1313/2904 nt) | rrlG | 23S ribosomal RNA of rrnG operon | |||||
| * | ? | NC_000913 | 2729453 = | NA (NA) | 8 (0.100) | 6/158 | NT | 56.3% | intergenic (‑9/+163) | gltW/rrsG | tRNA‑Glu/16S ribosomal RNA of rrnG operon |
| ? | NC_000913 | 2729475 = | 7 (0.080) | intergenic (‑31/+141) | gltW/rrsG | tRNA‑Glu/16S ribosomal RNA of rrnG operon | |||||
| * | ? | NC_000913 | 2729955 = | NA (NA) | 10 (0.120) | 10/166 | NT | NA | noncoding (1203/1542 nt) | rrsG | 16S ribosomal RNA of rrnG operon |
| ? | NC_000913 | 2729972 = | NA (NA) | noncoding (1186/1542 nt) | rrsG | 16S ribosomal RNA of rrnG operon | |||||
| * | ? | NC_000913 | 2794028 = | NA (NA) | 5 (0.060) | 4/166 | NT | NA | noncoding (1/136 nt) | REP191 (repetitive extragenic palindromic) element; contains 3 REP sequences | REP191 (repetitive extragenic palindromic) element; contains 3 REP sequences |
| ? | NC_000913 | 2794059 = | NA (NA) | noncoding (32/136 nt) | REP191 (repetitive extragenic palindromic) element; contains 3 REP sequences | REP191 (repetitive extragenic palindromic) element; contains 3 REP sequences | |||||
| * | ? | NC_000913 | = 2794135 | NA (NA) | 3 (0.040) | 3/168 | NT | NA | noncoding (108/136 nt) | REP191 (repetitive extragenic palindromic) element; contains 3 REP sequences | REP191 (repetitive extragenic palindromic) element; contains 3 REP sequences |
| ? | NC_000913 | = 2794163 | NA (NA) | noncoding (136/136 nt) | REP191 (repetitive extragenic palindromic) element; contains 3 REP sequences | REP191 (repetitive extragenic palindromic) element; contains 3 REP sequences | |||||
| * | ? | NC_000913 | 2835067 = | NA (NA) | 4 (0.050) | 4/164 | NT | NA | noncoding (1/82 nt) | REP195 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP195 (repetitive extragenic palindromic) element; contains 2 REP sequences |
| ? | NC_000913 | 2835099 = | NA (NA) | noncoding (33/82 nt) | REP195 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP195 (repetitive extragenic palindromic) element; contains 2 REP sequences | |||||
| * | ? | NC_000913 | 2842423 = | NA (NA) | 4 (0.050) | 5/164 | NT | NA | noncoding (1/79 nt) | REP197 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP197 (repetitive extragenic palindromic) element; contains 2 REP sequences |
| ? | NC_000913 | 2842453 = | NA (NA) | noncoding (31/79 nt) | REP197 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP197 (repetitive extragenic palindromic) element; contains 2 REP sequences | |||||
| * | ? | NC_000913 | 3163644 = | NA (NA) | 3 (0.040) | 3/160 | NT | NA | noncoding (1/30 nt) | REP223 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP223 (repetitive extragenic palindromic) element; contains 1 REP sequences |
| ? | NC_000913 | 3163674 = | NA (NA) | intergenic (‑193/+41) | plsC/parC | 1‑acyl‑sn‑glycerol‑3‑phosphate acyltransferase/DNA topoisomerase IV, subunit A | |||||
| * | ? | NC_000913 | 3217434 = | NA (NA) | 8 (0.100) | 6/164 | NT | NA | noncoding (1/89 nt) | REP229 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP229 (repetitive extragenic palindromic) element; contains 2 REP sequences |
| ? | NC_000913 | 3217467 = | NA (NA) | noncoding (34/89 nt) | REP229 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP229 (repetitive extragenic palindromic) element; contains 2 REP sequences | |||||
| * | ? | NC_000913 | 3255175 = | NA (NA) | 4 (0.050) | 3/168 | NT | NA | coding (133/165 nt) | yhaL | uncharacterized protein |
| ? | NC_000913 | 3255206 = | NA (NA) | coding (164/165 nt) | yhaL | uncharacterized protein | |||||
| * | ? | NC_000913 | = 3423822 | 0 (0.000) | 16 (0.200) | 5/166 | NT | 100% | intergenic (‑35/+58) | rrfD/rrlD | 5S ribosomal RNA of rrnD operon/23S ribosomal RNA of rrnD operon |
| ? | NC_000913 | 4040506 = | NA (NA) | intergenic (+83/‑11) | rrlA/rrfA | 23S ribosomal RNA of rrnA operon/5S ribosomal RNA of rrnA operon | |||||
| * | ? | NC_000913 | 3470277 = | NA (NA) | 6 (0.070) | 3/164 | NT | NA | coding (1053/1185 nt) | tufA | translation elongation factor EF‑Tu 1 |
| ? | NC_000913 | 3470311 = | NA (NA) | coding (1019/1185 nt) | tufA | translation elongation factor EF‑Tu 1 | |||||
| * | ? | NC_000913 | 3546222 = | NA (NA) | 5 (0.060) | 3/166 | NT | NA | noncoding (1/36 nt) | REP253 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP253 (repetitive extragenic palindromic) element; contains 1 REP sequences |
| ? | NC_000913 | 3546254 = | NA (NA) | noncoding (33/36 nt) | REP253 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP253 (repetitive extragenic palindromic) element; contains 1 REP sequences | |||||
| * | ? | NC_000913 | 3547887 = | NA (NA) | 3 (0.040) | 3/164 | NT | NA | noncoding (1/87 nt) | REP254 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP254 (repetitive extragenic palindromic) element; contains 2 REP sequences |
| ? | NC_000913 | 3547917 = | NA (NA) | noncoding (31/87 nt) | REP254 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP254 (repetitive extragenic palindromic) element; contains 2 REP sequences | |||||
| * | ? | NC_000913 | = 3620116 | NA (NA) | 3 (0.040) | 3/166 | NT | 100% | coding (925/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor |
| ? | NC_000913 | = 3620152 | 0 (0.000) | coding (961/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor | |||||
| * | ? | NC_000913 | = 3620220 | NA (NA) | 4 (0.050) | 4/166 | NT | 100% | coding (1029/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor |
| ? | NC_000913 | = 3620255 | 0 (0.000) | coding (1064/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor | |||||
| * | ? | NC_000913 | 3620569 = | NA (NA) | 9 (0.110) | 4/166 | NT | 100% | coding (1378/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor |
| ? | NC_000913 | 3620582 = | 0 (0.000) | coding (1391/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor | |||||
| * | ? | NC_000913 | = 3620614 | NA (NA) | 11 (0.140) | 6/166 | NT | 100% | coding (1423/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor |
| ? | NC_000913 | = 3620635 | 0 (0.000) | coding (1444/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor | |||||
| * | ? | NC_000913 | 3622466 = | NA (NA) | 6 (0.070) | 4/170 | NT | 86.3% | coding (3275/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor |
| ? | NC_000913 | 3622497 = | 1 (0.010) | coding (3306/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor | |||||
| * | ? | NC_000913 | = 3625632 | NA (NA) | 3 (0.040) | 3/166 | NT | NA | noncoding (44/82 nt) | RIP260 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | RIP260 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site |
| ? | NC_000913 | = 3625670 | NA (NA) | noncoding (82/82 nt) | RIP260 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | RIP260 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | |||||
| * | ? | NC_000913 | 3754860 = | NA (NA) | 4 (0.050) | 3/164 | NT | NA | noncoding (1/82 nt) | REP270 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP270 (repetitive extragenic palindromic) element; contains 2 REP sequences |
| ? | NC_000913 | 3754890 = | NA (NA) | noncoding (31/82 nt) | REP270 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP270 (repetitive extragenic palindromic) element; contains 2 REP sequences | |||||
| * | ? | NC_000913 | 3898629 = | NA (NA) | 5 (0.060) | 4/162 | NT | NA | intergenic (+20/+42) | cbrC/yieK | UPF0167 family protein/putative 6‑phosphogluconolactonase |
| ? | NC_000913 | 3898659 = | NA (NA) | intergenic (+50/+12) | cbrC/yieK | UPF0167 family protein/putative 6‑phosphogluconolactonase | |||||
| * | ? | NC_000913 | = 3898636 | NA (NA) | 3 (0.040) | 3/162 | NT | NA | noncoding (6/26 nt) | REP282 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP282 (repetitive extragenic palindromic) element; contains 1 REP sequences |
| ? | NC_000913 | = 3898650 | NA (NA) | noncoding (20/26 nt) | REP282 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP282 (repetitive extragenic palindromic) element; contains 1 REP sequences | |||||
| * | ? | NC_000913 | 3908387 = | NA (NA) | 7 (0.090) | 5/164 | NT | NA | noncoding (1/64 nt) | REP283 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP283 (repetitive extragenic palindromic) element; contains 2 REP sequences |
| ? | NC_000913 | 3908412 = | NA (NA) | noncoding (26/64 nt) | REP283 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP283 (repetitive extragenic palindromic) element; contains 2 REP sequences | |||||
| * | ? | NC_000913 | = 3945985 | 23 (0.260) | 8 (0.100) | 4/164 | NT | 27.4% | noncoding (2282/2904 nt) | rrlC | 23S ribosomal RNA of rrnC operon |
| ? | NC_000913 | = 4039776 | NA (NA) | noncoding (2258/2905 nt) | rrlA | 23S ribosomal RNA of rrnA operon | |||||
| * | ? | NC_000913 | = 3946826 | NA (NA) | 20 (0.230) +G |
5/176 | NT | 16.3% | intergenic (+7/‑46) | rrfC/aspT | 5S ribosomal RNA of rrnC operon/tRNA‑Asp |
| ? | NC_000913 | = 4213198 | 104 (1.200) | intergenic (+39/‑36) | rrfE/yjaA | 5S ribosomal RNA of rrnE operon/stress‑induced protein | |||||
| * | ? | NC_000913 | = 4035244 | 18 (0.210) | 3 (0.040) | 3/168 | NT | 15.0% | intergenic (+91/‑287) | hemG/rrsA | protoporphyrin oxidase, flavoprotein/16S ribosomal RNA of rrnA operon |
| ? | NC_000913 | = 4035271 | NA (NA) | intergenic (+118/‑260) | hemG/rrsA | protoporphyrin oxidase, flavoprotein/16S ribosomal RNA of rrnA operon | |||||
| * | ? | NC_000913 | = 4132350 | NA (NA) | 5 (0.060) | 4/162 | NT | NA | noncoding (4/34 nt) | REP306 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP306 (repetitive extragenic palindromic) element; contains 1 REP sequences |
| ? | NC_000913 | = 4132380 | NA (NA) | noncoding (34/34 nt) | REP306 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP306 (repetitive extragenic palindromic) element; contains 1 REP sequences | |||||
| * | ? | NC_000913 | = 4249477 | NA (NA) | 6 (0.070) | 5/166 | NT | NA | intergenic (+166/‑77) | lamB/malM | maltose outer membrane porin (maltoporin)/maltose regulon periplasmic protein |
| ? | NC_000913 | = 4249481 | NA (NA) | intergenic (+170/‑73) | lamB/malM | maltose outer membrane porin (maltoporin)/maltose regulon periplasmic protein | |||||
| * | ? | NC_000913 | = 4254000 | NA (NA) | 4 (0.050) | 4/164 | NT | NA | noncoding (100/130 nt) | RIP317 (repetitive extragenic palindromic) element; contains 3 REP sequences and 1 IHF site | RIP317 (repetitive extragenic palindromic) element; contains 3 REP sequences and 1 IHF site |
| ? | NC_000913 | = 4254030 | NA (NA) | noncoding (130/130 nt) | RIP317 (repetitive extragenic palindromic) element; contains 3 REP sequences and 1 IHF site | RIP317 (repetitive extragenic palindromic) element; contains 3 REP sequences and 1 IHF site | |||||
| * | ? | NC_000913 | = 4285342 | NA (NA) | 3 (0.040) | 3/164 | NT | NA | noncoding (41/77 nt) | REP320 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP320 (repetitive extragenic palindromic) element; contains 2 REP sequences |
| ? | NC_000913 | = 4285374 | NA (NA) | noncoding (73/77 nt) | REP320 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP320 (repetitive extragenic palindromic) element; contains 2 REP sequences | |||||
| * | ? | NC_000913 | = 4295918 | 9 (0.100) | 5 (0.060) | 3/164 | NT | 37.6% | noncoding (84/600 nt) | RIP321 (repetitive extragenic palindromic) element; contains 11 REP sequences and 4 IHF sites | RIP321 (repetitive extragenic palindromic) element; contains 11 REP sequences and 4 IHF sites |
| ? | NC_000913 | = 4295934 | NA (NA) | noncoding (100/600 nt) | RIP321 (repetitive extragenic palindromic) element; contains 11 REP sequences and 4 IHF sites | RIP321 (repetitive extragenic palindromic) element; contains 11 REP sequences and 4 IHF sites | |||||
| * | ? | NC_000913 | = 4296060 | 26 (0.320) | 5 (0.060) | 3/164 | NT | 16.1% | noncoding (226/600 nt) | RIP321 (repetitive extragenic palindromic) element; contains 11 REP sequences and 4 IHF sites | RIP321 (repetitive extragenic palindromic) element; contains 11 REP sequences and 4 IHF sites |
| ? | NC_000913 | = 4296430 | NA (NA) | noncoding (596/600 nt) | RIP321 (repetitive extragenic palindromic) element; contains 11 REP sequences and 4 IHF sites | RIP321 (repetitive extragenic palindromic) element; contains 11 REP sequences and 4 IHF sites | |||||
| * | ? | NC_000913 | 4332016 = | NA (NA) | 3 (0.040) | 3/160 | NT | NA | noncoding (3/32 nt) | REP326 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP326 (repetitive extragenic palindromic) element; contains 1 REP sequences |
| ? | NC_000913 | 4332047 = | NA (NA) | intergenic (+43/‑69) | proP/pmrR | proline/glycine betaine transporter/putative membrane‑bound BasS regulator | |||||
| * | ? | NC_000913 | = 4386017 | NA (NA) | 6 (0.070) | 6/164 | NT | NA | coding (314/315 nt) | yjeO | inner membrane protein |
| ? | NC_000913 | = 4386039 | NA (NA) | intergenic (+21/+8) | yjeO/mscM | inner membrane protein/mechanosensitive channel protein, miniconductance | |||||
| * | ? | NC_000913 | = 4415961 | NA (NA) | 6 (0.070) | 3/166 | NT | NA | noncoding (4/34 nt) | REP332 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP332 (repetitive extragenic palindromic) element; contains 1 REP sequences |
| ? | NC_000913 | = 4415991 | NA (NA) | noncoding (34/34 nt) | REP332 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP332 (repetitive extragenic palindromic) element; contains 1 REP sequences | |||||
| * | ? | NC_000913 | 4415962 = | NA (NA) | 7 (0.090) | 6/166 | NT | NA | noncoding (5/34 nt) | REP332 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP332 (repetitive extragenic palindromic) element; contains 1 REP sequences |
| ? | NC_000913 | 4415992 = | NA (NA) | intergenic (+92/+25) | aidB/yjfN | DNA alkylation damage repair protein; flavin‑containing DNA binding protein, weak isovaleryl CoA dehydrogenase/DUF1471 family periplasmic protein | |||||
| * | ? | NC_000913 | = 4587878 | NA (NA) | 8 (0.100) | 6/162 | NT | NA | noncoding (7/27 nt) | REP348 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP348 (repetitive extragenic palindromic) element; contains 1 REP sequences |
| ? | NC_000913 | = 4587891 | NA (NA) | noncoding (20/27 nt) | REP348 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP348 (repetitive extragenic palindromic) element; contains 1 REP sequences | |||||
| * | ? | NC_000913 | 4606558 = | NA (NA) | 5 (0.060) | 4/164 | NT | NA | noncoding (1/92 nt) | REP351 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP351 (repetitive extragenic palindromic) element; contains 2 REP sequences |
| ? | NC_000913 | 4606590 = | NA (NA) | noncoding (33/92 nt) | REP351 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP351 (repetitive extragenic palindromic) element; contains 2 REP sequences | |||||