breseq  version 0.29.0  revision 8f9c342918e4
mutation predictions | marginal predictions | summary statistics | genome diff | command line log

Predicted mutations
evidence position mutation freq annotation gene description
RA 9,907 A→C 17.5% intergenic (+14/+21) mog → / ← satP molybdochelatase incorporating molybdenum into molybdopterin/succinate‑acetate transporter
RA 9,908 G→T 17.4% intergenic (+15/+20) mog → / ← satP molybdochelatase incorporating molybdenum into molybdopterin/succinate‑acetate transporter
JC 147,727 Δ12 bp 100% coding (760‑771/903 nt) yadD → transposase_31 family protein
RA 151,522 G→T 15.2% A26A (GCC→GCA)  yadK ← putative fimbrial‑like adhesin protein
RA 252,589 G→C 17.3% A97P (GCA→CCA)  yafO → mRNA interferase toxin of the YafO‑YafN toxin‑antitoxin system
RA 335,166 T→A 19.1% intergenic (‑144/‑114) yahC ← / → yahD putative inner membrane protein/ankyrin repeat protein
RA 448,768 C→T 15.5% W625* (TGG→TAG)  cyoB ← cytochrome o ubiquinol oxidase subunit I
RA 454,853 T→C 15.6% intergenic (+64/‑280) bolA → / → tig stationary‑phase morphogene, transcriptional repressor for mreB; also regulator for dacA, dacC, and ampC/peptidyl‑prolyl cis/trans isomerase (trigger factor)
RA 478,750 C→T 18.5% intergenic (‑133/+31) ylaB ← / ← ylaC putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase/DUF1449 family inner membrane protein
RA 478,757 T→C 15.9% intergenic (‑140/+24) ylaB ← / ← ylaC putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase/DUF1449 family inner membrane protein
RA 478,759 A→G 15.5% intergenic (‑142/+22) ylaB ← / ← ylaC putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase/DUF1449 family inner membrane protein
RA 481,225 T→G 18.5% intergenic (‑517/+29) tomB ← / ← acrB Hha toxicity attenuator; conjugation‑related protein/multidrug efflux system protein
RA 481,228 C→A 18.5% intergenic (‑520/+26) tomB ← / ← acrB Hha toxicity attenuator; conjugation‑related protein/multidrug efflux system protein
RA 518,860 A→G 15.7% F97S (TTC→TCC)  ybbO ← putative oxidoreductase
RA 518,863 C→T 15.5% G96E (GGA→GAA)  ybbO ← putative oxidoreductase
RA 569,160 G→T 16.7% D87Y (GAC→TAC) ‡ ybcK → DLP12 prophage; putative recombinase
RA 569,161 A→C 15.4% D87A (GAC→GCC) ‡ ybcK → DLP12 prophage; putative recombinase
RA 657,531 T→G 19.0% intergenic (+30/+24) cspE → / ← flc constitutive cold shock family transcription antitermination protein; negative regulator of cspA transcription; RNA melting protein; ssDNA‑binding protein/fluoride efflux channel, dual topology membrane protein
RA 657,533 A→T 18.3% intergenic (+32/+22) cspE → / ← flc constitutive cold shock family transcription antitermination protein; negative regulator of cspA transcription; RNA melting protein; ssDNA‑binding protein/fluoride efflux channel, dual topology membrane protein
RA 657,535 C→A 18.7% intergenic (+34/+20) cspE → / ← flc constitutive cold shock family transcription antitermination protein; negative regulator of cspA transcription; RNA melting protein; ssDNA‑binding protein/fluoride efflux channel, dual topology membrane protein
RA 710,170 C→T 18.3% intergenic (+54/+30) chiQ → / ← fur chitosugar‑induced verified lipoprotein/ferric iron uptake regulon transcriptional repressor; autorepressor
RA 710,173 A→G 17.5% intergenic (+57/+27) chiQ → / ← fur chitosugar‑induced verified lipoprotein/ferric iron uptake regulon transcriptional repressor; autorepressor
RA 721,004 T→A 15.5% intergenic (+164/+52) ybfK → / ← kdpE uncharacterized protein/response regulator in two‑component regulatory system with KdpD
RA 721,006 T→A 15.9% intergenic (+166/+50) ybfK → / ← kdpE uncharacterized protein/response regulator in two‑component regulatory system with KdpD
RA 721,009 T→A 15.9% intergenic (+169/+47) ybfK → / ← kdpE uncharacterized protein/response regulator in two‑component regulatory system with KdpD
RA 721,011 T→A 15.7% intergenic (+171/+45) ybfK → / ← kdpE uncharacterized protein/response regulator in two‑component regulatory system with KdpD
RA 756,725 G→A 15.3% M273I (ATG→ATA)  sdhA → succinate dehydrogenase, flavoprotein subunit
RA 850,995 T→G 15.7% intergenic (+30/+19) ompX → / ← opgE outer membrane protein X/OPG biosynthetic transmembrane phosphoethanolamine transferase
RA 850,996 C→A 16.9% intergenic (+31/+18) ompX → / ← opgE outer membrane protein X/OPG biosynthetic transmembrane phosphoethanolamine transferase
RA 850,998 G→A 16.4% intergenic (+33/+16) ompX → / ← opgE outer membrane protein X/OPG biosynthetic transmembrane phosphoethanolamine transferase
RA 922,316:1 +C 15.8% intergenic (+23/+50) macB → / ← cspD macrolide ABC transporter peremase/ATPase/inhibitor of DNA replication, cold shock protein homolog
RA 1,020,958 A→T 15.3% intergenic (‑39/‑180) sulA ← / → sxy SOS cell division inhibitor/CRP‑S‑dependent promoter expression factor
RA 1,052,257 C→T 16.8% intergenic (+17/+32) gnsA → / ← yccM putative phosphatidylethanolamine synthesis regulator/putative 4Fe‑4S membrane protein
RA 1,143,998 C→T 100% G124S (GGT→AGT)  rne ← endoribonuclease; RNA‑binding protein;RNA degradosome binding protein
RA 1,224,239 A→T 16.2% intergenic (+332/+40) ycgI → / ← minE pseudogene/cell division topological specificity factor
RA 1,224,242 A→T 17.7% intergenic (+335/+37) ycgI → / ← minE pseudogene/cell division topological specificity factor
JC JC 1,293,033 IS1 (+) +9 bp 100% intergenic (‑111/‑486) hns ← / → tdk global DNA‑binding transcriptional dual regulator H‑NS/thymidine kinase/deoxyuridine kinase
RA 1,298,278 T→A 15.5% intergenic (‑157/‑320) adhE ← / → ychE fused acetaldehyde‑CoA dehydrogenase/iron‑dependent alcohol dehydrogenase/pyruvate‑formate lyase deactivase/UPF0056 family inner membrane protein
RA 1,298,284 T→A 16.0% intergenic (‑163/‑314) adhE ← / → ychE fused acetaldehyde‑CoA dehydrogenase/iron‑dependent alcohol dehydrogenase/pyruvate‑formate lyase deactivase/UPF0056 family inner membrane protein
RA 1,306,787 G→A 16.9% intergenic (+19/+34) oppF → / ← yciU oligopeptide ABC transporter ATPase/UPF0263 family protein
RA 1,306,788 T→C 17.5% intergenic (+20/+33) oppF → / ← yciU oligopeptide ABC transporter ATPase/UPF0263 family protein
RA 1,311,830 A→G 15.6% intergenic (+22/+18) tonB → / ← yciA membrane spanning protein in TonB‑ExbB‑ExbD transport complex/acyl‑CoA esterase
RA 1,311,831 C→T 15.9% intergenic (+23/+17) tonB → / ← yciA membrane spanning protein in TonB‑ExbB‑ExbD transport complex/acyl‑CoA esterase
RA 1,524,458:1 +T 15.7% intergenic (+90/+23) yncE → / ← ansP ATP‑binding protein, periplasmic, function unknown/L‑asparagine transporter
RA 1,524,463 Δ1 bp 15.4% intergenic (+95/+18) yncE → / ← ansP ATP‑binding protein, periplasmic, function unknown/L‑asparagine transporter
RA 1,530,490 T→C 16.3% intergenic (+86/‑96) ydcD → / → yncI putative immunity protein for RhsE/pseudogene
RA 1,530,499 A→C 16.5% intergenic (+95/‑87) ydcD → / → yncI putative immunity protein for RhsE/pseudogene
RA 1,530,505 G→A 15.8% intergenic (+101/‑81) ydcD → / → yncI putative immunity protein for RhsE/pseudogene
RA 1,541,077 G→C 15.0% A505G (GCC→GGC)  narZ ← nitrate reductase 2 (NRZ), alpha subunit
RA 1,572,928 C→G 15.9% A759P (GCA→CCA)  pqqL ← putative periplasmic M16 family zinc metalloendopeptidase
RA 1,597,272 T→A 15.8% pseudogene (716/3861 nt) yneO ← pseudogene, AidA homolog
RA 1,823,335 G→C 16.0% intergenic (+50/‑180) nadE → / → cho NAD synthetase, NH3/glutamine‑dependent/endonuclease of nucleotide excision repair
RA 1,823,338 G→C 16.7% intergenic (+53/‑177) nadE → / → cho NAD synthetase, NH3/glutamine‑dependent/endonuclease of nucleotide excision repair
RA 1,892,363 A→G 15.9% Y291Y (TAT→TAC)  yoaA ← putative ATP‑dependent helicase, DinG family
RA 1,950,296:1 +C 15.3% coding (227/1773 nt) aspS ← aspartyl‑tRNA synthetase
RA 1,950,306 C→G 15.7% G73R (GGC→CGC)  aspS ← aspartyl‑tRNA synthetase
MC JC 1,978,503 Δ776 bp 100% insB1–insA insB1, insA
JC JC 1,979,486 IS5 (+) +4 bp 100% intergenic (‑271/‑264) insA ← / → uspC IS1 repressor TnpA/universal stress protein
RA 1,999,231 T→A 15.6% T84S (ACT→TCT)  dcyD ← D‑cysteine desulfhydrase, PLP‑dependent
RA 2,089,854 A→T 16.8% intergenic (‑141/‑142) yefM ← / → hisL antitoxin of the YoeB‑YefM toxin‑antitoxin system/his operon leader peptide
RA 2,173,363 Δ2 bp 100% intergenic (‑1/+1) gatC ← / ← gatC pseudogene, galactitol‑specific enzyme IIC component of PTS;transport; Transport of small molecules: Carbohydrates, organic acids, alcohols; PTS system galactitol‑specific enzyme IIC/pseudogene, galactitol‑specific enzyme IIC component of PTS;transport; Transport of small molecules: Carbohydrates, organic acids, alcohols; PTS system galactitol‑specific enzyme IIC
RA 2,364,995 T→G 17.5% intergenic (+16/+23) nudI → / ← ais nucleoside triphosphatase/putative LPS core heptose(II)‑phosphate phosphatase
RA 2,364,998 C→A 16.5% intergenic (+19/+20) nudI → / ← ais nucleoside triphosphatase/putative LPS core heptose(II)‑phosphate phosphatase
RA 2,391,414 C→G 16.1% R31P (CGA→CCA)  nuoN ← NADH:ubiquinone oxidoreductase, membrane subunit N
RA 2,391,417 C→G 16.6% W30S (TGG→TCG)  nuoN ← NADH:ubiquinone oxidoreductase, membrane subunit N
RA 2,449,615 C→G 16.7% G145G (GGG→GGC) ‡ yfcO ← DUF2544 family putative outer membrane protein
RA 2,449,616 C→G 16.6% G145A (GGG→GCG) ‡ yfcO ← DUF2544 family putative outer membrane protein
RA 2,449,624 Δ1 bp 16.4% coding (426/822 nt) yfcO ← DUF2544 family putative outer membrane protein
RA 2,457,128 T→A 17.4% M678L (ATG→TTG)  fadJ ← enoyl‑CoA hydratase/epimerase and isomerase/3‑hydroxyacyl‑CoA dehydrogenase
RA 2,457,131 T→A 17.0% I677L (ATA→TTA)  fadJ ← enoyl‑CoA hydratase/epimerase and isomerase/3‑hydroxyacyl‑CoA dehydrogenase
RA 2,707,320 A→T 15.8% intergenic (‑196/+2) lepA ← / ← rseC back‑translocating elongation factor EF4, GTPase/SoxR iron‑sulfur cluster reduction factor component
RA 2,707,321 A→T 15.6% intergenic (‑197/+1) lepA ← / ← rseC back‑translocating elongation factor EF4, GTPase/SoxR iron‑sulfur cluster reduction factor component
RA 2,731,073 A→T 15.0% noncoding (85/1542 nt) rrsG ← 16S ribosomal RNA of rrnG operon
RA 2,838,222 A→T 15.3% intergenic (‑117/+32) hydN ← / ← ascG formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit/asc operon transcriptional repressor; prpBC operon repressor
RA 2,917,345 G→A 100% G763G (GGG→GGA)  barA → hybrid sensory histidine kinase, in two‑component regulatory system with UvrY
RA 3,057,140 A→G 15.5% intergenic (‑191/+38) ibsC ← / ← serA toxic membrane protein/D‑3‑phosphoglycerate dehydrogenase
RA 3,057,145 G→C 16.0% intergenic (‑196/+33) ibsC ← / ← serA toxic membrane protein/D‑3‑phosphoglycerate dehydrogenase
RA 3,057,150 C→T 17.5% intergenic (‑201/+28) ibsC ← / ← serA toxic membrane protein/D‑3‑phosphoglycerate dehydrogenase
RA 3,067,320 A→T 20.0% intergenic (‑147/+20) ygfI ← / ← yggE putative DNA‑binding transcriptional regulator/oxidative stress defense protein
RA 3,067,323 A→T 19.4% intergenic (‑150/+17) ygfI ← / ← yggE putative DNA‑binding transcriptional regulator/oxidative stress defense protein
RA 3,068,922 G→T 15.2% intergenic (‑114/+25) argO ← / ← mscS arginine transporter/mechanosensitive channel protein, small conductance
RA 3,068,924 G→A 15.3% intergenic (‑116/+23) argO ← / ← mscS arginine transporter/mechanosensitive channel protein, small conductance
RA 3,068,927 T→C 15.0% intergenic (‑119/+20) argO ← / ← mscS arginine transporter/mechanosensitive channel protein, small conductance
RA 3,068,929 A→C 15.2% intergenic (‑121/+18) argO ← / ← mscS arginine transporter/mechanosensitive channel protein, small conductance
RA 3,078,186 C→T 15.3% G225D (GGC→GAC)  cmtA ← putative mannitol‑specific PTS IIB and IIC components
RA 3,078,191 A→G 16.1% G223G (GGT→GGC)  cmtA ← putative mannitol‑specific PTS IIB and IIC components
RA 3,156,590 C→A 17.4% intergenic (+72/‑33) yqhD → / → dkgA aldehyde reductase, NADPH‑dependent/2,5‑diketo‑D‑gluconate reductase A
RA 3,156,591 T→G 17.1% intergenic (+73/‑32) yqhD → / → dkgA aldehyde reductase, NADPH‑dependent/2,5‑diketo‑D‑gluconate reductase A
RA 3,171,852 C→T 17.2% intergenic (+19/+27) qseC → / ← ygiZ quorum sensing sensory histidine kinase in two‑component regulatory system with QseB/inner membrane protein
RA 3,171,857 A→T 17.4% intergenic (+24/+22) qseC → / ← ygiZ quorum sensing sensory histidine kinase in two‑component regulatory system with QseB/inner membrane protein
RA 3,171,858 A→T 17.6% intergenic (+25/+21) qseC → / ← ygiZ quorum sensing sensory histidine kinase in two‑component regulatory system with QseB/inner membrane protein
RA 3,171,863 A→G 17.2% intergenic (+30/+16) qseC → / ← ygiZ quorum sensing sensory histidine kinase in two‑component regulatory system with QseB/inner membrane protein
RA 3,318,344 G→A 62.9% intergenic (‑55/‑293) metY ← / → argG tRNA‑Met/argininosuccinate synthetase
RA 3,471,357 C→T 15.5% intergenic (‑28/+43) tufA ← / ← fusA translation elongation factor EF‑Tu 1/protein chain elongation factor EF‑G, GTP‑binding
RA 3,560,455:1 +G 100% intergenic (‑2/+1) glpR ← / ← glpR pseudogene, DNA‑binding transcriptional repressor;regulator; Energy metabolism, carbon: Anaerobic respiration; repressor of the glp operon/pseudogene, DNA‑binding transcriptional repressor;regulator; Energy metabolism, carbon: Anaerobic respiration; repressor of the glp operon
RA 3,566,544 C→A 100% S13I (AGC→ATC)  glgP ← glycogen phosphorylase
RA 3,705,970 G→A 23.1% intergenic (‑180/+128) dppB ← / ← dppA dipeptide/heme ABC transporter permease/dipeptide/heme ABC transporter periplasmic binding protein; dipeptide chemotaxis receptor
RA 3,705,971 C→A 23.1% intergenic (‑181/+127) dppB ← / ← dppA dipeptide/heme ABC transporter permease/dipeptide/heme ABC transporter periplasmic binding protein; dipeptide chemotaxis receptor
RA 3,705,978 A→C 24.4% intergenic (‑188/+120) dppB ← / ← dppA dipeptide/heme ABC transporter permease/dipeptide/heme ABC transporter periplasmic binding protein; dipeptide chemotaxis receptor
RA 3,705,984 T→G 35.8% intergenic (‑194/+114) dppB ← / ← dppA dipeptide/heme ABC transporter permease/dipeptide/heme ABC transporter periplasmic binding protein; dipeptide chemotaxis receptor
RA 3,705,985 T→C 35.2% intergenic (‑195/+113) dppB ← / ← dppA dipeptide/heme ABC transporter permease/dipeptide/heme ABC transporter periplasmic binding protein; dipeptide chemotaxis receptor
RA 3,706,028 T→C 23.4% intergenic (‑238/+70) dppB ← / ← dppA dipeptide/heme ABC transporter permease/dipeptide/heme ABC transporter periplasmic binding protein; dipeptide chemotaxis receptor
RA 3,706,048 G→T 27.0% intergenic (‑258/+50) dppB ← / ← dppA dipeptide/heme ABC transporter permease/dipeptide/heme ABC transporter periplasmic binding protein; dipeptide chemotaxis receptor
RA 3,714,163:1 +T 15.8% coding (2232/2334 nt) bisC ← biotin sulfoxide reductase
RA 3,714,168 Δ1 bp 15.2% coding (2227/2334 nt) bisC ← biotin sulfoxide reductase
RA 3,790,300 A→T 18.9% intergenic (‑219/+20) waaH ← / ← tdh LPS(HepIII)‑glucuronic acid glycosyltransferase/L‑threonine 3‑dehydrogenase, NAD(P)‑binding
RA 3,790,303 A→T 19.0% intergenic (‑222/+17) waaH ← / ← tdh LPS(HepIII)‑glucuronic acid glycosyltransferase/L‑threonine 3‑dehydrogenase, NAD(P)‑binding
RA 3,810,321 T→C 15.2% intergenic (+17/+22) coaD → / ← mutM pantetheine‑phosphate adenylyltransferase/formamidopyrimidine/5‑formyluracil/ 5‑hydroxymethyluracil DNA glycosylase
RA 3,810,324 G→A 15.0% intergenic (+20/+19) coaD → / ← mutM pantetheine‑phosphate adenylyltransferase/formamidopyrimidine/5‑formyluracil/ 5‑hydroxymethyluracil DNA glycosylase
MC JC 3,815,859 Δ82 bp 100% [rph]–[rph] [rph], [rph]
RA 3,831,757 C→T 15.9% A434V (GCC→GTC)  yicH → putative inner membrane‑anchored periplasmic AsmA family protein
RA 3,891,502 C→G 19.4% intergenic (+19/‑113) tnaB → / → mdtL tryptophan transporter of low affinity/multidrug efflux system protein
RA 3,891,504 T→A 18.3% intergenic (+21/‑111) tnaB → / → mdtL tryptophan transporter of low affinity/multidrug efflux system protein
RA 3,891,506 C→G 17.0% intergenic (+23/‑109) tnaB → / → mdtL tryptophan transporter of low affinity/multidrug efflux system protein
RA 4,051,259 G→T 15.4% intergenic (‑494/‑88) yihA ← / → yihI cell division GTP‑binding protein/activator of Der GTPase
RA 4,051,262 A→C 15.2% intergenic (‑497/‑85) yihA ← / → yihI cell division GTP‑binding protein/activator of Der GTPase
RA 4,060,264 A→C 15.2% intergenic (+34/‑183) typA → / → yihL GTP‑binding protein/putative DNA‑binding transcriptional regulator
RA 4,113,473 T→C 16.0% L61L (TTG→CTG) ‡ uspD → stress‑induced protein
RA 4,113,474 T→A 16.4% L61* (TTG→TAG) ‡ uspD → stress‑induced protein
RA 4,113,475 G→A 16.9% L61L (TTG→TTA) ‡ uspD → stress‑induced protein
RA 4,177,171 T→A 16.0% intergenic (+43/‑187) tufB → / → secE translation elongation factor EF‑Tu 2/preprotein translocase membrane subunit
RA 4,185,470 C→A 18.0% P41T (CCG→ACG)  rpoC → RNA polymerase, beta prime subunit
RA 4,227,550 G→A 16.8% intergenic (+39/‑181) metH → / → yjbB homocysteine‑N5‑methyltetrahydrofolate transmethylase, B12‑dependent/putative Na+/Pi‑cotransporter
RA 4,227,555 A→T 16.8% intergenic (+44/‑176) metH → / → yjbB homocysteine‑N5‑methyltetrahydrofolate transmethylase, B12‑dependent/putative Na+/Pi‑cotransporter
RA 4,227,560 T→C 17.4% intergenic (+49/‑171) metH → / → yjbB homocysteine‑N5‑methyltetrahydrofolate transmethylase, B12‑dependent/putative Na+/Pi‑cotransporter
RA 4,296,060 C→T 27.1% intergenic (+266/+376) gltP → / ← yjcO glutamate/aspartate:proton symporter/Sel1 family TPR‑like repeat protein
RA 4,296,381:1 +GC 100% intergenic (+587/+55) gltP → / ← yjcO glutamate/aspartate:proton symporter/Sel1 family TPR‑like repeat protein
RA 4,376,280 G→A 15.3% intergenic (+15/‑37) efp → / → ecnA polyproline‑specific translation elongation factor EF‑P/entericidin A membrane lipoprotein, antidote entericidin B
RA 4,376,291 T→C 15.3% intergenic (+26/‑26) efp → / → ecnA polyproline‑specific translation elongation factor EF‑P/entericidin A membrane lipoprotein, antidote entericidin B

Unassigned new junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? NC_000913 = 16583NA (NA)15 (0.120) 7/168 NT NA noncoding (1197/1345 nt) IS186 repeat region
?NC_000913 = 16604 NA (NA)noncoding (1218/1345 nt) IS186 repeat region
* ? NC_000913 = 16653NA (NA)25 (0.200) 8/164 NT NA noncoding (1267/1345 nt) IS186 repeat region
?NC_000913 = 16691 NA (NA)noncoding (1305/1345 nt) IS186 repeat region
* ? NC_000913 = 20044NA (NA)14 (0.110) 11/168 NT NA noncoding (520/768 nt) IS1 repeat region
?NC_000913 = 20084 NA (NA)noncoding (480/768 nt) IS1 repeat region
* ? NC_000913 = 20197NA (NA)9 (0.070) 5/166 NT NA noncoding (367/768 nt) IS1 repeat region
?NC_000913 = 20223 NA (NA)noncoding (341/768 nt) IS1 repeat region
* ? NC_000913 = 46077115 (0.850)22 (0.180) 11/164 NT 16.6% coding (271/1332 nt) yaaU putative MFS sugar transporter; membrane protein
?NC_000913 = 46089 115 (0.920)coding (283/1332 nt) yaaU putative MFS sugar transporter; membrane protein
* ? NC_000913 = 50326NA (NA)10 (0.080) 7/164 NT NA intergenic (+24/+54) folA/apaH dihydrofolate reductase/diadenosine tetraphosphatase
?NC_000913 = 50359 NA (NA)noncoding (33/37 nt) REP5 (repetitive extragenic palindromic) element; contains 1 REP sequences REP5 (repetitive extragenic palindromic) element; contains 1 REP sequences
* ? NC_000913 = 133866110 (0.810)20 (0.160) 11/162 NT 16.3% coding (2252/2598 nt) acnB aconitate hydratase 2; aconitase B; 2‑methyl‑cis‑aconitate hydratase
?NC_000913 = 133880 106 (0.860)coding (2266/2598 nt) acnB aconitate hydratase 2; aconitase B; 2‑methyl‑cis‑aconitate hydratase
* ? NC_000913 = 224344NA (NA)52 (0.400) 11/172 NT NA noncoding (574/1542 nt) rrsH 16S ribosomal RNA of rrnH operon
?NC_000913 = 224358 NA (NA)noncoding (588/1542 nt) rrsH 16S ribosomal RNA of rrnH operon
* ? NC_000913 = 224374NA (NA)20 (0.160) 12/164 NT NA noncoding (604/1542 nt) rrsH 16S ribosomal RNA of rrnH operon
?NC_000913 = 224403 NA (NA)noncoding (633/1542 nt) rrsH 16S ribosomal RNA of rrnH operon
* ? NC_000913 225078 =NA (NA)53 (0.430) 21/164 NT NA noncoding (1308/1542 nt) rrsH 16S ribosomal RNA of rrnH operon
?NC_000913 225100 = NA (NA)noncoding (1330/1542 nt) rrsH 16S ribosomal RNA of rrnH operon
* ? NC_000913 225889 =NA (NA)38 (0.300) 14/164 NT NA noncoding (131/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
?NC_000913 225907 = NA (NA)noncoding (149/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
* ? NC_000913 = 225998NA (NA)47 (0.360) 17/170 NT NA noncoding (240/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
?NC_000913 = 226015 NA (NA)noncoding (257/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
* ? NC_000913 226704 =NA (NA)33 (0.260) 12/170 NT NA noncoding (946/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
?NC_000913 226730 = NA (NA)noncoding (972/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
* ? NC_000913 226815 =NA (NA)13 (0.100) 9/172 NT NA noncoding (1057/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
?NC_000913 226840 = NA (NA)noncoding (1082/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
* ? NC_000913 = 227444NA (NA)52 (0.410) 17/168 NT NA noncoding (1686/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
?NC_000913 = 227459 NA (NA)noncoding (1701/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
* ? NC_000913 228016 =NA (NA)59 (0.470) 10/164 NT NA noncoding (2258/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
?NC_000913 228041 = NA (NA)noncoding (2283/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
* ? NC_000913 = 228022NA (NA)27 (0.220) 8/164 NT NA noncoding (2264/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
?NC_000913 = 228033 NA (NA)noncoding (2275/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
* ? NC_000913 = 228108NA (NA)37 (0.290) 16/170 NT NA noncoding (2350/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
?NC_000913 = 228124 NA (NA)noncoding (2366/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
* ? NC_000913 = 228224NA (NA)36 (0.290) 13/166 NT NA noncoding (2466/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
?NC_000913 = 228241 NA (NA)noncoding (2483/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
* ? NC_000913 = 228452NA (NA)9 (0.070) 5/170 NT NA noncoding (2694/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
?NC_000913 = 228472 NA (NA)noncoding (2714/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
* ? NC_000913 = 2579070 (0.000)135 (1.100) 80/162 NT 100% intergenic (+8/‑769) crl/crl pseudogene, sigma factor‑binding protein, RNA polymerase holoenzyme formation stimulator;regulator; Surface structures; transcriptional regulator of cryptic csgA gene for curli surface fibers/pseudogene, sigma factor‑binding protein, RNA polymerase holoenzyme formation stimulator;regulator; Surface structures; transcriptional regulator of cryptic csgA gene for curli surface fibers
?NC_000913 258684 = 0 (0.000)pseudogene (9/331 nt) crl pseudogene, sigma factor‑binding protein, RNA polymerase holoenzyme formation stimulator;regulator; Surface structures; transcriptional regulator of cryptic csgA gene for curli surface fibers
* ? NC_000913 = 270756NA (NA)16 (0.130) 4/168 NT NA noncoding (216/1221 nt) IS30 repeat region
?NC_000913 = 270770 NA (NA)noncoding (230/1221 nt) IS30 repeat region
* ? NC_000913 = 271133NA (NA)11 (0.090) 6/168 NT NA noncoding (593/1221 nt) IS30 repeat region
?NC_000913 = 271141 NA (NA)noncoding (601/1221 nt) IS30 repeat region
* ? NC_000913 274347 =NA (NA)32 (0.260) 14/164 NT NA noncoding (803/1195 nt) IS5 repeat region
?NC_000913 274410 = NA (NA)noncoding (740/1195 nt) IS5 repeat region
* ? NC_000913 274384 =NA (NA)22 (0.170) 9/172 NT NA noncoding (766/1195 nt) IS5 repeat region
?NC_000913 274422 = NA (NA)noncoding (728/1195 nt) IS5 repeat region
* ? NC_000913 274525 =NA (NA)22 (0.180) 10/164 NT NA noncoding (625/1195 nt) IS5 repeat region
?NC_000913 274559 = NA (NA)noncoding (591/1195 nt) IS5 repeat region
* ? NC_000913 274620 =NA (NA)14 (0.120) 10/160 NT NA noncoding (530/1195 nt) IS5 repeat region
?NC_000913 274663 = NA (NA)noncoding (487/1195 nt) IS5 repeat region
* ? NC_000913 = 274695NA (NA)25 (0.190) 12/170 NT NA noncoding (455/1195 nt) IS5 repeat region
?NC_000913 = 274727 NA (NA)noncoding (423/1195 nt) IS5 repeat region
* ? NC_000913 = 275007NA (NA)59 (0.450) 14/172 NT NA noncoding (143/1195 nt) IS5 repeat region
?NC_000913 = 275025 NA (NA)noncoding (125/1195 nt) IS5 repeat region
* ? NC_000913 303617 =122 (0.900)19 (0.160) 11/152 NT 16.7% intergenic (+12/+236) yagU/ykgJ DUF1440 family inner membrane acid resistance protein/UPF0153 cysteine cluster protein
?NC_000913 303650 = 85 (0.740)intergenic (+45/+203) yagU/ykgJ DUF1440 family inner membrane acid resistance protein/UPF0153 cysteine cluster protein
* ? NC_000913 = 315520NA (NA)5 (0.040) 4/164 NT NA noncoding (292/1255 nt) IS3 repeat region
?NC_000913 = 315537 NA (NA)noncoding (309/1255 nt) IS3 repeat region
* ? NC_000913 315563 =NA (NA)15 (0.120) 9/158 NT NA noncoding (335/1255 nt) IS3 repeat region
?NC_000913 315599 = NA (NA)noncoding (371/1255 nt) IS3 repeat region
* ? NC_000913 = 315572NA (NA)23 (0.190) 9/158 NT NA noncoding (344/1255 nt) IS3 repeat region
?NC_000913 = 315588 NA (NA)noncoding (360/1255 nt) IS3 repeat region
* ? NC_000913 315642 =NA (NA)31 (0.240) 9/168 NT NA noncoding (414/1255 nt) IS3 repeat region
?NC_000913 315671 = NA (NA)noncoding (443/1255 nt) IS3 repeat region
* ? NC_000913 315892 =NA (NA)15 (0.110) 8/172 NT NA noncoding (664/1255 nt) IS3 repeat region
?NC_000913 315923 = NA (NA)noncoding (695/1255 nt) IS3 repeat region
* ? NC_000913 315991 =NA (NA)24 (0.190) 11/170 NT NA noncoding (763/1255 nt) IS3 repeat region
?NC_000913 316014 = NA (NA)noncoding (786/1255 nt) IS3 repeat region
* ? NC_000913 = 316201NA (NA)25 (0.210) 8/160 NT NA noncoding (973/1255 nt) IS3 repeat region
?NC_000913 = 316220 NA (NA)noncoding (992/1255 nt) IS3 repeat region
* ? NC_000913 = 34984584 (0.670)19 (0.150) 3/164 NT 18.4% noncoding (241/365 nt) REP25 (repetitive extragenic palindromic) element; contains 8 REP sequences REP25 (repetitive extragenic palindromic) element; contains 8 REP sequences
?NC_000913 = 349969 NA (NA)noncoding (365/365 nt) REP25 (repetitive extragenic palindromic) element; contains 8 REP sequences REP25 (repetitive extragenic palindromic) element; contains 8 REP sequences
* ? NC_000913 381663 =NA (NA)30 (0.240) 11/164 NT NA noncoding (404/1331 nt) IS2 repeat region
?NC_000913 381703 = NA (NA)noncoding (444/1331 nt) IS2 repeat region
* ? NC_000913 = 381669NA (NA)37 (0.300) 13/164 NT NA noncoding (410/1331 nt) IS2 repeat region
?NC_000913 = 381695 NA (NA)noncoding (436/1331 nt) IS2 repeat region
* ? NC_000913 381681 =NA (NA)9 (0.070) 6/160 NT NA noncoding (422/1331 nt) IS2 repeat region
?NC_000913 381753 = NA (NA)noncoding (494/1331 nt) IS2 repeat region
* ? NC_000913 381819 =NA (NA)37 (0.300) 11/164 NT NA noncoding (560/1331 nt) IS2 repeat region
?NC_000913 381841 = NA (NA)noncoding (582/1331 nt) IS2 repeat region
* ? NC_000913 = 381910NA (NA)64 (0.510) 13/166 NT NA noncoding (651/1331 nt) IS2 repeat region
?NC_000913 = 381923 NA (NA)noncoding (664/1331 nt) IS2 repeat region
* ? NC_000913 382110 =NA (NA)23 (0.180) 6/168 NT NA noncoding (851/1331 nt) IS2 repeat region
?NC_000913 382141 = NA (NA)noncoding (882/1331 nt) IS2 repeat region
* ? NC_000913 = 382129NA (NA)14 (0.110) 8/172 NT NA noncoding (870/1331 nt) IS2 repeat region
?NC_000913 = 382146 NA (NA)noncoding (887/1331 nt) IS2 repeat region
* ? NC_000913 382237 =NA (NA)14 (0.110) 7/166 NT NA noncoding (978/1331 nt) IS2 repeat region
?NC_000913 382267 = NA (NA)noncoding (1008/1331 nt) IS2 repeat region
* ? NC_000913 = 382242NA (NA)25 (0.200) 9/166 NT NA noncoding (983/1331 nt) IS2 repeat region
?NC_000913 = 382260 NA (NA)noncoding (1001/1331 nt) IS2 repeat region
* ? NC_000913 382282 =NA (NA)25 (0.200) 10/166 NT NA noncoding (1023/1331 nt) IS2 repeat region
?NC_000913 382313 = NA (NA)noncoding (1054/1331 nt) IS2 repeat region
* ? NC_000913 = 382323NA (NA)18 (0.140) 11/168 NT NA noncoding (1064/1331 nt) IS2 repeat region
?NC_000913 = 382348 NA (NA)noncoding (1089/1331 nt) IS2 repeat region
* ? NC_000913 507677 =138 (1.020)24 (0.190) 9/168 NT 16.6% coding (404/795 nt) ybaP TraB family protein
?NC_000913 507702 = 111 (0.870)coding (379/795 nt) ybaP TraB family protein
* ? NC_000913 = 570701129 (0.950)22 (0.180) 7/164 NT 15.8% intergenic (+273/‑192) ybcK/ybcL DLP12 prophage; putative recombinase/inactive polymorphonuclear leukocyte migration suppressor; DLP12 prophage; UPF0098 family secreted protein
?NC_000913 = 570711 116 (0.930)intergenic (+283/‑182) ybcK/ybcL DLP12 prophage; putative recombinase/inactive polymorphonuclear leukocyte migration suppressor; DLP12 prophage; UPF0098 family secreted protein
* ? NC_000913 = 632332116 (0.860)21 (0.160) 13/172 NT 15.3% coding (151/198 nt) ybdD DUF466 family protein
?NC_000913 = 632374 121 (0.930)coding (193/198 nt) ybdD DUF466 family protein
* ? NC_000913 689269 =NA (NA)5 (0.040) 4/166 NT NA noncoding (6/34 nt) REP59 (repetitive extragenic palindromic) element; contains 1 REP sequences REP59 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 689297 = NA (NA)noncoding (34/34 nt) REP59 (repetitive extragenic palindromic) element; contains 1 REP sequences REP59 (repetitive extragenic palindromic) element; contains 1 REP sequences
* ? NC_000913 707773 =NA (NA)18 (0.150) 8/160 NT NA noncoding (4/165 nt) RIP63 (repetitive extragenic palindromic) element; contains 3 REP sequences and 1 IHF site RIP63 (repetitive extragenic palindromic) element; contains 3 REP sequences and 1 IHF site
?NC_000913 707805 = NA (NA)noncoding (36/165 nt) RIP63 (repetitive extragenic palindromic) element; contains 3 REP sequences and 1 IHF site RIP63 (repetitive extragenic palindromic) element; contains 3 REP sequences and 1 IHF site
* ? NC_000913 731060 =NA (NA)4 (0.030) 3/166 NT NA coding (1478/4194 nt) rhsC Rhs protein with putative toxin domain; putative neighboring cell growth inhibitor
?NC_000913 731092 = NA (NA)coding (1510/4194 nt) rhsC Rhs protein with putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 732857 =NA (NA)39 (0.300) 9/170 NT 33.5% coding (3275/4194 nt) rhsC Rhs protein with putative toxin domain; putative neighboring cell growth inhibitor
?NC_000913 732888 = 81 (0.600)coding (3306/4194 nt) rhsC Rhs protein with putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 = 792267NA (NA)11 (0.090) 6/164 NT NA noncoding (4/34 nt) REP71 (repetitive extragenic palindromic) element; contains 1 REP sequences REP71 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 = 792297 NA (NA)noncoding (34/34 nt) REP71 (repetitive extragenic palindromic) element; contains 1 REP sequences REP71 (repetitive extragenic palindromic) element; contains 1 REP sequences
* ? NC_000913 = 937227NA (NA)10 (0.080) 5/162 NT NA noncoding (4/36 nt) REP85 (repetitive extragenic palindromic) element; contains 1 REP sequences REP85 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 = 937259 NA (NA)noncoding (36/36 nt) REP85 (repetitive extragenic palindromic) element; contains 1 REP sequences REP85 (repetitive extragenic palindromic) element; contains 1 REP sequences
* ? NC_000913 937227 =NA (NA)15 (0.120) 8/162 NT NA noncoding (4/36 nt) REP85 (repetitive extragenic palindromic) element; contains 1 REP sequences REP85 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 937261 = NA (NA)intergenic (+48/‑111) ftsK/lolA DNA translocase at septal ring sorting daughter chromsomes/lipoprotein chaperone
* ? NC_000913 = 1054940113 (0.830)22 (0.170) 7/170 NT 16.4% coding (1239/2745 nt) torS hybrid sensory histidine kinase in two‑component regulatory system with TorR
?NC_000913 = 1054956 117 (0.910)coding (1223/2745 nt) torS hybrid sensory histidine kinase in two‑component regulatory system with TorR
* ? NC_000913 = 1084726NA (NA)11 (0.090) 7/162 NT NA noncoding (45/86 nt) REP95 (repetitive extragenic palindromic) element; contains 2 REP sequences REP95 (repetitive extragenic palindromic) element; contains 2 REP sequences
?NC_000913 = 1084773 NA (NA)intergenic (+126/‑219) efeB/phoH deferrrochelatase, periplasmic/ATP‑binding protein; putative PhoH family P‑loop ATPase
* ? NC_000913 1187036 =NA (NA)9 (0.070) 6/168 NT NA coding (1193/1227 nt) pepT peptidase T
?NC_000913 1187066 = NA (NA)coding (1223/1227 nt) pepT peptidase T
* ? NC_000913 1207790 =12 (0.090)95 (0.860) 61/146 NT 93.7% coding (290/630 nt) stfP e14 prophage; uncharacterized protein
?NC_000913 1209619 = 3 (0.030)pseudogene (1/501 nt) stfE pseudogene, e14 prophage; side tail fiber protein fragment family;Phage or Prophage Related
* ? NC_000913 = 120780511 (0.080)108 (0.970) 69/146 NT 94.7% coding (305/630 nt) stfP e14 prophage; uncharacterized protein
?NC_000913 = 1209602 3 (0.030)pseudogene (18/501 nt) stfE pseudogene, e14 prophage; side tail fiber protein fragment family;Phage or Prophage Related
* ? NC_000913 1269276 =62 (0.460)15 (0.120) 8/162 NT 16.8% intergenic (‑1/+427) ldrA/ldrB toxic polypeptide, small/toxic polypeptide, small
?NC_000913 1269314 = 92 (0.750)intergenic (‑39/+389) ldrA/ldrB toxic polypeptide, small/toxic polypeptide, small
* ? NC_000913 = 12994980 (0.000)121 (0.940) 77/170 NT 100% intergenic (+253/‑1684) ychE/oppA UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein
?NC_000913 1300698 = 0 (0.000)intergenic (+1453/‑484) ychE/oppA UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein
* ? NC_000913 = 1432761NA (NA)18 (0.140) 7/170 NT NA coding (351/576 nt) tfaR Rac prophage; putative tail fiber assembly protein
?NC_000913 = 1432785 NA (NA)coding (375/576 nt) tfaR Rac prophage; putative tail fiber assembly protein
* ? NC_000913 2252796 =NA (NA)14 (0.110) 8/164 NT NA noncoding (1/91 nt) RIP157 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site RIP157 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site
?NC_000913 2252829 = NA (NA)noncoding (34/91 nt) RIP157 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site RIP157 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site
* ? NC_000913 2304400 =NA (NA)25 (0.210)
+AGCGGTGTAG
8/158 NT 77.9% intergenic (+7/+708) eco/mqo ecotin, a serine protease inhibitor/malate dehydrogenase, FAD/NAD(P)‑binding domain
?NC_000913 2304923 = 8 (0.060)noncoding (507/655 nt) REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences
* ? NC_000913 = 230447793 (0.690)27 (0.220) 7/164 NT 22.4% noncoding (61/655 nt) REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences
?NC_000913 = 2304495 102 (0.820)noncoding (79/655 nt) REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences
* ? NC_000913 2304654 =NA (NA)8 (0.060) 3/164 NT 100% noncoding (238/655 nt) REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences
?NC_000913 2304670 = 0 (0.000)noncoding (254/655 nt) REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences
* ? NC_000913 = 2440342NA (NA)7 (0.060) 5/166 NT NA intergenic (‑222/+43) yfcJ/fabB putative arabinose efflux transporter/3‑oxoacyl‑[acyl‑carrier‑protein] synthase I
?NC_000913 = 2440374 NA (NA)noncoding (32/36 nt) REP170 (repetitive extragenic palindromic) element; contains 1 REP sequences REP170 (repetitive extragenic palindromic) element; contains 1 REP sequences
* ? NC_000913 = 2502824108 (0.800)22 (0.180) 11/164 NT 17.9% coding (1662/2496 nt) fryA putative PTS enzyme: Hpr, enzyme I and IIA components
?NC_000913 = 2502837 103 (0.830)coding (1649/2496 nt) fryA putative PTS enzyme: Hpr, enzyme I and IIA components
* ? NC_000913 2568185 =NA (NA)6 (0.060)
+ACCCGCTACACACCCCGCAG
6/138 NT NA noncoding (47/183 nt) REP178 (repetitive extragenic palindromic) element; contains 4 REP sequences REP178 (repetitive extragenic palindromic) element; contains 4 REP sequences
?NC_000913 = 3217522 NA (NA)noncoding (89/89 nt) REP229 (repetitive extragenic palindromic) element; contains 2 REP sequences REP229 (repetitive extragenic palindromic) element; contains 2 REP sequences
* ? NC_000913 2617939 =NA (NA)14 (0.110) 9/164 NT NA intergenic (+2/+136) yfgD/hda putative oxidoreductase/ATPase regulatory factor involved in DnaA inactivation
?NC_000913 2617967 = NA (NA)intergenic (+30/+108) yfgD/hda putative oxidoreductase/ATPase regulatory factor involved in DnaA inactivation
* ? NC_000913 = 2662541NA (NA)17 (0.140) 6/164 NT NA noncoding (233/266 nt) REP184 (repetitive extragenic palindromic) element; contains 6 REP sequences REP184 (repetitive extragenic palindromic) element; contains 6 REP sequences
?NC_000913 = 2662574 NA (NA)noncoding (266/266 nt) REP184 (repetitive extragenic palindromic) element; contains 6 REP sequences REP184 (repetitive extragenic palindromic) element; contains 6 REP sequences
* ? NC_000913 2726200 =NA (NA)89 (0.710) 13/166 NT NA intergenic (‑12/+81) rrfG/rrlG 5S ribosomal RNA of rrnG operon/23S ribosomal RNA of rrnG operon
?NC_000913 2726224 = NA (NA)intergenic (‑36/+57) rrfG/rrlG 5S ribosomal RNA of rrnG operon/23S ribosomal RNA of rrnG operon
* ? NC_000913 2726352 =NA (NA)11 (0.090) 5/168 NT NA noncoding (2833/2904 nt) rrlG 23S ribosomal RNA of rrnG operon
?NC_000913 2726373 = NA (NA)noncoding (2812/2904 nt) rrlG 23S ribosomal RNA of rrnG operon
* ? NC_000913 2728214 =NA (NA)60 (0.460) 15/170 NT NA noncoding (971/2904 nt) rrlG 23S ribosomal RNA of rrnG operon
?NC_000913 2728240 = NA (NA)noncoding (945/2904 nt) rrlG 23S ribosomal RNA of rrnG operon
* ? NC_000913 = 2729452NA (NA)13 (0.110) 6/158 NT NA intergenic (‑8/+164) gltW/rrsG tRNA‑Glu/16S ribosomal RNA of rrnG operon
?NC_000913 = 2729474 NA (NA)intergenic (‑30/+142) gltW/rrsG tRNA‑Glu/16S ribosomal RNA of rrnG operon
* ? NC_000913 = 2794135NA (NA)15 (0.120) 8/168 NT NA noncoding (108/136 nt) REP191 (repetitive extragenic palindromic) element; contains 3 REP sequences REP191 (repetitive extragenic palindromic) element; contains 3 REP sequences
?NC_000913 = 2794163 NA (NA)noncoding (136/136 nt) REP191 (repetitive extragenic palindromic) element; contains 3 REP sequences REP191 (repetitive extragenic palindromic) element; contains 3 REP sequences
* ? NC_000913 = 308308096 (0.710)17 (0.140) 8/164 NT 15.1% coding (718/921 nt) speB agmatinase
?NC_000913 = 3083094 103 (0.830)coding (704/921 nt) speB agmatinase
* ? NC_000913 = 3277814NA (NA)7 (0.060) 6/162 NT NA intergenic (+13/+42) yhaV/agaR toxin of the SohB(PrlF)‑YhaV toxin‑antitoxin system/transcriptional repressor of the aga regulon
?NC_000913 = 3277847 NA (NA)noncoding (29/29 nt) REP238 (repetitive extragenic palindromic) element; contains 1 REP sequences REP238 (repetitive extragenic palindromic) element; contains 1 REP sequences
* ? NC_000913 3277819 =NA (NA)17 (0.140) 10/162 NT NA noncoding (1/29 nt) REP238 (repetitive extragenic palindromic) element; contains 1 REP sequences REP238 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 3277844 = NA (NA)noncoding (26/29 nt) REP238 (repetitive extragenic palindromic) element; contains 1 REP sequences REP238 (repetitive extragenic palindromic) element; contains 1 REP sequences
* ? NC_000913 3281702 =NA (NA)8 (0.060) 4/164 NT NA noncoding (1/82 nt) REP239 (repetitive extragenic palindromic) element; contains 2 REP sequences REP239 (repetitive extragenic palindromic) element; contains 2 REP sequences
?NC_000913 3281734 = NA (NA)noncoding (33/82 nt) REP239 (repetitive extragenic palindromic) element; contains 2 REP sequences REP239 (repetitive extragenic palindromic) element; contains 2 REP sequences
* ? NC_000913 3296999 =NA (NA)17 (0.140) 11/164 NT NA noncoding (1/84 nt) REP240 (repetitive extragenic palindromic) element; contains 2 REP sequences REP240 (repetitive extragenic palindromic) element; contains 2 REP sequences
?NC_000913 3297032 = NA (NA)noncoding (34/84 nt) REP240 (repetitive extragenic palindromic) element; contains 2 REP sequences REP240 (repetitive extragenic palindromic) element; contains 2 REP sequences
* ? NC_000913 = 3313290NA (NA)13 (0.100) 9/164 NT NA noncoding (39/77 nt) REP242 (repetitive extragenic palindromic) element; contains 2 REP sequences REP242 (repetitive extragenic palindromic) element; contains 2 REP sequences
?NC_000913 = 3313328 NA (NA)noncoding (77/77 nt) REP242 (repetitive extragenic palindromic) element; contains 2 REP sequences REP242 (repetitive extragenic palindromic) element; contains 2 REP sequences
* ? NC_000913 3336878 =NA (NA)10 (0.080) 7/168 NT NA intergenic (‑75/+85) ibaG/mlaB acid stress protein; putative BolA family transcriptional regulator/ABC transporter maintaining OM lipid asymmetry, cytoplasmic STAS component
?NC_000913 3336905 = NA (NA)intergenic (‑102/+58) ibaG/mlaB acid stress protein; putative BolA family transcriptional regulator/ABC transporter maintaining OM lipid asymmetry, cytoplasmic STAS component
* ? NC_000913 = 3546221NA (NA)13 (0.100) 8/166 NT NA intergenic (+22/‑338) nfuA/gntT Fe/S biogenesis protein, putative scaffold/chaperone protein/gluconate transporter, high‑affinity GNT I system
?NC_000913 = 3546253 NA (NA)noncoding (32/36 nt) REP253 (repetitive extragenic palindromic) element; contains 1 REP sequences REP253 (repetitive extragenic palindromic) element; contains 1 REP sequences
* ? NC_000913 = 3620116NA (NA)17 (0.130) 10/166 NT 100% coding (925/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
?NC_000913 = 3620152 0 (0.000)coding (961/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 = 3620220NA (NA)18 (0.140) 9/166 NT 100% coding (1029/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
?NC_000913 = 3620255 0 (0.000)coding (1064/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 3620569 =NA (NA)22 (0.170) 11/166 NT 100% coding (1378/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
?NC_000913 3620582 = 0 (0.000)coding (1391/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 = 3620614NA (NA)25 (0.200) 10/166 NT 100% coding (1423/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
?NC_000913 = 3620635 0 (0.000)coding (1444/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 = 3621314NA (NA)9 (0.070) 6/168 NT 100% coding (2123/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
?NC_000913 = 3621344 0 (0.000)coding (2153/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 3621557 =NA (NA)11 (0.090) 7/170 NT NA coding (2366/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
?NC_000913 3621605 = NA (NA)coding (2414/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 3622540 =NA (NA)22 (0.170) 6/168 NT 100% coding (3349/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
?NC_000913 3622556 = 0 (0.000)coding (3365/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 = 3650792NA (NA)14 (0.110) 9/166 NT NA noncoding (81/100 nt) RIP262 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site RIP262 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site
?NC_000913 = 3650805 NA (NA)noncoding (94/100 nt) RIP262 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site RIP262 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site
* ? NC_000913 = 3674441NA (NA)21 (0.170) 10/164 NT NA noncoding (61/93 nt) REP263 (repetitive extragenic palindromic) element; contains 2 REP sequences REP263 (repetitive extragenic palindromic) element; contains 2 REP sequences
?NC_000913 = 3674473 NA (NA)noncoding (93/93 nt) REP263 (repetitive extragenic palindromic) element; contains 2 REP sequences REP263 (repetitive extragenic palindromic) element; contains 2 REP sequences
* ? NC_000913 = 383736092 (0.680)18 (0.140) 9/168 NT 17.4% coding (408/1185 nt) setC putative arabinose efflux transporter
?NC_000913 = 3837376 84 (0.660)coding (424/1185 nt) setC putative arabinose efflux transporter
* ? NC_000913 = 3884855110 (0.810)23 (0.180) 9/166 NT 17.9% coding (40/258 nt) yidD membrane protein insertion efficiency factor, UPF0161 family inner membrane protein
?NC_000913 = 3884868 109 (0.860)coding (53/258 nt) yidD membrane protein insertion efficiency factor, UPF0161 family inner membrane protein
* ? NC_000913 = 3898636NA (NA)19 (0.150) 10/162 NT NA noncoding (6/26 nt) REP282 (repetitive extragenic palindromic) element; contains 1 REP sequences REP282 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 = 3898650 NA (NA)noncoding (20/26 nt) REP282 (repetitive extragenic palindromic) element; contains 1 REP sequences REP282 (repetitive extragenic palindromic) element; contains 1 REP sequences
* ? NC_000913 = 3943543NA (NA)15 (0.130) 6/156 NT 100% intergenic (+33/‑161) gltU/rrlC tRNA‑Glu/23S ribosomal RNA of rrnC operon
?NC_000913 = 3943583 0 (0.000)intergenic (+73/‑121) gltU/rrlC tRNA‑Glu/23S ribosomal RNA of rrnC operon
* ? NC_000913 3943544 =NA (NA)29 (0.220) 5/174 NT NA intergenic (+34/‑160) gltU/rrlC tRNA‑Glu/23S ribosomal RNA of rrnC operon
?NC_000913 4037399 = NA (NA)intergenic (+64/‑120) alaT/rrlA tRNA‑Ala/23S ribosomal RNA of rrnA operon
* ? NC_000913 = 3943635NA (NA)22 (0.180) 13/164 NT 53.2% intergenic (+125/‑69) gltU/rrlC tRNA‑Glu/23S ribosomal RNA of rrnC operon
?NC_000913 = 4037446 21 (0.160)intergenic (+111/‑73) alaT/rrlA tRNA‑Ala/23S ribosomal RNA of rrnA operon
* ? NC_000913 = 403524426 (0.190)5 (0.040) 5/168 NT 16.9% intergenic (+91/‑287) hemG/rrsA protoporphyrin oxidase, flavoprotein/16S ribosomal RNA of rrnA operon
?NC_000913 = 4035271 NA (NA)intergenic (+118/‑260) hemG/rrsA protoporphyrin oxidase, flavoprotein/16S ribosomal RNA of rrnA operon
* ? NC_000913 4040482 =NA (NA)67 (0.530) 17/166 NT NA intergenic (+59/‑35) rrlA/rrfA 23S ribosomal RNA of rrnA operon/5S ribosomal RNA of rrnA operon
?NC_000913 4040506 = NA (NA)intergenic (+83/‑11) rrlA/rrfA 23S ribosomal RNA of rrnA operon/5S ribosomal RNA of rrnA operon
* ? NC_000913 = 4148478NA (NA)12 (0.100) 9/164 NT NA noncoding (49/82 nt) REP308 (repetitive extragenic palindromic) element; contains 2 REP sequences REP308 (repetitive extragenic palindromic) element; contains 2 REP sequences
?NC_000913 = 4148511 NA (NA)noncoding (82/82 nt) REP308 (repetitive extragenic palindromic) element; contains 2 REP sequences REP308 (repetitive extragenic palindromic) element; contains 2 REP sequences
* ? NC_000913 = 4171803116 (0.860)42 (0.320) 12/174 NT 27.0% intergenic (+47/‑254) rrfB/murB 5S ribosomal RNA of rrnB operon/UDP‑N‑acetylenolpyruvoylglucosamine reductase, FAD‑binding
?NC_000913 = 4213162 NA (NA)intergenic (+3/‑72) rrfE/yjaA 5S ribosomal RNA of rrnE operon/stress‑induced protein
* ? NC_000913 = 4210001NA (NA)25 (0.190) 7/170 NT 17.4% intergenic (+152/‑42) gltV/rrlE tRNA‑Glu/23S ribosomal RNA of rrnE operon
?NC_000913 = 4210039 124 (0.920)intergenic (+190/‑4) gltV/rrlE tRNA‑Glu/23S ribosomal RNA of rrnE operon
* ? NC_000913 4235376 =NA (NA)13 (0.110)
+TCGTCGAT
8/162 NT NA coding (1619/1650 nt) pgi glucosephosphate isomerase
?NC_000913 4285300 = NA (NA)intergenic (‑87/+113) yjcH/acs DUF485 family inner membrane protein/acetyl‑CoA synthetase
* ? NC_000913 4240157 =NA (NA)7 (0.060) 5/164 NT NA noncoding (1/37 nt) REP314 (repetitive extragenic palindromic) element; contains 1 REP sequences REP314 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 4240190 = NA (NA)noncoding (34/37 nt) REP314 (repetitive extragenic palindromic) element; contains 1 REP sequences REP314 (repetitive extragenic palindromic) element; contains 1 REP sequences
* ? NC_000913 4323250 =NA (NA)15 (0.120) 6/164 NT NA noncoding (5/87 nt) REP324 (repetitive extragenic palindromic) element; contains 2 REP sequences REP324 (repetitive extragenic palindromic) element; contains 2 REP sequences
?NC_000913 4323280 = NA (NA)noncoding (35/87 nt) REP324 (repetitive extragenic palindromic) element; contains 2 REP sequences REP324 (repetitive extragenic palindromic) element; contains 2 REP sequences
* ? NC_000913 4415962 =NA (NA)16 (0.130) 9/166 NT NA noncoding (5/34 nt) REP332 (repetitive extragenic palindromic) element; contains 1 REP sequences REP332 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 4415992 = NA (NA)intergenic (+92/+25) aidB/yjfN DNA alkylation damage repair protein; flavin‑containing DNA binding protein, weak isovaleryl CoA dehydrogenase/DUF1471 family periplasmic protein
* ? NC_000913 4460417 =NA (NA)24 (0.190) 8/168 NT NA noncoding (3/84 nt) REP338 (repetitive extragenic palindromic) element; contains 2 REP sequences REP338 (repetitive extragenic palindromic) element; contains 2 REP sequences
?NC_000913 4460445 = NA (NA)noncoding (31/84 nt) REP338 (repetitive extragenic palindromic) element; contains 2 REP sequences REP338 (repetitive extragenic palindromic) element; contains 2 REP sequences
* ? NC_000913 = 4536412NA (NA)12 (0.100) 8/166 NT NA noncoding (8/26 nt) REP344 (repetitive extragenic palindromic) element; contains 1 REP sequences REP344 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 = 4536422 NA (NA)noncoding (18/26 nt) REP344 (repetitive extragenic palindromic) element; contains 1 REP sequences REP344 (repetitive extragenic palindromic) element; contains 1 REP sequences
* ? NC_000913 4542682 =15 (0.110)99 (0.810) 69/160 NT 88.2% intergenic (+49/‑433) fimE/fimA tyrosine recombinase/inversion of on/off regulator of fimA/major type 1 subunit fimbrin (pilin)
?NC_000913 4542996 = 13 (0.110)intergenic (+363/‑119) fimE/fimA tyrosine recombinase/inversion of on/off regulator of fimA/major type 1 subunit fimbrin (pilin)
* ? NC_000913 = 454269018 (0.130)102 (0.840) 71/160 NT 87.5% intergenic (+57/‑425) fimE/fimA tyrosine recombinase/inversion of on/off regulator of fimA/major type 1 subunit fimbrin (pilin)
?NC_000913 = 4542986 13 (0.110)intergenic (+353/‑129) fimE/fimA tyrosine recombinase/inversion of on/off regulator of fimA/major type 1 subunit fimbrin (pilin)
* ? NC_000913 4587871 =NA (NA)13 (0.110) 5/162 NT NA intergenic (+8/+38) mrr/yjiA methylated adenine and cytosine restriction protein/metal‑binding GTPase
?NC_000913 4587900 = NA (NA)intergenic (+37/+9) mrr/yjiA methylated adenine and cytosine restriction protein/metal‑binding GTPase
* ? NC_000913 = 4587878NA (NA)23 (0.190) 9/162 NT NA noncoding (7/27 nt) REP348 (repetitive extragenic palindromic) element; contains 1 REP sequences REP348 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 = 4587891 NA (NA)noncoding (20/27 nt) REP348 (repetitive extragenic palindromic) element; contains 1 REP sequences REP348 (repetitive extragenic palindromic) element; contains 1 REP sequences