mutation predictions | marginal predictions | summary statistics | genome diff | command line log
|
breseq version 0.29.0 revision 8f9c342918e4
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Predicted mutations | ||||||
|---|---|---|---|---|---|---|
| evidence | position | mutation | freq | annotation | gene | description |
| RA | 9,907 | A→C | 17.5% | intergenic (+14/+21) | mog → / ← satP | molybdochelatase incorporating molybdenum into molybdopterin/succinate‑acetate transporter |
| RA | 9,908 | G→T | 17.4% | intergenic (+15/+20) | mog → / ← satP | molybdochelatase incorporating molybdenum into molybdopterin/succinate‑acetate transporter |
| JC | 147,727 | Δ12 bp | 100% | coding (760‑771/903 nt) | yadD → | transposase_31 family protein |
| RA | 151,522 | G→T | 15.2% | A26A (GCC→GCA) | yadK ← | putative fimbrial‑like adhesin protein |
| RA | 252,589 | G→C | 17.3% | A97P (GCA→CCA) | yafO → | mRNA interferase toxin of the YafO‑YafN toxin‑antitoxin system |
| RA | 335,166 | T→A | 19.1% | intergenic (‑144/‑114) | yahC ← / → yahD | putative inner membrane protein/ankyrin repeat protein |
| RA | 448,768 | C→T | 15.5% | W625* (TGG→TAG) | cyoB ← | cytochrome o ubiquinol oxidase subunit I |
| RA | 454,853 | T→C | 15.6% | intergenic (+64/‑280) | bolA → / → tig | stationary‑phase morphogene, transcriptional repressor for mreB; also regulator for dacA, dacC, and ampC/peptidyl‑prolyl cis/trans isomerase (trigger factor) |
| RA | 478,750 | C→T | 18.5% | intergenic (‑133/+31) | ylaB ← / ← ylaC | putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase/DUF1449 family inner membrane protein |
| RA | 478,757 | T→C | 15.9% | intergenic (‑140/+24) | ylaB ← / ← ylaC | putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase/DUF1449 family inner membrane protein |
| RA | 478,759 | A→G | 15.5% | intergenic (‑142/+22) | ylaB ← / ← ylaC | putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase/DUF1449 family inner membrane protein |
| RA | 481,225 | T→G | 18.5% | intergenic (‑517/+29) | tomB ← / ← acrB | Hha toxicity attenuator; conjugation‑related protein/multidrug efflux system protein |
| RA | 481,228 | C→A | 18.5% | intergenic (‑520/+26) | tomB ← / ← acrB | Hha toxicity attenuator; conjugation‑related protein/multidrug efflux system protein |
| RA | 518,860 | A→G | 15.7% | F97S (TTC→TCC) | ybbO ← | putative oxidoreductase |
| RA | 518,863 | C→T | 15.5% | G96E (GGA→GAA) | ybbO ← | putative oxidoreductase |
| RA | 569,160 | G→T | 16.7% | D87Y (GAC→TAC) ‡ | ybcK → | DLP12 prophage; putative recombinase |
| RA | 569,161 | A→C | 15.4% | D87A (GAC→GCC) ‡ | ybcK → | DLP12 prophage; putative recombinase |
| RA | 657,531 | T→G | 19.0% | intergenic (+30/+24) | cspE → / ← flc | constitutive cold shock family transcription antitermination protein; negative regulator of cspA transcription; RNA melting protein; ssDNA‑binding protein/fluoride efflux channel, dual topology membrane protein |
| RA | 657,533 | A→T | 18.3% | intergenic (+32/+22) | cspE → / ← flc | constitutive cold shock family transcription antitermination protein; negative regulator of cspA transcription; RNA melting protein; ssDNA‑binding protein/fluoride efflux channel, dual topology membrane protein |
| RA | 657,535 | C→A | 18.7% | intergenic (+34/+20) | cspE → / ← flc | constitutive cold shock family transcription antitermination protein; negative regulator of cspA transcription; RNA melting protein; ssDNA‑binding protein/fluoride efflux channel, dual topology membrane protein |
| RA | 710,170 | C→T | 18.3% | intergenic (+54/+30) | chiQ → / ← fur | chitosugar‑induced verified lipoprotein/ferric iron uptake regulon transcriptional repressor; autorepressor |
| RA | 710,173 | A→G | 17.5% | intergenic (+57/+27) | chiQ → / ← fur | chitosugar‑induced verified lipoprotein/ferric iron uptake regulon transcriptional repressor; autorepressor |
| RA | 721,004 | T→A | 15.5% | intergenic (+164/+52) | ybfK → / ← kdpE | uncharacterized protein/response regulator in two‑component regulatory system with KdpD |
| RA | 721,006 | T→A | 15.9% | intergenic (+166/+50) | ybfK → / ← kdpE | uncharacterized protein/response regulator in two‑component regulatory system with KdpD |
| RA | 721,009 | T→A | 15.9% | intergenic (+169/+47) | ybfK → / ← kdpE | uncharacterized protein/response regulator in two‑component regulatory system with KdpD |
| RA | 721,011 | T→A | 15.7% | intergenic (+171/+45) | ybfK → / ← kdpE | uncharacterized protein/response regulator in two‑component regulatory system with KdpD |
| RA | 756,725 | G→A | 15.3% | M273I (ATG→ATA) | sdhA → | succinate dehydrogenase, flavoprotein subunit |
| RA | 850,995 | T→G | 15.7% | intergenic (+30/+19) | ompX → / ← opgE | outer membrane protein X/OPG biosynthetic transmembrane phosphoethanolamine transferase |
| RA | 850,996 | C→A | 16.9% | intergenic (+31/+18) | ompX → / ← opgE | outer membrane protein X/OPG biosynthetic transmembrane phosphoethanolamine transferase |
| RA | 850,998 | G→A | 16.4% | intergenic (+33/+16) | ompX → / ← opgE | outer membrane protein X/OPG biosynthetic transmembrane phosphoethanolamine transferase |
| RA | 922,316:1 | +C | 15.8% | intergenic (+23/+50) | macB → / ← cspD | macrolide ABC transporter peremase/ATPase/inhibitor of DNA replication, cold shock protein homolog |
| RA | 1,020,958 | A→T | 15.3% | intergenic (‑39/‑180) | sulA ← / → sxy | SOS cell division inhibitor/CRP‑S‑dependent promoter expression factor |
| RA | 1,052,257 | C→T | 16.8% | intergenic (+17/+32) | gnsA → / ← yccM | putative phosphatidylethanolamine synthesis regulator/putative 4Fe‑4S membrane protein |
| RA | 1,143,998 | C→T | 100% | G124S (GGT→AGT) | rne ← | endoribonuclease; RNA‑binding protein;RNA degradosome binding protein |
| RA | 1,224,239 | A→T | 16.2% | intergenic (+332/+40) | ycgI → / ← minE | pseudogene/cell division topological specificity factor |
| RA | 1,224,242 | A→T | 17.7% | intergenic (+335/+37) | ycgI → / ← minE | pseudogene/cell division topological specificity factor |
| JC JC | 1,293,033 | IS1 (+) +9 bp | 100% | intergenic (‑111/‑486) | hns ← / → tdk | global DNA‑binding transcriptional dual regulator H‑NS/thymidine kinase/deoxyuridine kinase |
| RA | 1,298,278 | T→A | 15.5% | intergenic (‑157/‑320) | adhE ← / → ychE | fused acetaldehyde‑CoA dehydrogenase/iron‑dependent alcohol dehydrogenase/pyruvate‑formate lyase deactivase/UPF0056 family inner membrane protein |
| RA | 1,298,284 | T→A | 16.0% | intergenic (‑163/‑314) | adhE ← / → ychE | fused acetaldehyde‑CoA dehydrogenase/iron‑dependent alcohol dehydrogenase/pyruvate‑formate lyase deactivase/UPF0056 family inner membrane protein |
| RA | 1,306,787 | G→A | 16.9% | intergenic (+19/+34) | oppF → / ← yciU | oligopeptide ABC transporter ATPase/UPF0263 family protein |
| RA | 1,306,788 | T→C | 17.5% | intergenic (+20/+33) | oppF → / ← yciU | oligopeptide ABC transporter ATPase/UPF0263 family protein |
| RA | 1,311,830 | A→G | 15.6% | intergenic (+22/+18) | tonB → / ← yciA | membrane spanning protein in TonB‑ExbB‑ExbD transport complex/acyl‑CoA esterase |
| RA | 1,311,831 | C→T | 15.9% | intergenic (+23/+17) | tonB → / ← yciA | membrane spanning protein in TonB‑ExbB‑ExbD transport complex/acyl‑CoA esterase |
| RA | 1,524,458:1 | +T | 15.7% | intergenic (+90/+23) | yncE → / ← ansP | ATP‑binding protein, periplasmic, function unknown/L‑asparagine transporter |
| RA | 1,524,463 | Δ1 bp | 15.4% | intergenic (+95/+18) | yncE → / ← ansP | ATP‑binding protein, periplasmic, function unknown/L‑asparagine transporter |
| RA | 1,530,490 | T→C | 16.3% | intergenic (+86/‑96) | ydcD → / → yncI | putative immunity protein for RhsE/pseudogene |
| RA | 1,530,499 | A→C | 16.5% | intergenic (+95/‑87) | ydcD → / → yncI | putative immunity protein for RhsE/pseudogene |
| RA | 1,530,505 | G→A | 15.8% | intergenic (+101/‑81) | ydcD → / → yncI | putative immunity protein for RhsE/pseudogene |
| RA | 1,541,077 | G→C | 15.0% | A505G (GCC→GGC) | narZ ← | nitrate reductase 2 (NRZ), alpha subunit |
| RA | 1,572,928 | C→G | 15.9% | A759P (GCA→CCA) | pqqL ← | putative periplasmic M16 family zinc metalloendopeptidase |
| RA | 1,597,272 | T→A | 15.8% | pseudogene (716/3861 nt) | yneO ← | pseudogene, AidA homolog |
| RA | 1,823,335 | G→C | 16.0% | intergenic (+50/‑180) | nadE → / → cho | NAD synthetase, NH3/glutamine‑dependent/endonuclease of nucleotide excision repair |
| RA | 1,823,338 | G→C | 16.7% | intergenic (+53/‑177) | nadE → / → cho | NAD synthetase, NH3/glutamine‑dependent/endonuclease of nucleotide excision repair |
| RA | 1,892,363 | A→G | 15.9% | Y291Y (TAT→TAC) | yoaA ← | putative ATP‑dependent helicase, DinG family |
| RA | 1,950,296:1 | +C | 15.3% | coding (227/1773 nt) | aspS ← | aspartyl‑tRNA synthetase |
| RA | 1,950,306 | C→G | 15.7% | G73R (GGC→CGC) | aspS ← | aspartyl‑tRNA synthetase |
| MC JC | 1,978,503 | Δ776 bp | 100% | insB1–insA | insB1, insA | |
| JC JC | 1,979,486 | IS5 (+) +4 bp | 100% | intergenic (‑271/‑264) | insA ← / → uspC | IS1 repressor TnpA/universal stress protein |
| RA | 1,999,231 | T→A | 15.6% | T84S (ACT→TCT) | dcyD ← | D‑cysteine desulfhydrase, PLP‑dependent |
| RA | 2,089,854 | A→T | 16.8% | intergenic (‑141/‑142) | yefM ← / → hisL | antitoxin of the YoeB‑YefM toxin‑antitoxin system/his operon leader peptide |
| RA | 2,173,363 | Δ2 bp | 100% | intergenic (‑1/+1) | gatC ← / ← gatC | pseudogene, galactitol‑specific enzyme IIC component of PTS;transport; Transport of small molecules: Carbohydrates, organic acids, alcohols; PTS system galactitol‑specific enzyme IIC/pseudogene, galactitol‑specific enzyme IIC component of PTS;transport; Transport of small molecules: Carbohydrates, organic acids, alcohols; PTS system galactitol‑specific enzyme IIC |
| RA | 2,364,995 | T→G | 17.5% | intergenic (+16/+23) | nudI → / ← ais | nucleoside triphosphatase/putative LPS core heptose(II)‑phosphate phosphatase |
| RA | 2,364,998 | C→A | 16.5% | intergenic (+19/+20) | nudI → / ← ais | nucleoside triphosphatase/putative LPS core heptose(II)‑phosphate phosphatase |
| RA | 2,391,414 | C→G | 16.1% | R31P (CGA→CCA) | nuoN ← | NADH:ubiquinone oxidoreductase, membrane subunit N |
| RA | 2,391,417 | C→G | 16.6% | W30S (TGG→TCG) | nuoN ← | NADH:ubiquinone oxidoreductase, membrane subunit N |
| RA | 2,449,615 | C→G | 16.7% | G145G (GGG→GGC) ‡ | yfcO ← | DUF2544 family putative outer membrane protein |
| RA | 2,449,616 | C→G | 16.6% | G145A (GGG→GCG) ‡ | yfcO ← | DUF2544 family putative outer membrane protein |
| RA | 2,449,624 | Δ1 bp | 16.4% | coding (426/822 nt) | yfcO ← | DUF2544 family putative outer membrane protein |
| RA | 2,457,128 | T→A | 17.4% | M678L (ATG→TTG) | fadJ ← | enoyl‑CoA hydratase/epimerase and isomerase/3‑hydroxyacyl‑CoA dehydrogenase |
| RA | 2,457,131 | T→A | 17.0% | I677L (ATA→TTA) | fadJ ← | enoyl‑CoA hydratase/epimerase and isomerase/3‑hydroxyacyl‑CoA dehydrogenase |
| RA | 2,707,320 | A→T | 15.8% | intergenic (‑196/+2) | lepA ← / ← rseC | back‑translocating elongation factor EF4, GTPase/SoxR iron‑sulfur cluster reduction factor component |
| RA | 2,707,321 | A→T | 15.6% | intergenic (‑197/+1) | lepA ← / ← rseC | back‑translocating elongation factor EF4, GTPase/SoxR iron‑sulfur cluster reduction factor component |
| RA | 2,731,073 | A→T | 15.0% | noncoding (85/1542 nt) | rrsG ← | 16S ribosomal RNA of rrnG operon |
| RA | 2,838,222 | A→T | 15.3% | intergenic (‑117/+32) | hydN ← / ← ascG | formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit/asc operon transcriptional repressor; prpBC operon repressor |
| RA | 2,917,345 | G→A | 100% | G763G (GGG→GGA) | barA → | hybrid sensory histidine kinase, in two‑component regulatory system with UvrY |
| RA | 3,057,140 | A→G | 15.5% | intergenic (‑191/+38) | ibsC ← / ← serA | toxic membrane protein/D‑3‑phosphoglycerate dehydrogenase |
| RA | 3,057,145 | G→C | 16.0% | intergenic (‑196/+33) | ibsC ← / ← serA | toxic membrane protein/D‑3‑phosphoglycerate dehydrogenase |
| RA | 3,057,150 | C→T | 17.5% | intergenic (‑201/+28) | ibsC ← / ← serA | toxic membrane protein/D‑3‑phosphoglycerate dehydrogenase |
| RA | 3,067,320 | A→T | 20.0% | intergenic (‑147/+20) | ygfI ← / ← yggE | putative DNA‑binding transcriptional regulator/oxidative stress defense protein |
| RA | 3,067,323 | A→T | 19.4% | intergenic (‑150/+17) | ygfI ← / ← yggE | putative DNA‑binding transcriptional regulator/oxidative stress defense protein |
| RA | 3,068,922 | G→T | 15.2% | intergenic (‑114/+25) | argO ← / ← mscS | arginine transporter/mechanosensitive channel protein, small conductance |
| RA | 3,068,924 | G→A | 15.3% | intergenic (‑116/+23) | argO ← / ← mscS | arginine transporter/mechanosensitive channel protein, small conductance |
| RA | 3,068,927 | T→C | 15.0% | intergenic (‑119/+20) | argO ← / ← mscS | arginine transporter/mechanosensitive channel protein, small conductance |
| RA | 3,068,929 | A→C | 15.2% | intergenic (‑121/+18) | argO ← / ← mscS | arginine transporter/mechanosensitive channel protein, small conductance |
| RA | 3,078,186 | C→T | 15.3% | G225D (GGC→GAC) | cmtA ← | putative mannitol‑specific PTS IIB and IIC components |
| RA | 3,078,191 | A→G | 16.1% | G223G (GGT→GGC) | cmtA ← | putative mannitol‑specific PTS IIB and IIC components |
| RA | 3,156,590 | C→A | 17.4% | intergenic (+72/‑33) | yqhD → / → dkgA | aldehyde reductase, NADPH‑dependent/2,5‑diketo‑D‑gluconate reductase A |
| RA | 3,156,591 | T→G | 17.1% | intergenic (+73/‑32) | yqhD → / → dkgA | aldehyde reductase, NADPH‑dependent/2,5‑diketo‑D‑gluconate reductase A |
| RA | 3,171,852 | C→T | 17.2% | intergenic (+19/+27) | qseC → / ← ygiZ | quorum sensing sensory histidine kinase in two‑component regulatory system with QseB/inner membrane protein |
| RA | 3,171,857 | A→T | 17.4% | intergenic (+24/+22) | qseC → / ← ygiZ | quorum sensing sensory histidine kinase in two‑component regulatory system with QseB/inner membrane protein |
| RA | 3,171,858 | A→T | 17.6% | intergenic (+25/+21) | qseC → / ← ygiZ | quorum sensing sensory histidine kinase in two‑component regulatory system with QseB/inner membrane protein |
| RA | 3,171,863 | A→G | 17.2% | intergenic (+30/+16) | qseC → / ← ygiZ | quorum sensing sensory histidine kinase in two‑component regulatory system with QseB/inner membrane protein |
| RA | 3,318,344 | G→A | 62.9% | intergenic (‑55/‑293) | metY ← / → argG | tRNA‑Met/argininosuccinate synthetase |
| RA | 3,471,357 | C→T | 15.5% | intergenic (‑28/+43) | tufA ← / ← fusA | translation elongation factor EF‑Tu 1/protein chain elongation factor EF‑G, GTP‑binding |
| RA | 3,560,455:1 | +G | 100% | intergenic (‑2/+1) | glpR ← / ← glpR | pseudogene, DNA‑binding transcriptional repressor;regulator; Energy metabolism, carbon: Anaerobic respiration; repressor of the glp operon/pseudogene, DNA‑binding transcriptional repressor;regulator; Energy metabolism, carbon: Anaerobic respiration; repressor of the glp operon |
| RA | 3,566,544 | C→A | 100% | S13I (AGC→ATC) | glgP ← | glycogen phosphorylase |
| RA | 3,705,970 | G→A | 23.1% | intergenic (‑180/+128) | dppB ← / ← dppA | dipeptide/heme ABC transporter permease/dipeptide/heme ABC transporter periplasmic binding protein; dipeptide chemotaxis receptor |
| RA | 3,705,971 | C→A | 23.1% | intergenic (‑181/+127) | dppB ← / ← dppA | dipeptide/heme ABC transporter permease/dipeptide/heme ABC transporter periplasmic binding protein; dipeptide chemotaxis receptor |
| RA | 3,705,978 | A→C | 24.4% | intergenic (‑188/+120) | dppB ← / ← dppA | dipeptide/heme ABC transporter permease/dipeptide/heme ABC transporter periplasmic binding protein; dipeptide chemotaxis receptor |
| RA | 3,705,984 | T→G | 35.8% | intergenic (‑194/+114) | dppB ← / ← dppA | dipeptide/heme ABC transporter permease/dipeptide/heme ABC transporter periplasmic binding protein; dipeptide chemotaxis receptor |
| RA | 3,705,985 | T→C | 35.2% | intergenic (‑195/+113) | dppB ← / ← dppA | dipeptide/heme ABC transporter permease/dipeptide/heme ABC transporter periplasmic binding protein; dipeptide chemotaxis receptor |
| RA | 3,706,028 | T→C | 23.4% | intergenic (‑238/+70) | dppB ← / ← dppA | dipeptide/heme ABC transporter permease/dipeptide/heme ABC transporter periplasmic binding protein; dipeptide chemotaxis receptor |
| RA | 3,706,048 | G→T | 27.0% | intergenic (‑258/+50) | dppB ← / ← dppA | dipeptide/heme ABC transporter permease/dipeptide/heme ABC transporter periplasmic binding protein; dipeptide chemotaxis receptor |
| RA | 3,714,163:1 | +T | 15.8% | coding (2232/2334 nt) | bisC ← | biotin sulfoxide reductase |
| RA | 3,714,168 | Δ1 bp | 15.2% | coding (2227/2334 nt) | bisC ← | biotin sulfoxide reductase |
| RA | 3,790,300 | A→T | 18.9% | intergenic (‑219/+20) | waaH ← / ← tdh | LPS(HepIII)‑glucuronic acid glycosyltransferase/L‑threonine 3‑dehydrogenase, NAD(P)‑binding |
| RA | 3,790,303 | A→T | 19.0% | intergenic (‑222/+17) | waaH ← / ← tdh | LPS(HepIII)‑glucuronic acid glycosyltransferase/L‑threonine 3‑dehydrogenase, NAD(P)‑binding |
| RA | 3,810,321 | T→C | 15.2% | intergenic (+17/+22) | coaD → / ← mutM | pantetheine‑phosphate adenylyltransferase/formamidopyrimidine/5‑formyluracil/ 5‑hydroxymethyluracil DNA glycosylase |
| RA | 3,810,324 | G→A | 15.0% | intergenic (+20/+19) | coaD → / ← mutM | pantetheine‑phosphate adenylyltransferase/formamidopyrimidine/5‑formyluracil/ 5‑hydroxymethyluracil DNA glycosylase |
| MC JC | 3,815,859 | Δ82 bp | 100% | [rph]–[rph] | [rph], [rph] | |
| RA | 3,831,757 | C→T | 15.9% | A434V (GCC→GTC) | yicH → | putative inner membrane‑anchored periplasmic AsmA family protein |
| RA | 3,891,502 | C→G | 19.4% | intergenic (+19/‑113) | tnaB → / → mdtL | tryptophan transporter of low affinity/multidrug efflux system protein |
| RA | 3,891,504 | T→A | 18.3% | intergenic (+21/‑111) | tnaB → / → mdtL | tryptophan transporter of low affinity/multidrug efflux system protein |
| RA | 3,891,506 | C→G | 17.0% | intergenic (+23/‑109) | tnaB → / → mdtL | tryptophan transporter of low affinity/multidrug efflux system protein |
| RA | 4,051,259 | G→T | 15.4% | intergenic (‑494/‑88) | yihA ← / → yihI | cell division GTP‑binding protein/activator of Der GTPase |
| RA | 4,051,262 | A→C | 15.2% | intergenic (‑497/‑85) | yihA ← / → yihI | cell division GTP‑binding protein/activator of Der GTPase |
| RA | 4,060,264 | A→C | 15.2% | intergenic (+34/‑183) | typA → / → yihL | GTP‑binding protein/putative DNA‑binding transcriptional regulator |
| RA | 4,113,473 | T→C | 16.0% | L61L (TTG→CTG) ‡ | uspD → | stress‑induced protein |
| RA | 4,113,474 | T→A | 16.4% | L61* (TTG→TAG) ‡ | uspD → | stress‑induced protein |
| RA | 4,113,475 | G→A | 16.9% | L61L (TTG→TTA) ‡ | uspD → | stress‑induced protein |
| RA | 4,177,171 | T→A | 16.0% | intergenic (+43/‑187) | tufB → / → secE | translation elongation factor EF‑Tu 2/preprotein translocase membrane subunit |
| RA | 4,185,470 | C→A | 18.0% | P41T (CCG→ACG) | rpoC → | RNA polymerase, beta prime subunit |
| RA | 4,227,550 | G→A | 16.8% | intergenic (+39/‑181) | metH → / → yjbB | homocysteine‑N5‑methyltetrahydrofolate transmethylase, B12‑dependent/putative Na+/Pi‑cotransporter |
| RA | 4,227,555 | A→T | 16.8% | intergenic (+44/‑176) | metH → / → yjbB | homocysteine‑N5‑methyltetrahydrofolate transmethylase, B12‑dependent/putative Na+/Pi‑cotransporter |
| RA | 4,227,560 | T→C | 17.4% | intergenic (+49/‑171) | metH → / → yjbB | homocysteine‑N5‑methyltetrahydrofolate transmethylase, B12‑dependent/putative Na+/Pi‑cotransporter |
| RA | 4,296,060 | C→T | 27.1% | intergenic (+266/+376) | gltP → / ← yjcO | glutamate/aspartate:proton symporter/Sel1 family TPR‑like repeat protein |
| RA | 4,296,381:1 | +GC | 100% | intergenic (+587/+55) | gltP → / ← yjcO | glutamate/aspartate:proton symporter/Sel1 family TPR‑like repeat protein |
| RA | 4,376,280 | G→A | 15.3% | intergenic (+15/‑37) | efp → / → ecnA | polyproline‑specific translation elongation factor EF‑P/entericidin A membrane lipoprotein, antidote entericidin B |
| RA | 4,376,291 | T→C | 15.3% | intergenic (+26/‑26) | efp → / → ecnA | polyproline‑specific translation elongation factor EF‑P/entericidin A membrane lipoprotein, antidote entericidin B |
| Unassigned new junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | = 16583 | NA (NA) | 15 (0.120) | 7/168 | NT | NA | noncoding (1197/1345 nt) | IS186 | repeat region |
| ? | NC_000913 | = 16604 | NA (NA) | noncoding (1218/1345 nt) | IS186 | repeat region | |||||
| * | ? | NC_000913 | = 16653 | NA (NA) | 25 (0.200) | 8/164 | NT | NA | noncoding (1267/1345 nt) | IS186 | repeat region |
| ? | NC_000913 | = 16691 | NA (NA) | noncoding (1305/1345 nt) | IS186 | repeat region | |||||
| * | ? | NC_000913 | = 20044 | NA (NA) | 14 (0.110) | 11/168 | NT | NA | noncoding (520/768 nt) | IS1 | repeat region |
| ? | NC_000913 | = 20084 | NA (NA) | noncoding (480/768 nt) | IS1 | repeat region | |||||
| * | ? | NC_000913 | = 20197 | NA (NA) | 9 (0.070) | 5/166 | NT | NA | noncoding (367/768 nt) | IS1 | repeat region |
| ? | NC_000913 | = 20223 | NA (NA) | noncoding (341/768 nt) | IS1 | repeat region | |||||
| * | ? | NC_000913 | = 46077 | 115 (0.850) | 22 (0.180) | 11/164 | NT | 16.6% | coding (271/1332 nt) | yaaU | putative MFS sugar transporter; membrane protein |
| ? | NC_000913 | = 46089 | 115 (0.920) | coding (283/1332 nt) | yaaU | putative MFS sugar transporter; membrane protein | |||||
| * | ? | NC_000913 | = 50326 | NA (NA) | 10 (0.080) | 7/164 | NT | NA | intergenic (+24/+54) | folA/apaH | dihydrofolate reductase/diadenosine tetraphosphatase |
| ? | NC_000913 | = 50359 | NA (NA) | noncoding (33/37 nt) | REP5 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP5 (repetitive extragenic palindromic) element; contains 1 REP sequences | |||||
| * | ? | NC_000913 | = 133866 | 110 (0.810) | 20 (0.160) | 11/162 | NT | 16.3% | coding (2252/2598 nt) | acnB | aconitate hydratase 2; aconitase B; 2‑methyl‑cis‑aconitate hydratase |
| ? | NC_000913 | = 133880 | 106 (0.860) | coding (2266/2598 nt) | acnB | aconitate hydratase 2; aconitase B; 2‑methyl‑cis‑aconitate hydratase | |||||
| * | ? | NC_000913 | = 224344 | NA (NA) | 52 (0.400) | 11/172 | NT | NA | noncoding (574/1542 nt) | rrsH | 16S ribosomal RNA of rrnH operon |
| ? | NC_000913 | = 224358 | NA (NA) | noncoding (588/1542 nt) | rrsH | 16S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | = 224374 | NA (NA) | 20 (0.160) | 12/164 | NT | NA | noncoding (604/1542 nt) | rrsH | 16S ribosomal RNA of rrnH operon |
| ? | NC_000913 | = 224403 | NA (NA) | noncoding (633/1542 nt) | rrsH | 16S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | 225078 = | NA (NA) | 53 (0.430) | 21/164 | NT | NA | noncoding (1308/1542 nt) | rrsH | 16S ribosomal RNA of rrnH operon |
| ? | NC_000913 | 225100 = | NA (NA) | noncoding (1330/1542 nt) | rrsH | 16S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | 225889 = | NA (NA) | 38 (0.300) | 14/164 | NT | NA | noncoding (131/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon |
| ? | NC_000913 | 225907 = | NA (NA) | noncoding (149/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | = 225998 | NA (NA) | 47 (0.360) | 17/170 | NT | NA | noncoding (240/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon |
| ? | NC_000913 | = 226015 | NA (NA) | noncoding (257/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | 226704 = | NA (NA) | 33 (0.260) | 12/170 | NT | NA | noncoding (946/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon |
| ? | NC_000913 | 226730 = | NA (NA) | noncoding (972/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | 226815 = | NA (NA) | 13 (0.100) | 9/172 | NT | NA | noncoding (1057/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon |
| ? | NC_000913 | 226840 = | NA (NA) | noncoding (1082/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | = 227444 | NA (NA) | 52 (0.410) | 17/168 | NT | NA | noncoding (1686/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon |
| ? | NC_000913 | = 227459 | NA (NA) | noncoding (1701/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | 228016 = | NA (NA) | 59 (0.470) | 10/164 | NT | NA | noncoding (2258/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon |
| ? | NC_000913 | 228041 = | NA (NA) | noncoding (2283/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | = 228022 | NA (NA) | 27 (0.220) | 8/164 | NT | NA | noncoding (2264/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon |
| ? | NC_000913 | = 228033 | NA (NA) | noncoding (2275/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | = 228108 | NA (NA) | 37 (0.290) | 16/170 | NT | NA | noncoding (2350/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon |
| ? | NC_000913 | = 228124 | NA (NA) | noncoding (2366/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | = 228224 | NA (NA) | 36 (0.290) | 13/166 | NT | NA | noncoding (2466/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon |
| ? | NC_000913 | = 228241 | NA (NA) | noncoding (2483/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | = 228452 | NA (NA) | 9 (0.070) | 5/170 | NT | NA | noncoding (2694/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon |
| ? | NC_000913 | = 228472 | NA (NA) | noncoding (2714/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | = 257907 | 0 (0.000) | 135 (1.100) | 80/162 | NT | 100% | intergenic (+8/‑769) | crl/crl | pseudogene, sigma factor‑binding protein, RNA polymerase holoenzyme formation stimulator;regulator; Surface structures; transcriptional regulator of cryptic csgA gene for curli surface fibers/pseudogene, sigma factor‑binding protein, RNA polymerase holoenzyme formation stimulator;regulator; Surface structures; transcriptional regulator of cryptic csgA gene for curli surface fibers |
| ? | NC_000913 | 258684 = | 0 (0.000) | pseudogene (9/331 nt) | crl | pseudogene, sigma factor‑binding protein, RNA polymerase holoenzyme formation stimulator;regulator; Surface structures; transcriptional regulator of cryptic csgA gene for curli surface fibers | |||||
| * | ? | NC_000913 | = 270756 | NA (NA) | 16 (0.130) | 4/168 | NT | NA | noncoding (216/1221 nt) | IS30 | repeat region |
| ? | NC_000913 | = 270770 | NA (NA) | noncoding (230/1221 nt) | IS30 | repeat region | |||||
| * | ? | NC_000913 | = 271133 | NA (NA) | 11 (0.090) | 6/168 | NT | NA | noncoding (593/1221 nt) | IS30 | repeat region |
| ? | NC_000913 | = 271141 | NA (NA) | noncoding (601/1221 nt) | IS30 | repeat region | |||||
| * | ? | NC_000913 | 274347 = | NA (NA) | 32 (0.260) | 14/164 | NT | NA | noncoding (803/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | 274410 = | NA (NA) | noncoding (740/1195 nt) | IS5 | repeat region | |||||
| * | ? | NC_000913 | 274384 = | NA (NA) | 22 (0.170) | 9/172 | NT | NA | noncoding (766/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | 274422 = | NA (NA) | noncoding (728/1195 nt) | IS5 | repeat region | |||||
| * | ? | NC_000913 | 274525 = | NA (NA) | 22 (0.180) | 10/164 | NT | NA | noncoding (625/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | 274559 = | NA (NA) | noncoding (591/1195 nt) | IS5 | repeat region | |||||
| * | ? | NC_000913 | 274620 = | NA (NA) | 14 (0.120) | 10/160 | NT | NA | noncoding (530/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | 274663 = | NA (NA) | noncoding (487/1195 nt) | IS5 | repeat region | |||||
| * | ? | NC_000913 | = 274695 | NA (NA) | 25 (0.190) | 12/170 | NT | NA | noncoding (455/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | = 274727 | NA (NA) | noncoding (423/1195 nt) | IS5 | repeat region | |||||
| * | ? | NC_000913 | = 275007 | NA (NA) | 59 (0.450) | 14/172 | NT | NA | noncoding (143/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | = 275025 | NA (NA) | noncoding (125/1195 nt) | IS5 | repeat region | |||||
| * | ? | NC_000913 | 303617 = | 122 (0.900) | 19 (0.160) | 11/152 | NT | 16.7% | intergenic (+12/+236) | yagU/ykgJ | DUF1440 family inner membrane acid resistance protein/UPF0153 cysteine cluster protein |
| ? | NC_000913 | 303650 = | 85 (0.740) | intergenic (+45/+203) | yagU/ykgJ | DUF1440 family inner membrane acid resistance protein/UPF0153 cysteine cluster protein | |||||
| * | ? | NC_000913 | = 315520 | NA (NA) | 5 (0.040) | 4/164 | NT | NA | noncoding (292/1255 nt) | IS3 | repeat region |
| ? | NC_000913 | = 315537 | NA (NA) | noncoding (309/1255 nt) | IS3 | repeat region | |||||
| * | ? | NC_000913 | 315563 = | NA (NA) | 15 (0.120) | 9/158 | NT | NA | noncoding (335/1255 nt) | IS3 | repeat region |
| ? | NC_000913 | 315599 = | NA (NA) | noncoding (371/1255 nt) | IS3 | repeat region | |||||
| * | ? | NC_000913 | = 315572 | NA (NA) | 23 (0.190) | 9/158 | NT | NA | noncoding (344/1255 nt) | IS3 | repeat region |
| ? | NC_000913 | = 315588 | NA (NA) | noncoding (360/1255 nt) | IS3 | repeat region | |||||
| * | ? | NC_000913 | 315642 = | NA (NA) | 31 (0.240) | 9/168 | NT | NA | noncoding (414/1255 nt) | IS3 | repeat region |
| ? | NC_000913 | 315671 = | NA (NA) | noncoding (443/1255 nt) | IS3 | repeat region | |||||
| * | ? | NC_000913 | 315892 = | NA (NA) | 15 (0.110) | 8/172 | NT | NA | noncoding (664/1255 nt) | IS3 | repeat region |
| ? | NC_000913 | 315923 = | NA (NA) | noncoding (695/1255 nt) | IS3 | repeat region | |||||
| * | ? | NC_000913 | 315991 = | NA (NA) | 24 (0.190) | 11/170 | NT | NA | noncoding (763/1255 nt) | IS3 | repeat region |
| ? | NC_000913 | 316014 = | NA (NA) | noncoding (786/1255 nt) | IS3 | repeat region | |||||
| * | ? | NC_000913 | = 316201 | NA (NA) | 25 (0.210) | 8/160 | NT | NA | noncoding (973/1255 nt) | IS3 | repeat region |
| ? | NC_000913 | = 316220 | NA (NA) | noncoding (992/1255 nt) | IS3 | repeat region | |||||
| * | ? | NC_000913 | = 349845 | 84 (0.670) | 19 (0.150) | 3/164 | NT | 18.4% | noncoding (241/365 nt) | REP25 (repetitive extragenic palindromic) element; contains 8 REP sequences | REP25 (repetitive extragenic palindromic) element; contains 8 REP sequences |
| ? | NC_000913 | = 349969 | NA (NA) | noncoding (365/365 nt) | REP25 (repetitive extragenic palindromic) element; contains 8 REP sequences | REP25 (repetitive extragenic palindromic) element; contains 8 REP sequences | |||||
| * | ? | NC_000913 | 381663 = | NA (NA) | 30 (0.240) | 11/164 | NT | NA | noncoding (404/1331 nt) | IS2 | repeat region |
| ? | NC_000913 | 381703 = | NA (NA) | noncoding (444/1331 nt) | IS2 | repeat region | |||||
| * | ? | NC_000913 | = 381669 | NA (NA) | 37 (0.300) | 13/164 | NT | NA | noncoding (410/1331 nt) | IS2 | repeat region |
| ? | NC_000913 | = 381695 | NA (NA) | noncoding (436/1331 nt) | IS2 | repeat region | |||||
| * | ? | NC_000913 | 381681 = | NA (NA) | 9 (0.070) | 6/160 | NT | NA | noncoding (422/1331 nt) | IS2 | repeat region |
| ? | NC_000913 | 381753 = | NA (NA) | noncoding (494/1331 nt) | IS2 | repeat region | |||||
| * | ? | NC_000913 | 381819 = | NA (NA) | 37 (0.300) | 11/164 | NT | NA | noncoding (560/1331 nt) | IS2 | repeat region |
| ? | NC_000913 | 381841 = | NA (NA) | noncoding (582/1331 nt) | IS2 | repeat region | |||||
| * | ? | NC_000913 | = 381910 | NA (NA) | 64 (0.510) | 13/166 | NT | NA | noncoding (651/1331 nt) | IS2 | repeat region |
| ? | NC_000913 | = 381923 | NA (NA) | noncoding (664/1331 nt) | IS2 | repeat region | |||||
| * | ? | NC_000913 | 382110 = | NA (NA) | 23 (0.180) | 6/168 | NT | NA | noncoding (851/1331 nt) | IS2 | repeat region |
| ? | NC_000913 | 382141 = | NA (NA) | noncoding (882/1331 nt) | IS2 | repeat region | |||||
| * | ? | NC_000913 | = 382129 | NA (NA) | 14 (0.110) | 8/172 | NT | NA | noncoding (870/1331 nt) | IS2 | repeat region |
| ? | NC_000913 | = 382146 | NA (NA) | noncoding (887/1331 nt) | IS2 | repeat region | |||||
| * | ? | NC_000913 | 382237 = | NA (NA) | 14 (0.110) | 7/166 | NT | NA | noncoding (978/1331 nt) | IS2 | repeat region |
| ? | NC_000913 | 382267 = | NA (NA) | noncoding (1008/1331 nt) | IS2 | repeat region | |||||
| * | ? | NC_000913 | = 382242 | NA (NA) | 25 (0.200) | 9/166 | NT | NA | noncoding (983/1331 nt) | IS2 | repeat region |
| ? | NC_000913 | = 382260 | NA (NA) | noncoding (1001/1331 nt) | IS2 | repeat region | |||||
| * | ? | NC_000913 | 382282 = | NA (NA) | 25 (0.200) | 10/166 | NT | NA | noncoding (1023/1331 nt) | IS2 | repeat region |
| ? | NC_000913 | 382313 = | NA (NA) | noncoding (1054/1331 nt) | IS2 | repeat region | |||||
| * | ? | NC_000913 | = 382323 | NA (NA) | 18 (0.140) | 11/168 | NT | NA | noncoding (1064/1331 nt) | IS2 | repeat region |
| ? | NC_000913 | = 382348 | NA (NA) | noncoding (1089/1331 nt) | IS2 | repeat region | |||||
| * | ? | NC_000913 | 507677 = | 138 (1.020) | 24 (0.190) | 9/168 | NT | 16.6% | coding (404/795 nt) | ybaP | TraB family protein |
| ? | NC_000913 | 507702 = | 111 (0.870) | coding (379/795 nt) | ybaP | TraB family protein | |||||
| * | ? | NC_000913 | = 570701 | 129 (0.950) | 22 (0.180) | 7/164 | NT | 15.8% | intergenic (+273/‑192) | ybcK/ybcL | DLP12 prophage; putative recombinase/inactive polymorphonuclear leukocyte migration suppressor; DLP12 prophage; UPF0098 family secreted protein |
| ? | NC_000913 | = 570711 | 116 (0.930) | intergenic (+283/‑182) | ybcK/ybcL | DLP12 prophage; putative recombinase/inactive polymorphonuclear leukocyte migration suppressor; DLP12 prophage; UPF0098 family secreted protein | |||||
| * | ? | NC_000913 | = 632332 | 116 (0.860) | 21 (0.160) | 13/172 | NT | 15.3% | coding (151/198 nt) | ybdD | DUF466 family protein |
| ? | NC_000913 | = 632374 | 121 (0.930) | coding (193/198 nt) | ybdD | DUF466 family protein | |||||
| * | ? | NC_000913 | 689269 = | NA (NA) | 5 (0.040) | 4/166 | NT | NA | noncoding (6/34 nt) | REP59 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP59 (repetitive extragenic palindromic) element; contains 1 REP sequences |
| ? | NC_000913 | 689297 = | NA (NA) | noncoding (34/34 nt) | REP59 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP59 (repetitive extragenic palindromic) element; contains 1 REP sequences | |||||
| * | ? | NC_000913 | 707773 = | NA (NA) | 18 (0.150) | 8/160 | NT | NA | noncoding (4/165 nt) | RIP63 (repetitive extragenic palindromic) element; contains 3 REP sequences and 1 IHF site | RIP63 (repetitive extragenic palindromic) element; contains 3 REP sequences and 1 IHF site |
| ? | NC_000913 | 707805 = | NA (NA) | noncoding (36/165 nt) | RIP63 (repetitive extragenic palindromic) element; contains 3 REP sequences and 1 IHF site | RIP63 (repetitive extragenic palindromic) element; contains 3 REP sequences and 1 IHF site | |||||
| * | ? | NC_000913 | 731060 = | NA (NA) | 4 (0.030) | 3/166 | NT | NA | coding (1478/4194 nt) | rhsC | Rhs protein with putative toxin domain; putative neighboring cell growth inhibitor |
| ? | NC_000913 | 731092 = | NA (NA) | coding (1510/4194 nt) | rhsC | Rhs protein with putative toxin domain; putative neighboring cell growth inhibitor | |||||
| * | ? | NC_000913 | 732857 = | NA (NA) | 39 (0.300) | 9/170 | NT | 33.5% | coding (3275/4194 nt) | rhsC | Rhs protein with putative toxin domain; putative neighboring cell growth inhibitor |
| ? | NC_000913 | 732888 = | 81 (0.600) | coding (3306/4194 nt) | rhsC | Rhs protein with putative toxin domain; putative neighboring cell growth inhibitor | |||||
| * | ? | NC_000913 | = 792267 | NA (NA) | 11 (0.090) | 6/164 | NT | NA | noncoding (4/34 nt) | REP71 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP71 (repetitive extragenic palindromic) element; contains 1 REP sequences |
| ? | NC_000913 | = 792297 | NA (NA) | noncoding (34/34 nt) | REP71 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP71 (repetitive extragenic palindromic) element; contains 1 REP sequences | |||||
| * | ? | NC_000913 | = 937227 | NA (NA) | 10 (0.080) | 5/162 | NT | NA | noncoding (4/36 nt) | REP85 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP85 (repetitive extragenic palindromic) element; contains 1 REP sequences |
| ? | NC_000913 | = 937259 | NA (NA) | noncoding (36/36 nt) | REP85 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP85 (repetitive extragenic palindromic) element; contains 1 REP sequences | |||||
| * | ? | NC_000913 | 937227 = | NA (NA) | 15 (0.120) | 8/162 | NT | NA | noncoding (4/36 nt) | REP85 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP85 (repetitive extragenic palindromic) element; contains 1 REP sequences |
| ? | NC_000913 | 937261 = | NA (NA) | intergenic (+48/‑111) | ftsK/lolA | DNA translocase at septal ring sorting daughter chromsomes/lipoprotein chaperone | |||||
| * | ? | NC_000913 | = 1054940 | 113 (0.830) | 22 (0.170) | 7/170 | NT | 16.4% | coding (1239/2745 nt) | torS | hybrid sensory histidine kinase in two‑component regulatory system with TorR |
| ? | NC_000913 | = 1054956 | 117 (0.910) | coding (1223/2745 nt) | torS | hybrid sensory histidine kinase in two‑component regulatory system with TorR | |||||
| * | ? | NC_000913 | = 1084726 | NA (NA) | 11 (0.090) | 7/162 | NT | NA | noncoding (45/86 nt) | REP95 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP95 (repetitive extragenic palindromic) element; contains 2 REP sequences |
| ? | NC_000913 | = 1084773 | NA (NA) | intergenic (+126/‑219) | efeB/phoH | deferrrochelatase, periplasmic/ATP‑binding protein; putative PhoH family P‑loop ATPase | |||||
| * | ? | NC_000913 | 1187036 = | NA (NA) | 9 (0.070) | 6/168 | NT | NA | coding (1193/1227 nt) | pepT | peptidase T |
| ? | NC_000913 | 1187066 = | NA (NA) | coding (1223/1227 nt) | pepT | peptidase T | |||||
| * | ? | NC_000913 | 1207790 = | 12 (0.090) | 95 (0.860) | 61/146 | NT | 93.7% | coding (290/630 nt) | stfP | e14 prophage; uncharacterized protein |
| ? | NC_000913 | 1209619 = | 3 (0.030) | pseudogene (1/501 nt) | stfE | pseudogene, e14 prophage; side tail fiber protein fragment family;Phage or Prophage Related | |||||
| * | ? | NC_000913 | = 1207805 | 11 (0.080) | 108 (0.970) | 69/146 | NT | 94.7% | coding (305/630 nt) | stfP | e14 prophage; uncharacterized protein |
| ? | NC_000913 | = 1209602 | 3 (0.030) | pseudogene (18/501 nt) | stfE | pseudogene, e14 prophage; side tail fiber protein fragment family;Phage or Prophage Related | |||||
| * | ? | NC_000913 | 1269276 = | 62 (0.460) | 15 (0.120) | 8/162 | NT | 16.8% | intergenic (‑1/+427) | ldrA/ldrB | toxic polypeptide, small/toxic polypeptide, small |
| ? | NC_000913 | 1269314 = | 92 (0.750) | intergenic (‑39/+389) | ldrA/ldrB | toxic polypeptide, small/toxic polypeptide, small | |||||
| * | ? | NC_000913 | = 1299498 | 0 (0.000) | 121 (0.940) | 77/170 | NT | 100% | intergenic (+253/‑1684) | ychE/oppA | UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein |
| ? | NC_000913 | 1300698 = | 0 (0.000) | intergenic (+1453/‑484) | ychE/oppA | UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein | |||||
| * | ? | NC_000913 | = 1432761 | NA (NA) | 18 (0.140) | 7/170 | NT | NA | coding (351/576 nt) | tfaR | Rac prophage; putative tail fiber assembly protein |
| ? | NC_000913 | = 1432785 | NA (NA) | coding (375/576 nt) | tfaR | Rac prophage; putative tail fiber assembly protein | |||||
| * | ? | NC_000913 | 2252796 = | NA (NA) | 14 (0.110) | 8/164 | NT | NA | noncoding (1/91 nt) | RIP157 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | RIP157 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site |
| ? | NC_000913 | 2252829 = | NA (NA) | noncoding (34/91 nt) | RIP157 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | RIP157 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | |||||
| * | ? | NC_000913 | 2304400 = | NA (NA) | 25 (0.210) +AGCGGTGTAG |
8/158 | NT | 77.9% | intergenic (+7/+708) | eco/mqo | ecotin, a serine protease inhibitor/malate dehydrogenase, FAD/NAD(P)‑binding domain |
| ? | NC_000913 | 2304923 = | 8 (0.060) | noncoding (507/655 nt) | REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences | REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences | |||||
| * | ? | NC_000913 | = 2304477 | 93 (0.690) | 27 (0.220) | 7/164 | NT | 22.4% | noncoding (61/655 nt) | REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences | REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences |
| ? | NC_000913 | = 2304495 | 102 (0.820) | noncoding (79/655 nt) | REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences | REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences | |||||
| * | ? | NC_000913 | 2304654 = | NA (NA) | 8 (0.060) | 3/164 | NT | 100% | noncoding (238/655 nt) | REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences | REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences |
| ? | NC_000913 | 2304670 = | 0 (0.000) | noncoding (254/655 nt) | REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences | REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences | |||||
| * | ? | NC_000913 | = 2440342 | NA (NA) | 7 (0.060) | 5/166 | NT | NA | intergenic (‑222/+43) | yfcJ/fabB | putative arabinose efflux transporter/3‑oxoacyl‑[acyl‑carrier‑protein] synthase I |
| ? | NC_000913 | = 2440374 | NA (NA) | noncoding (32/36 nt) | REP170 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP170 (repetitive extragenic palindromic) element; contains 1 REP sequences | |||||
| * | ? | NC_000913 | = 2502824 | 108 (0.800) | 22 (0.180) | 11/164 | NT | 17.9% | coding (1662/2496 nt) | fryA | putative PTS enzyme: Hpr, enzyme I and IIA components |
| ? | NC_000913 | = 2502837 | 103 (0.830) | coding (1649/2496 nt) | fryA | putative PTS enzyme: Hpr, enzyme I and IIA components | |||||
| * | ? | NC_000913 | 2568185 = | NA (NA) | 6 (0.060) +ACCCGCTACACACCCCGCAG |
6/138 | NT | NA | noncoding (47/183 nt) | REP178 (repetitive extragenic palindromic) element; contains 4 REP sequences | REP178 (repetitive extragenic palindromic) element; contains 4 REP sequences |
| ? | NC_000913 | = 3217522 | NA (NA) | noncoding (89/89 nt) | REP229 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP229 (repetitive extragenic palindromic) element; contains 2 REP sequences | |||||
| * | ? | NC_000913 | 2617939 = | NA (NA) | 14 (0.110) | 9/164 | NT | NA | intergenic (+2/+136) | yfgD/hda | putative oxidoreductase/ATPase regulatory factor involved in DnaA inactivation |
| ? | NC_000913 | 2617967 = | NA (NA) | intergenic (+30/+108) | yfgD/hda | putative oxidoreductase/ATPase regulatory factor involved in DnaA inactivation | |||||
| * | ? | NC_000913 | = 2662541 | NA (NA) | 17 (0.140) | 6/164 | NT | NA | noncoding (233/266 nt) | REP184 (repetitive extragenic palindromic) element; contains 6 REP sequences | REP184 (repetitive extragenic palindromic) element; contains 6 REP sequences |
| ? | NC_000913 | = 2662574 | NA (NA) | noncoding (266/266 nt) | REP184 (repetitive extragenic palindromic) element; contains 6 REP sequences | REP184 (repetitive extragenic palindromic) element; contains 6 REP sequences | |||||
| * | ? | NC_000913 | 2726200 = | NA (NA) | 89 (0.710) | 13/166 | NT | NA | intergenic (‑12/+81) | rrfG/rrlG | 5S ribosomal RNA of rrnG operon/23S ribosomal RNA of rrnG operon |
| ? | NC_000913 | 2726224 = | NA (NA) | intergenic (‑36/+57) | rrfG/rrlG | 5S ribosomal RNA of rrnG operon/23S ribosomal RNA of rrnG operon | |||||
| * | ? | NC_000913 | 2726352 = | NA (NA) | 11 (0.090) | 5/168 | NT | NA | noncoding (2833/2904 nt) | rrlG | 23S ribosomal RNA of rrnG operon |
| ? | NC_000913 | 2726373 = | NA (NA) | noncoding (2812/2904 nt) | rrlG | 23S ribosomal RNA of rrnG operon | |||||
| * | ? | NC_000913 | 2728214 = | NA (NA) | 60 (0.460) | 15/170 | NT | NA | noncoding (971/2904 nt) | rrlG | 23S ribosomal RNA of rrnG operon |
| ? | NC_000913 | 2728240 = | NA (NA) | noncoding (945/2904 nt) | rrlG | 23S ribosomal RNA of rrnG operon | |||||
| * | ? | NC_000913 | = 2729452 | NA (NA) | 13 (0.110) | 6/158 | NT | NA | intergenic (‑8/+164) | gltW/rrsG | tRNA‑Glu/16S ribosomal RNA of rrnG operon |
| ? | NC_000913 | = 2729474 | NA (NA) | intergenic (‑30/+142) | gltW/rrsG | tRNA‑Glu/16S ribosomal RNA of rrnG operon | |||||
| * | ? | NC_000913 | = 2794135 | NA (NA) | 15 (0.120) | 8/168 | NT | NA | noncoding (108/136 nt) | REP191 (repetitive extragenic palindromic) element; contains 3 REP sequences | REP191 (repetitive extragenic palindromic) element; contains 3 REP sequences |
| ? | NC_000913 | = 2794163 | NA (NA) | noncoding (136/136 nt) | REP191 (repetitive extragenic palindromic) element; contains 3 REP sequences | REP191 (repetitive extragenic palindromic) element; contains 3 REP sequences | |||||
| * | ? | NC_000913 | = 3083080 | 96 (0.710) | 17 (0.140) | 8/164 | NT | 15.1% | coding (718/921 nt) | speB | agmatinase |
| ? | NC_000913 | = 3083094 | 103 (0.830) | coding (704/921 nt) | speB | agmatinase | |||||
| * | ? | NC_000913 | = 3277814 | NA (NA) | 7 (0.060) | 6/162 | NT | NA | intergenic (+13/+42) | yhaV/agaR | toxin of the SohB(PrlF)‑YhaV toxin‑antitoxin system/transcriptional repressor of the aga regulon |
| ? | NC_000913 | = 3277847 | NA (NA) | noncoding (29/29 nt) | REP238 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP238 (repetitive extragenic palindromic) element; contains 1 REP sequences | |||||
| * | ? | NC_000913 | 3277819 = | NA (NA) | 17 (0.140) | 10/162 | NT | NA | noncoding (1/29 nt) | REP238 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP238 (repetitive extragenic palindromic) element; contains 1 REP sequences |
| ? | NC_000913 | 3277844 = | NA (NA) | noncoding (26/29 nt) | REP238 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP238 (repetitive extragenic palindromic) element; contains 1 REP sequences | |||||
| * | ? | NC_000913 | 3281702 = | NA (NA) | 8 (0.060) | 4/164 | NT | NA | noncoding (1/82 nt) | REP239 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP239 (repetitive extragenic palindromic) element; contains 2 REP sequences |
| ? | NC_000913 | 3281734 = | NA (NA) | noncoding (33/82 nt) | REP239 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP239 (repetitive extragenic palindromic) element; contains 2 REP sequences | |||||
| * | ? | NC_000913 | 3296999 = | NA (NA) | 17 (0.140) | 11/164 | NT | NA | noncoding (1/84 nt) | REP240 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP240 (repetitive extragenic palindromic) element; contains 2 REP sequences |
| ? | NC_000913 | 3297032 = | NA (NA) | noncoding (34/84 nt) | REP240 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP240 (repetitive extragenic palindromic) element; contains 2 REP sequences | |||||
| * | ? | NC_000913 | = 3313290 | NA (NA) | 13 (0.100) | 9/164 | NT | NA | noncoding (39/77 nt) | REP242 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP242 (repetitive extragenic palindromic) element; contains 2 REP sequences |
| ? | NC_000913 | = 3313328 | NA (NA) | noncoding (77/77 nt) | REP242 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP242 (repetitive extragenic palindromic) element; contains 2 REP sequences | |||||
| * | ? | NC_000913 | 3336878 = | NA (NA) | 10 (0.080) | 7/168 | NT | NA | intergenic (‑75/+85) | ibaG/mlaB | acid stress protein; putative BolA family transcriptional regulator/ABC transporter maintaining OM lipid asymmetry, cytoplasmic STAS component |
| ? | NC_000913 | 3336905 = | NA (NA) | intergenic (‑102/+58) | ibaG/mlaB | acid stress protein; putative BolA family transcriptional regulator/ABC transporter maintaining OM lipid asymmetry, cytoplasmic STAS component | |||||
| * | ? | NC_000913 | = 3546221 | NA (NA) | 13 (0.100) | 8/166 | NT | NA | intergenic (+22/‑338) | nfuA/gntT | Fe/S biogenesis protein, putative scaffold/chaperone protein/gluconate transporter, high‑affinity GNT I system |
| ? | NC_000913 | = 3546253 | NA (NA) | noncoding (32/36 nt) | REP253 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP253 (repetitive extragenic palindromic) element; contains 1 REP sequences | |||||
| * | ? | NC_000913 | = 3620116 | NA (NA) | 17 (0.130) | 10/166 | NT | 100% | coding (925/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor |
| ? | NC_000913 | = 3620152 | 0 (0.000) | coding (961/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor | |||||
| * | ? | NC_000913 | = 3620220 | NA (NA) | 18 (0.140) | 9/166 | NT | 100% | coding (1029/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor |
| ? | NC_000913 | = 3620255 | 0 (0.000) | coding (1064/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor | |||||
| * | ? | NC_000913 | 3620569 = | NA (NA) | 22 (0.170) | 11/166 | NT | 100% | coding (1378/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor |
| ? | NC_000913 | 3620582 = | 0 (0.000) | coding (1391/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor | |||||
| * | ? | NC_000913 | = 3620614 | NA (NA) | 25 (0.200) | 10/166 | NT | 100% | coding (1423/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor |
| ? | NC_000913 | = 3620635 | 0 (0.000) | coding (1444/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor | |||||
| * | ? | NC_000913 | = 3621314 | NA (NA) | 9 (0.070) | 6/168 | NT | 100% | coding (2123/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor |
| ? | NC_000913 | = 3621344 | 0 (0.000) | coding (2153/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor | |||||
| * | ? | NC_000913 | 3621557 = | NA (NA) | 11 (0.090) | 7/170 | NT | NA | coding (2366/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor |
| ? | NC_000913 | 3621605 = | NA (NA) | coding (2414/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor | |||||
| * | ? | NC_000913 | 3622540 = | NA (NA) | 22 (0.170) | 6/168 | NT | 100% | coding (3349/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor |
| ? | NC_000913 | 3622556 = | 0 (0.000) | coding (3365/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor | |||||
| * | ? | NC_000913 | = 3650792 | NA (NA) | 14 (0.110) | 9/166 | NT | NA | noncoding (81/100 nt) | RIP262 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | RIP262 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site |
| ? | NC_000913 | = 3650805 | NA (NA) | noncoding (94/100 nt) | RIP262 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | RIP262 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | |||||
| * | ? | NC_000913 | = 3674441 | NA (NA) | 21 (0.170) | 10/164 | NT | NA | noncoding (61/93 nt) | REP263 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP263 (repetitive extragenic palindromic) element; contains 2 REP sequences |
| ? | NC_000913 | = 3674473 | NA (NA) | noncoding (93/93 nt) | REP263 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP263 (repetitive extragenic palindromic) element; contains 2 REP sequences | |||||
| * | ? | NC_000913 | = 3837360 | 92 (0.680) | 18 (0.140) | 9/168 | NT | 17.4% | coding (408/1185 nt) | setC | putative arabinose efflux transporter |
| ? | NC_000913 | = 3837376 | 84 (0.660) | coding (424/1185 nt) | setC | putative arabinose efflux transporter | |||||
| * | ? | NC_000913 | = 3884855 | 110 (0.810) | 23 (0.180) | 9/166 | NT | 17.9% | coding (40/258 nt) | yidD | membrane protein insertion efficiency factor, UPF0161 family inner membrane protein |
| ? | NC_000913 | = 3884868 | 109 (0.860) | coding (53/258 nt) | yidD | membrane protein insertion efficiency factor, UPF0161 family inner membrane protein | |||||
| * | ? | NC_000913 | = 3898636 | NA (NA) | 19 (0.150) | 10/162 | NT | NA | noncoding (6/26 nt) | REP282 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP282 (repetitive extragenic palindromic) element; contains 1 REP sequences |
| ? | NC_000913 | = 3898650 | NA (NA) | noncoding (20/26 nt) | REP282 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP282 (repetitive extragenic palindromic) element; contains 1 REP sequences | |||||
| * | ? | NC_000913 | = 3943543 | NA (NA) | 15 (0.130) | 6/156 | NT | 100% | intergenic (+33/‑161) | gltU/rrlC | tRNA‑Glu/23S ribosomal RNA of rrnC operon |
| ? | NC_000913 | = 3943583 | 0 (0.000) | intergenic (+73/‑121) | gltU/rrlC | tRNA‑Glu/23S ribosomal RNA of rrnC operon | |||||
| * | ? | NC_000913 | 3943544 = | NA (NA) | 29 (0.220) | 5/174 | NT | NA | intergenic (+34/‑160) | gltU/rrlC | tRNA‑Glu/23S ribosomal RNA of rrnC operon |
| ? | NC_000913 | 4037399 = | NA (NA) | intergenic (+64/‑120) | alaT/rrlA | tRNA‑Ala/23S ribosomal RNA of rrnA operon | |||||
| * | ? | NC_000913 | = 3943635 | NA (NA) | 22 (0.180) | 13/164 | NT | 53.2% | intergenic (+125/‑69) | gltU/rrlC | tRNA‑Glu/23S ribosomal RNA of rrnC operon |
| ? | NC_000913 | = 4037446 | 21 (0.160) | intergenic (+111/‑73) | alaT/rrlA | tRNA‑Ala/23S ribosomal RNA of rrnA operon | |||||
| * | ? | NC_000913 | = 4035244 | 26 (0.190) | 5 (0.040) | 5/168 | NT | 16.9% | intergenic (+91/‑287) | hemG/rrsA | protoporphyrin oxidase, flavoprotein/16S ribosomal RNA of rrnA operon |
| ? | NC_000913 | = 4035271 | NA (NA) | intergenic (+118/‑260) | hemG/rrsA | protoporphyrin oxidase, flavoprotein/16S ribosomal RNA of rrnA operon | |||||
| * | ? | NC_000913 | 4040482 = | NA (NA) | 67 (0.530) | 17/166 | NT | NA | intergenic (+59/‑35) | rrlA/rrfA | 23S ribosomal RNA of rrnA operon/5S ribosomal RNA of rrnA operon |
| ? | NC_000913 | 4040506 = | NA (NA) | intergenic (+83/‑11) | rrlA/rrfA | 23S ribosomal RNA of rrnA operon/5S ribosomal RNA of rrnA operon | |||||
| * | ? | NC_000913 | = 4148478 | NA (NA) | 12 (0.100) | 9/164 | NT | NA | noncoding (49/82 nt) | REP308 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP308 (repetitive extragenic palindromic) element; contains 2 REP sequences |
| ? | NC_000913 | = 4148511 | NA (NA) | noncoding (82/82 nt) | REP308 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP308 (repetitive extragenic palindromic) element; contains 2 REP sequences | |||||
| * | ? | NC_000913 | = 4171803 | 116 (0.860) | 42 (0.320) | 12/174 | NT | 27.0% | intergenic (+47/‑254) | rrfB/murB | 5S ribosomal RNA of rrnB operon/UDP‑N‑acetylenolpyruvoylglucosamine reductase, FAD‑binding |
| ? | NC_000913 | = 4213162 | NA (NA) | intergenic (+3/‑72) | rrfE/yjaA | 5S ribosomal RNA of rrnE operon/stress‑induced protein | |||||
| * | ? | NC_000913 | = 4210001 | NA (NA) | 25 (0.190) | 7/170 | NT | 17.4% | intergenic (+152/‑42) | gltV/rrlE | tRNA‑Glu/23S ribosomal RNA of rrnE operon |
| ? | NC_000913 | = 4210039 | 124 (0.920) | intergenic (+190/‑4) | gltV/rrlE | tRNA‑Glu/23S ribosomal RNA of rrnE operon | |||||
| * | ? | NC_000913 | 4235376 = | NA (NA) | 13 (0.110) +TCGTCGAT |
8/162 | NT | NA | coding (1619/1650 nt) | pgi | glucosephosphate isomerase |
| ? | NC_000913 | 4285300 = | NA (NA) | intergenic (‑87/+113) | yjcH/acs | DUF485 family inner membrane protein/acetyl‑CoA synthetase | |||||
| * | ? | NC_000913 | 4240157 = | NA (NA) | 7 (0.060) | 5/164 | NT | NA | noncoding (1/37 nt) | REP314 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP314 (repetitive extragenic palindromic) element; contains 1 REP sequences |
| ? | NC_000913 | 4240190 = | NA (NA) | noncoding (34/37 nt) | REP314 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP314 (repetitive extragenic palindromic) element; contains 1 REP sequences | |||||
| * | ? | NC_000913 | 4323250 = | NA (NA) | 15 (0.120) | 6/164 | NT | NA | noncoding (5/87 nt) | REP324 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP324 (repetitive extragenic palindromic) element; contains 2 REP sequences |
| ? | NC_000913 | 4323280 = | NA (NA) | noncoding (35/87 nt) | REP324 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP324 (repetitive extragenic palindromic) element; contains 2 REP sequences | |||||
| * | ? | NC_000913 | 4415962 = | NA (NA) | 16 (0.130) | 9/166 | NT | NA | noncoding (5/34 nt) | REP332 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP332 (repetitive extragenic palindromic) element; contains 1 REP sequences |
| ? | NC_000913 | 4415992 = | NA (NA) | intergenic (+92/+25) | aidB/yjfN | DNA alkylation damage repair protein; flavin‑containing DNA binding protein, weak isovaleryl CoA dehydrogenase/DUF1471 family periplasmic protein | |||||
| * | ? | NC_000913 | 4460417 = | NA (NA) | 24 (0.190) | 8/168 | NT | NA | noncoding (3/84 nt) | REP338 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP338 (repetitive extragenic palindromic) element; contains 2 REP sequences |
| ? | NC_000913 | 4460445 = | NA (NA) | noncoding (31/84 nt) | REP338 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP338 (repetitive extragenic palindromic) element; contains 2 REP sequences | |||||
| * | ? | NC_000913 | = 4536412 | NA (NA) | 12 (0.100) | 8/166 | NT | NA | noncoding (8/26 nt) | REP344 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP344 (repetitive extragenic palindromic) element; contains 1 REP sequences |
| ? | NC_000913 | = 4536422 | NA (NA) | noncoding (18/26 nt) | REP344 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP344 (repetitive extragenic palindromic) element; contains 1 REP sequences | |||||
| * | ? | NC_000913 | 4542682 = | 15 (0.110) | 99 (0.810) | 69/160 | NT | 88.2% | intergenic (+49/‑433) | fimE/fimA | tyrosine recombinase/inversion of on/off regulator of fimA/major type 1 subunit fimbrin (pilin) |
| ? | NC_000913 | 4542996 = | 13 (0.110) | intergenic (+363/‑119) | fimE/fimA | tyrosine recombinase/inversion of on/off regulator of fimA/major type 1 subunit fimbrin (pilin) | |||||
| * | ? | NC_000913 | = 4542690 | 18 (0.130) | 102 (0.840) | 71/160 | NT | 87.5% | intergenic (+57/‑425) | fimE/fimA | tyrosine recombinase/inversion of on/off regulator of fimA/major type 1 subunit fimbrin (pilin) |
| ? | NC_000913 | = 4542986 | 13 (0.110) | intergenic (+353/‑129) | fimE/fimA | tyrosine recombinase/inversion of on/off regulator of fimA/major type 1 subunit fimbrin (pilin) | |||||
| * | ? | NC_000913 | 4587871 = | NA (NA) | 13 (0.110) | 5/162 | NT | NA | intergenic (+8/+38) | mrr/yjiA | methylated adenine and cytosine restriction protein/metal‑binding GTPase |
| ? | NC_000913 | 4587900 = | NA (NA) | intergenic (+37/+9) | mrr/yjiA | methylated adenine and cytosine restriction protein/metal‑binding GTPase | |||||
| * | ? | NC_000913 | = 4587878 | NA (NA) | 23 (0.190) | 9/162 | NT | NA | noncoding (7/27 nt) | REP348 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP348 (repetitive extragenic palindromic) element; contains 1 REP sequences |
| ? | NC_000913 | = 4587891 | NA (NA) | noncoding (20/27 nt) | REP348 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP348 (repetitive extragenic palindromic) element; contains 1 REP sequences | |||||