![]() |
breseq version 0.32.1 revision aa8f2595a244
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
Predicted mutations | |||||
---|---|---|---|---|---|
evidence | position | mutation | annotation | gene | description |
RA | 7,925 | +A | coding (35/1431 nt) | yaaJ ← | putative transporter |
RA | 10,647 | A→G | V237A (GTC→GCC) | yaaW ← | UPF0174 family protein |
RA | 14,301 | C→T | A45V (GCG→GTG) | dnaJ → | chaperone Hsp40, DnaK co‑chaperone |
RA | 28,269 | C→T | intergenic (+62/‑105) | rihC → / → dapB | ribonucleoside hydrolase 3/dihydrodipicolinate reductase |
RA | 30,616 | T→C | P322P (CCT→CCC) | carA → | carbamoyl phosphate synthetase small subunit, glutamine amidotransferase |
RA | 35,373 | G→C | intergenic (‑2/+4) | caiE ← / ← caiD | stimulator of CaiD and CaiB enzyme activities/carnitinyl‑CoA dehydratase |
RA | 37,903 | C→T | D405N (GAC→AAC) | caiB ← | crotonobetainyl CoA:carnitine CoA transferase |
RA | 47,776 | G→A | *177* (TAG→TAA) S3N (AGC→AAC) |
kefF → kefC → |
potassium‑efflux system ancillary protein for KefC, glutathione‑regulated, quinone oxidoreductase, FMN‑dependent potassium:proton antiporter |
RA | 49,765 | C→T | intergenic (+134/‑58) | kefC → / → folA | potassium:proton antiporter/dihydrofolate reductase |
RA | 49,767 | A→G | intergenic (+136/‑56) | kefC → / → folA | potassium:proton antiporter/dihydrofolate reductase |
RA | 66,447 | T→C | E35G (GAG→GGG) | araD ← | L‑ribulose‑5‑phosphate 4‑epimerase |
RA | 66,614 | T→A | intergenic (‑64/+221) | araD ← / ← araA | L‑ribulose‑5‑phosphate 4‑epimerase/L‑arabinose isomerase |
RA | 72,115 | G→A | *255* (TAG→TAA) | yabI → | DedA family inner membrane protein |
RA | 72,229 | C→T | *233* (TAG→TAA) | thiQ ← | thiamine/thiamine pyrophosphate ABC transporter ATPase |
RA | 75,447 | A→G | C12R (TGC→CGC) | thiB ← | thiamine/thiamine pyrophosphate/thiamine monophosphate ABC transporter periplasmic binding protein |
RA | 84,735 | A→G | D123G (GAC→GGC) | leuO → | global transcription factor |
RA | 96,008 | G→A | *453* (TAG→TAA) V3I (GTT→ATT) |
murF → mraY → |
UDP‑N‑acetylmuramoyl‑tripeptide:D‑alanyl‑D‑ alanine ligase phospho‑N‑acetylmuramoyl‑pentapeptide transferase |
RA | 104,352 | A→G | E124G (GAG→GGG) | ftsA → | ATP‑binding cell division FtsK recruitment protein |
RA | 111,433 | G→A | *130* (TAG→TAA) | mutT → | dGTP‑preferring nucleoside triphosphate pyrophosphohydrolase |
RA | 115,661 | T→C | M22V (ATG→GTG) | hofC ← | assembly protein in type IV pilin biogenesis, transmembrane protein |
RA | 117,074 | A→G | L9P (CTG→CCG) | hofB ← | T2SE secretion family protein, P‑loop ATPase superfamily protein |
RA | 117,798 | A→G | L283P (CTA→CCA) | nadC ← | quinolinate phosphoribosyltransferase |
RA | 122,856 | G→A | *255* (TAG→TAA) | pdhR → | pyruvate dehydrogenase complex repressor, autorepressor |
RA | 125,227 | T→C | R737R (CGT→CGC) | aceE → | pyruvate dehydrogenase, decarboxylase component E1, thiamine triphosphate‑binding |
RA | 150,947 | T→C | T3A (ACT→GCT) | yadC ← | putative fimbrial‑like adhesin protein |
RA | 152,036 | C→T | V66I (GTA→ATA) | yadL ← | putative fimbrial‑like adhesin protein |
RA | 155,935 | T→C | K89K (AAA→AAG) | yadV ← | putative periplasmic pilin chaperone |
RA | 160,782 | C→T | *235* (TAG→TAA) | sfsA ← | sugar fermentation stimulation protein A |
RA | 162,927 | G→A | A275T (GCT→ACT) | hrpB → | putative ATP‑dependent helicase |
RA | 167,743 | C→T | T87I (ACC→ATC) | fhuA → | ferrichrome outer membrane transporter |
RA | 169,645 | A→G | Y721C (TAC→TGC) | fhuA → | ferrichrome outer membrane transporter |
RA | 170,349 | A→G | H191R (CAC→CGC) | fhuC → | iron(3+)‑hydroxamate import ABC transporter ATPase |
RA | 177,662 | C→T | *267* (TAG→TAA) | btuF ← | vitamin B12 ABC transporter periplasmic binding protein |
RA | 183,215 | C→T | G251G (GGC→GGT) | cdaR → | carbohydrate diacid regulon transcriptional regulator, autoregulator |
RA | 183,607 | Δ1 bp | coding (1145/1158 nt) | cdaR → | carbohydrate diacid regulon transcriptional regulator, autoregulator |
RA | 183,620 | G→A | *386* (TAG→TAA) | cdaR → | carbohydrate diacid regulon transcriptional regulator, autoregulator |
RA | 184,257 | C→T | *271* (TAG→TAA) | yaeI ← | phosphodiesterase with model substrate bis‑pNPP |
RA | 197,574 | T→C | S343S (AGT→AGC) | rseP → | inner membrane zinc RIP metalloprotease, RpoE activator, by degrading RseA, cleaved signal peptide endoprotease |
RA | 200,214 | C→T | P763S (CCA→TCA) | bamA → | BamABCDE complex OM biogenesis outer membrane pore‑forming assembly factor |
RA | 219,364 | T→C | P77P (CCA→CCG) | tsaA ← | tRNA‑Thr(GGU) m(6)t(6)A37 methyltransferase, SAM‑dependent |
RA | 220,239 | C→T | L230L (CTG→CTA) | metQ ← | DL‑methionine transporter subunit |
RA | 239,378 | G→A | pseudogene (273/273 nt) | yafF → | pseudogene, H repeat‑associated protein |
RA | 247,461 | G→A | *250* (TAG→TAA) | yafL → | putative lipoprotein and C40 family peptidase |
RA | 247,466 | Δ1 bp | intergenic (+5/‑171) | yafL → / → rayT | putative lipoprotein and C40 family peptidase/RAYT REP element‑mobilizing transposase, TnpA(REP) |
RA | 253,084 | A→G | T126A (ACA→GCA) | yafP → | GNAT family putative N‑acetyltransferase |
RA | 255,659 | A→G | C20R (TGT→CGT) | pepD ← | aminoacyl‑histidine dipeptidase (peptidase D) |
MC JC | 257,908 | Δ776 bp | [crl] | [crl] | |
RA | 262,563 | G→A | R354H (CGT→CAT) | proA → | gamma‑glutamylphosphate reductase |
RA | 280,024 | C→T | pseudogene (94/174 nt) | insI1 → | IS30 transposase,IS, phage, Tn, Transposon‑related functions, extrachromosomal, transposon related |
RA | 281,662 | Δ1 bp | coding (322/1155 nt) | yagA ← | CP4‑6 prophage, putative DNA‑binding transcriptional regulator |
RA | 284,869 | C→T | P557S (CCG→TCG) | yagF → | CP4‑6 prophage, dehydratase family protein |
RA | 287,977 | A→G | M397V (ATG→GTG) | yagH → | CP4‑6 prophage, putative xylosidase/arabinosidase |
RA | 291,324 | C→T | C8Y (TGT→TAT) | insA ← | IS1 repressor TnpA |
RA | 309,358 | C→T | *223* (TAG→TAA) | ecpB ← | ECP production pilus chaperone |
RA | 309,486 | C→T | G181S (GGT→AGT) | ecpB ← | ECP production pilus chaperone |
RA | 312,189 | C→T | G26G (GGC→GGT) | ykgL → | uncharacterized protein |
RA | 315,244 | G→A | intergenic (+16/‑47) | eaeH → / → insE1 | pseudogene, attaching and effacing protein homology,factor, Not classified/IS3 transposase A |
RA | 316,453 | G→A | *289* (TAG→TAA) | insF1 → | IS3 transposase B |
RA | 321,564 | (G)7→6 | intergenic (+483/‑44) | rclR → / → ykgE | reactive chlorine species (RCS)‑specific activator of the rcl genes/cysteine‑rich LutA family protein, putative electron transport chain YkgEFG component |
RA | 323,355 | C→T | P340S (CCA→TCA) | ykgF → | ferridoxin‑like LutB family protein, putative electron transport chain YkgEFG component |
RA | 335,970 | C→T | Q16* (CAA→TAA) | yahE → | DUF2877 family protein |
RA | 340,089 | G→A | intergenic (+346/‑76) | yahG → / → yahI | DUF1116 family protein/carbamate kinase‑like protein |
RA | 344,674 | T→C | Y167H (TAC→CAC) | yahL → | uncharacterized protein |
RA | 344,991 | G→A | *272* (TAG→TAA) | yahL → | uncharacterized protein |
RA | 345,649 | G→A | *82* (TAG→TAA) | yahM → | uncharacterized protein |
RA | 349,847 | T→C | intergenic (+275/‑165) | prpB → / → prpC | 2‑methylisocitrate lyase/2‑methylcitrate synthase |
RA | 354,592 | G→A | *629* (TAG→TAA) | prpE → | propionate‑‑CoA ligase |
RA | 357,591 | C→T | intergenic (+137/+200) | codA → / ← cynR | cytosine/isoguanine deaminase/transcriptional activator of cyn operon, autorepressor |
RA | 357,606 | C→T | intergenic (+152/+185) | codA → / ← cynR | cytosine/isoguanine deaminase/transcriptional activator of cyn operon, autorepressor |
RA | 357,626 | 2 bp→TA | intergenic (+172/+164) | codA → / ← cynR | cytosine/isoguanine deaminase/transcriptional activator of cyn operon, autorepressor |
RA | 357,791 | C→T | *300* (TAG→TAA) | cynR ← | transcriptional activator of cyn operon, autorepressor |
RA | 371,542 | C→T | Q102* (CAA→TAA) | mhpC → | 2‑hydroxy‑6‑ketonona‑2,4‑dienedioic acid hydrolase |
RA | 372,966 | A→G | T16A (ACC→GCC) | mhpF → | acetaldehyde‑CoA dehydrogenase II, NAD‑binding |
RA | 375,067 | A→G | intergenic (+186/‑392) | mhpE → / → mhpT | 4‑hyroxy‑2‑oxovalerate/4‑hydroxy‑2‑oxopentanoic acid aldolase, class I/3‑hydroxyphenylpropionic transporter |
RA | 375,075 | G→A | intergenic (+194/‑384) | mhpE → / → mhpT | 4‑hyroxy‑2‑oxovalerate/4‑hydroxy‑2‑oxopentanoic acid aldolase, class I/3‑hydroxyphenylpropionic transporter |
RA | 375,307 | C→T | intergenic (+426/‑152) | mhpE → / → mhpT | 4‑hyroxy‑2‑oxovalerate/4‑hydroxy‑2‑oxopentanoic acid aldolase, class I/3‑hydroxyphenylpropionic transporter |
RA | 379,606 | C→T | *92* (TAG→TAA) | frmR ← | regulator protein that represses frmRAB operon |
RA | 380,022 | (G)10→11 | intergenic (‑141/+47) | frmR ← / ← yaiO | regulator protein that represses frmRAB operon/outer membrane protein |
RA | 382,579 | G→A | *302* (TAG→TAA) | insD1 → | IS2 transposase TnpB |
RA | 383,259 | C→T | R226Q (CGG→CAG) | yaiP ← | putative family 2 glycosyltransferase |
RA | 384,059 | C→T | *186* (TAG→TAA) | yaiS ← | putative PIG‑L family deacetylase |
RA | 385,737 | A→G | D169G (GAT→GGT) | tauA → | taurine ABC transporter periplasmic binding protein |
RA | 391,739 | C→T | *289* (TAG→TAA) | insF1 ← | IS3 transposase B |
RA | 401,548 | (G)5→4 | coding (163/261 nt) | iraP → | anti‑RssB factor, RpoS stabilzer during Pi starvation, anti‑adapter protein |
RA | 405,224 | G→A | P141S (CCA→TCA) | proC ← | pyrroline‑5‑carboxylate reductase, NAD(P)‑binding |
RA | 411,297 | C→T | *395* (TAG→TAA) | araJ ← | L‑arabinose‑inducible putative transporter, MFS family |
RA | 437,107 | G→A | *173* (TAG→TAA) | pgpA → | phosphatidylglycerophosphatase A |
RA | 443,051 | C→T | *197* (TAG→TAA) | yajL ← | oxidative‑stress‑resistance chaperone |
RA | 443,604 | C→T | S13N (AGT→AAT) *304* (TAG→TAA) |
yajL ← panE ← |
oxidative‑stress‑resistance chaperone 2‑dehydropantoate reductase, NADPH‑specific |
RA | 444,641 | C→T | intergenic (‑126/‑42) | panE ← / → yajQ | 2‑dehydropantoate reductase, NADPH‑specific/phage Phi6 host factor, ATP/GTP binding protein |
RA | 450,764 | C→T | A283T (GCT→ACT) | cyoA ← | cytochrome o ubiquinol oxidase subunit II |
RA | 461,242 | G→A | *785* (TAG→TAA) | lon → | DNA‑binding ATP‑dependent protease La |
RA | 468,510 | A→G | E43G (GAG→GGG) | ybaO → | putative DNA‑binding transcriptional regulator |
RA | 469,429 | A→G | K187E (AAG→GAG) | mdlA → | putative multidrug ABC transporter ATPase |
RA | 470,643 | G→A | *591* (TAG→TAA) S3N (AGT→AAT) |
mdlA → mdlB → |
putative multidrug ABC transporter ATPase putative multidrug ABC transporter ATPase |
RA | 475,667 | T→C | S97P (TCA→CCA) | ybaY → | outer membrane lipoprotein |
RA | 477,025 | G→A | *118* (TAG→TAA) | ybaA → | DUF1428 family protein |
RA | 477,435 | T→C | T395A (ACT→GCT) | ylaB ← | putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase |
RA | 478,533 | C→T | A29T (GCC→ACC) | ylaB ← | putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase |
RA | 480,334 | C→T | *125* (TAG→TAA) | tomB ← | Hha toxicity attenuator, conjugation‑related protein |
RA | 486,641 | T→C | S36P (TCA→CCA) | mscK → | mechanosensitive channel protein, intermediate conductance, K+ regulated |
RA | 490,285 | C→T | *176* (TAG→TAA) | priC ← | primosomal replication protein N'' |
RA | 491,776 | T→C | V122A (GTT→GCT) | apt → | adenine phosphoribosyltransferase |
RA | 499,014 | C→T | R320R (CGC→CGT) *320* (TAG→TAA) |
hemH → aes ← |
ferrochelatase acetyl esterase |
RA | 515,808 | C→T | intergenic (‑35/‑111) | qmcA ← / → fetA | PHB domain membrane‑anchored putative protease/iron export ABC transporter ATPase, peroxide resistance protein |
RA | 518,721 | C→A | M143I (ATG→ATT) | ybbO ← | putative oxidoreductase |
RA | 522,463 | T→C | V683A (GTG→GCG) | ybbP → | putative ABC transporter permease |
RA | 524,158 | C→T | L300L (CTG→TTG) | rhsD → | Rhs protein with DUF4329 family putative toxin domain, putative neighboring cell growth inhibitor |
RA | 540,515 | C→T | intergenic (+7/‑50) | allB → / → ybbY | allantoinase/putative uracil/xanthine transporter |
RA | 542,530 | A→G | T215A (ACG→GCG) | glxK → | glycerate kinase II |
RA | 544,754 | C→T | R180H (CGT→CAT) | allC ← | allantoate amidohydrolase |
RA | 551,332 | G→A | *298* (TAG→TAA) | ybcF → | putative carbonate kinase |
RA | 568,004 | G→A | *289* (TAG→TAA) | insF1 → | IS3 transposase B |
RA | 571,444 | G→A | *184* (TAG→TAA) | ybcL → | inactive polymorphonuclear leukocyte migration suppressor, DLP12 prophage, UPF0098 family secreted protein |
RA | 572,454 | C→T | C29C (TGC→TGT) | ylcH → | uncharacterized protein, DLP12 prophage |
RA | 578,568 | G→A | *154* (TAG→TAA) | rzpD → | DLP12 prophage, putative murein endopeptidase |
RA | 582,148 | Δ1 bp | intergenic (+51/+4) | tfaD → / ← ybcY | pseudogene, DLP12 prophage, tail fiber assembly protein family,Phage or Prophage Related/pseudogene, DLP12 prophage, methyltransferase homology,Phage or Prophage Related |
RA | 582,152 | C→T | pseudogene (653/653 nt) | ybcY ← | pseudogene, DLP12 prophage, methyltransferase homology,Phage or Prophage Related |
RA | 586,280 | T→C | N210S (AAC→AGC) | envY ← | porin thermoregulatory transcriptional activator |
RA | 607,988 | G→A | *51* (TAG→TAA) | hokE → | toxic polypeptide, small |
RA | 631,812 | T→C | F640S (TTC→TCC) | cstA → | carbon starvation protein involved in peptide utilization, APC peptide transporter family protein |
RA | 634,746 | 2 bp→AT | [ybdL]–[ybdM] | [ybdL], [ybdM] | |
RA | 649,372 | A→G | F67S (TTC→TCC) | citF ← | citrate lyase, citrate‑ACP transferase (alpha) subunit |
RA | 649,648 | A→G | G281G (GGT→GGC) | citE ← | citrate lyase, citryl‑ACP lyase (beta) subunit |
RA | 662,153 | C→A | E42D (GAG→GAT) | lipB ← | octanoyltransferase, octanoyl‑[ACP]:protein N‑octanoyltransferase |
RA | 664,102 | C→T | *363* (TAG→TAA) | rlpA ← | septal ring protein, suppressor of prc, minor lipoprotein |
RA | 672,947 | C→A | V613F (GTT→TTT) | leuS ← | leucyl‑tRNA synthetase |
RA | 675,570 | C→T | *326* (TAG→TAA) | ybeQ ← | Sel1 family TPR‑like repeat protein |
RA | 675,601 | Δ1 bp | coding (947/978 nt) | ybeQ ← | Sel1 family TPR‑like repeat protein |
RA | 677,889 | G→A | A159T (GCC→ACC) | djlB → | putative HscC co‑chaperone, uncharacterized J domain‑containing protein |
RA | 679,874 | G→A | G123R (GGG→AGG) | ybeU → | DUF1266 family protein |
RA | 696,276 | G→A | *392* (TAG→TAA) | ubiF → | 2‑octaprenyl‑3‑methyl‑6‑methoxy‑1,4‑benzoquinol oxygenase |
RA | 711,724 | C→T | A59T (GCG→ACG) | ybfE ← | LexA‑regulated protein, CopB family |
RA | 716,388 | C→T | pseudogene (210/651 nt) | ybfG ← | pseudogene |
RA | 723,528 | (T)8→9 | coding (887/2685 nt) | kdpD ← | fused sensory histidine kinase in two‑component regulatory system with KdpE: signal sensing protein |
RA | 738,853 | G→A | *254* (TAG→TAA) | ybfD → | H repeat‑associated putative transposase |
RA | 746,723 | C→T | H263H (CAC→CAT) *349* (TAG→TAA) |
nei → abrB ← |
endonuclease VIII and 5‑formyluracil/5‑hydroxymethyluracil DNA glycosylase regulator of aidB expression, inner membrane protein |
RA | 746,726 | G→A | *264* (TAG→TAA) A348A (GCC→GCT) |
nei → abrB ← |
endonuclease VIII and 5‑formyluracil/5‑hydroxymethyluracil DNA glycosylase regulator of aidB expression, inner membrane protein |
RA | 762,739 | G→A | *406* (TAG→TAA) | sucB → | dihydrolipoyltranssuccinase |
RA | 775,120 | G→A | A123A (GCG→GCA) | ybgC → | acyl‑CoA thioester hydrolase |
RA | 777,644 | A→G | intergenic (+37/‑96) | tolA → / → tolB | membrane anchored protein in TolA‑TolQ‑TolR complex/periplasmic protein |
RA | 789,464 | G→A | I172I (ATC→ATT) | galK ← | galactokinase |
RA | 812,947 | G→A | *226* (TAG→TAA) | bioD → | dethiobiotin synthetase |
RA | 819,747 | G→A | *151* (TAG→TAA) | moaE → | molybdopterin synthase, large subunit |
RA | 821,506 | G→A | *238* (TAG→TAA) | ybhM → | BAX Inhibitor‑1 family inner membrane protein |
RA | 825,102 | G→A | A336V (GCG→GTG) | ybhR ← | putative ABC transporter permease |
RA | 826,119 | C→T | *378* (TAG→TAA) | ybhS ← | putative ABC transporter permease |
RA | 829,972 | C→T | M1M (GTG→ATG) † *224* (TAG→TAA) |
ybhG ← ybiH ← |
putative membrane fusion protein (MFP) component of efflux pump, membrane anchor DUF1956 domain‑containing tetR family putative transcriptional regulator |
RA | 850,389 | T→C | intergenic (‑292/‑61) | rhtA ← / → ompX | threonine and homoserine efflux system/outer membrane protein X |
RA | 852,869 | C→T | *43* (TAG→TAA) | mntS ← | Mn(2)‑response protein, MntR‑repressed |
RA | 854,765 | G→A | *373* (TAG→TAA) | ybiR → | putative transporter |
RA | 855,796 | A→G | intergenic (‑52/‑167) | ldtB ← / → ybiT | L,D‑transpeptidase linking Lpp to murein/ABC‑F family putative regulatory ATPase |
RA | 860,638 | A→G | Y657H (TAT→CAT) | ybiW ← | putative pyruvate formate lyase |
RA | 872,801 | G→A | *304* (TAG→TAA) | gsiD → | glutathione ABC transporter permease |
RA | 875,327 | G→A | *783* (TAG→TAA) | yliE → | putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase |
RA | 879,857 | G→A | *372* (TAG→TAA) S208S (AGC→AGT) |
yliI → gstB ← |
soluble aldose sugar dehydrogenase glutathione S‑transferase |
JC JC | 883,665 | IS1 (–) +9 bp | [mdfA] | [mdfA] | |
RA | 887,959 | G→A | *179* (TAG→TAA) | rcdA → | transcriptional regulator of csgD and ybiJI, autoregulator |
RA | 889,215 | A→G | L202P (CTG→CCG) | ybjL ← | putative transporter |
RA | 892,869 | G→A | *301* (TAG→TAA) | rimK → | ribosomal protein S6 modification protein |
RA | 899,254 | (G)6→7 | coding (737/1128 nt) | rlmC → | 23S rRNA m(5)U747 methyltransferase, SAM‑dependent |
RA | 905,743 | G→A | *277* (TAG→TAA) R337R (CGC→CGT) |
amiD → ybjS ← |
1,6‑anhydro‑N‑acetylmuramyl‑L‑alanine amidase, Zn‑dependent, OM lipoprotein putative NAD(P)H‑dependent oxidoreductase |
RA | 911,132 | A→G | intergenic (‑83/+50) | poxB ← / ← hcr | pyruvate dehydrogenase, thiamine triphosphate‑binding, FAD‑binding/HCP oxidoreductase, NADH‑dependent |
RA | 913,349 | G→A | L156L (CTG→TTG) | hcp ← | hybrid‑cluster [4Fe‑2S‑2O] subunit of anaerobic terminal reductases |
RA | 915,730 | T→C | K106K (AAA→AAG) | aqpZ ← | aquaporin Z |
RA | 922,366 | C→T | *75* (TAG→TAA) | cspD ← | inhibitor of DNA replication, cold shock protein homolog |
RA | 927,205 | A→G | R76R (CGT→CGC) | aat ← | leucyl/phenylalanyl‑tRNA‑protein transferase |
RA | 932,340 | (A)8→7 | intergenic (‑290/‑255) | trxB ← / → lrp | thioredoxin reductase, FAD/NAD(P)‑binding/leucine‑responsive global transcriptional regulator |
RA | 937,983 | G→A | *204* (TAG→TAA) | lolA → | lipoprotein chaperone |
RA | 966,584 | G→A | *755* (TAG→TAA) | ycaI → | ComEC family inner membrane protein |
RA | 967,118 | A→G | Q166Q (CAA→CAG) | msbA → | lipid ABC transporter permease/ATPase |
RA | 969,352 | G→A | *329* (TAG→TAA) | lpxK → | lipid A 4'kinase |
RA | 983,623 | G→A | *183* (TAG→TAA) | ycbK → | M15A protease‑related family periplasmic protein |
RA | 986,671 | A→G | R104R (CGT→CGC) | ompF ← | outer membrane porin 1a (Ia,b,F) |
RA | 1,006,415 | Δ1 bp | coding (464/543 nt) | zapC → | FtsZ stabilizer |
RA | 1,006,491 | C→T | V180V (GTC→GTT) *370* (TAG→TAA) |
zapC → ycbX ← |
FtsZ stabilizer 6‑N‑hydroxylaminopurine detoxification oxidoreductase |
RA | 1,050,350 | C→A | S108S (TCC→TCA) | insB1 → | IS1 transposase B |
RA | 1,053,516 | (G)6→7 | coding (2663/2745 nt) | torS ← | hybrid sensory histidine kinase in two‑component regulatory system with TorR |
RA | 1,068,254 | G→A | *58* (TAG→TAA) | ymdF → | KGG family protein |
RA | 1,068,276 | Δ1 bp | intergenic (+22/+235) | ymdF → / ← rutG | KGG family protein/pyrimidine permease |
RA | 1,068,285 | Δ1 bp | intergenic (+31/+226) | ymdF → / ← rutG | KGG family protein/pyrimidine permease |
RA | 1,072,060 | G→A | L34L (CTG→TTG) | rutC ← | putative aminoacrylate deaminase, reactive intermediate detoxification, weak enamine/imine deaminase activity |
RA | 1,073,732 | C→T | A94T (GCG→ACG) | rutA ← | pyrimidine oxygenase, FMN‑dependent |
RA | 1,082,060 | A→G | pseudogene (601/726 nt) | efeU → | ferrous iron permease (pseudogene) |
RA | 1,089,570 | T→C | E96E (GAA→GAG) | pgaB ← | poly‑beta‑1,6‑N‑acetyl‑D‑glucosamine (PGA) N‑deacetylase outer membrane export lipoprotein |
RA | 1,094,275 | C→T | *289* (TAG→TAA) | insF1 ← | IS3 transposase B |
RA | 1,102,221 | T→C | E107E (GAA→GAG) | csgE ← | curlin secretion specificity factor |
RA | 1,119,307 | C→T | *47* (TAG→TAA) | yceO ← | uncharacterized protein |
RA | 1,125,011 | A→G | C106R (TGC→CGC) | mdtH ← | multidrug resistance efflux transporter conferring overexpression resistance to norfloxacin and enoxacin |
RA | 1,139,406 | Δ1 bp | coding (1029/1644 nt) | flgK → | flagellar hook‑filament junction protein 1 |
RA | 1,146,011 | C→T | *195* (TAG→TAA) | yceF ← | m(7)GTP pyrophosphatase |
RA | 1,148,691 | G→A | *357* (TAG→TAA) | plsX → | putative phosphate acyltransferase |
RA | 1,149,712 | G→A | *318* (TAG→TAA) | fabH → | 3‑oxoacyl‑[acyl‑carrier‑protein] synthase III |
RA | 1,153,047 | A→G | D370G (GAT→GGT) | fabF → | 3‑oxoacyl‑[acyl‑carrier‑protein] synthase II |
RA | 1,154,109 | G→A | *270* (TAG→TAA) | pabC → | 4‑amino‑4‑deoxychorismate lyase component of para‑aminobenzoate synthase multienzyme complex |
RA | 1,168,350 | Δ1 bp | coding (483/633 nt) | ycfQ ← | repressor for bhsA(ycfR) |
RA | 1,200,881 | G→A | A51V (GCC→GTC) | xisE ← | e14 prophage, putative excisionase |
RA | 1,203,224 | G→A | *67* (TAG→TAA) | croE → | e14 prophage, putative DNA‑binding transcriptional regulator |
RA | 1,204,160 | G→A | *113* (TAG→TAA) | ymfM → | e14 prophage, uncharacterized protein |
RA | 1,205,731 | G→A | *61* (TAG→TAA) pseudogene (1/412 nt) |
ymfR → beeE → |
e14 prophage, uncharacterized protein pseudogene, portal protein family, e14 prophage,Phage or Prophage Related |
RA | 1,208,517 | C→T | P129L (CCT→CTT) *201* (TAG→TAA) |
tfaP → tfaE ← |
e14 prophage, uncharacterized protein e14 prophage, putative tail fiber assembly protein |
RA | 1,208,534 | Δ1 bp | coding (403/414 nt);coding (586/603 nt) | tfaP → tfaE ← |
e14 prophage, uncharacterized protein e14 prophage, putative tail fiber assembly protein |
RA | 1,211,652 | C→T | intergenic (+75/+28) | icdC → / ← iraM | pseudogene, isocitrate dehydrogenase C‑terminal gene fragment, idcC' is a 54 codon 3' gene fragment created during e14 prophage insertion/RpoS stabilzer during Mg starvation, anti‑RssB factor |
RA | 1,212,233 | A→G | intergenic (‑230/+470) | iraM ← / ← ycgX | RpoS stabilzer during Mg starvation, anti‑RssB factor/DUF1398 family protein |
RA | 1,212,703 | C→T | *135* (TAG→TAA) | ycgX ← | DUF1398 family protein |
RA | 1,216,996 | Δ2 bp | [ymgC] | [ymgC] | |
RA | 1,228,724 | A→G | T216A (ACT→GCT) | ycgM → | putative isomerase/hydrolase |
RA | 1,245,600 | G→A | *147* (TAG→TAA) | ycgY → | uncharacterized protein |
RA | 1,250,629 | (C)5→6 | coding (210/1071 nt) | dhaK ← | dihydroxyacetone kinase, PTS‑dependent, dihydroxyacetone‑binding subunit |
RA | 1,252,038 | G→A | A325T (GCT→ACT) | dhaR → | dhaKLM operon transcription activator |
RA | 1,260,528 | A→G | I92I (ATT→ATC) | dauA ← | C4‑dicarboxylic acid transporter |
RA | 1,264,970 | G→A | *419* (TAG→TAA) | hemA → | glutamyl tRNA reductase |
MC JC | 1,265,001 | 1086 bp→GAGG | [prfA] | [prfA] | |
RA | 1,271,455 | G→A | T132I (ACC→ATC) | chaA ← | calcium/sodium:proton antiporter |
RA | 1,275,815 | T→C | E5E (GAA→GAG) | narL ← | response regulator in two‑component regulatory system with NarX |
RA | 1,286,793 | A→G | intergenic (+267/+273) | narI → / ← rttR | nitrate reductase 1, gamma (cytochrome b(NR)) subunit/rtT sRNA, processed from tyrT transcript |
RA | 1,286,796 | T→C | intergenic (+270/+270) | narI → / ← rttR | nitrate reductase 1, gamma (cytochrome b(NR)) subunit/rtT sRNA, processed from tyrT transcript |
RA | 1,286,805 | 2 bp→AA | intergenic (+279/+260) | narI → / ← rttR | nitrate reductase 1, gamma (cytochrome b(NR)) subunit/rtT sRNA, processed from tyrT transcript |
RA | 1,286,831 | T→A | intergenic (+305/+235) | narI → / ← rttR | nitrate reductase 1, gamma (cytochrome b(NR)) subunit/rtT sRNA, processed from tyrT transcript |
RA | 1,286,859 | T→C | intergenic (+333/+207) | narI → / ← rttR | nitrate reductase 1, gamma (cytochrome b(NR)) subunit/rtT sRNA, processed from tyrT transcript |
RA | 1,286,984 | G→A | intergenic (+458/+82) | narI → / ← rttR | nitrate reductase 1, gamma (cytochrome b(NR)) subunit/rtT sRNA, processed from tyrT transcript |
RA | 1,287,152 | T→C | noncoding (85/171 nt) T9A (ACT→GCT) |
rttR ← tpr ← |
rtT sRNA, processed from tyrT transcript protamine‑like protein |
RA | 1,287,161 | 2 bp→AA | noncoding (75‑76/171 nt) coding (15‑16/90 nt) |
rttR ← tpr ← |
rtT sRNA, processed from tyrT transcript protamine‑like protein |
RA | 1,309,016 | C→T | *418* (TAG→TAA) | kch ← | voltage‑gated potassium channel |
RA | 1,317,517 | A→G | I300T (ATC→ACC) | trpB ← | tryptophan synthase, beta subunit |
RA | 1,347,450 | C→T | G488D (GGT→GAT) | rnb ← | ribonuclease II |
RA | 1,354,505 | C→T | S5N (AGC→AAC) *322* (TAG→TAA) |
sapC ← sapB ← |
antimicrobial peptide transport ABC transporter permease antimicrobial peptide transport ABC transporter permease |
RA | 1,366,935 | C→T | *326* (TAG→TAA) | pspF ← | psp operon transcriptional activator |
RA | 1,370,044 | (T)9→8 | intergenic (+41/‑172) | pspE → / → ycjM | thiosulfate:cyanide sulfurtransferase (rhodanese)/alpha amylase catalytic domain family protein |
RA | 1,380,807 | G→A | *220* (TAG→TAA) | ycjU → | beta‑phosphoglucomutase |
RA | 1,381,789 | G→A | pseudogene (13/126 nt) | ycjV → | pseudogene, putative ATP‑binding component of a transport system |
RA | 1,389,242 | C→T | Q105* (CAA→TAA) | ycjG → | L‑Ala‑D/L‑Glu epimerase |
RA | 1,389,499 | C→T | C190C (TGC→TGT) | ycjG → | L‑Ala‑D/L‑Glu epimerase |
RA | 1,389,895 | G→A | *322* (TAG→TAA) P235L (CCT→CTT) |
ycjG → mpaA ← |
L‑Ala‑D/L‑Glu epimerase murein peptide amidase A |
RA | 1,392,890 | G→A | *300* (TAG→TAA) | pgrR → | murein peptide degradation regulator |
RA | 1,399,985 | (C)7→8 | coding (252/516 nt) | ogt ← | O‑6‑alkylguanine‑DNA:cysteine‑protein methyltransferase |
RA | 1,400,348 | G→A | P476S (CCC→TCC) | abgT ← | p‑aminobenzoyl‑glutamate transporter, membrane protein |
RA | 1,412,000 | C→T | *412* (TAG→TAA) | intR ← | Rac prophage, integrase |
RA | 1,418,386 | G→A | intergenic (‑157/‑285) | kilR ← / → sieB | killing protein, Rac prophage, FtsZ inhibitor protein/phage superinfection exclusion protein, Rac prophage |
RA | 1,419,159 | G→A | *163* (TAG→TAA) S51S (AGC→AGT) |
sieB → ydaF ← |
phage superinfection exclusion protein, Rac prophage uncharacterized protein, Rac prophage |
RA | 1,419,344 | G→A | A38V (GCT→GTT) | ydaG ← | Rac prophage, uncharacterized protein |
RA | 1,425,228 | (T)8→7 | coding (1447/1458 nt) | trkG → | Rac prophage, potassium transporter subunit |
RA | 1,425,980 | G→A | pseudogene (351/453 nt) | ydaY → | pseudogene, Rac prophage,Phage or Prophage Related |
RA | 1,426,288 | G→A | intergenic (+206/‑166) | ydaY → / → tmpR | pseudogene, Rac prophage,Phage or Prophage Related/Rac prophage, pseudogene, tail protein family,Phage or Prophage Related, putative alpha helix protein |
RA | 1,431,882 | T→C | V945A (GTG→GCG) | stfR → | Rac prophage, putative tail fiber protein |
RA | 1,432,273 | G→A | A1075A (GCG→GCA) | stfR → | Rac prophage, putative tail fiber protein |
RA | 1,450,392 | C→T | A320T (GCA→ACA) | tynA ← | tyramine oxidase, copper‑requiring |
RA | 1,454,292 | C→A | G122G (GGC→GGA) | paaA → | ring 1,2‑phenylacetyl‑CoA epoxidase subunit |
RA | 1,458,617 | A→G | A118A (GCA→GCG) | paaG → | 1,2‑epoxyphenylacetyl‑CoA isomerase, oxepin‑CoA‑forming |
RA | 1,459,052 | G→A | *263* (TAG→TAA) | paaG → | 1,2‑epoxyphenylacetyl‑CoA isomerase, oxepin‑CoA‑forming |
RA | 1,464,489 | G→A | *317* (TAG→TAA) D7N (GAC→AAC) |
paaX → paaY → |
transcriptional repressor of phenylacetic acid degradation paa operon, phenylacetyl‑CoA inducer thioesterase required for phenylacetic acid degradation, trimeric, phenylacetate regulatory and detoxification protein, hexapeptide repeat protein |
RA | 1,466,996 | T→C | pseudogene (1605/2513 nt) | ydbA → | pseudogene, autotransporter homolog, interrupted by IS2 and IS30 |
RA | 1,467,921 | C→T | *302* (TAG→TAA) | insD1 ← | IS2 transposase TnpB |
RA | 1,491,389 | A→G | K163R (AAG→AGG) | cybB → | cytochrome b561 |
RA | 1,493,219 | A→G | E250E (GAA→GAG) | trg → | methyl‑accepting chemotaxis protein III, ribose and galactose sensor receptor |
RA | 1,497,308 | A→G | E151E (GAA→GAG) | opgD → | OPG biosynthetic periplasmic protein |
RA | 1,503,125 | G→A | *223* (TAG→TAA) | ydcL → | lipoprotein |
RA | 1,513,468 | T→C | S218P (TCC→CCC) | ydcT → | putative ABC transporter ATPase |
RA | 1,529,938 | G→A | pseudogene (2037/2037 nt) R6K (AGA→AAA) |
rhsE → ydcD → |
pseudogene, Rhs family putative immunity protein for RhsE |
RA | 1,533,045 | C→T | intergenic (+93/‑7) | ydcC → / → pptA | H repeat‑associated putative transposase/4‑oxalocrotonate tautomerase |
RA | 1,544,384 | C→T | pseudogene (381/381 nt) | yddK ← | pseudogene, leucine‑rich protein, putative glycoportein |
RA | 1,548,360 | C→T | D320D (GAC→GAT) | fdnG → | formate dehydrogenase‑N, alpha subunit, nitrate‑inducible |
RA | 1,557,112 | C→T | *309* (TAG→TAA) | ddpF ← | D,D‑dipeptide ABC transporter ATPase |
RA | 1,559,680 | G→A | G77G (GGC→GGT) | ddpC ← | D,D‑dipeptide ABC transporter permease |
RA | 1,565,758 | C→T | *461* (TAG→TAA) | dosC ← | diguanylate cyclase, cold‑ and stationary phase‑induced oxygen‑dependent biofilm regulator |
RA | 1,571,332 | G→T | I238I (ATC→ATA) | gadB ← | glutamate decarboxylase B, PLP‑dependent |
RA | 1,571,902 | G→A | D48D (GAC→GAT) | gadB ← | glutamate decarboxylase B, PLP‑dependent |
RA | 1,571,917 | G→A | F43F (TTC→TTT) | gadB ← | glutamate decarboxylase B, PLP‑dependent |
RA | 1,598,617 | C→T | *531* (TAG→TAA) | lsrK ← | autoinducer‑2 (AI‑2) kinase |
RA | 1,614,789 | C→T | intergenic (‑86/‑15) | sad ← / → yneJ | succinate semialdehyde dehydrogenase, NAD(P)+‑dependent/putative DNA‑binding transcriptional regulator |
RA | 1,618,218 | G→A | *397* (TAG→TAA) | ydeA → | arabinose efflux transporter, arabinose‑inducible |
RA | 1,619,957 | G→A | *128* (TAG→TAA) | marA → | multiple antibiotic resistance transcriptional regulator |
RA | 1,620,207 | G→A | *73* (TAG→TAA) | marB → | periplasmic mar operon regulator |
RA | 1,621,542 | G→A | D71N (GAC→AAC) | ydeE → | putative transporter |
RA | 1,624,357 | (T)8→7 | coding (141/393 nt) | ydeI ← | hydrogen peroxide resistance OB fold protein, putative periplasmic protein |
RA | 1,626,825 | C→T | V186I (GTT→ATT) | dcp ← | dipeptidyl carboxypeptidase II |
RA | 1,627,124 | T→C | D86G (GAT→GGT) | dcp ← | dipeptidyl carboxypeptidase II |
RA | 1,627,625 | T→C | L37L (TTG→CTG) | ydfG → | NADP‑dependent 3‑hydroxy acid dehydrogenase, malonic semialdehyde reductase |
RA | 1,630,986 | A→G | intergenic (‑73/+16) | ydfI ← / ← ydfJ | putative NAD‑dependent D‑mannonate oxidoreductase/pseudogene, MFS transporter family, interrupted by Qin prophage,Phage or Prophage Related, putative transport protein |
RA | 1,639,030 | C→T | *166* (TAG→TAA) | rzpQ ← | Rz‑like protein, Qin prophage |
RA | 1,649,041 | G→A | *73* (TAG→TAA) | ydfC → | uncharacterized protein, Qin prophage |
RA | 1,651,537 | G→A | pseudogene (693/693 nt) | insD1 → | IS2 transposase TnpB,IS, phage, Tn, Transposon‑related functions, extrachromosomal, transposon related |
RA | 1,655,057 | T→C | T29A (ACG→GCG) | rspA ← | bifunctional D‑altronate/D‑mannonate dehydratase |
RA | 1,655,347 | C→T | *109* (TAG→TAA) | ynfA ← | UPF0060 family inner membrane protein |
RA | 1,655,360 | (C)5→4 | coding (314/327 nt) | ynfA ← | UPF0060 family inner membrane protein |
RA | 1,656,744 | G→A | *187* (TAG→TAA) | speG → | spermidine N(1)‑acetyltransferase |
RA | 1,664,096 | T→C | I163T (ATA→ACA) | ynfH → | oxidoreductase, membrane subunit |
RA | 1,665,120 | G→A | *205* (TAG→TAA) | dmsD → | twin‑argninine leader‑binding protein for DmsA and TorA |
RA | 1,670,581 | G→A | G295R (GGA→AGA) | ynfM → | putative arabinose efflux transporter |
RA | 1,673,314 | A→G | L63P (CTG→CCG) | mdtJ ← | multidrug efflux system transporter |
RA | 1,673,789 | T→C | intergenic (‑288/‑124) | mdtJ ← / → tqsA | multidrug efflux system transporter/pheromone AI‑2 transporter |
RA | 1,676,624 | T→C | H427R (CAC→CGC) | pntA ← | pyridine nucleotide transhydrogenase, alpha subunit |
RA | 1,685,542 | (C)6→5 | coding (1047/1404 nt) | fumC ← | fumarate hydratase (fumarase C),aerobic Class II |
RA | 1,691,192 | G→A | Q447Q (CAG→CAA) | ydgA → | DUF945 family protein |
RA | 1,696,452 | (A)5→4 | intergenic (‑381/+10) | uidA ← / ← uidR | beta‑D‑glucuronidase/transcriptional repressor |
RA | 1,700,201 | (T)5→6 | coding (847/1593 nt) | malX → | maltose and glucose‑specific PTS enzyme IIB component and IIC component |
RA | 1,709,163 | T→C | S8P (TCC→CCC) | rsxD → | SoxR iron‑sulfur cluster reduction factor component, putative membrane protein of electron transport complex |
RA | 1,712,518 | (C)6→7 | intergenic (+360/‑251) | nth → / → dtpA | DNA glycosylase and apyrimidinic (AP) lyase (endonuclease III)/dipeptide and tripeptide permease A |
RA | 1,714,326 | (T)9→8 | intergenic (+55/‑51) | dtpA → / → gstA | dipeptide and tripeptide permease A/glutathionine S‑transferase |
RA | 1,719,058 | G→A | P182L (CCG→CTG) | anmK ← | anhydro‑N‑acetylmuramic acid kinase |
RA | 1,726,622 | G→A | *200* (TAG→TAA) | nemR → | transcriptional repressor for the nemRA‑gloA operon, quinone‑, glyoxal‑, and HOCl‑activated |
RA | 1,733,703 | G→A | *1539* (TAG→TAA) | lhr → | putative ATP‑dependent helicase |
RA | 1,735,484 | T→C | V36A (GTC→GCC) | sodB → | superoxide dismutase, Fe |
RA | 1,742,575 | G→A | intergenic (+14/+26) | cfa → / ← ribC | cyclopropane fatty acyl phospholipid synthase, SAM‑dependent/riboflavin synthase, alpha subunit |
RA | 1,744,740 | C→T | G428G (GGC→GGT) | mdtK → | multidrug efflux system transporter |
RA | 1,757,006 | G→A | A437T (GCT→ACT) | pykF → | pyruvate kinase I |
RA | 1,757,721 | C→T | *335* (TAG→TAA) | ldtE ← | murein L,D‑transpeptidase |
MC JC | 1,757,753 | Δ5 bp | coding (969‑973/1005 nt) | ldtE ← | murein L,D‑transpeptidase |
RA | 1,759,680 | (C)5→6 | coding (844/1221 nt) | sufS ← | cysteine desulfurase, stimulated by SufE, selenocysteine lyase, PLP‑dependent |
RA | 1,761,518 | G→A | R92C (CGT→TGT) | sufD ← | component of SufBCD Fe‑S cluster assembly scaffold |
RA | 1,763,987 | Δ1 bp | coding (23/1488 nt) | sufB ← | component of SufBCD Fe‑S cluster assembly scaffold |
RA | 1,764,018 | C→T | *123* (TAG→TAA) | sufA ← | Fe‑S cluster assembly protein |
RA | 1,769,478 | (G)7→8 | coding (405/1113 nt) | ydiK → | UPF0118 family inner membrane protein |
RA | 1,781,964 | C→G | G190G (GGC→GGG) | ydiS → | putative oxidoreductase |
RA | 1,788,278 | G→A | *278* (TAG→TAA) | ppsR → | PEP synthase kinase and PEP synthase pyrophosphorylase |
RA | 1,789,804 | G→A | *64* (TAG→TAA) | ydiE → | hemin uptake protein HemP homolog |
RA | 1,792,267 | C→T | *155* (TAG→TAA) | nlpC ← | putative C40 clan peptidase lipoprotein |
RA | 1,794,172 | C→T | *327* (TAG→TAA) | btuC ← | vitamin B12 ABC transporter permease |
RA | 1,799,883 | T→C | K39K (AAA→AAG) | rpmI ← | 50S ribosomal subunit protein L35 |
RA | 1,803,567 | G→A | pseudogene (50/1476 nt) | arpB → | pseudogene, ankyrin repeats |
RA | 1,819,569 | A→G | G79G (GGT→GGC) | chbA ← | N,N'‑diacetylchitobiose‑specific enzyme IIA component of PTS |
RA | 1,821,867 | (A)8→7 | intergenic (‑248/+51) | chbB ← / ← osmE | N,N'‑diacetylchitobiose‑specific enzyme IIB component of PTS/osmotically‑inducible lipoprotein |
RA | 1,826,546 | T→C | E126E (GAA→GAG) | astE ← | succinylglutamate desuccinylase |
RA | 1,834,111 | G→A | *237* (TAG→TAA) | ydjX → | TVP38/TMEM64 family inner membrane protein |
RA | 1,841,897 | G→A | *136* (TAG→TAA) T80I (ACT→ATT) |
nudG → ynjH ← |
CTP pyrophosphohydrolase, also hydrolyzes 2‑hydroxy‑dATP, 8‑hydroxy‑dGTP, 5‑hydroxy‑CTP, dCTP and 5‑methyl‑dCTP DUF1496 family protein |
RA | 1,850,810 | (C)5→4 | intergenic (+117/‑50) | sppA → / → ansA | protease IV (signal peptide peptidase)/cytoplasmic L‑asparaginase 1 |
RA | 1,862,634 | A→G | intergenic (‑205/‑137) | msrB ← / → gapA | methionine sulfoxide reductase B/glyceraldehyde‑3‑phosphate dehydrogenase A |
RA | 1,863,004 | T→C | R78R (CGT→CGC) | gapA → | glyceraldehyde‑3‑phosphate dehydrogenase A |
RA | 1,869,022 | (T)6→5 | coding (68/1284 nt) | yeaH → | UPF0229 family protein |
RA | 1,874,078 | C→T | *35* (TAG→TAA) | yoaI ← | uncharacterized protein |
RA | 1,874,798 | G→A | *149* (TAG→TAA) T260I (ACT→ATT) |
yeaL → yeaM ← |
UPF0756 family putative inner membrane protein putative DNA‑binding transcriptional regulator |
RA | 1,875,056 | (C)6→5 | coding (521/822 nt) | yeaM ← | putative DNA‑binding transcriptional regulator |
RA | 1,881,463 | G→A | A116V (GCG→GTG) | dmlR ← | transcriptional activator of dmlA |
RA | 1,886,810 | G→A | *322* (TAG→TAA) | yeaX → | putative YeaWX dioxygenase beta subunit, reductase component |
RA | 1,892,402 | A→G | S278S (AGT→AGC) | yoaA ← | putative ATP‑dependent helicase, DinG family |
RA | 1,905,805 | G→A | G40S (GGC→AGC) | mntP → | putative Mn(2+) efflux pump, mntR‑regulated |
RA | 1,910,474 | T→C | S67P (TCC→CCC) | yebQ → | putative transporter |
RA | 1,920,205 | (T)7→8 | intergenic (+62/‑18) | yebT → / → rsmF | MCE domain protein/16S rRNA m(5)C1407 methyltransferase, SAM‑dependent |
RA | 1,926,096 | G→A | *219* (TAG→TAA) | yobB → | C‑N hydrolase family protein |
RA | 1,926,782 | G→A | *221* (TAG→TAA) D686D (GAC→GAT) |
exoX → ptrB ← |
exodeoxyribonuclease 10, DNA exonuclease X protease II |
RA | 1,939,673 | T→C | N174S (AAC→AGC) | lpxM ← | myristoyl‑acyl carrier protein (ACP)‑dependent acyltransferase |
RA | 1,942,993 | G→A | G111E (GGG→GAG) | znuC → | zinc ABC transporter ATPase |
RA | 1,950,559 | (C)5→6 | intergenic (‑37/‑273) | aspS ← / → yecD | aspartyl‑tRNA synthetase/isochorismatase family protein |
RA | 1,952,661 | G→A | *132* (TAG→TAA) | yecN → | MAPEG family inner membrane protein |
RA | 1,964,697 | G→A | L118L (CTC→CTT) | flhA ← | putative flagellar export pore protein |
MC JC | 1,978,503 | Δ776 bp | insB1–insA | insB1, insA | |
RA | 1,980,188 | C→T | *475* (TAG→TAA) | otsA ← | trehalose‑6‑phosphate synthase |
RA | 1,998,494 | C→T | *329* (TAG→TAA) | dcyD ← | D‑cysteine desulfhydrase, PLP‑dependent |
RA | 2,012,001 | C→T | pseudogene (40/678 nt) | yedN ← | pseudogene, IpaH/YopM family |
RA | 2,012,700 | C→T | *105* (TAG→TAA) | fliE ← | flagellar basal‑body component |
RA | 2,016,095 | G→A | L76L (CTG→CTA) | fliH → | negative regulator of FliI ATPase activity |
RA | 2,021,501 | G→A | *138* (TAG→TAA) | fliN → | flagellar motor switching and energizing component |
RA | 2,022,606 | G→A | *246* (TAG→TAA) | fliP → | flagellar biosynthesis protein |
RA | 2,022,810 | C→T | A65A (GCC→GCT) | fliQ → | flagellar biosynthesis protein |
RA | 2,022,885 | G→A | *90* (TAG→TAA) | fliQ → | flagellar biosynthesis protein |
RA | 2,029,729 | (C)6→5 | coding (191/921 nt) | yedA → | amino acid exporter for phenylalanine, threonine |
RA | 2,034,536 | G→A | pseudogene (486/663 nt) | yedS → | pseudogene, outer membrane protein homology, putative outer membrane protein |
RA | 2,049,336 | C→T | P1467S (CCG→TCG) | yeeJ → | putative adhesin |
RA | 2,051,158 | A→G | D2074G (GAC→GGC) | yeeJ → | putative adhesin |
RA | 2,059,964 | C→T | *317* (TAG→TAA) | cbl ← | ssuEADCB/tauABCD operon transcriptional activator |
RA | 2,068,952 | C→T | *302* (TAG→TAA) | insD1 ← | IS2 transposase TnpB |
RA | 2,084,773 | G→A | G251G (GGC→GGT) | yeeE ← | UPF0394 family inner membrane protein |
RA | 2,090,046 | G→A | *17* (TAG→TAA) | hisL → | his operon leader peptide |
RA | 2,099,237 | G→A | A126V (GCG→GTG) | ugd ← | UDP‑glucose 6‑dehydrogenase |
RA | 2,104,494 | C→T | V6I (GTC→ATC) *197* (TAG→TAA) |
wbbK ← wbbJ ← |
lipopolysaccharide biosynthesis protein putative lipopolysaccharide biosynthesis O‑acetyl transferase |
RA | 2,114,502 | C→T | *465* (TAG→TAA) | wcaM ← | colanic acid biosynthesis protein |
RA | 2,115,907 | C→T | *407* (TAG→TAA) | wcaL ← | putative glycosyl transferase |
RA | 2,118,164 | G→A | R81C (CGT→TGT) | wcaK ← | colanic acid biosynthesis protein |
RA | 2,130,853 | C→T | S9N (AGC→AAC) *406* (TAG→TAA) |
wcaD ← wcaC ← |
putative colanic acid polymerase putative glycosyl transferase |
RA | 2,131,667 | T→C | D135G (GAC→GGC) | wcaC ← | putative glycosyl transferase |
RA | 2,139,759 | C→T | *618* (TAG→TAA) | asmA ← | suppressor of OmpF assembly mutants, putative outer membrane protein assembly factor, inner membrane‑anchored periplasmic protein |
RA | 2,149,963 | G→T | G341G (GGC→GGA) | yegI ← | protein kinase‑related putative non‑specific DNA‑binding protein |
RA | 2,152,876 | G→A | P85S (CCG→TCG) | yegL ← | VMA domain protein |
RA | 2,161,529 | G→A | Q22Q (CAG→CAA) | iceT → | putative citrate/iron‑citrate/zinc‑citrate efflux transporter |
RA | 2,163,207 | A→G | D111G (GAT→GGT) | baeS → | sensory histidine kinase in two‑component regulatory system with BaeR |
RA | 2,164,998 | G→A | *241* (TAG→TAA) | baeR → | response regulator in two‑component regulatory system with BaeS |
RA | 2,169,693 | C→T | pseudogene (475/475 nt) | gatR ← | pseudogene, repressor for gat operon, interrupted by IS3, split galactitol utilization operon repressor, fragment 2, split galactitol utilization operon repressor, interrupted |
RA | 2,171,398 | G→A | *289* (TAG→TAA) | insF1 → | IS3 transposase B |
RA | 2,173,363 | Δ2 bp | intergenic (‑1/+1) | gatC ← / ← gatC | pseudogene, galactitol‑specific enzyme IIC component of PTS,transport, Transport of small molecules: Carbohydrates, organic acids, alcohols, PTS system galactitol‑specific enzyme IIC/pseudogene, galactitol‑specific enzyme IIC component of PTS,transport, Transport of small molecules: Carbohydrates, organic acids, alcohols, PTS system galactitol‑specific enzyme IIC |
RA | 2,179,330 | T→C | S170S (AGT→AGC) | yegT → | nucleoside transporter, low affinity |
RA | 2,182,035 | C→T | L314L (CTA→TTA) *249* (TAG→TAA) |
yegV → yegW ← |
putative kinase putative DNA‑binding transcriptional regulator |
RA | 2,182,061 | G→A | *322* (TAG→TAA) L241L (CTA→TTA) |
yegV → yegW ← |
putative kinase putative DNA‑binding transcriptional regulator |
RA | 2,189,594 | C→T | A439A (GCG→GCA) | yehB ← | putative outer membrane protein |
RA | 2,200,454 | (A)8→7 | coding (176/3633 nt) | yehI → | DUF4132 domain‑containing protein |
RA | 2,203,986 | (A)5→6 | coding (15/318 nt) | yehK → | uncharacterized protein |
RA | 2,210,944 | G→A | pseudogene (1845/2001 nt) | yehQ → | pseudogene |
RA | 2,214,339 | (C)6→5 | coding (306/1686 nt) | yehU ← | inner membrane putative sensory kinase in two‑component system with YehT |
RA | 2,218,207 | C→T | A117A (GCG→GCA) | yehY ← | putative ABC transporter permease |
RA | 2,220,789 | G→A | R401C (CGT→TGT) | bglX ← | beta‑D‑glucoside glucohydrolase, periplasmic |
RA | 2,225,044 | C→T | *196* (TAG→TAA) | yohC ← | Yip1 family inner membrane protein |
RA | 2,226,509 | C→T | *254* (TAG→TAA) | yohF ← | putative oxidoreductase |
RA | 2,233,597 | G→A | *240* (TAG→TAA) | sanA → | DUF218 superfamily vancomycin high temperature exclusion protein |
RA | 2,240,754 | (C)5→6 | coding (915/1041 nt) | galS ← | galactose‑ and fucose‑inducible galactose regulon transcriptional isorepressor, mgl operon transcriptional repressor, autorepressor |
RA | 2,244,245 | G→A | A112A (GCG→GCA) | yeiG → | S‑formylglutathione hydrolase |
RA | 2,263,478 | T→C | V6V (GTA→GTG) | fruB ← | fused fructose‑specific PTS enzymes: IIA component/HPr component |
RA | 2,266,013 | T→C | R188R (CGT→CGC) | yeiP → | elongation factor P‑like protein |
RA | 2,274,166 | A→G | K601K (AAA→AAG) | yejA → | microcin C ABC transporter periplasmic binding protein |
RA | 2,274,178 | G→A | *605* (TAG→TAA) | yejA → | microcin C ABC transporter periplasmic binding protein |
RA | 2,276,298 | G→A | *342* (TAG→TAA) | yejE → | microcin C ABC transporter permease |
RA | 2,276,530 | G→A | S77S (TCG→TCA) | yejF → | microcin C ABC transporter ATPase |
RA | 2,288,561 | (C)7→6 | pseudogene (354/2525 nt) | yejO ← | pseudogene, autotransporter outer membrane homology,putative transport, Not classified, putative ATP‑binding component of a transport system |
RA | 2,289,027 | G→A | intergenic (‑113/+38) | yejO ← / ← insH1 | pseudogene, autotransporter outer membrane homology,putative transport, Not classified, putative ATP‑binding component of a transport system/IS5 transposase and trans‑activator |
RA | 2,291,973 | T→C | G146G (GGA→GGG) | ccmH ← | heme lyase, CcmH subunit |
RA | 2,316,160 | G→A | *891* (TAG→TAA) | rcsD → | phosphotransfer intermediate protein in two‑component regulatory system with RcsBC |
RA | 2,317,027 | C→T | *950* (TAG→TAA) | rcsC ← | hybrid sensory kinase in two‑component regulatory system with RcsB and YojN |
RA | 2,318,019 | G→A | R620C (CGT→TGT) | rcsC ← | hybrid sensory kinase in two‑component regulatory system with RcsB and YojN |
RA | 2,334,336 | C→T | pseudogene (67/4605 nt) *208* (TAG→TAA) |
yfaS ← yfaT ← |
pseudogene, bacterial alpha2‑macroglobulin YfaS variant family, putative membrane protein DUF1175 family protein, putative host defense protein |
RA | 2,350,162 | A→G | L284L (TTG→CTG) | glpQ ← | periplasmic glycerophosphodiester phosphodiesterase |
RA | 2,358,163 | G→A | A228V (GCG→GTG) | rhmA ← | 2‑keto‑3‑deoxy‑L‑rhamnonate aldolase |
RA | 2,370,019 | T→C | *661R (TGA→CGA) M1T (ATG→ACG) † |
arnA → arnD → |
fused UDP‑L‑Ara4N formyltransferase/UDP‑GlcA C‑4'‑decarboxylase undecaprenyl phosphate‑alpha‑L‑ara4FN deformylase |
RA | 2,379,348 | C→T | *432* (TAG→TAA) | menF ← | isochorismate synthase 2 |
RA | 2,414,699 | T→C | intergenic (+27/‑48) | ackA → / → pta | acetate kinase A and propionate kinase 2/phosphate acetyltransferase |
RA | 2,416,763 | 2 bp→TC | coding (2017‑2018/2145 nt) | pta → | phosphate acetyltransferase |
RA | 2,438,548 | T→C | V200A (GTG→GCG) | flk → | putative flagella assembly protein |
RA | 2,449,228 | C→T | *274* (TAG→TAA) | yfcO ← | DUF2544 family putative outer membrane protein |
RA | 2,453,265 | C→T | pseudogene (1737/2646 nt) | yfcU ← | pseudogene, FimD fimbrial export usher family,putative membrane, Not classified, putative outer membrane protein |
RA | 2,462,889 | (C)9→8 | intergenic (+243/‑123) | fadL → / → yfdF | long‑chain fatty acid outer membrane transporter/uncharacterized protein |
RA | 2,468,106 | T→C | A84A (GCT→GCC) | gtrA → | CPS‑53 (KpLE1) prophage, bactoprenol‑linked glucose translocase/flippase |
RA | 2,471,105 | G→A | pseudogene (291/291 nt) P138L (CCT→CTT) |
tfaS → yfdK ← |
pseudogene, CPS‑53 (KpLE1) prophage, tail fiber assembly protein fragment,Phage or Prophage Related CPS‑53 (KpLE1) prophage, conserved protein |
RA | 2,478,092 | A→G | V82V (GTA→GTG) | dsdX → | D‑serine transporter |
RA | 2,484,897 | (C)6→7 | coding (524/3594 nt) | evgS → | hybrid sensory histidine kinase in two‑component regulatory system with EvgA |
RA | 2,494,950 | T→C | Y85H (TAT→CAT) | ypdI → | putative lipoprotein involved in colanic acid biosynthesis |
RA | 2,494,973 | G→A | *92* (TAG→TAA) | ypdI → | putative lipoprotein involved in colanic acid biosynthesis |
RA | 2,495,050 | C→T | *81* (TAG→TAA) | yfdY ← | DUF2545 family putative inner membrane protein |
RA | 2,504,391 | T→C | E32G (GAA→GGA) | fryA ← | putative PTS enzyme: Hpr, enzyme I and IIA components |
RA | 2,510,111 | G→A | G161D (GGC→GAC) | yfeO → | putative ion channel protein |
RA | 2,510,886 | G→A | *419* (TAG→TAA) | yfeO → | putative ion channel protein |
RA | 2,511,468 | C→T | *413* (TAG→TAA) | mntH ← | manganese/divalent cation transporter |
RA | 2,521,593 | C→T | *295* (TAG→TAA) | xapR ← | transcriptional activator of xapAB |
RA | 2,521,852 | T→C | D209G (GAT→GGT) | xapR ← | transcriptional activator of xapAB |
MC JC | 2,525,917 | Δ9 bp | intergenic (+26/+5) | yfeN → / ← yfeR | putative outer membrane protein/transcriptional regulator of yefH |
RA | 2,525,930 | C→T | *309* (TAG→TAA) | yfeR ← | transcriptional regulator of yefH |
RA | 2,534,031 | T→C | intergenic (+10/‑35) | ptsH → / → ptsI | phosphohistidinoprotein‑hexose phosphotransferase component of PTS system (Hpr)/PEP‑protein phosphotransferase of PTS system (enzyme I) |
RA | 2,552,094 | G→A | I15I (ATC→ATT) | ypeA ← | GNAT family putative N‑acetyltransferase |
RA | 2,574,135 | G→A | D57D (GAC→GAT) | eutT ← | cobalamin adenosyltransferase involved in ethanolamine utilization |
RA | 2,589,535 | C→T | I647I (ATC→ATT) | acrD → | aminoglycoside/multidrug efflux system |
RA | 2,591,603 | G→A | *119* (TAG→TAA) | yffB → | putative ArsC family reductase |
RA | 2,595,227 | T→C | Q211Q (CAA→CAG) | tmcA ← | elongator methionine tRNA (ac4C34) acetyltransferase |
RA | 2,600,609 | (C)5→6 | coding (132/471 nt) | bcp → | peroxiredoxin, thiol peroxidase, thioredoxin‑dependent |
MC JC | 2,614,614 | Δ3 bp | coding (681‑683/849 nt) | focB → | putative formate transporter |
RA | 2,618,075 | C→T | *234* (TAG→TAA) | hda ← | ATPase regulatory factor involved in DnaA inactivation |
RA | 2,621,307 | A→G | E37E (GAA→GAG) | purM → | phosphoribosylaminoimidazole synthetase |
RA | 2,629,481 | G→A | *64* (TAG→TAA) | yfgG → | uncharacterized protein |
RA | 2,637,295 | C→T | R21H (CGT→CAT) | der ← | GTPase, multicopy suppressor of ftsJ |
RA | 2,645,013 | C→T | *771* (TAG→TAA) | pbpC ← | penicillin‑insensitive murein repair transglycosylase, inactive transpeptidase domain protein |
RA | 2,655,767 | T→C | T198A (ACT→GCT) | pepB ← | aminopeptidase B |
RA | 2,673,768 | G→A | *141* (TAG→TAA) | yphA → | DoxX family inner membrane protein |
RA | 2,682,157 | (C)7→8 | coding (589/3282 nt) | yphG ← | DUF4380 domain‑containing TPR repeat protein |
RA | 2,684,971 | G→A | G179G (GGC→GGT) | glyA ← | serine hydroxymethyltransferase |
RA | 2,685,561 | T→C | intergenic (‑54/‑274) | glyA ← / → hmp | serine hydroxymethyltransferase/fused nitric oxide dioxygenase/dihydropteridine reductase 2 |
RA | 2,685,910 | G→A | A26T (GCC→ACC) | hmp → | fused nitric oxide dioxygenase/dihydropteridine reductase 2 |
RA | 2,697,915 | C→T | *212* (TAG→TAA) | pgpC ← | phosphatidylglycerophosphatase C, membrane bound |
RA | 2,713,568 | T→C | W225R (TGG→CGG) | srmB → | ATP‑dependent RNA helicase |
RA | 2,721,193 | C→T | A414V (GCA→GTA) | pka → | protein lysine acetyltransferase |
RA | 2,723,065 | G→A | A113A (GCG→GCA) | pssA → | phosphatidylserine synthase, CDP‑diacylglycerol‑serine O‑phosphatidyltransferase |
RA | 2,724,448 | C→T | H107H (CAC→CAT) *433* (TAG→TAA) |
yfiM → kgtP ← |
putative lipoprotein alpha‑ketoglutarate transporter |
RA | 2,737,495 | G→A | *114* (TAG→TAA) | raiA → | cold shock protein associated with 30S ribosomal subunit |
RA | 2,742,962 | G→A | D194N (GAT→AAT) | yfiN → | putative membrane‑anchored diguanylate cyclase |
RA | 2,765,829 | (C)5→4 | intergenic (‑53/‑89) | yfjM ← / → rnlA | CP4‑57 prophage, uncharacterized protein/CP4‑57 prophage, RNase LS |
RA | 2,767,445 | (C)7→8 | intergenic (+90/‑265) | rnlB → / → yfjP | CP4‑57 prophage, uncharacterized protein/CP4‑57 prophage, 50S ribosome‑binding GTPase family protein |
RA | 2,769,486 | G→A | *274* (TAG→TAA) | yfjQ → | CP4‑57 prophage, uncharacterized protein |
RA | 2,769,648 | (C)6→5 | intergenic (+162/‑55) | yfjQ → / → yfjR | CP4‑57 prophage, uncharacterized protein/CP4‑57 prophage, putative DNA‑binding transcriptional regulator |
RA | 2,770,404 | G→A | *234* (TAG→TAA) | yfjR → | CP4‑57 prophage, putative DNA‑binding transcriptional regulator |
RA | 2,781,132 | T→C | D532G (GAC→GGC) | ypjA ← | adhesin‑like autotransporter |
RA | 2,782,393 | (C)5→4 | coding (334/4581 nt) | ypjA ← | adhesin‑like autotransporter |
RA | 2,784,529 | C→T | pseudogene (483/1374 nt) | ypjC ← | pseudogene |
RA | 2,786,729 | G→A | pseudogene (333/2253 nt) | ygaQ → | uncharacterized protein, putative enzyme |
RA | 2,786,746 | Δ1 bp | pseudogene (350/2253 nt) | ygaQ → | uncharacterized protein, putative enzyme |
RA | 2,787,434 | G→A | pseudogene (1038/2253 nt) | ygaQ → | uncharacterized protein, putative enzyme |
RA | 2,788,238 | G→A | pseudogene (1842/2253 nt) | ygaQ → | uncharacterized protein, putative enzyme |
RA | 2,794,015 | G→A | *427* (TAG→TAA) | gabT → | 4‑aminobutyrate aminotransferase, PLP‑dependent |
RA | 2,796,146 | C→T | A158V (GCG→GTG) | csiR → | transcriptional repressor of csiD |
RA | 2,796,337 | C→T | *150* (TAG→TAA) | ygaU ← | uncharacterized protein |
RA | 2,796,916 | T→C | Y38C (TAT→TGT) | yqaE ← | cyaR sRNA‑regulated protein |
RA | 2,800,475 | G→A | *110* (TAG→TAA) | ygaM → | putative membrane‑anchored DUF883 family ribosome‑binding protein |
RA | 2,814,218 | C→T | *172* (TAG→TAA) | luxS ← | S‑ribosylhomocysteine lyase |
RA | 2,824,491 | C→T | *362* (TAG→TAA) | mltB ← | membrane‑bound lytic murein transglycosylase B |
RA | 2,824,496 | Δ1 bp | coding (1081/1086 nt) | mltB ← | membrane‑bound lytic murein transglycosylase B |
RA | 2,827,351 | G→A | *320* (TAG→TAA) | srlE → | glucitol/sorbitol‑specific enzyme IIB component of PTS |
RA | 2,835,045 | G→A | *378* (TAG→TAA) | norW → | NADH:flavorubredoxin oxidoreductase |
RA | 2,839,384 | T→A | intergenic (‑120/‑140) | ascG ← / → ascF | asc operon transcriptional repressor, prpBC operon repressor/cellobiose/arbutin/salicin‑specific PTS enzymes, IIB and IC components |
RA | 2,842,414 | G→A | *475* (TAG→TAA) | ascB → | cryptic 6‑phospho‑beta‑glucosidase |
RA | 2,842,573 | C→T | *157* (TAG→TAA) | hycI ← | protease involved in processing C‑terminal end of HycE |
RA | 2,851,873 | G→A | *291* (TAG→TAA) G4S (GGC→AGC) |
hypB → hypC → |
GTP hydrolase involved in nickel liganding into hydrogenases hydrogenase maturation protein |
RA | 2,856,453 | C→T | *118* (TAG→TAA) | ygbA ← | uncharacterized protein |
RA | 2,859,538 | C→T | L816L (CTG→TTG) | mutS → | methyl‑directed mismatch repair protein |
RA | 2,860,416 | G→A | *219* (TAG→TAA) | pphB → | serine/threonine‑specific protein phosphatase 2 |
RA | 2,860,426 | Δ1 bp | intergenic (+10/+41) | pphB → / ← ygbI | serine/threonine‑specific protein phosphatase 2/DeoR family putative transcriptional regulator |
RA | 2,876,944 | G→A | A122T (GCC→ACC) | iap → | aminopeptidase in alkaline phosphatase isozyme conversion |
RA | 2,893,928 | G→A | *424* (TAG→TAA) A4T (GCC→ACC) |
ygcN → ygcO → |
putative oxidoreductase putative 4Fe‑4S cluster‑containing protein |
MC JC | 2,893,961 | Δ3 bp | coding (43‑45/261 nt) | ygcO → | putative 4Fe‑4S cluster‑containing protein |
RA | 2,902,543 | G→A | G216G (GGG→GGA) | ygcE → | putative kinase |
RA | 2,905,532 | T→C | intergenic (‑114/‑25) | queE ← / → yqcG | 7‑carboxy‑7‑deazaguanine synthase, queosine biosynthesis/membrane stress resistance protein |
RA | 2,910,756 | C→T | *112* (TAG→TAA) | mazF ← | mRNA interferase toxin, antitoxin is MazE |
RA | 2,911,417 | C→T | *745* (TAG→TAA) | relA ← | (p)ppGpp synthetase I/GTP pyrophosphokinase |
RA | 2,913,699 | C→T | *434* (TAG→TAA) | rlmD ← | 23S rRNA m(5)U1939 methyltransferase, SAM‑dependent |
RA | 2,915,105 | C→T | P17S (CCG→TCG) | barA → | hybrid sensory histidine kinase, in two‑component regulatory system with UvrY |
RA | 2,935,917 | G→A | G112S (GGC→AGC) | fucI → | L‑fucose isomerase |
RA | 2,936,931 | T→C | F450L (TTC→CTC) | fucI → | L‑fucose isomerase |
RA | 2,937,802 | A→G | D112G (GAC→GGC) | fucK → | L‑fuculokinase |
RA | 2,962,441 | C→T | *108* (TAG→TAA) | ppdC ← | putative prepilin peptidase‑dependent protein |
RA | 2,966,188 | C→T | *749* (TAG→TAA) | ptsP ← | PEP‑protein phosphotransferase enzyme I, GAF domain containing protein |
RA | 2,967,135 | G→A | R434C (CGT→TGT) | ptsP ← | PEP‑protein phosphotransferase enzyme I, GAF domain containing protein |
RA | 2,970,351 | G→A | *230* (TAG→TAA) | mutH → | methyl‑directed mismatch repair protein |
RA | 2,979,943 | C→T | A308V (GCT→GTT) *231* (TAG→TAA) |
lysR → ygeA ← |
transcriptional activator of lysA, autorepressor Asp/Glu_racemase family protein |
RA | 2,983,288 | C→T | *279* (TAG→TAA) | kduI ← | hexuronate isomerase |
RA | 2,984,411 | C→T | *394* (TAG→TAA) | yqeF ← | short chain acyltransferase |
RA | 2,993,856 | G→A | *73* (TAG→TAA) | ygeI → | uncharacterized protein |
RA | 2,994,415 | G→A | pseudogene (34/60 nt) | pbl → | pseudogene, peptidoglycan‑binding enzyme family |
RA | 2,995,314 | C→T | pseudogene (447/447 nt) | ygeN ← | pseudogene, orgB family, part of T3SS PAI ETT2 remnant |
RA | 2,996,372 | C→T | *302* (TAG→TAA) | insD1 ← | IS2 transposase TnpB |
RA | 2,997,689 | C→T | intergenic (‑89/+3) | insC1 ← / ← ygeQ | IS2 repressor TnpA/pseudogene, glycosyl hydrolase family 15, part of T3SS PAI ETT2 remnant |
RA | 3,001,304 | (G)7→8 | coding (960/2259 nt) | xdhA → | xanthine dehydrogenase, molybdenum binding subunit |
RA | 3,012,553 | Δ1 bp | intergenic (+160/+61) | yqeA → / ← yqeB | putative amino acid kinase/XdhC‑CoxI family protein with NAD(P)‑binding Rossman fold |
RA | 3,014,259 | Δ1 bp | intergenic (‑20/+28) | yqeB ← / ← yqeC | XdhC‑CoxI family protein with NAD(P)‑binding Rossman fold/putative selenium‑dependent hydroxylase accessory protein |
RA | 3,014,287 | C→T | *257* (TAG→TAA) | yqeC ← | putative selenium‑dependent hydroxylase accessory protein |
RA | 3,015,738 | G→A | *193* (TAG→TAA) | mocA → | CTP:molybdopterin cytidylyltransferase |
RA | 3,032,032 | G→A | S222S (TCG→TCA) | uacT → | uric acid permease |
RA | 3,036,373 | C→T | *578* (TAG→TAA) | recJ ← | ssDNA exonuclease, 5' ‑‑> 3'‑specific |
RA | 3,056,273 | G→A | P11P (CCG→CCA) | fau → | 5‑formyltetrahydrofolate cyclo‑ligase family protein |
RA | 3,059,293 | T→C | G11G (GGA→GGG) | rpiA ← | ribose 5‑phosphate isomerase, constitutive |
RA | 3,061,202 | A→G | N118S (AAC→AGC) | scpA → | methylmalonyl‑CoA mutase |
RA | 3,068,173 | C→T | *212* (TAG→TAA) | argO ← | arginine transporter |
RA | 3,073,474 | T→C | D73G (GAC→GGC) | epd ← | D‑erythrose 4‑phosphate dehydrogenase |
RA | 3,082,038 | T→C | D42D (GAT→GAC) | loiP → | Phe‑Phe periplasmic metalloprotease, OM lipoprotein, low salt‑inducible, Era‑binding heat shock protein |
RA | 3,083,620 | G→A | R60C (CGT→TGT) | speB ← | agmatinase |
RA | 3,085,461 | A→G | S151P (TCC→CCC) | speA ← | biosynthetic arginine decarboxylase, PLP‑binding |
RA | 3,094,234 | T→C | T283A (ACA→GCA) | yggR ← | putative PilT family AAA+ ATPase |
RA | 3,096,673 | G→A | *97* (TAG→TAA) | yggU → | UPF0235 family protein |
RA | 3,101,039 | (C)7→8 | coding (585/720 nt) | yggN ← | DUF2884 family putative periplasmic protein |
RA | 3,104,065 | G→A | *351* (TAG→TAA) | mutY → | adenine DNA glycosylase |
RA | 3,129,036 | G→A | *255* (TAG→TAA) | glcC → | glycolate‑inducible glc operon transcriptional repressor, autorepressor |
RA | 3,131,341 | C→T | *356* (TAG→TAA) | yghQ ← | putative inner membrane polysaccharide flippase |
RA | 3,134,811 | Δ1 bp | coding (681/693 nt) | yghT → | putative ATP‑binding protein |
RA | 3,134,823 | G→A | *231* (TAG→TAA) | yghT → | putative ATP‑binding protein |
RA | 3,140,294 | T→C | S9G (AGC→GGC) | hybF ← | protein involved with the maturation of hydrogenases 1 and 2 |
RA | 3,162,308 | G→A | S121L (TCG→TTG) | ftsP ← | septal ring component that protects the divisome from stress, multicopy suppressor of ftsI(Ts) |
RA | 3,171,879 | C→T | *111* (TAG→TAA) | ygiZ ← | inner membrane protein |
RA | 3,176,721 | G→A | T38I (ACC→ATC) | cpdA ← | 3',5' cAMP phosphodiesterase |
RA | 3,176,858 | C→T | *141* (TAG→TAA) | yqiB ← | DUF1249 protein YqiB |
RA | 3,178,015 | G→A | intergenic (‑105/‑100) | nudF ← / → tolC | ADP‑ribose pyrophosphatase/transport channel |
RA | 3,183,006 | G→A | G153S (GGT→AGT) | zupT → | zinc transporter |
RA | 3,187,415 | G→A | *302* (TAG→TAA) | insD1 → | IS2 transposase TnpB |
RA | 3,187,588 | G→A | pseudogene (162/2439 nt) | yqiG → | pseudogene, fimbrial export usher family,putative membrane, Not classified, putative membrane protein |
RA | 3,191,696 | G→A | *355* (TAG→TAA) | yqiI → | fimbrial protein |
RA | 3,199,429 | T→C | A71A (GCA→GCG) | glnE ← | fused deadenylyltransferase/adenylyltransferase for glutamine synthetase |
RA | 3,205,324 | C→T | *311* (TAG→TAA) | ttdR ← | transcriptional activator of ttdABT |
RA | 3,218,365 | C→T | E238K (GAG→AAG) | aer ← | fused signal transducer for aerotaxis sensory component/methyl accepting chemotaxis component |
RA | 3,220,190 | G→A | A233T (GCT→ACT) | patA → | putrescine:2‑oxoglutaric acid aminotransferase, PLP‑dependent |
RA | 3,238,562 | (T)7→6 | intergenic (+265/‑18) | ygjR → / → alx | putative NAD(P)‑dependent dehydrogenase/putative membrane‑bound redox modulator |
RA | 3,240,587 | A→G | Y215C (TAC→TGC) | sstT → | sodium:serine/threonine symporter |
RA | 3,240,984 | (G)7→9 | coding (1041/1245 nt) | sstT → | sodium:serine/threonine symporter |
RA | 3,248,939 | T→C | intergenic (+117/‑30) | mzrA → / → yqjC | modulator of EnvZ/OmpR regulon/DUF1090 family putative periplasmic protein |
RA | 3,255,020 | G→A | *234* (TAG→TAA) | yhaK → | redox‑sensitive bicupin |
RA | 3,257,675 | G→A | G112G (GGC→GGT) | yhaO ← | putative transporter |
RA | 3,266,127 | C→T | *313* (TAG→TAA) | tdcA ← | tdc operon transcriptional activator |
RA | 3,269,012 | A→G | S200G (AGT→GGT) | yhaC → | pentapetide repeats‑related protein |
RA | 3,269,602 | G→A | *396* (TAG→TAA) | yhaC → | pentapetide repeats‑related protein |
RA | 3,271,932 | T→C | T274A (ACG→GCG) | garR ← | tartronate semialdehyde reductase |
RA | 3,277,726 | C→T | F130F (TTC→TTT) | yhaV → | toxin of the SohB(PrlF)‑YhaV toxin‑antitoxin system |
RA | 3,277,867 | C→T | V267I (GTC→ATC) | agaR ← | transcriptional repressor of the aga regulon |
RA | 3,296,984 | G→A | *192* (TAG→TAA) | yraP → | outer membrane lipoprotein |
RA | 3,298,035 | T→C | E35G (GAA→GGA) | yraQ ← | putative inner membrane permease |
RA | 3,299,438 | A→G | T155T (ACA→ACG) | yhbO → | stress‑resistance protein |
RA | 3,299,999 | G→A | A12T (GCC→ACC) | yhbQ → | GIY‑YIG nuclease superfamily protein |
RA | 3,301,599 | G→A | G39S (GGC→AGC) | yhbU → | U32 peptidase family protein |
RA | 3,303,529 | C→T | H28Y (CAC→TAC) | yhbW → | putative luciferase‑like monooxygenase |
RA | 3,304,455 | G→A | *336* (TAG→TAA) | yhbW → | putative luciferase‑like monooxygenase |
RA | 3,308,040 | C→T | *295* (TAG→TAA) | nlpI ← | lipoprotein involved in osmotic sensitivity and filamentation |
RA | 3,308,868 | G→A | C19C (TGC→TGT) | nlpI ← | lipoprotein involved in osmotic sensitivity and filamentation |
RA | 3,309,006 | (C)6→5 | intergenic (‑82/+27) | nlpI ← / ← pnp | lipoprotein involved in osmotic sensitivity and filamentation/polynucleotide phosphorylase/polyadenylase |
RA | 3,309,007 | G→A | intergenic (‑83/+26) | nlpI ← / ← pnp | lipoprotein involved in osmotic sensitivity and filamentation/polynucleotide phosphorylase/polyadenylase |
RA | 3,320,333 | T→C | E427E (GAA→GAG) | yhbX ← | putative EptAB family phosphoethanolamine transferase, inner membrane protein |
RA | 3,330,357 | +T | coding (1395/1434 nt) | dacB → | D‑alanyl‑D‑alanine carboxypeptidase |
RA | 3,330,396 | G→A | *478* (TAG→TAA) | dacB → | D‑alanyl‑D‑alanine carboxypeptidase |
RA | 3,340,588 | T→C | L105S (TTA→TCA) | yrbG → | putative calcium/sodium:proton antiporter |
RA | 3,347,069 | G→A | *164* (TAG→TAA) | ptsN → | sugar‑specific enzyme IIA component of PTS |
RA | 3,353,121 | C→T | *310* (TAG→TAA) | yhcC ← | putative Fe‑S oxidoreductase, Radical SAM superfamily protein |
RA | 3,360,769 | G→A | intergenic (+153/‑407) | gltD → / → gltF | glutamate synthase, 4Fe‑4S protein, small subunit/periplasmic protein |
RA | 3,365,664 | G→A | intergenic (+113/+38) | yhcE → / ← insH1 | pseudogene fragment, interrupted by IS5/IS5 transposase and trans‑activator |
RA | 3,366,953 | G→A | G10R (GGA→AGA) | yhcF → | putative transcriptional regulator |
RA | 3,372,254 | G→A | G107G (GGC→GGT) | nanT ← | sialic acid transporter |
RA | 3,385,857 | C→T | *91* (TAG→TAA) | yhcO ← | putative barnase inhibitor |
RA | 3,398,875 | C→T | M1M (GTG→ATG) † *368* (TAG→TAA) |
mreD ← mreC ← |
cell wall structural complex MreBCD transmembrane component MreD cell wall structural complex MreBCD transmembrane component MreC |
RA | 3,400,773 | A→G | R105R (CGT→CGC) | mreB ← | cell wall structural complex MreBCD, actin‑like component MreB |
RA | 3,410,406 | T→C | S43P (TCT→CCT) | dusB → | tRNA‑dihydrouridine synthase B |
RA | 3,418,548 | T→C | A53A (GCT→GCC) | yhdV → | putative outer membrane protein |
RA | 3,432,994 | (C)6→7 | coding (567/1125 nt) | smf ← | DNA recombination‑mediator A family protein |
RA | 3,434,577 | G→A | A122T (GCA→ACA) | fmt → | 10‑formyltetrahydrofolate:L‑methionyl‑tRNA(fMet) N‑formyltransferase |
RA | 3,439,141 | C→T | *123* (TAG→TAA) | yhdN ← | DUF1992 family protein |
RA | 3,440,950 | G→A | T27I (ACC→ATC) | rpoA ← | RNA polymerase, alpha subunit |
RA | 3,457,616 | G→A | A414T (GCC→ACC) | gspD → | general secretory pathway component, cryptic |
RA | 3,466,313 | A→G | L138P (CTT→CCT) | bfr ← | bacterioferritin, iron storage and detoxification protein |
RA | 3,478,592 | C→T | *67* (TAG→TAA) | yheV ← | DUF2387 family putative metal‑binding protein |
RA | 3,478,802 | C→T | *602* (TAG→TAA) | kefB ← | potassium:proton antiporter |
RA | 3,482,967 | T→C | L560P (CTG→CCG) | yheS → | ABC‑F family protein predicted regulatory ATPase |
RA | 3,503,952 | G→A | *262* (TAG→TAA) | frlD → | fructoselysine 6‑kinase |
RA | 3,507,942 | A→G | Y217H (TAC→CAC) | php ← | phosphotriesterase homology protein |
RA | 3,508,454 | Δ1 bp | coding (137/879 nt) | php ← | phosphotriesterase homology protein |
RA | 3,515,726 | T→C | Y63C (TAT→TGT) | dam ← | DNA adenine methyltransferase |
RA | 3,516,104 | T→C | K401K (AAA→AAG) | damX ← | cell division protein that binds to the septal ring |
RA | 3,531,605 | T→C | T279A (ACA→GCA) | yhgE ← | DUF4153 family putative inner membrane protein |
RA | 3,534,656 | C→T | G405R (GGG→AGG) | envZ ← | sensory histidine kinase in two‑component regulatory system with OmpR |
RA | 3,544,074 | C→T | *257* (TAG→TAA) | bioH ← | pimeloyl‑ACP methyl ester carboxylesterase |
RA | 3,545,565 | G→A | *228* (TAG→TAA) | gntX → | DNA catabolic protein |
RA | 3,547,986 | C→T | *695* (TAG→TAA) | malQ ← | 4‑alpha‑glucanotransferase (amylomaltase) |
RA | 3,556,033 | A→G | Y273H (TAC→CAC) | rtcA ← | RNA 3'‑terminal phosphate cyclase |
RA | 3,560,455 | +G | intergenic (‑2/+1) | glpR ← / ← glpR | pseudogene, DNA‑binding transcriptional repressor,regulator, Energy metabolism, carbon: Anaerobic respiration, repressor of the glp operon/pseudogene, DNA‑binding transcriptional repressor,regulator, Energy metabolism, carbon: Anaerobic respiration, repressor of the glp operon |
RA | 3,566,600 | C→T | *478* (TAG→TAA) | glgA ← | glycogen synthase |
RA | 3,567,251 | C→T | L261L (TTG→TTA) | glgA ← | glycogen synthase |
RA | 3,583,454 | G→A | intergenic (+36/‑29) | yrhA → / → insA | pseudogene, interrupted by IS1E/IS1 repressor TnpA |
RA | 3,587,370 | C→T | T143I (ACT→ATT) *248* (TAG→TAA) |
yhhA → ugpQ ← |
DUF2756 family protein glycerophosphodiester phosphodiesterase, cytosolic |
RA | 3,587,389 | G→A | P242L (CCG→CTG) | ugpQ ← | glycerophosphodiester phosphodiesterase, cytosolic |
RA | 3,589,820 | T→C | S70G (AGC→GGC) | ugpE ← | sn‑glycerol‑3‑phosphate ABC transporter permease |
RA | 3,598,557 | A→G | *368Q (TAA→CAA) | livJ ← | branched‑chain amino acid ABC transporter periplasmic binding protein |
RA | 3,614,092 | T→C | I142I (ATT→ATC) | nikA → | nickel/heme ABC transporter periplasmic binding protein |
RA | 3,643,899 | G→A | G428G (GGC→GGT) | prlC ← | oligopeptidase A |
RA | 3,652,144 | G→A | intergenic (+113/+38) | yhiS → / ← insH1 | pseudogene/IS5 transposase and trans‑activator |
RA | 3,658,893 | G→A | *176* (TAG→TAA) | gadE → | gad regulon transcriptional activator |
RA | 3,664,363 | (G)6→7 | coding (256/729 nt) | gadW ← | transcriptional activator of gadA and gadBC, repressor of gadX |
RA | 3,664,986 | C→T | *275* (TAG→TAA) | gadX ← | acid resistance regulon transcriptional activator, autoactivator |
RA | 3,683,630 | C→T | *663* (TAG→TAA) | yhjK ← | cyclic‑di‑GMP phosphodiesterase |
RA | 3,694,840 | G→A | H133Y (CAT→TAT) | bcsA ← | cellulose synthase, catalytic subunit |
RA | 3,695,997 | C→T | *63* (TAG→TAA) | yhjR ← | DUF2629 family protein |
RA | 3,709,561 | (C)6→7 | coding (915/1692 nt) | eptB ← | KDO phosphoethanolamine transferase, Ca(2+)‑inducible |
RA | 3,719,768 | G→A | *97* (TAG→TAA) | yiaG → | HTH_CROC1 family putative transcriptional regulator |
RA | 3,731,980 | G→A | G284S (GGT→AGT) | xylF → | D‑xylose transporter subunit |
RA | 3,732,319 | G→A | G40E (GGG→GAG) | xylG → | D‑xylose ABC transporter dual domain ATPase |
RA | 3,736,157 | G→A | *393* (TAG→TAA) | xylR → | xylose divergent operon transcriptional activator |
RA | 3,736,160 | +A | intergenic (+3/+193) | xylR → / ← bax | xylose divergent operon transcriptional activator/putative glucosaminidase |
RA | 3,742,599 | Δ1 bp | intergenic (‑67/‑134) | yiaJ ← / → yiaK | transcriptional repressor for the yiaKLMNO‑lyxK‑sgbHUE operon/2,3‑diketo‑L‑gulonate reductase, NADH‑dependent |
RA | 3,750,092 | G→A | *287* (TAG→TAA) E3K (GAG→AAG) |
sgbU → sgbE → |
putative L‑xylulose 5‑phosphate 3‑epimerase L‑ribulose‑5‑phosphate 4‑epimerase |
RA | 3,761,850 | C→T | A36T (GCG→ACG) | yibF ← | glutathione S‑transferase homolog |
RA | 3,766,316 | G→A | *1378* (TAG→TAA) | rhsA → | Rhs protein with putative toxin 55 domain, putative polysaccharide synthesis/export protein, putative neighboring cell growth inhibitor |
RA | 3,767,179 | G→A | *281* (TAG→TAA) | yibA → | putative immunity protein for polymorphic toxin RhsA, HEAT‑domain protein, lethality reduction protein |
RA | 3,773,602 | T→C | V441A (GTT→GCT) | mtlA → | mannitol‑specific PTS enzyme: IIA, IIB and IIC components |
RA | 3,781,017 | G→A | *397* (TAG→TAA) | lldD → | L‑lactate dehydrogenase, FMN‑linked |
RA | 3,781,688 | G→A | *158* (TAG→TAA) | trmL → | tRNA Leu mC34,mU34 2'‑O‑methyltransferase, SAM‑dependent |
RA | 3,783,086 | G→A | G192G (GGC→GGT) | gpsA ← | glycerol‑3‑phosphate dehydrogenase (NAD+) |
RA | 3,789,047 | C→T | A316V (GCT→GTT) *345* (TAG→TAA) |
yibQ → waaH ← |
putative polysaccharide deacetylase LPS(HepIII)‑glucuronic acid glycosyltransferase |
RA | 3,789,352 | G→A | R244C (CGC→TGC) | waaH ← | LPS(HepIII)‑glucuronic acid glycosyltransferase |
RA | 3,789,683 | C→T | W133* (TGG→TGA) | waaH ← | LPS(HepIII)‑glucuronic acid glycosyltransferase |
RA | 3,789,913 | C→T | A57T (GCA→ACA) | waaH ← | LPS(HepIII)‑glucuronic acid glycosyltransferase |
RA | 3,792,826 | C→T | *286* (TAG→TAA) | yibB ← | YibB family protein, function unknown |
RA | 3,804,410 | C→G | R236P (CGT→CCT) | waaS ← | lipopolysaccharide rhamnose:KdoIII transferase, lipopolysaccharide core biosynthesis protein |
RA | 3,810,304 | G→A | *160* (TAG→TAA) | coaD → | pantetheine‑phosphate adenylyltransferase |
RA | 3,815,811 | C→T | intergenic (‑43/+23) | pyrE ← / ← rph | orotate phosphoribosyltransferase/ribonuclease PH (defective),enzyme, Degradation of RNA, RNase PH |
RA | 3,815,863 | C→T | pseudogene (19/48 nt) | rph ← | ribonuclease PH (defective),enzyme, Degradation of RNA, RNase PH |
RA | 3,818,584 | G→A | *275* (TAG→TAA) | dinD → | DNA damage‑inducible protein |
RA | 3,819,488 | C→T | H205H (CAC→CAT) *561* (TAG→TAA) |
yicG → ligB ← |
UPF0126 family inner membrane protein DNA ligase, NAD(+)‑dependent |
RA | 3,838,137 | G→A | *395* (TAG→TAA) | setC → | putative arabinose efflux transporter |
RA | 3,842,455 | C→T | *445* (TAG→TAA) | adeQ ← | adenine permease, high affinity, adenine:H+ symporter |
RA | 3,852,890 | C→T | *33* (TAG→TAA) | ivbL ← | ilvB operon leader peptide |
RA | 3,855,960 | C→T | S4N (AGC→AAC) *116* (TAG→TAA) |
yidG ← yidH ← |
inner membrane protein DUF202 family inner membrane protein |
RA | 3,862,497 | C→T | pseudogene (1107/1617 nt) | glvC ← | pseudogene, arbutin specific enzyme IIC component of PTS,enzyme, Transport of small molecules: Carbohydrates, organic acids, alcohols, PTS system, arbutin‑like IIB component, PTS system, arbutin‑like IIC component |
RA | 3,862,518 | Δ1 bp | pseudogene (1086/1617 nt) | glvC ← | pseudogene, arbutin specific enzyme IIC component of PTS,enzyme, Transport of small molecules: Carbohydrates, organic acids, alcohols, PTS system, arbutin‑like IIB component, PTS system, arbutin‑like IIC component |
JC | 3,862,524 | Δ3 bp | pseudogene (1078‑1080/1617 nt) | glvC ← | pseudogene, arbutin specific enzyme IIC component of PTS,enzyme, Transport of small molecules: Carbohydrates, organic acids, alcohols, PTS system, arbutin‑like IIB component, PTS system, arbutin‑like IIC component |
RA | 3,870,441 | G→A | *355* (TAG→TAA) G430G (GGC→GGT) |
cbrA → dgoT ← |
colicin M resistance protein, FAD‑binding protein, putative oxidoreductase D‑galactonate transporter |
RA | 3,892,455 | G→A | A281T (GCG→ACG) | mdtL → | multidrug efflux system protein |
RA | 3,897,050 | +G | coding (277/666 nt) | yieH → | phosphoenolpyruvate and 6‑phosphogluconate phosphatase |
RA | 3,897,439 | G→A | *222* (TAG→TAA) | yieH → | phosphoenolpyruvate and 6‑phosphogluconate phosphatase |
RA | 3,898,609 | G→A | *196* (TAG→TAA) | cbrC → | UPF0167 family protein |
RA | 3,908,514 | A→G | intergenic (‑148/+35) | pstB ← / ← pstA | phosphate ABC transporter ATPase/phosphate ABC transporter permease |
RA | 3,920,950 | C→T | *80* (TAG→TAA) | atpE ← | F0 sector of membrane‑bound ATP synthase, subunit c |
RA | 3,921,515 | C→T | T179T (ACG→ACA) | atpB ← | F0 sector of membrane‑bound ATP synthase, subunit a |
RA | 3,923,070 | G→A | A204V (GCA→GTA) | rsmG ← | 16S rRNA m(7)G527 methyltransferase, SAM‑dependent, glucose‑inhibited cell‑division protein |
RA | 3,937,168 | G→A | *297* (TAG→TAA) | rbsB → | D‑ribose ABC transporter periplasmic binding protein, ribose chemotaxis receptor |
RA | 3,939,219 | G→A | *331* (TAG→TAA) S465F (TCT→TTT) |
rbsR → hsrA ← |
transcriptional repressor of ribose metabolism putative multidrug or homocysteine efflux system |
RA | 3,948,805 | (G)6→7 | coding (1165/1521 nt) | yifB ← | magnesium chelatase family protein and putative transcriptional regulator |
RA | 3,950,420 | G→A | *33* (TAG→TAA) | ilvL → | ilvG operon leader peptide |
RA | 3,956,875 | G→A | *515* (TAG→TAA) | ilvA → | l‑threonine dehydratase, biosynthetic, also known as threonine deaminase |
RA | 3,963,829 | C→T | R134H (CGC→CAC) | gpp ← | guanosine pentaphosphatase/exopolyphosphatase |
RA | 3,965,088 | C→T | W181* (TGG→TGA) | rhlB ← | ATP‑dependent RNA helicase |
RA | 3,970,015 | T→C | W329R (TGG→CGG) | wzzE → | Entobacterial Common Antigen (ECA) polysaccharide chain length modulation protein |
RA | 3,970,032 | (G)6→8 | coding (1002/1047 nt) | wzzE → | Entobacterial Common Antigen (ECA) polysaccharide chain length modulation protein |
RA | 3,970,077 | G→A | *349* (TAG→TAA) | wzzE → | Entobacterial Common Antigen (ECA) polysaccharide chain length modulation protein |
RA | 3,976,605 | T→C | F110L (TTT→CTT) | wzxE → | O‑antigen translocase |
RA | 3,980,957 | (G)6→7 | coding (71/1386 nt) | yifK → | putative APC family amino acid transporter |
RA | 3,984,193 | G→A | *412* (TAG→TAA) | aslB → | putative AslA‑specific sulfatase‑maturating enzyme |
RA | 3,986,686 | C→T | *399* (TAG→TAA) | hemY ← | putative protoheme IX synthesis protein |
RA | 3,992,054 | C→T | P301L (CCA→CTA) | cyaA → | adenylate cyclase |
RA | 4,002,813 | C→T | *127* (TAG→TAA) | yigG ← | PRK11371 family inner membrane protein |
RA | 4,007,693 | G→A | *610* (TAG→TAA) | recQ → | ATP‑dependent DNA helicase |
RA | 4,018,760 | G→A | *476* (TAG→TAA) | rmuC → | DNA recombination protein |
RA | 4,024,336 | G→A | *261* (TAG→TAA) L162L (CTC→CTT) |
tatD → rfaH ← |
quality control of Tat‑exported FeS proteins, Mg‑dependent cytoplasmic DNase transcription antitermination protein |
RA | 4,054,439 | A→G | T280T (ACT→ACC) | glnG ← | fused DNA‑binding response regulator in two‑component regulatory system with GlnL: response regulator/sigma54 interaction protein |
RA | 4,061,157 | G→A | *237* (TAG→TAA) | yihL → | putative DNA‑binding transcriptional regulator |
RA | 4,075,454 | G→A | *262* (TAG→TAA) | yihW → | putative transcriptional regulator for sulphoquinovose utilization |
RA | 4,077,469 | G→A | L7L (TTG→TTA) | yiiD → | GNAT family putative N‑acetyltransferase |
RA | 4,078,438 | G→A | *330* (TAG→TAA) | yiiD → | GNAT family putative N‑acetyltransferase |
RA | 4,106,320 | G→A | *167* (TAG→TAA) | cpxP → | inhibitor of the cpx response, periplasmic adaptor protein |
RA | 4,112,787 | C→T | intergenic (+32/‑180) | yiiR → / → yiiS | DUF805 family putative inner membrane protein/UPF0381 family protein |
RA | 4,117,123 | G→A | R34C (CGC→TGC) | glpK ← | glycerol kinase |
RA | 4,137,229 | A→G | S143S (AGT→AGC) | yijF ← | DUF1287 family protein |
RA | 4,147,479 | G→A | *114* (TAG→TAA) T280I (ACT→ATT) |
frwD → yijO ← |
putative enzyme IIB component of PTS AraC family putative transcriptional activator |
RA | 4,148,681 | C→T | G529S (GGC→AGC) | eptC ← | LPS heptose I phosphoethanolamine transferase |
RA | 4,204,645 | G→A | *442* (TAG→TAA) N429N (AAC→AAT) |
zraR → purD ← |
fused DNA‑binding response regulator in two‑component regulatory system with ZraS: response regulator/sigma54 interaction protein phosphoribosylglycinamide synthetase phosphoribosylamine‑glycine ligase |
RA | 4,213,680 | C→T | *148* (TAG→TAA) | yjaB ← | GNAT‑family putative N‑acetyltransferase, acetyl coenzyme A‑binding protein |
RA | 4,218,815 | A→G | T74A (ACG→GCG) | aceK → | isocitrate dehydrogenase kinase/phosphatase |
RA | 4,232,752 | G→A | A161V (GCG→GTG) | lysC ← | lysine‑sensitive aspartokinase 3 |
RA | 4,268,487 | (T)7→8 | intergenic (+180/+322) | tyrB → / ← yjbS | tyrosine aminotransferase, tyrosine‑repressible, PLP‑dependent/uncharacterized protein |
RA | 4,268,809 | C→T | *68* (TAG→TAA) | yjbS ← | uncharacterized protein |
RA | 4,279,849 | A→G | intergenic (+21/‑131) | ghxP → / → yjcE | guanine/hypoxanthine permease, high affinity, guanine/hypoxanthine:H+ symporter/putative cation/proton antiporter |
RA | 4,296,381 | +GC | intergenic (+587/+55) | gltP → / ← yjcO | glutamate/aspartate:proton symporter/Sel1 family TPR‑like repeat protein |
RA | 4,297,668 | C→T | D567N (GAC→AAC) | fdhF ← | formate dehydrogenase‑H, selenopolypeptide subunit |
RA | 4,302,240 | A→G | I280T (ATC→ACC) | mdtO ← | membrane translocase (MDR) of MdtNOP efflux pump, PET family |
RA | 4,317,409 | C→T | G163S (GGC→AGC) | phnL ← | ribophosphonate triphosphate synthase subunit, putative ABC transporter‑related ATPase |
RA | 4,324,876 | A→G | L97P (CTG→CCG) | phnC ← | phosphonate ABC transporter ATPase |
RA | 4,325,152 | A→G | I5T (ATC→ACC) | phnC ← | phosphonate ABC transporter ATPase |
RA | 4,331,634 | C→T | A378V (GCG→GTG) | proP → | proline/glycine betaine transporter |
RA | 4,336,405 | A→G | S209S (AGT→AGC) | adiC ← | arginine:agmatine antiporter |
RA | 4,346,086 | A→G | I414T (ATC→ACC) | fumB ← | anaerobic class I fumarate hydratase (fumarase B) |
RA | 4,352,880 | G→A | *99* (TAG→TAA) | ghoS → | antitoxin of GhoTS toxin‑antitoxin pair, endonuclease for ghoT mRNA |
RA | 4,353,081 | G→A | *58* (TAG→TAA) | ghoT → | toxin of GhoTS toxin‑antitoxin pair, membrane‑lytic protein, stimulator of persister cell formation |
RA | 4,377,189 | C→T | H105H (CAC→CAT) *178* (TAG→TAA) |
sugE → blc ← |
multidrug efflux system protein outer membrane lipoprotein cell division and growth lipocalin |
RA | 4,386,872 | C→T | A833A (GCG→GCA) | mscM ← | mechanosensitive channel protein, miniconductance |
RA | 4,389,934 | A→G | Y143H (TAC→CAC) | psd ← | phosphatidylserine decarboxylase |
RA | 4,395,058 | C→T | G331G (GGC→GGT) | nnr → | bifunctional NAD(P)H‑hydrate repair enzyme, C‑terminal domain ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase and N‑terminal domain NAD(P)H‑hydrate epimerase |
RA | 4,422,793 | C→T | A203V (GCC→GTC) | ulaD → | 3‑keto‑L‑gulonate 6‑phosphate decarboxylase |
RA | 4,424,386 | G→A | *229* (TAG→TAA) | ulaF → | L‑ribulose 5‑phosphate 4‑epimerase |
RA | 4,424,516 | C→T | *92* (TAG→TAA) | yjfY ← | YhcN family protein, periplasmic |
RA | 4,424,543 | Δ1 bp | coding (249/276 nt) | yjfY ← | YhcN family protein, periplasmic |
RA | 4,425,834 | G→A | *105* (TAG→TAA) | priB → | primosomal protein N |
RA | 4,428,079 | C→T | pseudogene (386/402 nt) *213* (TAG→TAA) |
ytfA → ytfB ← |
pseudogene, related to transcriptional regulators OapA family protein |
RA | 4,433,164 | C→T | *287* (TAG→TAA) | qorB ← | NAD(P)H:quinone oxidoreductase |
RA | 4,441,538 | C→T | *213* (TAG→TAA) | msrA ← | methionine sulfoxide reductase A |
RA | 4,442,007 | T→C | E57G (GAG→GGG) | msrA ← | methionine sulfoxide reductase A |
RA | 4,447,869 | Δ1 bp | coding (3758/3780 nt) | tamB → | translocation and assembly module for autotransporter export, inner membrane subunit |
RA | 4,447,891 | G→A | *1260* (TAG→TAA) | tamB → | translocation and assembly module for autotransporter export, inner membrane subunit |
RA | 4,474,138 | (A)6→7 | coding (15/594 nt) | bdcR → | transcriptional repressor for divergent bdcA |
RA | 4,474,391 | G→A | G90S (GGC→AGC) | bdcR → | transcriptional repressor for divergent bdcA |
RA | 4,475,562 | (G)6→7 | coding (126/1815 nt) | yjgL → | SopA‑central‑domain‑like hexapeptide repeat protein |
MC JC | 4,490,116 | Δ11 bp | intergenic (‑53/+15) | yjgR ← / ← idnR | DUF853 family protein with NTPase fold/transcriptional repressor, 5‑gluconate‑binding |
RA | 4,490,141 | C→T | *333* (TAG→TAA) | idnR ← | transcriptional repressor, 5‑gluconate‑binding |
RA | 4,490,375 | C→T | A255A (GCG→GCA) | idnR ← | transcriptional repressor, 5‑gluconate‑binding |
RA | 4,499,500 | G→A | *302* (TAG→TAA) | insD1 → | IS2 transposase TnpB |
RA | 4,499,640 | C→T | pseudogene (895/942 nt) | yjgX ← | pseudogene fragment |
RA | 4,500,043 | C→T | pseudogene (492/942 nt) | yjgX ← | pseudogene fragment |
RA | 4,500,060 | C→T | pseudogene (475/942 nt) | yjgX ← | pseudogene fragment |
RA | 4,504,006 | G→A | intergenic (‑575/‑52) | insG ← / → yjhB | IS4 transposase/putative MFS transporter, membrane protein |
RA | 4,507,463 | G→A | intergenic (+12/+3) | insO → / ← insI1 | pseudogene, IS911 transposase B,IS, phage, Tn, Transposon‑related functions, extrachromosomal, transposon related/IS30 transposase |
RA | 4,510,188 | A→G | intergenic (+55/+502) | yjhV → / ← fecE | pseudogene, KpLE2 phage‑like element/ferric citrate ABC transporter ATPase |
RA | 4,510,690 | C→T | *256* (TAG→TAA) | fecE ← | ferric citrate ABC transporter ATPase |
RA | 4,511,146 | C→T | W104* (TGG→TGA) | fecE ← | ferric citrate ABC transporter ATPase |
RA | 4,515,284 | C→T | G465D (GGC→GAC) | fecA ← | TonB‑dependent outer membrane ferric citrate transporter and signal transducer, ferric citrate extracelluar receptor, FecR‑interacting protein |
RA | 4,519,014 | G→A | pseudogene (294/504 nt) | insB1 → | IS1 transposase B,IS, phage, Tn, Transposon‑related functions, extrachromosomal, transposon related |
RA | 4,535,441 | C→T | pseudogene (439/1029 nt) | yjhR → | pseudogene, helicase family, putative frameshift suppressor |
RA | 4,538,785 | C→T | *239* (TAG→TAA) | nanC ← | N‑acetylnuraminic acid outer membrane channel protein |
RA | 4,541,559 | G→A | *201* (TAG→TAA) | fimB → | tyrosine recombinase/inversion of on/off regulator of fimA |
JC | 4,543,180 | (TCCCTCAGTTCTACAGCGGCTCTG)1→2 | coding (66/549 nt) | fimA → | major type 1 subunit fimbrin (pilin) |
RA | 4,549,037 | T→C | V77A (GTC→GCC) | fimH → | minor component of type 1 fimbriae |
RA | 4,565,464 | C→A | L129F (TTG→TTT) | yjiM ← | putative 2‑hydroxyglutaryl‑CoA dehydratase |
RA | 4,565,966 | C→T | *427* (TAG→TAA) | yjiN ← | zinc‑type alcohol dehydrogenase‑like protein |
RA | 4,569,309 | G→A | pseudogene (312/921 nt) | yjiP → | pseudogene, transposase_31 family protein |
RA | 4,577,958 | C→T | M1M (GTG→ATG) † *460* (TAG→TAA) |
mcrC ← mcrB ← |
5‑methylcytosine‑specific restriction enzyme McrBC, subunit McrC 5‑methylcytosine‑specific restriction enzyme McrBC, subunit McrB |
RA | 4,581,621 | G→A | A476A (GCC→GCT) | hsdM ← | DNA methyltransferase M |
RA | 4,599,234 | C→T | G70S (GGT→AGT) | opgB ← | OPG periplasmic biosynthetic phosphoglycerol transferases I (membrane‑bound) and II (soluble) |
RA | 4,600,589 | G→A | S129S (TCC→TCT) | dnaC ← | DNA biosynthesis protein |
RA | 4,604,202 | G→A | *242* (TAG→TAA) E15K (GAA→AAA) |
yjjQ → bglJ → |
putative transcriptional regulator bgl operon transcriptional activator |
RA | 4,606,215 | (G)8→7 | noncoding (72/87 nt) | leuP ← | tRNA‑Leu |
RA | 4,606,239 | A→G | noncoding (48/87 nt) | leuP ← | tRNA‑Leu |
RA | 4,609,336 | (C)7→8 | intergenic (+13/‑78) | yjjG → / → prfC | dUMP phosphatase/peptide chain release factor RF‑3 |
RA | 4,612,289 | G→A | *54* (TAG→TAA) | ytjA → | uncharacterized protein |
RA | 4,614,260 | G→A | *260* (TAG→TAA) | yjjV → | putative DNase |
MC JC | 4,619,478 | Δ9 bp | coding (1250‑1258/1323 nt) | deoA → | thymidine phosphorylase |
RA | 4,619,913 | A→G | E104G (GAA→GGA) | deoB → | phosphopentomutase |
RA | 4,623,101 | C→T | *339* (TAG→TAA) | lplA ← | lipoate‑protein ligase A |
RA | 4,631,593 | G→A | W287* (TGG→TGA) | slt → | lytic murein transglycosylase, soluble |
RA | 4,634,581 | A→G | Y244H (TAC→CAC) | rob ← | right oriC‑binding transcriptional activator, AraC family |
RA | 4,638,120 | G→A | *475* (TAG→TAA) | creC → | sensory histidine kinase in two‑component regulatory system with CreB or PhoB |
Unassigned missing coverage evidence | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
seq id | start | end | size | ←reads | reads→ | gene | description | |||
* | * | ÷ | NC_000913 | 66626 | 66746 | 121 | 21 [19] | [19] 20 | araD/araA | L‑ribulose‑5‑phosphate 4‑epimerase/L‑arabinose isomerase |
* | * | ÷ | NC_000913 | 225825–226021 | 226880–226606 | 586–1056 | 20 [18] | [18] 20 | rrlH | 23S ribosomal RNA of rrnH operon |
* | * | ÷ | NC_000913 | 583489 | 583618 | 130 | 22 [18] | [15] 22 | tfaX/appY | pseudogene, DLP12 prophage,Phage or Prophage Related/global transcriptional activator, DLP12 prophage |
* | * | ÷ | NC_000913 | 789973 | 789980 | 8 | 25 [16] | [0] 64 | [galK] | [galK] |
* | * | ÷ | NC_000913 | 807293 | 810371 | 3079 | 21 [17] | [19] 23 | ybhB–[bioB] | ybhB, bioA, [bioB] |
* | * | ÷ | NC_000913 | 1427848 | 1428215–1428086 | 239–368 | 20 [17] | [19] 22 | insH1 | IS5 transposase and trans‑activator |
* | * | ÷ | NC_000913 | 1432743–1433198 | 1434028–1433668 | 471–1286 | 20 [18] | [16] 22 | [tfaR]–[ynaE] | [tfaR], pinR, [ynaE] |
* | * | ÷ | NC_000913 | 1958272 | 1958350 | 79 | 21 [19] | [17] 20 | torY/cutC | TMAO reductase III (TorYZ), cytochrome c‑type subunit/copper homeostasis protein |
* | * | ÷ | NC_000913 | 2033822 | 2033975 | 154 | 20 [15] | [14] 20 | rseX/yedS | sRNA antisense regulator of ompA and ompC translation, Hfq‑dependent/pseudogene, outer membrane protein homology, putative outer membrane protein |
* | * | ÷ | NC_000913 | 2469329 | 2469518 | 190 | 21 [16] | [17] 24 | gtrS | serotype‑specific glucosyl transferase, CPS‑53 (KpLE1) prophage |
* | * | ÷ | NC_000913 | 2699942 | 2700036 | 95 | 22 [17] | [16] 20 | yfhL/shoB | putative 4Fe‑4S cluster‑containing protein/toxic membrane protein |
* | * | ÷ | NC_000913 | 3423748–3424234 | 3424559–3424242 | 9–812 | 21 [18] | [16] 23 | [rrfD]–[rrlD] | [rrfD], [rrlD] |
* | * | ÷ | NC_000913 | 3762331–3764072 | 3765243–3764076 | 5–2913 | 20 [18] | [19] 20 | rhsA | Rhs protein with putative toxin 55 domain, putative polysaccharide synthesis/export protein, putative neighboring cell growth inhibitor |
* | * | ÷ | NC_000913 | 3769655 | 3769917 | 263 | 21 [15] | [17] 22 | [yibV]–yibV | [yibV], yibV |
* | * | ÷ | NC_000913 | 3793676 | 3793756 | 81 | 23 [19] | [16] 26 | [yibB] | [yibB] |
* | * | ÷ | NC_000913 | 4037911–4038688 | 4039313–4038730 | 43–1403 | 22 [19] | [19] 21 | rrlA | 23S ribosomal RNA of rrnA operon |
* | * | ÷ | NC_000913 | 4410063 | 4410121 | 59 | 20 [19] | [17] 21 | rlmB/yjfI | 23S rRNA mG2251 2'‑O‑ribose methyltransferase, SAM‑dependent/DUF2170 family protein |
Unassigned new junction evidence | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
* | ? | NC_000913 | = 788831 | 0 (0.000) | 64 (0.960) | 51/200 | 0.1 | 100% | coding (7/1041 nt) coding (1149/1149 nt) |
galM galK |
aldose 1‑epimerase, type‑1 mutarotase, galactose mutarotase galactokinase |
? | NC_000913 | 789981 = | 0 (0.000) | intergenic (‑2/+2) | galK/galT | galactokinase/galactose‑1‑phosphate uridylyltransferase | |||||
* | ? | NC_000913 | 788831 = | 0 (0.000) | 107 (1.570) | 57/204 | 0.1 | 97.3% | coding (7/1041 nt) coding (1149/1149 nt) |
galM galK |
aldose 1‑epimerase, type‑1 mutarotase, galactose mutarotase galactokinase |
? | NC_000913 | 3742633 = | 6 (0.090) | intergenic (‑101/‑100) | yiaJ/yiaK | transcriptional repressor for the yiaKLMNO‑lyxK‑sgbHUE operon/2,3‑diketo‑L‑gulonate reductase, NADH‑dependent | |||||
* | ? | NC_000913 | 1207790 = | 20 (0.290) | 53 (0.920) | 39/172 | 0.3 | 72.2% | coding (290/630 nt) | stfP | e14 prophage, uncharacterized protein |
? | NC_000913 | 1209619 = | 24 (0.420) | pseudogene (1/501 nt) | stfE | pseudogene, e14 prophage, side tail fiber protein fragment family,Phage or Prophage Related | |||||
* | ? | NC_000913 | = 1207805 | 20 (0.290) | 31 (0.540) | 21/172 | 1.6 | 60.3% | coding (305/630 nt) | stfP | e14 prophage, uncharacterized protein |
? | NC_000913 | = 1209602 | 24 (0.420) | pseudogene (18/501 nt) | stfE | pseudogene, e14 prophage, side tail fiber protein fragment family,Phage or Prophage Related | |||||
* | ? | NC_000913 | 1286708 = | 80 (1.170) | 36 (0.670) | 21/162 | 1.4 | 50.2% | intergenic (+182/+358) | narI/rttR | nitrate reductase 1, gamma (cytochrome b(NR)) subunit/rtT sRNA, processed from tyrT transcript |
? | NC_000913 | = 1287241 | 8 (0.150) | intergenic (‑5/+3) | rttR/tyrV | rtT sRNA, processed from tyrT transcript/tRNA‑Tyr | |||||
* | ? | NC_000913 | = 1287084 | 6 (0.090) | 34 (0.620) | 17/164 | 2.0 | 54.5% | noncoding (153/171 nt) | rttR | rtT sRNA, processed from tyrT transcript |
? | NC_000913 | 1287557 = | 52 (0.950) | noncoding (66/85 nt) | tyrT | tRNA‑Tyr | |||||
* | ? | NC_000913 | = 1299498 | 0 (0.000) | 27 (0.410) | 19/196 | 2.3 | 100% | intergenic (+253/‑1684) | ychE/oppA | UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein |
? | NC_000913 | 1300698 = | 0 (0.000) | intergenic (+1453/‑484) | ychE/oppA | UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein |