breseq  version 0.29.0  revision 8f9c342918e4
mutation predictions | marginal predictions | summary statistics | genome diff | command line log

Predicted mutations
evidence position mutation freq annotation gene description
RA 107,553 (T)9→8 100% intergenic (+79/‑152) lpxC → / → secM UDP‑3‑O‑acyl N‑acetylglucosamine deacetylase/regulator of secA translation
RA 281,599 C→T 63.8% G129S (GGC→AGC)  yagA ← CP4‑6 prophage; putative DNA‑binding transcriptional regulator
RA 380,022 (G)10→9 100% intergenic (‑141/+47) frmR ← / ← yaiO regulator protein that represses frmRAB operon/outer membrane protein
RA 410,479 A→G 100% S112S (TCA→TCG)  mak → manno(fructo)kinase
RA 460,106 A→T 51.9% I407F (ATC→TTC)  lon → DNA‑binding ATP‑dependent protease La
RA 953,802 A→G 100% V222A (GTA→GCA)  focA ← formate channel
RA 1,077,116 T→C 53.5% E589E (GAA→GAG)  putA ← fused DNA‑binding transcriptional regulator/proline dehydrogenase/pyrroline‑5‑carboxylate dehydrogenase
RA 1,143,641 G→A 100% H243Y (CAT→TAT)  rne ← endoribonuclease; RNA‑binding protein;RNA degradosome binding protein
RA 1,146,997 G→A 55.0% T68T (ACG→ACA)  yceD → DUF177 family protein
RA 1,246,073 C→T 100% G435D (GGC→GAC)  treA ← periplasmic trehalase
RA 1,489,197 C→T 100% D322D (GAC→GAT)  aldA → aldehyde dehydrogenase A, NAD‑linked
RA 1,554,731 C→T 50.9% M313I (ATG→ATA)  maeA ← malate dehydrogenase, decarboxylating, NAD‑requiring; malic enzyme
RA 1,755,639 G→A 100% intergenic (‑498/‑59) ydhZ ← / → pykF uncharacterized protein/pyruvate kinase I
RA 1,799,488 C→T 18.1% V88I (GTT→ATT)  rplT ← 50S ribosomal subunit protein L20
RA 1,803,104 A→G 20.6% pseudogene (11/426 nt) arpB → pseudogene, ankyrin repeats
RA 1,835,622 G→A 32.8% R36R (CGG→CGA)  ynjA → carboxymuconolactone decarboxylase family protein
RA 1,868,250 A→G 100% Y448C (TAC→TGC)  yeaG → protein kinase, endogenous substrate unidentified; autokinase
RA 1,950,296:1 +C 16.7% coding (227/1773 nt) aspS ← aspartyl‑tRNA synthetase
RA 1,950,302 Δ1 bp 16.9% coding (221/1773 nt) aspS ← aspartyl‑tRNA synthetase
RA 1,950,306 C→G 18.3% G73R (GGC→CGC)  aspS ← aspartyl‑tRNA synthetase
JC JC 1,979,486 IS5 (+) +4 bp 100% intergenic (‑271/‑264) insA ← / → uspC IS1 repressor TnpA/universal stress protein
RA 2,018,260 (A)8→7 100% coding (315/444 nt) fliJ → flagellar protein
RA 2,173,363 Δ2 bp 100% intergenic (‑1/+1) gatC ← / ← gatC pseudogene, galactitol‑specific enzyme IIC component of PTS;transport; Transport of small molecules: Carbohydrates, organic acids, alcohols; PTS system galactitol‑specific enzyme IIC/pseudogene, galactitol‑specific enzyme IIC component of PTS;transport; Transport of small molecules: Carbohydrates, organic acids, alcohols; PTS system galactitol‑specific enzyme IIC
RA 2,326,925:1 (C)6→7 100% coding (817/1185 nt) atoB → acetyl‑CoA acetyltransferase
RA 2,470,410 (T)7→6 100% coding (1280/1332 nt) gtrS → serotype‑specific glucosyl transferase, CPS‑53 (KpLE1) prophage
RA 2,516,689 T→C 100% T382A (ACG→GCG)  yfeA ← putative diguanylate cyclase
RA 2,652,855:1 (G)6→7 100% coding (362/846 nt) sseA → 3‑mercaptopyruvate sulfurtransferase
RA 2,731,312 G→A 100% intergenic (‑155/+288) rrsG ← / ← clpB 16S ribosomal RNA of rrnG operon/protein disaggregation chaperone
RA 2,776,420 T→C 15.0% V12A (GTA→GCA)  yfjY → CP4‑57 prophage; putative DNA repair protein
RA 2,866,592:1 +C 100% coding (960/993 nt) rpoS ← RNA polymerase, sigma S (sigma 38) factor
RA 2,966,582 C→T 27.2% G618D (GGC→GAC)  ptsP ← PEP‑protein phosphotransferase enzyme I; GAF domain containing protein
RA 3,008,075 A→G 100% D189G (GAC→GGC)  ygeX → 2,3‑diaminopropionate ammonia lyase, PLP‑dependent
RA 3,194,516 A→G 100% K551K (AAA→AAG)  yqiK → PHB family membrane protein, function unknown
RA 3,227,143 A→G 16.2% T304A (ACC→GCC)  ygjI → putative transporter
RA 3,277,706 (A)7→6 100% coding (370/465 nt) yhaV → toxin of the SohB(PrlF)‑YhaV toxin‑antitoxin system
RA 3,352,673 T→C 100% E118G (GAA→GGA)  arcB ← aerobic respiration control sensor histidine protein kinase, cognate to two‑component response regulators ArcA and RssB
RA 3,379,266:1 (C)7→8 100% coding (732/1128 nt) zapE ← divisome ATPase
RA 3,411,299 T→C 100% V10A (GTA→GCA)  fis → global DNA‑binding transcriptional dual regulator
RA 3,542,503 G→A 59.3% W699* (TGG→TGA)  feoB → ferrous iron transporter protein B and GTP‑binding protein; membrane protein
RA 3,542,842 C→T 15.4% Q39* (CAA→TAA)  feoC → putative DNA‑binding transcriptional regulator
RA 3,560,455:1 +G 100% intergenic (‑2/+1) glpR ← / ← glpR pseudogene, DNA‑binding transcriptional repressor;regulator; Energy metabolism, carbon: Anaerobic respiration; repressor of the glp operon/pseudogene, DNA‑binding transcriptional repressor;regulator; Energy metabolism, carbon: Anaerobic respiration; repressor of the glp operon
MC JC 3,582,206 Δ1,222 bp 100% IS1‑mediated [yhhZ]–yrhA [yhhZ], yrhA
JC 3,596,220 (TCA)3→2 61.9% coding (182‑184/927 nt) livH ← branched‑chain amino acid ABC transporter permease
RA 3,648,144 (T)7→6 100% intergenic (‑356/‑384) dinQ ← / → arsR UV‑inducible membrane toxin, DinQ‑AgrB type I toxin‑antitoxin system/arsenical resistance operon transcriptional repressor; autorepressor
MC JC 3,815,859 Δ82 bp 100% [rph]–[rph] [rph], [rph]
RA 3,951,598:1 +T 35.8% pseudogene (57/663 nt) ilvG → pseudogene, acetolactate synthase 2 large subunit, valine‑insensitive; acetolactate synthase II, large subunit, cryptic, interrupted
RA 3,966,720 C→T 54.7% R102C (CGC→TGC)  rho → transcription termination factor
RA 4,121,879 Δ1 bp 49.5% coding (409/531 nt) hslV ← peptidase component of the HslUV protease
RA 4,121,880 Δ1 bp 49.5% coding (408/531 nt) hslV ← peptidase component of the HslUV protease
RA 4,215,178 Δ1 bp 29.9% coding (899/930 nt) metA → homoserine O‑transsuccinylase
RA 4,296,060 C→T 100% intergenic (+266/+376) gltP → / ← yjcO glutamate/aspartate:proton symporter/Sel1 family TPR‑like repeat protein
RA 4,296,381:1 +GC 100% intergenic (+587/+55) gltP → / ← yjcO glutamate/aspartate:proton symporter/Sel1 family TPR‑like repeat protein
RA 4,337,024 G→A 100% S3L (TCG→TTG)  adiC ← arginine:agmatine antiporter
RA 4,370,616 A→G 56.8% intergenic (‑204/‑72) yjeH ← / → groS putative transporter/Cpn10 chaperonin GroES, small subunit of GroESL
RA 4,397,557 G→T 100% G49V (GGT→GTT)  mutL → methyl‑directed mismatch repair protein
RA 4,410,053 (T)9→8 100% intergenic (+47/‑80) rlmB → / → yjfI 23S rRNA mG2251 2'‑O‑ribose methyltransferase, SAM‑dependent/DUF2170 family protein
RA 4,465,236 C→T 50.4% P315P (CCG→CCA)  treB ← trehalose‑specific PTS enzyme: IIB and IIC component
RA 4,494,883:1 (A)7→8 100% coding (261/564 nt) idnK → D‑gluconate kinase, thermosensitive
RA 4,573,528 A→G 100% pseudogene (1115/1503 nt) yjiT → pseudogene
RA 4,638,193:1 (C)6→7 100% coding (16/1353 nt) creD → inner membrane protein

Unassigned missing coverage evidence
   seq id start end size ←reads reads→ gene description
* * ÷ NC_000913 3423731–3424586 3424586 1–856 49 [48] [48] 49 [rrfD]–[rrlD] [rrfD], [rrlD]
* * ÷ NC_000913 3762318–3764074 3765215–3764077 4–2898 50 [48] [46] 49 rhsA Rhs protein with putative toxin 55 domain; putative polysaccharide synthesis/export protein; putative neighboring cell growth inhibitor

Unassigned new junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? NC_000913 = 16583NA (NA)5 (0.060) 4/168 NT NA noncoding (1197/1345 nt) IS186 repeat region
?NC_000913 = 16604 NA (NA)noncoding (1218/1345 nt) IS186 repeat region
* ? NC_000913 = 50326NA (NA)3 (0.040) 3/164 NT NA intergenic (+24/+54) folA/apaH dihydrofolate reductase/diadenosine tetraphosphatase
?NC_000913 = 50359 NA (NA)noncoding (33/37 nt) REP5 (repetitive extragenic palindromic) element; contains 1 REP sequences REP5 (repetitive extragenic palindromic) element; contains 1 REP sequences
* ? NC_000913 72136 =NA (NA)6 (0.070) 6/164 NT NA noncoding (1/85 nt) REP7 (repetitive extragenic palindromic) element; contains 2 REP sequences REP7 (repetitive extragenic palindromic) element; contains 2 REP sequences
?NC_000913 72169 = NA (NA)noncoding (34/85 nt) REP7 (repetitive extragenic palindromic) element; contains 2 REP sequences REP7 (repetitive extragenic palindromic) element; contains 2 REP sequences
* ? NC_000913 = 224027NA (NA)4 (0.050) 3/166 NT NA noncoding (257/1542 nt) rrsH 16S ribosomal RNA of rrnH operon
?NC_000913 = 224038 NA (NA)noncoding (268/1542 nt) rrsH 16S ribosomal RNA of rrnH operon
* ? NC_000913 224059 =NA (NA)16 (0.200) 8/164 NT NA noncoding (289/1542 nt) rrsH 16S ribosomal RNA of rrnH operon
?NC_000913 224082 = NA (NA)noncoding (312/1542 nt) rrsH 16S ribosomal RNA of rrnH operon
* ? NC_000913 = 224065NA (NA)8 (0.100) 3/164 NT NA noncoding (295/1542 nt) rrsH 16S ribosomal RNA of rrnH operon
?NC_000913 = 224074 NA (NA)noncoding (304/1542 nt) rrsH 16S ribosomal RNA of rrnH operon
* ? NC_000913 = 224374NA (NA)5 (0.060) 4/164 NT NA noncoding (604/1542 nt) rrsH 16S ribosomal RNA of rrnH operon
?NC_000913 = 224403 NA (NA)noncoding (633/1542 nt) rrsH 16S ribosomal RNA of rrnH operon
* ? NC_000913 225078 =NA (NA)19 (0.240) 8/164 NT NA noncoding (1308/1542 nt) rrsH 16S ribosomal RNA of rrnH operon
?NC_000913 225100 = NA (NA)noncoding (1330/1542 nt) rrsH 16S ribosomal RNA of rrnH operon
* ? NC_000913 = 225084NA (NA)16 (0.200) 7/164 NT NA noncoding (1314/1542 nt) rrsH 16S ribosomal RNA of rrnH operon
?NC_000913 = 225092 NA (NA)noncoding (1322/1542 nt) rrsH 16S ribosomal RNA of rrnH operon
* ? NC_000913 225154 =NA (NA)12 (0.150) 7/168 NT NA noncoding (1384/1542 nt) rrsH 16S ribosomal RNA of rrnH operon
?NC_000913 225176 = NA (NA)noncoding (1406/1542 nt) rrsH 16S ribosomal RNA of rrnH operon
* ? NC_000913 225889 =NA (NA)16 (0.200) 10/164 NT NA noncoding (131/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
?NC_000913 225907 = NA (NA)noncoding (149/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
* ? NC_000913 = 225998NA (NA)8 (0.100) 6/170 NT NA noncoding (240/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
?NC_000913 = 226015 NA (NA)noncoding (257/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
* ? NC_000913 226704 =NA (NA)4 (0.050) 4/170 NT NA noncoding (946/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
?NC_000913 226730 = NA (NA)noncoding (972/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
* ? NC_000913 = 2267070 (0.000)25 (0.300) 13/170 NT 100% noncoding (949/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
?NC_000913 = 226725 NA (NA)noncoding (967/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
* ? NC_000913 227242 =NA (NA)8 (0.100) 4/166 NT NA noncoding (1484/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
?NC_000913 227264 = NA (NA)noncoding (1506/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
* ? NC_000913 = 227444NA (NA)8 (0.100) 7/168 NT NA noncoding (1686/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
?NC_000913 = 227459 NA (NA)noncoding (1701/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
* ? NC_000913 228016 =NA (NA)12 (0.150) 10/164 NT NA noncoding (2258/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
?NC_000913 228041 = NA (NA)noncoding (2283/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
* ? NC_000913 = 228108NA (NA)6 (0.070) 5/170 NT NA noncoding (2350/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
?NC_000913 = 228124 NA (NA)noncoding (2366/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
* ? NC_000913 = 228224NA (NA)7 (0.090) 6/166 NT NA noncoding (2466/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
?NC_000913 = 228241 NA (NA)noncoding (2483/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
* ? NC_000913 = 2579070 (0.000)71 (0.900) 49/162 NT 100% intergenic (+8/‑769) crl/crl pseudogene, sigma factor‑binding protein, RNA polymerase holoenzyme formation stimulator;regulator; Surface structures; transcriptional regulator of cryptic csgA gene for curli surface fibers/pseudogene, sigma factor‑binding protein, RNA polymerase holoenzyme formation stimulator;regulator; Surface structures; transcriptional regulator of cryptic csgA gene for curli surface fibers
?NC_000913 258684 = 0 (0.000)pseudogene (9/331 nt) crl pseudogene, sigma factor‑binding protein, RNA polymerase holoenzyme formation stimulator;regulator; Surface structures; transcriptional regulator of cryptic csgA gene for curli surface fibers
* ? NC_000913 271440 =NA (NA)4 (0.050) 4/164 NT NA noncoding (900/1221 nt) IS30 repeat region
?NC_000913 271463 = NA (NA)noncoding (923/1221 nt) IS30 repeat region
* ? NC_000913 = 274213NA (NA)17 (0.210) 10/168 NT NA noncoding (937/1195 nt) IS5 repeat region
?NC_000913 = 274218 NA (NA)noncoding (932/1195 nt) IS5 repeat region
* ? NC_000913 274525 =NA (NA)6 (0.070) 5/164 NT NA noncoding (625/1195 nt) IS5 repeat region
?NC_000913 274559 = NA (NA)noncoding (591/1195 nt) IS5 repeat region
* ? NC_000913 274620 =NA (NA)10 (0.130) 8/160 NT NA noncoding (530/1195 nt) IS5 repeat region
?NC_000913 274663 = NA (NA)noncoding (487/1195 nt) IS5 repeat region
* ? NC_000913 = 274695NA (NA)5 (0.060) 4/170 NT NA noncoding (455/1195 nt) IS5 repeat region
?NC_000913 = 274727 NA (NA)noncoding (423/1195 nt) IS5 repeat region
* ? NC_000913 274965 =NA (NA)10 (0.120) 6/172 NT NA noncoding (185/1195 nt) IS5 repeat region
?NC_000913 274991 = NA (NA)noncoding (159/1195 nt) IS5 repeat region
* ? NC_000913 = 275007NA (NA)15 (0.180) 9/172 NT NA noncoding (143/1195 nt) IS5 repeat region
?NC_000913 = 275025 NA (NA)noncoding (125/1195 nt) IS5 repeat region
* ? NC_000913 = 315520NA (NA)3 (0.040) 3/164 NT NA noncoding (292/1255 nt) IS3 repeat region
?NC_000913 = 315537 NA (NA)noncoding (309/1255 nt) IS3 repeat region
* ? NC_000913 = 315572NA (NA)8 (0.100) 5/158 NT NA noncoding (344/1255 nt) IS3 repeat region
?NC_000913 = 315588 NA (NA)noncoding (360/1255 nt) IS3 repeat region
* ? NC_000913 = 315852NA (NA)12 (0.140) 8/170 NT NA noncoding (624/1255 nt) IS3 repeat region
?NC_000913 = 315875 NA (NA)noncoding (647/1255 nt) IS3 repeat region
* ? NC_000913 315892 =NA (NA)5 (0.060) 3/172 NT NA noncoding (664/1255 nt) IS3 repeat region
?NC_000913 315923 = NA (NA)noncoding (695/1255 nt) IS3 repeat region
* ? NC_000913 315991 =NA (NA)10 (0.120) 6/170 NT NA noncoding (763/1255 nt) IS3 repeat region
?NC_000913 316014 = NA (NA)noncoding (786/1255 nt) IS3 repeat region
* ? NC_000913 = 316201NA (NA)10 (0.130) 5/160 NT NA noncoding (973/1255 nt) IS3 repeat region
?NC_000913 = 316220 NA (NA)noncoding (992/1255 nt) IS3 repeat region
* ? NC_000913 361887 =NA (NA)6 (0.070) 5/164 NT NA noncoding (5/34 nt) REP30 (repetitive extragenic palindromic) element; contains 1 REP sequences REP30 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 361917 = NA (NA)intergenic (‑57/+9) lacA/lacY thiogalactoside acetyltransferase/lactose permease
* ? NC_000913 377335 =NA (NA)9 (0.110) 4/164 NT NA noncoding (1/187 nt) REP32 (repetitive extragenic palindromic) element; contains 4 REP sequences REP32 (repetitive extragenic palindromic) element; contains 4 REP sequences
?NC_000913 377368 = NA (NA)noncoding (34/187 nt) REP32 (repetitive extragenic palindromic) element; contains 4 REP sequences REP32 (repetitive extragenic palindromic) element; contains 4 REP sequences
* ? NC_000913 381663 =NA (NA)7 (0.090) 5/164 NT NA noncoding (404/1331 nt) IS2 repeat region
?NC_000913 381703 = NA (NA)noncoding (444/1331 nt) IS2 repeat region
* ? NC_000913 = 381669NA (NA)10 (0.120) 6/164 NT NA noncoding (410/1331 nt) IS2 repeat region
?NC_000913 = 381695 NA (NA)noncoding (436/1331 nt) IS2 repeat region
* ? NC_000913 = 381837NA (NA)5 (0.060) 4/166 NT NA noncoding (578/1331 nt) IS2 repeat region
?NC_000913 = 381852 NA (NA)noncoding (593/1331 nt) IS2 repeat region
* ? NC_000913 = 381910NA (NA)13 (0.160) 7/166 NT NA noncoding (651/1331 nt) IS2 repeat region
?NC_000913 = 381923 NA (NA)noncoding (664/1331 nt) IS2 repeat region
* ? NC_000913 = 382211NA (NA)20 (0.240) 11/168 NT NA noncoding (952/1331 nt) IS2 repeat region
?NC_000913 = 382218 NA (NA)noncoding (959/1331 nt) IS2 repeat region
* ? NC_000913 382282 =NA (NA)5 (0.060) 3/166 NT NA noncoding (1023/1331 nt) IS2 repeat region
?NC_000913 382313 = NA (NA)noncoding (1054/1331 nt) IS2 repeat region
* ? NC_000913 = 382287NA (NA)3 (0.040) 3/166 NT NA noncoding (1028/1331 nt) IS2 repeat region
?NC_000913 = 382306 NA (NA)noncoding (1047/1331 nt) IS2 repeat region
* ? NC_000913 409056 =NA (NA)6 (0.070) 5/164 NT NA noncoding (5/37 nt) REP34 (repetitive extragenic palindromic) element; contains 1 REP sequences REP34 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 409089 = NA (NA)intergenic (+139/+19) ykiA/rdgC pseudogene/nucleoid‑associated ssDNA and dsDNA binding protein; competitive inhibitor of RecA function
* ? NC_000913 474269 =NA (NA)4 (0.050) 3/166 NT NA intergenic (+17/+32) amtB/tesB ammonium transporter/acyl‑CoA thioesterase 2
?NC_000913 474296 = NA (NA)intergenic (+44/+5) amtB/tesB ammonium transporter/acyl‑CoA thioesterase 2
* ? NC_000913 = 526253NA (NA)3 (0.040) 3/168 NT 100% coding (2993/4281 nt) rhsD Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
?NC_000913 = 526279 0 (0.000)coding (3019/4281 nt) rhsD Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 632112 =NA (NA)4 (0.070)
+31 bp
3/116 NT NA intergenic (+113/‑70) cstA/ybdD carbon starvation protein involved in peptide utilization; APC peptide transporter family protein/DUF466 family protein
?NC_000913 4344813 = NA (NA)intergenic (+23/+116) melB/yjdF melibiose:sodium symporter/DUF2238 family inner membrane protein
* ? NC_000913 = 705938NA (NA)4 (0.050) 3/166 NT NA intergenic (+48/‑155) nagE/glnS N‑acetyl glucosamine specific PTS enzyme IIC, IIB, and IIA components/glutamyl‑tRNA synthetase
?NC_000913 = 705965 NA (NA)intergenic (+75/‑128) nagE/glnS N‑acetyl glucosamine specific PTS enzyme IIC, IIB, and IIA components/glutamyl‑tRNA synthetase
* ? NC_000913 = 729987NA (NA)6 (0.070) 3/168 NT NA coding (405/4194 nt) rhsC Rhs protein with putative toxin domain; putative neighboring cell growth inhibitor
?NC_000913 = 730012 NA (NA)coding (430/4194 nt) rhsC Rhs protein with putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 = 730045NA (NA)4 (0.050) 3/168 NT NA coding (463/4194 nt) rhsC Rhs protein with putative toxin domain; putative neighboring cell growth inhibitor
?NC_000913 = 730067 NA (NA)coding (485/4194 nt) rhsC Rhs protein with putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 734797 =48 (0.550)9 (0.110) 3/168 NT 28.4% pseudogene (665/1521 nt) rhsO pseudogene, Rhs family
?NC_000913 3622561 = 0 (0.000)coding (3370/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 786696 =NA (NA)6 (0.070) 3/166 NT NA intergenic (+11/+147) aroG/gpmA 3‑deoxy‑D‑arabino‑heptulosonate‑7‑phosphate synthase, phenylalanine repressible/phosphoglyceromutase 1
?NC_000913 786726 = NA (NA)intergenic (+41/+117) aroG/gpmA 3‑deoxy‑D‑arabino‑heptulosonate‑7‑phosphate synthase, phenylalanine repressible/phosphoglyceromutase 1
* ? NC_000913 805804 =NA (NA)4 (0.050) 4/164 NT NA noncoding (1/178 nt) REP72 (repetitive extragenic palindromic) element; contains 4 REP sequences REP72 (repetitive extragenic palindromic) element; contains 4 REP sequences
?NC_000913 805836 = NA (NA)noncoding (33/178 nt) REP72 (repetitive extragenic palindromic) element; contains 4 REP sequences REP72 (repetitive extragenic palindromic) element; contains 4 REP sequences
* ? NC_000913 = 805951NA (NA)5 (0.060) 5/164 NT NA noncoding (148/178 nt) REP72 (repetitive extragenic palindromic) element; contains 4 REP sequences REP72 (repetitive extragenic palindromic) element; contains 4 REP sequences
?NC_000913 = 805981 NA (NA)noncoding (178/178 nt) REP72 (repetitive extragenic palindromic) element; contains 4 REP sequences REP72 (repetitive extragenic palindromic) element; contains 4 REP sequences
* ? NC_000913 832307 =NA (NA)4 (0.050) 3/164 NT NA noncoding (19/98 nt) RIP75 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site RIP75 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site
?NC_000913 2714290 = NA (NA)noncoding (8/98 nt) RIP188 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site RIP188 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site
* ? NC_000913 937227 =NA (NA)4 (0.050) 3/162 NT NA noncoding (4/36 nt) REP85 (repetitive extragenic palindromic) element; contains 1 REP sequences REP85 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 937261 = NA (NA)intergenic (+48/‑111) ftsK/lolA DNA translocase at septal ring sorting daughter chromsomes/lipoprotein chaperone
* ? NC_000913 1187036 =NA (NA)3 (0.040) 3/168 NT NA coding (1193/1227 nt) pepT peptidase T
?NC_000913 1187066 = NA (NA)coding (1223/1227 nt) pepT peptidase T
* ? NC_000913 1207790 =40 (0.460)11 (0.150) 11/146 NT 25.7% coding (290/630 nt) stfP e14 prophage; uncharacterized protein
?NC_000913 1209619 = 31 (0.440)pseudogene (1/501 nt) stfE pseudogene, e14 prophage; side tail fiber protein fragment family;Phage or Prophage Related
* ? NC_000913 = 120780542 (0.480)19 (0.270) 15/146 NT 36.8% coding (305/630 nt) stfP e14 prophage; uncharacterized protein
?NC_000913 = 1209602 31 (0.440)pseudogene (18/501 nt) stfE pseudogene, e14 prophage; side tail fiber protein fragment family;Phage or Prophage Related
* ? NC_000913 = 12994980 (0.000)75 (0.900) 53/170 NT 100% intergenic (+253/‑1684) ychE/oppA UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein
?NC_000913 1300698 = 0 (0.000)intergenic (+1453/‑484) ychE/oppA UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein
* ? NC_000913 = 1357753NA (NA)8 (0.100) 6/160 NT NA intergenic (‑85/+49) ymjA/puuP DUF2543 family protein/putrescine importer
?NC_000913 = 1357792 NA (NA)noncoding (23/30 nt) REP111 (repetitive extragenic palindromic) element; contains 1 REP sequences REP111 (repetitive extragenic palindromic) element; contains 1 REP sequences
* ? NC_000913 = 1432761NA (NA)7 (0.080) 5/170 NT NA coding (351/576 nt) tfaR Rac prophage; putative tail fiber assembly protein
?NC_000913 = 1432785 NA (NA)coding (375/576 nt) tfaR Rac prophage; putative tail fiber assembly protein
* ? NC_000913 1665136 =NA (NA)5 (0.070) 3/156 NT NA noncoding (1/31 nt) REP125 (repetitive extragenic palindromic) element; contains 1 REP sequences REP125 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 1665167 = NA (NA)intergenic (+47/‑148) dmsD/clcB twin‑argninine leader‑binding protein for DmsA and TorA/H(+)/Cl(‑) exchange transporter
* ? NC_000913 1852545 =NA (NA)3 (0.040) 3/156 NT NA intergenic (+17/+76) pncA/ydjE nicotinamidase/pyrazinamidase/putative MFS sugar transporter, membrane protein
?NC_000913 1852562 = NA (NA)noncoding (1/36 nt) REP132 (repetitive extragenic palindromic) element; contains 1 REP sequences REP132 (repetitive extragenic palindromic) element; contains 1 REP sequences
* ? NC_000913 1929923 =NA (NA)6 (0.070) 5/172 NT NA noncoding (1/84 nt) REP135 (repetitive extragenic palindromic) element; contains 2 REP sequences REP135 (repetitive extragenic palindromic) element; contains 2 REP sequences
?NC_000913 1929955 = NA (NA)noncoding (33/84 nt) REP135 (repetitive extragenic palindromic) element; contains 2 REP sequences REP135 (repetitive extragenic palindromic) element; contains 2 REP sequences
* ? NC_000913 = 19785020 (0.000)89 (1.130) 58/162 NT 100% intergenic (‑305/+16) flhD/insB1 flagellar class II regulon transcriptional activator, with FlhC/IS1 transposase B
?NC_000913 1979279 = 0 (0.000)intergenic (‑64/‑474) insA/uspC IS1 repressor TnpA/universal stress protein
* ? NC_000913 = 20668320 (0.000)11 (0.140) 8/160 NT 100% noncoding (522/1195 nt) IS5 repeat region
?NC_000913 = 2066857 NA (NA)noncoding (497/1195 nt) IS5 repeat region
* ? NC_000913 = 2139701NA (NA)5 (0.060) 4/164 NT NA intergenic (+216/+58) yegH/asmA inner membrane protein/suppressor of OmpF assembly mutants; putative outer membrane protein assembly factor; inner membrane‑anchored periplasmic protein
?NC_000913 = 2139734 NA (NA)noncoding (33/37 nt) REP146 (repetitive extragenic palindromic) element; contains 1 REP sequences REP146 (repetitive extragenic palindromic) element; contains 1 REP sequences
* ? NC_000913 2139728 =NA (NA)8 (0.100) 4/164 NT NA noncoding (27/37 nt) REP146 (repetitive extragenic palindromic) element; contains 1 REP sequences REP146 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 = 4229405 NA (NA)noncoding (30/70 nt) REP312 (repetitive extragenic palindromic) element; contains 2 REP sequences REP312 (repetitive extragenic palindromic) element; contains 2 REP sequences
* ? NC_000913 2232736 =NA (NA)3 (0.040) 3/166 NT NA noncoding (1/34 nt) REP155 (repetitive extragenic palindromic) element; contains 1 REP sequences REP155 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 2232766 = NA (NA)noncoding (31/34 nt) REP155 (repetitive extragenic palindromic) element; contains 1 REP sequences REP155 (repetitive extragenic palindromic) element; contains 1 REP sequences
* ? NC_000913 2393131 =NA (NA)6 (0.070) 6/164 NT NA noncoding (1/36 nt) REP166 (repetitive extragenic palindromic) element; contains 1 REP sequences REP166 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 2393163 = NA (NA)noncoding (33/36 nt) REP166 (repetitive extragenic palindromic) element; contains 1 REP sequences REP166 (repetitive extragenic palindromic) element; contains 1 REP sequences
* ? NC_000913 = 2440342NA (NA)10 (0.120) 6/166 NT NA intergenic (‑222/+43) yfcJ/fabB putative arabinose efflux transporter/3‑oxoacyl‑[acyl‑carrier‑protein] synthase I
?NC_000913 = 2440374 NA (NA)noncoding (32/36 nt) REP170 (repetitive extragenic palindromic) element; contains 1 REP sequences REP170 (repetitive extragenic palindromic) element; contains 1 REP sequences
* ? NC_000913 = 2539674NA (NA)10 (0.120) 7/164 NT NA intergenic (‑91/+43) cysM/cysA cysteine synthase B (O‑acetylserine sulfhydrolase B)/sulfate/thiosulfate transporter subunit
?NC_000913 = 2539688 NA (NA)intergenic (‑105/+29) cysM/cysA cysteine synthase B (O‑acetylserine sulfhydrolase B)/sulfate/thiosulfate transporter subunit
* ? NC_000913 2568185 =NA (NA)7 (0.100)
+ACCCGCTACACACCCCGCAG
3/138 NT NA noncoding (47/183 nt) REP178 (repetitive extragenic palindromic) element; contains 4 REP sequences REP178 (repetitive extragenic palindromic) element; contains 4 REP sequences
?NC_000913 = 3217522 NA (NA)noncoding (89/89 nt) REP229 (repetitive extragenic palindromic) element; contains 2 REP sequences REP229 (repetitive extragenic palindromic) element; contains 2 REP sequences
* ? NC_000913 2617939 =NA (NA)4 (0.050) 4/164 NT NA intergenic (+2/+136) yfgD/hda putative oxidoreductase/ATPase regulatory factor involved in DnaA inactivation
?NC_000913 2617967 = NA (NA)intergenic (+30/+108) yfgD/hda putative oxidoreductase/ATPase regulatory factor involved in DnaA inactivation
* ? NC_000913 = 2618037NA (NA)3 (0.040) 3/166 NT NA intergenic (+100/+38) yfgD/hda putative oxidoreductase/ATPase regulatory factor involved in DnaA inactivation
?NC_000913 = 2618053 NA (NA)intergenic (+116/+22) yfgD/hda putative oxidoreductase/ATPase regulatory factor involved in DnaA inactivation
* ? NC_000913 2726200 =NA (NA)22 (0.270) 8/166 NT NA intergenic (‑12/+81) rrfG/rrlG 5S ribosomal RNA of rrnG operon/23S ribosomal RNA of rrnG operon
?NC_000913 2726224 = NA (NA)intergenic (‑36/+57) rrfG/rrlG 5S ribosomal RNA of rrnG operon/23S ribosomal RNA of rrnG operon
* ? NC_000913 2727847 =NA (NA)5 (0.060) 5/170 NT NA noncoding (1338/2904 nt) rrlG 23S ribosomal RNA of rrnG operon
?NC_000913 2727872 = NA (NA)noncoding (1313/2904 nt) rrlG 23S ribosomal RNA of rrnG operon
* ? NC_000913 2729453 =NA (NA)8 (0.100) 6/158 NT 56.3% intergenic (‑9/+163) gltW/rrsG tRNA‑Glu/16S ribosomal RNA of rrnG operon
?NC_000913 2729475 = 7 (0.080)intergenic (‑31/+141) gltW/rrsG tRNA‑Glu/16S ribosomal RNA of rrnG operon
* ? NC_000913 2729955 =NA (NA)10 (0.120) 10/166 NT NA noncoding (1203/1542 nt) rrsG 16S ribosomal RNA of rrnG operon
?NC_000913 2729972 = NA (NA)noncoding (1186/1542 nt) rrsG 16S ribosomal RNA of rrnG operon
* ? NC_000913 2794028 =NA (NA)5 (0.060) 4/166 NT NA noncoding (1/136 nt) REP191 (repetitive extragenic palindromic) element; contains 3 REP sequences REP191 (repetitive extragenic palindromic) element; contains 3 REP sequences
?NC_000913 2794059 = NA (NA)noncoding (32/136 nt) REP191 (repetitive extragenic palindromic) element; contains 3 REP sequences REP191 (repetitive extragenic palindromic) element; contains 3 REP sequences
* ? NC_000913 = 2794135NA (NA)3 (0.040) 3/168 NT NA noncoding (108/136 nt) REP191 (repetitive extragenic palindromic) element; contains 3 REP sequences REP191 (repetitive extragenic palindromic) element; contains 3 REP sequences
?NC_000913 = 2794163 NA (NA)noncoding (136/136 nt) REP191 (repetitive extragenic palindromic) element; contains 3 REP sequences REP191 (repetitive extragenic palindromic) element; contains 3 REP sequences
* ? NC_000913 2835067 =NA (NA)4 (0.050) 4/164 NT NA noncoding (1/82 nt) REP195 (repetitive extragenic palindromic) element; contains 2 REP sequences REP195 (repetitive extragenic palindromic) element; contains 2 REP sequences
?NC_000913 2835099 = NA (NA)noncoding (33/82 nt) REP195 (repetitive extragenic palindromic) element; contains 2 REP sequences REP195 (repetitive extragenic palindromic) element; contains 2 REP sequences
* ? NC_000913 2842423 =NA (NA)4 (0.050) 5/164 NT NA noncoding (1/79 nt) REP197 (repetitive extragenic palindromic) element; contains 2 REP sequences REP197 (repetitive extragenic palindromic) element; contains 2 REP sequences
?NC_000913 2842453 = NA (NA)noncoding (31/79 nt) REP197 (repetitive extragenic palindromic) element; contains 2 REP sequences REP197 (repetitive extragenic palindromic) element; contains 2 REP sequences
* ? NC_000913 3163644 =NA (NA)3 (0.040) 3/160 NT NA noncoding (1/30 nt) REP223 (repetitive extragenic palindromic) element; contains 1 REP sequences REP223 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 3163674 = NA (NA)intergenic (‑193/+41) plsC/parC 1‑acyl‑sn‑glycerol‑3‑phosphate acyltransferase/DNA topoisomerase IV, subunit A
* ? NC_000913 3217434 =NA (NA)8 (0.100) 6/164 NT NA noncoding (1/89 nt) REP229 (repetitive extragenic palindromic) element; contains 2 REP sequences REP229 (repetitive extragenic palindromic) element; contains 2 REP sequences
?NC_000913 3217467 = NA (NA)noncoding (34/89 nt) REP229 (repetitive extragenic palindromic) element; contains 2 REP sequences REP229 (repetitive extragenic palindromic) element; contains 2 REP sequences
* ? NC_000913 3255175 =NA (NA)4 (0.050) 3/168 NT NA coding (133/165 nt) yhaL uncharacterized protein
?NC_000913 3255206 = NA (NA)coding (164/165 nt) yhaL uncharacterized protein
* ? NC_000913 = 34238220 (0.000)16 (0.200) 5/166 NT 100% intergenic (‑35/+58) rrfD/rrlD 5S ribosomal RNA of rrnD operon/23S ribosomal RNA of rrnD operon
?NC_000913 4040506 = NA (NA)intergenic (+83/‑11) rrlA/rrfA 23S ribosomal RNA of rrnA operon/5S ribosomal RNA of rrnA operon
* ? NC_000913 3470277 =NA (NA)6 (0.070) 3/164 NT NA coding (1053/1185 nt) tufA translation elongation factor EF‑Tu 1
?NC_000913 3470311 = NA (NA)coding (1019/1185 nt) tufA translation elongation factor EF‑Tu 1
* ? NC_000913 3546222 =NA (NA)5 (0.060) 3/166 NT NA noncoding (1/36 nt) REP253 (repetitive extragenic palindromic) element; contains 1 REP sequences REP253 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 3546254 = NA (NA)noncoding (33/36 nt) REP253 (repetitive extragenic palindromic) element; contains 1 REP sequences REP253 (repetitive extragenic palindromic) element; contains 1 REP sequences
* ? NC_000913 3547887 =NA (NA)3 (0.040) 3/164 NT NA noncoding (1/87 nt) REP254 (repetitive extragenic palindromic) element; contains 2 REP sequences REP254 (repetitive extragenic palindromic) element; contains 2 REP sequences
?NC_000913 3547917 = NA (NA)noncoding (31/87 nt) REP254 (repetitive extragenic palindromic) element; contains 2 REP sequences REP254 (repetitive extragenic palindromic) element; contains 2 REP sequences
* ? NC_000913 = 3620116NA (NA)3 (0.040) 3/166 NT 100% coding (925/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
?NC_000913 = 3620152 0 (0.000)coding (961/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 = 3620220NA (NA)4 (0.050) 4/166 NT 100% coding (1029/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
?NC_000913 = 3620255 0 (0.000)coding (1064/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 3620569 =NA (NA)9 (0.110) 4/166 NT 100% coding (1378/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
?NC_000913 3620582 = 0 (0.000)coding (1391/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 = 3620614NA (NA)11 (0.140) 6/166 NT 100% coding (1423/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
?NC_000913 = 3620635 0 (0.000)coding (1444/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 3622466 =NA (NA)6 (0.070) 4/170 NT 86.3% coding (3275/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
?NC_000913 3622497 = 1 (0.010)coding (3306/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 = 3625632NA (NA)3 (0.040) 3/166 NT NA noncoding (44/82 nt) RIP260 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site RIP260 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site
?NC_000913 = 3625670 NA (NA)noncoding (82/82 nt) RIP260 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site RIP260 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site
* ? NC_000913 3754860 =NA (NA)4 (0.050) 3/164 NT NA noncoding (1/82 nt) REP270 (repetitive extragenic palindromic) element; contains 2 REP sequences REP270 (repetitive extragenic palindromic) element; contains 2 REP sequences
?NC_000913 3754890 = NA (NA)noncoding (31/82 nt) REP270 (repetitive extragenic palindromic) element; contains 2 REP sequences REP270 (repetitive extragenic palindromic) element; contains 2 REP sequences
* ? NC_000913 3898629 =NA (NA)5 (0.060) 4/162 NT NA intergenic (+20/+42) cbrC/yieK UPF0167 family protein/putative 6‑phosphogluconolactonase
?NC_000913 3898659 = NA (NA)intergenic (+50/+12) cbrC/yieK UPF0167 family protein/putative 6‑phosphogluconolactonase
* ? NC_000913 = 3898636NA (NA)3 (0.040) 3/162 NT NA noncoding (6/26 nt) REP282 (repetitive extragenic palindromic) element; contains 1 REP sequences REP282 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 = 3898650 NA (NA)noncoding (20/26 nt) REP282 (repetitive extragenic palindromic) element; contains 1 REP sequences REP282 (repetitive extragenic palindromic) element; contains 1 REP sequences
* ? NC_000913 3908387 =NA (NA)7 (0.090) 5/164 NT NA noncoding (1/64 nt) REP283 (repetitive extragenic palindromic) element; contains 2 REP sequences REP283 (repetitive extragenic palindromic) element; contains 2 REP sequences
?NC_000913 3908412 = NA (NA)noncoding (26/64 nt) REP283 (repetitive extragenic palindromic) element; contains 2 REP sequences REP283 (repetitive extragenic palindromic) element; contains 2 REP sequences
* ? NC_000913 = 394598523 (0.260)8 (0.100) 4/164 NT 27.4% noncoding (2282/2904 nt) rrlC 23S ribosomal RNA of rrnC operon
?NC_000913 = 4039776 NA (NA)noncoding (2258/2905 nt) rrlA 23S ribosomal RNA of rrnA operon
* ? NC_000913 = 3946826NA (NA)20 (0.230)
+G
5/176 NT 16.3% intergenic (+7/‑46) rrfC/aspT 5S ribosomal RNA of rrnC operon/tRNA‑Asp
?NC_000913 = 4213198 104 (1.200)intergenic (+39/‑36) rrfE/yjaA 5S ribosomal RNA of rrnE operon/stress‑induced protein
* ? NC_000913 = 403524418 (0.210)3 (0.040) 3/168 NT 15.0% intergenic (+91/‑287) hemG/rrsA protoporphyrin oxidase, flavoprotein/16S ribosomal RNA of rrnA operon
?NC_000913 = 4035271 NA (NA)intergenic (+118/‑260) hemG/rrsA protoporphyrin oxidase, flavoprotein/16S ribosomal RNA of rrnA operon
* ? NC_000913 = 4132350NA (NA)5 (0.060) 4/162 NT NA noncoding (4/34 nt) REP306 (repetitive extragenic palindromic) element; contains 1 REP sequences REP306 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 = 4132380 NA (NA)noncoding (34/34 nt) REP306 (repetitive extragenic palindromic) element; contains 1 REP sequences REP306 (repetitive extragenic palindromic) element; contains 1 REP sequences
* ? NC_000913 = 4249477NA (NA)6 (0.070) 5/166 NT NA intergenic (+166/‑77) lamB/malM maltose outer membrane porin (maltoporin)/maltose regulon periplasmic protein
?NC_000913 = 4249481 NA (NA)intergenic (+170/‑73) lamB/malM maltose outer membrane porin (maltoporin)/maltose regulon periplasmic protein
* ? NC_000913 = 4254000NA (NA)4 (0.050) 4/164 NT NA noncoding (100/130 nt) RIP317 (repetitive extragenic palindromic) element; contains 3 REP sequences and 1 IHF site RIP317 (repetitive extragenic palindromic) element; contains 3 REP sequences and 1 IHF site
?NC_000913 = 4254030 NA (NA)noncoding (130/130 nt) RIP317 (repetitive extragenic palindromic) element; contains 3 REP sequences and 1 IHF site RIP317 (repetitive extragenic palindromic) element; contains 3 REP sequences and 1 IHF site
* ? NC_000913 = 4285342NA (NA)3 (0.040) 3/164 NT NA noncoding (41/77 nt) REP320 (repetitive extragenic palindromic) element; contains 2 REP sequences REP320 (repetitive extragenic palindromic) element; contains 2 REP sequences
?NC_000913 = 4285374 NA (NA)noncoding (73/77 nt) REP320 (repetitive extragenic palindromic) element; contains 2 REP sequences REP320 (repetitive extragenic palindromic) element; contains 2 REP sequences
* ? NC_000913 = 42959189 (0.100)5 (0.060) 3/164 NT 37.6% noncoding (84/600 nt) RIP321 (repetitive extragenic palindromic) element; contains 11 REP sequences and 4 IHF sites RIP321 (repetitive extragenic palindromic) element; contains 11 REP sequences and 4 IHF sites
?NC_000913 = 4295934 NA (NA)noncoding (100/600 nt) RIP321 (repetitive extragenic palindromic) element; contains 11 REP sequences and 4 IHF sites RIP321 (repetitive extragenic palindromic) element; contains 11 REP sequences and 4 IHF sites
* ? NC_000913 = 429606026 (0.320)5 (0.060) 3/164 NT 16.1% noncoding (226/600 nt) RIP321 (repetitive extragenic palindromic) element; contains 11 REP sequences and 4 IHF sites RIP321 (repetitive extragenic palindromic) element; contains 11 REP sequences and 4 IHF sites
?NC_000913 = 4296430 NA (NA)noncoding (596/600 nt) RIP321 (repetitive extragenic palindromic) element; contains 11 REP sequences and 4 IHF sites RIP321 (repetitive extragenic palindromic) element; contains 11 REP sequences and 4 IHF sites
* ? NC_000913 4332016 =NA (NA)3 (0.040) 3/160 NT NA noncoding (3/32 nt) REP326 (repetitive extragenic palindromic) element; contains 1 REP sequences REP326 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 4332047 = NA (NA)intergenic (+43/‑69) proP/pmrR proline/glycine betaine transporter/putative membrane‑bound BasS regulator
* ? NC_000913 = 4386017NA (NA)6 (0.070) 6/164 NT NA coding (314/315 nt) yjeO inner membrane protein
?NC_000913 = 4386039 NA (NA)intergenic (+21/+8) yjeO/mscM inner membrane protein/mechanosensitive channel protein, miniconductance
* ? NC_000913 = 4415961NA (NA)6 (0.070) 3/166 NT NA noncoding (4/34 nt) REP332 (repetitive extragenic palindromic) element; contains 1 REP sequences REP332 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 = 4415991 NA (NA)noncoding (34/34 nt) REP332 (repetitive extragenic palindromic) element; contains 1 REP sequences REP332 (repetitive extragenic palindromic) element; contains 1 REP sequences
* ? NC_000913 4415962 =NA (NA)7 (0.090) 6/166 NT NA noncoding (5/34 nt) REP332 (repetitive extragenic palindromic) element; contains 1 REP sequences REP332 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 4415992 = NA (NA)intergenic (+92/+25) aidB/yjfN DNA alkylation damage repair protein; flavin‑containing DNA binding protein, weak isovaleryl CoA dehydrogenase/DUF1471 family periplasmic protein
* ? NC_000913 = 4587878NA (NA)8 (0.100) 6/162 NT NA noncoding (7/27 nt) REP348 (repetitive extragenic palindromic) element; contains 1 REP sequences REP348 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 = 4587891 NA (NA)noncoding (20/27 nt) REP348 (repetitive extragenic palindromic) element; contains 1 REP sequences REP348 (repetitive extragenic palindromic) element; contains 1 REP sequences
* ? NC_000913 4606558 =NA (NA)5 (0.060) 4/164 NT NA noncoding (1/92 nt) REP351 (repetitive extragenic palindromic) element; contains 2 REP sequences REP351 (repetitive extragenic palindromic) element; contains 2 REP sequences
?NC_000913 4606590 = NA (NA)noncoding (33/92 nt) REP351 (repetitive extragenic palindromic) element; contains 2 REP sequences REP351 (repetitive extragenic palindromic) element; contains 2 REP sequences