![]() |
breseq version 0.29.0 revision 8f9c342918e4
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
Predicted mutations | ||||||
---|---|---|---|---|---|---|
evidence | position | mutation | freq | annotation | gene | description |
RA | 14,116 | A→G | 15.6% | intergenic (+37/‑52) | dnaK → / → dnaJ | chaperone Hsp70, with co‑chaperone DnaJ/chaperone Hsp40, DnaK co‑chaperone |
RA | 14,119 | G→A | 15.9% | intergenic (+40/‑49) | dnaK → / → dnaJ | chaperone Hsp70, with co‑chaperone DnaJ/chaperone Hsp40, DnaK co‑chaperone |
RA | 14,124 | T→A | 15.2% | intergenic (+45/‑44) | dnaK → / → dnaJ | chaperone Hsp70, with co‑chaperone DnaJ/chaperone Hsp40, DnaK co‑chaperone |
RA | 87,881 | A→G | 18.0% | intergenic (+33/‑147) | ilvH → / → cra | acetolactate synthase 3, small subunit, valine‑sensitive/transcriptional repressor‑activator for carbon metabolism |
RA | 87,884 | T→A | 17.4% | intergenic (+36/‑144) | ilvH → / → cra | acetolactate synthase 3, small subunit, valine‑sensitive/transcriptional repressor‑activator for carbon metabolism |
RA | 87,887 | C→T | 17.3% | intergenic (+39/‑141) | ilvH → / → cra | acetolactate synthase 3, small subunit, valine‑sensitive/transcriptional repressor‑activator for carbon metabolism |
RA | 107,553 | (T)9→8 | 100% | intergenic (+79/‑152) | lpxC → / → secM | UDP‑3‑O‑acyl N‑acetylglucosamine deacetylase/regulator of secA translation |
RA | 120,154 | Δ1 bp | 20.7% | intergenic (+19/+24) | ampE → / ← aroP | ampicillin resistance inner membrane protein; putative signaling protein in beta‑lactamase regulation/aromatic amino acid transporter |
RA | 120,158:1 | +A | 20.8% | intergenic (+23/+20) | ampE → / ← aroP | ampicillin resistance inner membrane protein; putative signaling protein in beta‑lactamase regulation/aromatic amino acid transporter |
RA | 151,519 | A→C | 22.2% | I27M (ATT→ATG) | yadK ← | putative fimbrial‑like adhesin protein |
RA | 151,522 | G→T | 21.7% | A26A (GCC→GCA) | yadK ← | putative fimbrial‑like adhesin protein |
RA | 217,030 | C→T | 19.0% | intergenic (‑27/+27) | yaeF ← / ← proS | putative lipoprotein/prolyl‑tRNA synthetase |
RA | 217,037 | A→T | 20.1% | intergenic (‑34/+20) | yaeF ← / ← proS | putative lipoprotein/prolyl‑tRNA synthetase |
RA | 217,044 | A→G | 21.2% | intergenic (‑41/+13) | yaeF ← / ← proS | putative lipoprotein/prolyl‑tRNA synthetase |
RA | 220,849 | (T)5→4 | 100% | coding (80/816 nt) | metQ ← | DL‑methionine transporter subunit |
RA | 236,569 | C→T | 17.2% | A168V (GCC→GTC) | dnaQ → | DNA polymerase III epsilon subunit |
RA | 254,223 | A→T | 19.0% | intergenic (+21/+36) | prfH → / ← pepD | pseudogene, RF‑1 domain family; probable peptide chain release factor/aminoacyl‑histidine dipeptidase (peptidase D) |
RA | 254,228 | A→T | 16.9% | intergenic (+26/+31) | prfH → / ← pepD | pseudogene, RF‑1 domain family; probable peptide chain release factor/aminoacyl‑histidine dipeptidase (peptidase D) |
RA | 254,233 | A→T | 16.7% | intergenic (+31/+26) | prfH → / ← pepD | pseudogene, RF‑1 domain family; probable peptide chain release factor/aminoacyl‑histidine dipeptidase (peptidase D) |
RA | 254,238 | A→T | 16.6% | intergenic (+36/+21) | prfH → / ← pepD | pseudogene, RF‑1 domain family; probable peptide chain release factor/aminoacyl‑histidine dipeptidase (peptidase D) |
RA | 256,454 | C→G | 16.5% | intergenic (+19/‑73) | gpt → / → frsA | xanthine phosphoribosyltransferase; xanthine‑guanine phosphoribosyltransferase/fermentation‑respiration switch protein; PTS Enzyme IIA(Glc)‑binding protein; pNP‑butyrate esterase activity |
RA | 256,459 | G→A | 16.4% | intergenic (+24/‑68) | gpt → / → frsA | xanthine phosphoribosyltransferase; xanthine‑guanine phosphoribosyltransferase/fermentation‑respiration switch protein; PTS Enzyme IIA(Glc)‑binding protein; pNP‑butyrate esterase activity |
MC JC | 257,908 | Δ776 bp | 100% | [crl] | [crl] | |
RA | 317,566 | G→A | 20.8% | pseudogene (128/129 nt) | ykgQ → | pseudogene, putative dehydrogenase |
RA | 317,571 | T→C | 18.2% | intergenic (+4/+155) | ykgQ → / ← rclC | pseudogene, putative dehydrogenase/reactive chlorine species (RCS) stress resistance inner membrane protein |
RA | 349,717 | T→C | 69.6% | intergenic (+145/‑295) | prpB → / → prpC | 2‑methylisocitrate lyase/2‑methylcitrate synthase |
RA | 379,603 | C→T | 84.9% | intergenic (‑32/+3) | frmA ← / ← frmR | alcohol dehydrogenase class III; glutathione‑dependent formaldehyde dehydrogenase/regulator protein that represses frmRAB operon |
JC | 380,020 | (G)10→7 | 100% | intergenic (‑139/+47) | frmR ← / ← yaiO | regulator protein that represses frmRAB operon/outer membrane protein |
RA | 380,022:1 | (G)10→11 | 100% | intergenic (‑141/+47) | frmR ← / ← yaiO | regulator protein that represses frmRAB operon/outer membrane protein |
RA | 383,897 | C→T | 15.5% | M13I (ATG→ATA) ‡ | yaiP ← | putative family 2 glycosyltransferase |
RA | 383,898 | A→G | 15.5% | M13T (ATG→ACG) ‡ | yaiP ← | putative family 2 glycosyltransferase |
RA | 410,479 | A→G | 100% | S112S (TCA→TCG) | mak → | manno(fructo)kinase |
RA | 452,478 | C→T | 100% | L356L (CTG→CTA) | ampG ← | muropeptide transporter |
RA | 454,853 | T→C | 17.2% | intergenic (+64/‑280) | bolA → / → tig | stationary‑phase morphogene, transcriptional repressor for mreB; also regulator for dacA, dacC, and ampC/peptidyl‑prolyl cis/trans isomerase (trigger factor) |
RA | 454,856 | G→A | 16.9% | intergenic (+67/‑277) | bolA → / → tig | stationary‑phase morphogene, transcriptional repressor for mreB; also regulator for dacA, dacC, and ampC/peptidyl‑prolyl cis/trans isomerase (trigger factor) |
RA | 459,440 | G→A | 79.0% | E185K (GAG→AAG) | lon → | DNA‑binding ATP‑dependent protease La |
RA | 478,750 | C→T | 16.5% | intergenic (‑133/+31) | ylaB ← / ← ylaC | putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase/DUF1449 family inner membrane protein |
RA | 478,757 | T→C | 16.2% | intergenic (‑140/+24) | ylaB ← / ← ylaC | putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase/DUF1449 family inner membrane protein |
RA | 478,759 | A→G | 15.9% | intergenic (‑142/+22) | ylaB ← / ← ylaC | putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase/DUF1449 family inner membrane protein |
RA | 518,860 | A→G | 16.1% | F97S (TTC→TCC) | ybbO ← | putative oxidoreductase |
RA | 518,863 | C→T | 17.1% | G96E (GGA→GAA) | ybbO ← | putative oxidoreductase |
RA | 569,160 | G→T | 17.1% | D87Y (GAC→TAC) ‡ | ybcK → | DLP12 prophage; putative recombinase |
RA | 569,161 | A→C | 15.8% | D87A (GAC→GCC) ‡ | ybcK → | DLP12 prophage; putative recombinase |
RA | 605,022 | C→G | 15.8% | D135H (GAT→CAT) | nfsB ← | dihydropteridine reductase, NAD(P)H‑dependent, oxygen‑insensitive |
RA | 605,025 | C→G | 15.9% | D134H (GAT→CAT) | nfsB ← | dihydropteridine reductase, NAD(P)H‑dependent, oxygen‑insensitive |
RA | 654,560 | A→C | 16.7% | intergenic (+18/+23) | citB → / ← dcuC | response regulator in two‑component regulatory system with CitA/anaerobic C4‑dicarboxylate transport |
RA | 654,563 | C→G | 16.2% | intergenic (+21/+20) | citB → / ← dcuC | response regulator in two‑component regulatory system with CitA/anaerobic C4‑dicarboxylate transport |
RA | 654,566 | G→T | 16.4% | intergenic (+24/+17) | citB → / ← dcuC | response regulator in two‑component regulatory system with CitA/anaerobic C4‑dicarboxylate transport |
RA | 740,004 | G→A | 84.3% | M166I (ATG→ATA) | phr → | deoxyribodipyrimidine photolyase, FAD‑binding |
RA | 781,818:1 | (A)6→7 | 100% | intergenic (+166/‑267) | lysQ → / → nadA | tRNA‑Lys/quinolinate synthase, subunit A |
RA | 801,861 | G→C | 16.1% | intergenic (+50/‑26) | ybhH → / → ybhI | putative PrpF family isomerase/putative DASS family tricarboxylate or dicarboxylate transporter |
RA | 844,513 | T→A | 44.1% | Q323L (CAG→CTG) | ybiO ← | mechanosensitive channel protein, intermediate conductance |
RA | 940,751 | T→C | 15.5% | intergenic (+31/‑208) | serS → / → dmsA | seryl‑tRNA synthetase/dimethyl sulfoxide reductase, anaerobic, subunit A |
RA | 940,754 | G→A | 15.9% | intergenic (+34/‑205) | serS → / → dmsA | seryl‑tRNA synthetase/dimethyl sulfoxide reductase, anaerobic, subunit A |
RA | 949,741 | Δ1 bp | 17.2% | coding (74/591 nt) | ycaK → | putative NAD(P)H‑dependent oxidoreductase |
RA | 949,745:1 | +G | 16.7% | coding (78/591 nt) | ycaK → | putative NAD(P)H‑dependent oxidoreductase |
RA | 953,802 | A→G | 100% | V222A (GTA→GCA) | focA ← | formate channel |
RA | 987,560 | G→C | 18.1% | intergenic (‑578/+25) | ompF ← / ← asnS | outer membrane porin 1a (Ia;b;F)/asparaginyl tRNA synthetase |
RA | 987,561 | G→C | 17.8% | intergenic (‑579/+24) | ompF ← / ← asnS | outer membrane porin 1a (Ia;b;F)/asparaginyl tRNA synthetase |
RA | 1,015,912 | T→A | 15.5% | intergenic (+30/+40) | rmf → / ← fabA | ribosome modulation factor/beta‑hydroxydecanoyl thioester dehydrase |
RA | 1,143,641 | G→A | 100% | H243Y (CAT→TAT) | rne ← | endoribonuclease; RNA‑binding protein;RNA degradosome binding protein |
RA | 1,156,112 | T→C | 100% | A117A (GCT→GCC) | holB → | DNA polymerase III, delta prime subunit |
RA | 1,159,335 | G→T | 15.5% | intergenic (+33/+27) | ptsG → / ← fhuE | fused glucose‑specific PTS enzymes: IIB component/IIC component/ferric‑rhodotorulic acid outer membrane transporter |
RA | 1,196,408 | A→T | 15.4% | intergenic (+35/+459) | icd → / ← ymfD | isocitrate dehydrogenase; e14 prophage attachment site; tellurite reductase/e14 prophage; putative SAM‑dependent methyltransferase |
RA | 1,224,239 | A→T | 15.7% | intergenic (+332/+40) | ycgI → / ← minE | pseudogene/cell division topological specificity factor |
RA | 1,224,242 | A→T | 15.5% | intergenic (+335/+37) | ycgI → / ← minE | pseudogene/cell division topological specificity factor |
RA | 1,232,481 | C→T | 22.5% | intergenic (+27/+19) | umuC → / ← dsbB | translesion error‑prone DNA polymerase V subunit; DNA polymerase activity/oxidoreductase that catalyzes reoxidation of DsbA protein disulfide isomerase I |
RA | 1,232,484 | A→G | 22.4% | intergenic (+30/+16) | umuC → / ← dsbB | translesion error‑prone DNA polymerase V subunit; DNA polymerase activity/oxidoreductase that catalyzes reoxidation of DsbA protein disulfide isomerase I |
RA | 1,233,154 | T→A | 15.5% | intergenic (‑124/+22) | dsbB ← / ← nhaB | oxidoreductase that catalyzes reoxidation of DsbA protein disulfide isomerase I/sodium:proton antiporter |
RA | 1,246,073 | C→T | 100% | G435D (GGC→GAC) | treA ← | periplasmic trehalase |
RA | 1,327,213 | C→T | 16.4% | T121I (ACC→ATC) | rluB → | 23S rRNA pseudouridine(2605) synthase |
RA | 1,388,283 | C→T | 15.1% | intergenic (+22/+22) | tyrR → / ← tpx | aromatic amino acid biosynthesis and transport regulon transcriptional regulator; autorepressor; ATPase; phosphatase/lipid hydroperoxide peroxidase |
RA | 1,428,391 | G→C | 15.7% | L112L (CTC→CTG) | insH1 ← | IS5 transposase and trans‑activator |
RA | 1,441,833 | G→C | 15.8% | intergenic (‑90/+21) | hslJ ← / ← ldhA | heat‑inducible lipoprotein involved in novobiocin resistance/fermentative D‑lactate dehydrogenase, NAD‑dependent |
RA | 1,441,835 | A→T | 15.6% | intergenic (‑92/+19) | hslJ ← / ← ldhA | heat‑inducible lipoprotein involved in novobiocin resistance/fermentative D‑lactate dehydrogenase, NAD‑dependent |
RA | 1,441,837 | G→C | 16.6% | intergenic (‑94/+17) | hslJ ← / ← ldhA | heat‑inducible lipoprotein involved in novobiocin resistance/fermentative D‑lactate dehydrogenase, NAD‑dependent |
RA | 1,446,357:1 | +T | 24.5% | intergenic (+151/+21) | ydbL → / ← feaR | DUF1318 family protein/transcriptional activator for tynA and feaB |
RA | 1,446,362 | Δ1 bp | 23.6% | intergenic (+156/+16) | ydbL → / ← feaR | DUF1318 family protein/transcriptional activator for tynA and feaB |
RA | 1,489,197 | C→T | 100% | D322D (GAC→GAT) | aldA → | aldehyde dehydrogenase A, NAD‑linked |
RA | 1,597,313:1 | (C)7→8 | 100% | pseudogene (675/3861 nt) | yneO ← | pseudogene, AidA homolog |
RA | 1,650,147 | G→A | 15.2% | pseudogene (70/765 nt) | ydfE → | Qin prophage; pseudogene;Phage or Prophage Related |
RA | 1,650,148 | T→C | 15.5% | pseudogene (71/765 nt) | ydfE → | Qin prophage; pseudogene;Phage or Prophage Related |
RA | 1,657,898 | A→T | 15.8% | intergenic (+28/‑171) | ynfD → / → ynfE | DUF1161 family periplasmic protein/putative selenate reductase, periplasmic |
RA | 1,657,901 | A→T | 15.5% | intergenic (+31/‑168) | ynfD → / → ynfE | DUF1161 family periplasmic protein/putative selenate reductase, periplasmic |
RA | 1,666,466 | T→G | 23.8% | Y384* (TAT→TAG) | clcB → | H(+)/Cl(‑) exchange transporter |
RA | 1,666,468 | A→T | 23.5% | Q385L (CAG→CTG) | clcB → | H(+)/Cl(‑) exchange transporter |
RA | 1,666,470 | C→A | 23.2% | L386I (CTA→ATA) | clcB → | H(+)/Cl(‑) exchange transporter |
RA | 1,701,108 | A→T | 15.9% | N51I (AAT→ATT) | malY → | PLP‑dependent beta‑cystathionase and maltose regulon regulator |
RA | 1,755,639 | G→A | 100% | intergenic (‑498/‑59) | ydhZ ← / → pykF | uncharacterized protein/pyruvate kinase I |
RA | 1,764,687 | T→C | 20.8% | intergenic (‑301/+247) | sufA ← / ← ydiH | Fe‑S cluster assembly protein/uncharacterized protein |
RA | 1,764,701 | G→A | 18.2% | intergenic (‑315/+233) | sufA ← / ← ydiH | Fe‑S cluster assembly protein/uncharacterized protein |
RA | 1,810,065 | T→G | 15.3% | intergenic (+17/‑146) | yniC → / → ydjM | 2‑deoxyglucose‑6‑P phosphatase/inner membrane protein regulated by LexA |
RA | 1,810,066 | C→A | 15.2% | intergenic (+18/‑145) | yniC → / → ydjM | 2‑deoxyglucose‑6‑P phosphatase/inner membrane protein regulated by LexA |
RA | 1,850,715 | Δ1 bp | 17.3% | intergenic (+22/‑145) | sppA → / → ansA | protease IV (signal peptide peptidase)/cytoplasmic L‑asparaginase 1 |
RA | 1,850,719:1 | +T | 16.7% | intergenic (+26/‑141) | sppA → / → ansA | protease IV (signal peptide peptidase)/cytoplasmic L‑asparaginase 1 |
RA | 1,861,419 | A→G | 19.8% | intergenic (‑87/+283) | ydjL ← / ← yeaC | putative Zn‑dependent NAD(P)‑binding oxidoreductase/DUF1315 family protein |
RA | 1,861,425 | A→C | 19.3% | intergenic (‑93/+277) | ydjL ← / ← yeaC | putative Zn‑dependent NAD(P)‑binding oxidoreductase/DUF1315 family protein |
RA | 1,861,428 | G→T | 17.9% | intergenic (‑96/+274) | ydjL ← / ← yeaC | putative Zn‑dependent NAD(P)‑binding oxidoreductase/DUF1315 family protein |
RA | 1,861,434 | C→T | 19.4% | intergenic (‑102/+268) | ydjL ← / ← yeaC | putative Zn‑dependent NAD(P)‑binding oxidoreductase/DUF1315 family protein |
RA | 1,868,250 | A→G | 100% | Y448C (TAC→TGC) | yeaG → | protein kinase, endogenous substrate unidentified; autokinase |
RA | 1,868,859 | Δ1 bp | 16.7% | intergenic (+17/‑96) | yeaG → / → yeaH | protein kinase, endogenous substrate unidentified; autokinase/UPF0229 family protein |
RA | 1,868,865:1 | +G | 15.6% | intergenic (+23/‑90) | yeaG → / → yeaH | protein kinase, endogenous substrate unidentified; autokinase/UPF0229 family protein |
RA | 1,883,027 | C→G | 19.4% | intergenic (+30/‑161) | dmlA → / → yeaV | D‑malate oxidase, NAD‑dependent; putative tartrate dehydrogenase/putative transporter |
RA | 1,932,094 | C→G | 21.3% | intergenic (+35/+21) | purT → / ← eda | phosphoribosylglycinamide formyltransferase 2/KHG/KDPG aldolase; 2‑dehydro‑3‑deoxy‑phosphogluconate/4‑hydroxy‑2‑ oxoglutarate aldolase |
RA | 1,932,095 | T→A | 20.1% | intergenic (+36/+20) | purT → / ← eda | phosphoribosylglycinamide formyltransferase 2/KHG/KDPG aldolase; 2‑dehydro‑3‑deoxy‑phosphogluconate/4‑hydroxy‑2‑ oxoglutarate aldolase |
RA | 1,932,096 | C→G | 19.7% | intergenic (+37/+19) | purT → / ← eda | phosphoribosylglycinamide formyltransferase 2/KHG/KDPG aldolase; 2‑dehydro‑3‑deoxy‑phosphogluconate/4‑hydroxy‑2‑ oxoglutarate aldolase |
RA | 1,945,839 | G→A | 100% | I46I (ATC→ATT) | ruvA ← | component of RuvABC resolvasome, regulatory subunit |
RA | 1,950,955 | Δ1 bp | 16.8% | coding (124/567 nt) | yecD → | isochorismatase family protein |
RA | 1,950,966:1 | +C | 15.8% | coding (135/567 nt) | yecD → | isochorismatase family protein |
MC JC | 1,978,503 | Δ776 bp | 100% | insB1–insA | insB1, insA | |
JC JC | 1,979,486 | IS5 (+) +4 bp | 100% | intergenic (‑271/‑264) | insA ← / → uspC | IS1 repressor TnpA/universal stress protein |
RA | 1,985,112 | C→G | 16.0% | intergenic (‑43/+27) | araG ← / ← araF | L‑arabinose ABC transporter ATPase/L‑arabinose ABC transporter periplasmic binding protein |
RA | 2,018,260 | (A)8→7 | 100% | coding (315/444 nt) | fliJ → | flagellar protein |
RA | 2,028,158 | G→C | 16.9% | intergenic (‑141/+30) | yedQ ← / ← yodC | putative membrane‑anchored diguanylate cyclase/uncharacterized protein |
RA | 2,028,159 | T→A | 16.9% | intergenic (‑142/+29) | yedQ ← / ← yodC | putative membrane‑anchored diguanylate cyclase/uncharacterized protein |
RA | 2,028,160 | G→C | 16.7% | intergenic (‑143/+28) | yedQ ← / ← yodC | putative membrane‑anchored diguanylate cyclase/uncharacterized protein |
RA | 2,032,336 | G→C | 20.8% | intergenic (‑19/+48) | dcm ← / ← yedJ | DNA cytosine methyltransferase/putative HD superfamily phosphohydrolase |
RA | 2,079,004 | G→C | 15.4% | intergenic (+73/+28) | yoeF → / ← yeeX | pseudogene, CP4‑44 putative prophage remnant;Phage or Prophage Related/UPF0265 family protein |
RA | 2,089,854 | A→T | 16.2% | intergenic (‑141/‑142) | yefM ← / → hisL | antitoxin of the YoeB‑YefM toxin‑antitoxin system/his operon leader peptide |
RA | 2,143,720 | C→G | 15.7% | P152R (CCT→CGT) | yegE → | putative diguanylate cyclase |
RA | 2,143,725 | A→C | 15.3% | R154R (AGG→CGG) | yegE → | putative diguanylate cyclase |
RA | 2,173,363 | Δ2 bp | 100% | intergenic (‑1/+1) | gatC ← / ← gatC | pseudogene, galactitol‑specific enzyme IIC component of PTS;transport; Transport of small molecules: Carbohydrates, organic acids, alcohols; PTS system galactitol‑specific enzyme IIC/pseudogene, galactitol‑specific enzyme IIC component of PTS;transport; Transport of small molecules: Carbohydrates, organic acids, alcohols; PTS system galactitol‑specific enzyme IIC |
RA | 2,187,314 | C→G | 17.0% | intergenic (+16/+66) | rcnB → / ← yehA | periplasmic modulator of Ni and Co efflux/putative fimbrial‑like adhesin protein |
RA | 2,202,110 | T→C | 81.5% | F611S (TTT→TCT) | yehI → | DUF4132 domain‑containing protein |
RA | 2,286,311 | C→G | 19.8% | intergenic (+24/+79) | proL → / ← yejO | tRNA‑Pro/pseudogene, autotransporter outer membrane homology;putative transport; Not classified; putative ATP‑binding component of a transport system |
RA | 2,286,313 | T→A | 18.8% | intergenic (+26/+77) | proL → / ← yejO | tRNA‑Pro/pseudogene, autotransporter outer membrane homology;putative transport; Not classified; putative ATP‑binding component of a transport system |
RA | 2,286,315 | C→G | 18.0% | intergenic (+28/+75) | proL → / ← yejO | tRNA‑Pro/pseudogene, autotransporter outer membrane homology;putative transport; Not classified; putative ATP‑binding component of a transport system |
RA | 2,304,221 | C→T | 100% | A106V (GCC→GTC) | eco → | ecotin, a serine protease inhibitor |
RA | 2,304,649 | C→T | 16.6% | intergenic (+256/+459) | eco → / ← mqo | ecotin, a serine protease inhibitor/malate dehydrogenase, FAD/NAD(P)‑binding domain |
RA | 2,314,800 | A→C | 17.4% | Q438P (CAG→CCG) ‡ | rcsD → | phosphotransfer intermediate protein in two‑component regulatory system with RcsBC |
RA | 2,314,801 | G→T | 17.3% | Q438H (CAG→CAT) ‡ | rcsD → | phosphotransfer intermediate protein in two‑component regulatory system with RcsBC |
RA | 2,391,414 | C→G | 18.1% | R31P (CGA→CCA) | nuoN ← | NADH:ubiquinone oxidoreductase, membrane subunit N |
RA | 2,391,417 | C→G | 18.2% | W30S (TGG→TCG) | nuoN ← | NADH:ubiquinone oxidoreductase, membrane subunit N |
RA | 2,405,941 | C→G | 15.3% | G234A (GGC→GCC) | lrhA ← | transcriptional repressor of flagellar, motility and chemotaxis genes |
RA | 2,405,946 | A→G | 15.0% | G232G (GGT→GGC) | lrhA ← | transcriptional repressor of flagellar, motility and chemotaxis genes |
RA | 2,470,410 | (T)7→6 | 100% | coding (1280/1332 nt) | gtrS → | serotype‑specific glucosyl transferase, CPS‑53 (KpLE1) prophage |
RA | 2,474,878 | T→C | 17.1% | intergenic (+22/‑106) | yfdQ → / → yfdR | CPS‑53 (KpLE1) prophage; uncharacterized protein/CPS‑53 (KpLE1) prophage; conserved protein |
RA | 2,474,881 | G→A | 19.2% | intergenic (+25/‑103) | yfdQ → / → yfdR | CPS‑53 (KpLE1) prophage; uncharacterized protein/CPS‑53 (KpLE1) prophage; conserved protein |
RA | 2,516,689 | T→C | 100% | T382A (ACG→GCG) | yfeA ← | putative diguanylate cyclase |
RA | 2,589,122 | G→A | 15.6% | G510S (GGC→AGC) | acrD → | aminoglycoside/multidrug efflux system |
RA | 2,589,125 | T→C | 17.2% | F511L (TTT→CTT) | acrD → | aminoglycoside/multidrug efflux system |
RA | 2,596,874 | Δ1 bp | 16.1% | intergenic (‑137/+31) | ypfJ ← / ← purC | putative neutral zinc metallopeptidase/phosphoribosylaminoimidazole‑succinocarboxamide synthetase |
RA | 2,596,879:1 | +G | 16.1% | intergenic (‑142/+26) | ypfJ ← / ← purC | putative neutral zinc metallopeptidase/phosphoribosylaminoimidazole‑succinocarboxamide synthetase |
RA | 2,652,855:1 | (G)6→7 | 100% | coding (362/846 nt) | sseA → | 3‑mercaptopyruvate sulfurtransferase |
RA | 2,653,367 | G→A | 17.0% | intergenic (+28/+790) | sseA → / ← sseB | 3‑mercaptopyruvate sulfurtransferase/rhodanase‑like enzyme, sulfur transfer from thiosulfate |
RA | 2,663,466 | G→T | 15.6% | V9L (GTG→TTG) | suhB → | inositol monophosphatase |
RA | 2,663,474 | A→T | 15.4% | A11A (GCA→GCT) | suhB → | inositol monophosphatase |
RA | 2,679,430 | Δ1 bp | 23.7% | intergenic (‑63/+34) | yphF ← / ← yphG | putative sugar ABC transporter periplasmic binding protein/DUF4380 domain‑containing TPR repeat protein |
RA | 2,679,434:1 | +C | 23.9% | intergenic (‑67/+30) | yphF ← / ← yphG | putative sugar ABC transporter periplasmic binding protein/DUF4380 domain‑containing TPR repeat protein |
RA | 2,731,312 | G→A | 70.1% | intergenic (‑155/+288) | rrsG ← / ← clpB | 16S ribosomal RNA of rrnG operon/protein disaggregation chaperone |
RA | 2,732,147 | A→T | 16.3% | L676Q (CTG→CAG) | clpB ← | protein disaggregation chaperone |
RA | 2,732,150 | A→T | 16.7% | L675Q (CTG→CAG) | clpB ← | protein disaggregation chaperone |
RA | 2,736,911 | C→T | 15.1% | intergenic (+28/‑243) | bamD → / → raiA | BamABCDE complex OM biogenesis lipoprotein/cold shock protein associated with 30S ribosomal subunit |
RA | 2,790,586 | T→C | 100% | L202P (CTG→CCG) | lhgO → | L‑2‑hydroxyglutarate oxidase |
RA | 2,809,774:1 | (T)7→8 | 100% | coding (158/738 nt) | ygaZ → | putative L‑valine exporter, norvaline resistance protein |
RA | 2,810,872 | C→T | 21.2% | H35Y (CAC→TAC) ‡ | mprA → | transcriptional repressor of microcin B17 synthesis and multidrug efflux |
RA | 2,810,873 | A→G | 19.5% | H35R (CAC→CGC) ‡ | mprA → | transcriptional repressor of microcin B17 synthesis and multidrug efflux |
RA | 2,814,174 | T→A | 21.5% | intergenic (+20/+44) | emrB → / ← luxS | multidrug efflux system protein/S‑ribosylhomocysteine lyase |
RA | 2,814,175 | T→A | 20.6% | intergenic (+21/+43) | emrB → / ← luxS | multidrug efflux system protein/S‑ribosylhomocysteine lyase |
RA | 2,838,222 | A→T | 17.8% | intergenic (‑117/+32) | hydN ← / ← ascG | formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit/asc operon transcriptional repressor; prpBC operon repressor |
RA | 2,838,231 | A→T | 17.0% | intergenic (‑126/+23) | hydN ← / ← ascG | formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit/asc operon transcriptional repressor; prpBC operon repressor |
RA | 2,856,887 | C→T | 81.4% | intergenic (‑81/‑206) | ygbA ← / → mutS | uncharacterized protein/methyl‑directed mismatch repair protein |
RA | 2,866,592:1 | +C | 100% | coding (960/993 nt) | rpoS ← | RNA polymerase, sigma S (sigma 38) factor |
RA | 2,890,521 | G→A | 52.7% | P460S (CCA→TCA) | cysJ ← | sulfite reductase, alpha subunit, flavoprotein |
RA | 2,900,327 | A→C | 15.0% | intergenic (‑54/‑265) | ygcW ← / → yqcE | putative SDR family oxidoreductase/putative MFS transporter, inner membrane protein |
RA | 2,933,398 | A→T | 15.4% | H97Q (CAT→CAA) | fucA ← | L‑fuculose‑1‑phosphate aldolase |
RA | 2,933,401 | A→C | 15.3% | V96V (GTT→GTG) | fucA ← | L‑fuculose‑1‑phosphate aldolase |
RA | 2,967,887 | G→A | 100% | A183V (GCC→GTC) | ptsP ← | PEP‑protein phosphotransferase enzyme I; GAF domain containing protein |
RA | 2,993,889 | T→A | 15.2% | intergenic (+33/‑50) | ygeI → / → pbl | uncharacterized protein/pseudogene, peptidoglycan‑binding enzyme family |
RA | 3,001,304:1 | (G)7→8 | 100% | coding (960/2259 nt) | xdhA → | xanthine dehydrogenase, molybdenum binding subunit |
RA | 3,007,187 | A→T | 84.7% | D309V (GAC→GTC) | ygeW → | putative carbamoyltransferase |
RA | 3,008,075 | A→G | 100% | D189G (GAC→GGC) | ygeX → | 2,3‑diaminopropionate ammonia lyase, PLP‑dependent |
RA | 3,037,957 | G→T | 15.1% | P50P (CCC→CCA) | recJ ← | ssDNA exonuclease, 5' ‑‑> 3'‑specific |
RA | 3,057,140 | A→G | 16.2% | intergenic (‑191/+38) | ibsC ← / ← serA | toxic membrane protein/D‑3‑phosphoglycerate dehydrogenase |
RA | 3,057,145 | G→C | 15.8% | intergenic (‑196/+33) | ibsC ← / ← serA | toxic membrane protein/D‑3‑phosphoglycerate dehydrogenase |
RA | 3,057,150 | C→T | 15.3% | intergenic (‑201/+28) | ibsC ← / ← serA | toxic membrane protein/D‑3‑phosphoglycerate dehydrogenase |
RA | 3,066,319 | Δ1 bp | 16.1% | coding (855/897 nt) | ygfI ← | putative DNA‑binding transcriptional regulator |
RA | 3,068,922 | G→T | 17.1% | intergenic (‑114/+25) | argO ← / ← mscS | arginine transporter/mechanosensitive channel protein, small conductance |
RA | 3,068,924 | G→A | 17.6% | intergenic (‑116/+23) | argO ← / ← mscS | arginine transporter/mechanosensitive channel protein, small conductance |
RA | 3,068,927 | T→C | 17.7% | intergenic (‑119/+20) | argO ← / ← mscS | arginine transporter/mechanosensitive channel protein, small conductance |
RA | 3,068,929 | A→C | 17.0% | intergenic (‑121/+18) | argO ← / ← mscS | arginine transporter/mechanosensitive channel protein, small conductance |
RA | 3,111,961 | T→C | 15.2% | pseudogene (130/963 nt) | yghE ← | pseudogene, secretion pathway protein, L‑type protein homology; putative general secretion pathway for protein export (GSP) |
RA | 3,111,962 | G→A | 15.1% | pseudogene (129/963 nt) | yghE ← | pseudogene, secretion pathway protein, L‑type protein homology; putative general secretion pathway for protein export (GSP) |
RA | 3,183,345:1 | +T | 18.8% | intergenic (+22/+468) | zupT → / ← ribB | zinc transporter/3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase |
RA | 3,183,350 | Δ1 bp | 17.1% | intergenic (+27/+463) | zupT → / ← ribB | zinc transporter/3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase |
RA | 3,194,516 | A→G | 100% | K551K (AAA→AAG) | yqiK → | PHB family membrane protein, function unknown |
RA | 3,247,812 | C→T | 35.9% | Q14* (CAG→TAG) | yqjA → | general envelope maintenance protein; DedA family inner membrane protein; putative multidrug efflux transporter |
RA | 3,249,628 | G→A | 100% | G85D (GGC→GAC) | yqjD → | membrane‑anchored ribosome‑binding protein |
RA | 3,288,032 | C→A | 16.5% | intergenic (+22/‑58) | yraH → / → yraI | putative fimbrial‑like adhesin protein/putative periplasmic pilin chaperone |
RA | 3,288,033 | T→G | 15.7% | intergenic (+23/‑57) | yraH → / → yraI | putative fimbrial‑like adhesin protein/putative periplasmic pilin chaperone |
RA | 3,298,809 | A→G | 82.7% | V13A (GTG→GCG) | yraR ← | putative nucleoside‑diphosphate‑sugar epimerase |
RA | 3,331,979 | T→C | 16.1% | T253A (ACG→GCG) | yhbE ← | EamA family inner membrane putative transporter |
RA | 3,331,983 | G→C | 17.2% | I251M (ATC→ATG) | yhbE ← | EamA family inner membrane putative transporter |
RA | 3,331,987 | G→A | 16.4% | A250V (GCG→GTG) | yhbE ← | EamA family inner membrane putative transporter |
RA | 3,352,673 | T→C | 100% | E118G (GAA→GGA) | arcB ← | aerobic respiration control sensor histidine protein kinase, cognate to two‑component response regulators ArcA and RssB |
RA | 3,379,266:1 | (C)7→8 | 100% | coding (732/1128 nt) | zapE ← | divisome ATPase |
RA | 3,395,910 | T→C | 38.6% | T117A (ACC→GCC) | yhdP ← | DUF3971‑AsmA2 domains protein |
RA | 3,407,293 | T→A | 18.3% | intergenic (+27/‑82) | accC → / → yhdT | acetyl‑CoA carboxylase, biotin carboxylase subunit/DUF997 family putative inner membrane protein |
RA | 3,407,294 | T→A | 17.0% | intergenic (+28/‑81) | accC → / → yhdT | acetyl‑CoA carboxylase, biotin carboxylase subunit/DUF997 family putative inner membrane protein |
RA | 3,407,295 | T→A | 17.4% | intergenic (+29/‑80) | accC → / → yhdT | acetyl‑CoA carboxylase, biotin carboxylase subunit/DUF997 family putative inner membrane protein |
RA | 3,411,299 | T→C | 100% | V10A (GTA→GCA) | fis → | global DNA‑binding transcriptional dual regulator |
RA | 3,468,389 | T→C | 15.9% | S489G (AGT→GGT) | chiA ← | periplasmic endochitinase |
RA | 3,471,357 | C→T | 17.1% | intergenic (‑28/+43) | tufA ← / ← fusA | translation elongation factor EF‑Tu 1/protein chain elongation factor EF‑G, GTP‑binding |
RA | 3,471,361 | T→G | 16.3% | intergenic (‑32/+39) | tufA ← / ← fusA | translation elongation factor EF‑Tu 1/protein chain elongation factor EF‑G, GTP‑binding |
RA | 3,471,362 | C→A | 15.8% | intergenic (‑33/+38) | tufA ← / ← fusA | translation elongation factor EF‑Tu 1/protein chain elongation factor EF‑G, GTP‑binding |
RA | 3,520,513 | T→C | 100% | D64G (GAT→GGT) | hofQ ← | DNA catabolic putative fimbrial transporter |
JC | 3,525,968 | (ATCAGG)2→1 | 23.3% | coding (177‑182/561 nt) | nudE ← | adenosine nucleotide hydrolase; Ap3A/Ap2A/ADP‑ribose/NADH hydrolase |
RA | 3,549,792 | (C)6→5 | 100% | coding (279/2085 nt) | malQ ← | 4‑alpha‑glucanotransferase (amylomaltase) |
RA | 3,560,455:1 | +G | 100% | intergenic (‑2/+1) | glpR ← / ← glpR | pseudogene, DNA‑binding transcriptional repressor;regulator; Energy metabolism, carbon: Anaerobic respiration; repressor of the glp operon/pseudogene, DNA‑binding transcriptional repressor;regulator; Energy metabolism, carbon: Anaerobic respiration; repressor of the glp operon |
MC JC | 3,582,206 | Δ1,222 bp | 100% | IS1‑mediated | [yhhZ]–yrhA | [yhhZ], yrhA |
RA | 3,646,678 | G→A | 100% | G127D (GGC→GAC) | gor → | glutathione oxidoreductase |
RA | 3,648,144 | (T)7→6 | 100% | intergenic (‑356/‑384) | dinQ ← / → arsR | UV‑inducible membrane toxin, DinQ‑AgrB type I toxin‑antitoxin system/arsenical resistance operon transcriptional repressor; autorepressor |
RA | 3,705,970 | G→A | 25.9% | intergenic (‑180/+128) | dppB ← / ← dppA | dipeptide/heme ABC transporter permease/dipeptide/heme ABC transporter periplasmic binding protein; dipeptide chemotaxis receptor |
RA | 3,705,971 | C→A | 26.3% | intergenic (‑181/+127) | dppB ← / ← dppA | dipeptide/heme ABC transporter permease/dipeptide/heme ABC transporter periplasmic binding protein; dipeptide chemotaxis receptor |
RA | 3,705,984 | T→G | 32.3% | intergenic (‑194/+114) | dppB ← / ← dppA | dipeptide/heme ABC transporter permease/dipeptide/heme ABC transporter periplasmic binding protein; dipeptide chemotaxis receptor |
RA | 3,705,985 | T→C | 32.0% | intergenic (‑195/+113) | dppB ← / ← dppA | dipeptide/heme ABC transporter permease/dipeptide/heme ABC transporter periplasmic binding protein; dipeptide chemotaxis receptor |
RA | 3,781,145 | C→G | 17.2% | intergenic (+128/‑70) | lldD → / → trmL | L‑lactate dehydrogenase, FMN‑linked/tRNA Leu mC34,mU34 2'‑O‑methyltransferase, SAM‑dependent |
RA | 3,810,324 | G→A | 15.5% | intergenic (+20/+19) | coaD → / ← mutM | pantetheine‑phosphate adenylyltransferase/formamidopyrimidine/5‑formyluracil/ 5‑hydroxymethyluracil DNA glycosylase |
RA | 3,815,816 | C→G | 17.8% | intergenic (‑48/+18) | pyrE ← / ← rph | orotate phosphoribosyltransferase/ribonuclease PH (defective);enzyme; Degradation of RNA; RNase PH |
RA | 3,815,819 | C→G | 17.8% | intergenic (‑51/+15) | pyrE ← / ← rph | orotate phosphoribosyltransferase/ribonuclease PH (defective);enzyme; Degradation of RNA; RNase PH |
MC JC | 3,815,859 | Δ82 bp | 100% | [rph]–[rph] | [rph], [rph] | |
RA | 3,891,502 | C→G | 18.0% | intergenic (+19/‑113) | tnaB → / → mdtL | tryptophan transporter of low affinity/multidrug efflux system protein |
RA | 3,891,504 | T→A | 17.4% | intergenic (+21/‑111) | tnaB → / → mdtL | tryptophan transporter of low affinity/multidrug efflux system protein |
RA | 3,891,506 | C→G | 17.3% | intergenic (+23/‑109) | tnaB → / → mdtL | tryptophan transporter of low affinity/multidrug efflux system protein |
RA | 3,903,585 | G→A | 80.9% | G39G (GGC→GGT) | bglB ← | cryptic phospho‑beta‑glucosidase B |
RA | 3,946,246 | G→A | 21.9% | noncoding (2543/2904 nt) | rrlC → | 23S ribosomal RNA of rrnC operon |
RA | 3,951,559:1 | +A | 100% | pseudogene (18/663 nt) | ilvG → | pseudogene, acetolactate synthase 2 large subunit, valine‑insensitive; acetolactate synthase II, large subunit, cryptic, interrupted |
RA | 4,022,007 | C→T | 17.9% | G21G (GGC→GGT) | tatA → | TatABCE protein translocation system subunit |
RA | 4,022,008 | A→G | 16.3% | T22A (ACC→GCC) | tatA → | TatABCE protein translocation system subunit |
RA | 4,051,259 | G→T | 15.3% | intergenic (‑494/‑88) | yihA ← / → yihI | cell division GTP‑binding protein/activator of Der GTPase |
RA | 4,110,719 | G→C | 15.2% | intergenic (+34/+21) | cdh → / ← tpiA | CDP‑diacylglycerol phosphotidylhydrolase/triosephosphate isomerase |
RA | 4,110,721 | A→T | 15.3% | intergenic (+36/+19) | cdh → / ← tpiA | CDP‑diacylglycerol phosphotidylhydrolase/triosephosphate isomerase |
RA | 4,128,197 | T→C | 100% | T67A (ACC→GCC) | metJ ← | transcriptional repressor, S‑adenosylmethionine‑binding |
RA | 4,130,005 | G→A | 15.1% | L57L (TTG→TTA) | metL → | Bifunctional aspartokinase/homoserine dehydrogenase 2 |
RA | 4,130,008 | T→C | 15.0% | I58I (ATT→ATC) | metL → | Bifunctional aspartokinase/homoserine dehydrogenase 2 |
RA | 4,214,649 | A→T | 81.5% | I124F (ATC→TTC) | metA → | homoserine O‑transsuccinylase |
RA | 4,223,854 | T→C | 18.9% | R9R (CGT→CGC) | metH → | homocysteine‑N5‑methyltetrahydrofolate transmethylase, B12‑dependent |
RA | 4,223,855 | G→A | 18.5% | A10T (GCG→ACG) | metH → | homocysteine‑N5‑methyltetrahydrofolate transmethylase, B12‑dependent |
RA | 4,227,560 | T→C | 16.4% | intergenic (+49/‑171) | metH → / → yjbB | homocysteine‑N5‑methyltetrahydrofolate transmethylase, B12‑dependent/putative Na+/Pi‑cotransporter |
RA | 4,243,370 | C→T | 81.1% | L49L (CTG→CTA) | malG ← | maltose transporter subunit |
RA | 4,261,349 | G→A | 15.5% | intergenic (+43/‑320) | yjbM → / → dusA | uncharacterized protein/tRNA‑dihydrouridine synthase A |
RA | 4,261,358 | T→A | 18.1% | intergenic (+52/‑311) | yjbM → / → dusA | uncharacterized protein/tRNA‑dihydrouridine synthase A |
RA | 4,261,359 | T→A | 18.0% | intergenic (+53/‑310) | yjbM → / → dusA | uncharacterized protein/tRNA‑dihydrouridine synthase A |
RA | 4,291,512 | G→A | 17.8% | M1M (GTG→ATG) †‡ | nrfE → | heme lyase (NrfEFG) for insertion of heme into c552, subunit NrfE |
RA | 4,291,513 | T→C | 18.2% | M1A (GTG→GCG) †‡ | nrfE → | heme lyase (NrfEFG) for insertion of heme into c552, subunit NrfE |
RA | 4,295,744 | G→A | 100% | A422T (GCT→ACT) | gltP → | glutamate/aspartate:proton symporter |
RA | 4,296,060 | C→T | 100% | intergenic (+266/+376) | gltP → / ← yjcO | glutamate/aspartate:proton symporter/Sel1 family TPR‑like repeat protein |
RA | 4,296,381:1 | +GC | 100% | intergenic (+587/+55) | gltP → / ← yjcO | glutamate/aspartate:proton symporter/Sel1 family TPR‑like repeat protein |
RA | 4,312,074 | C→T | 18.5% | intergenic (‑32/+27) | alsB ← / ← alsR | D‑allose ABC transporter periplasmic binding protein/d‑allose‑inducible als operon transcriptional repressor; autorepressor; repressor of rpiR |
RA | 4,312,080 | G→C | 19.4% | intergenic (‑38/+21) | alsB ← / ← alsR | D‑allose ABC transporter periplasmic binding protein/d‑allose‑inducible als operon transcriptional repressor; autorepressor; repressor of rpiR |
RA | 4,312,083 | G→C | 18.9% | intergenic (‑41/+18) | alsB ← / ← alsR | D‑allose ABC transporter periplasmic binding protein/d‑allose‑inducible als operon transcriptional repressor; autorepressor; repressor of rpiR |
RA | 4,312,089 | A→G | 19.6% | intergenic (‑47/+12) | alsB ← / ← alsR | D‑allose ABC transporter periplasmic binding protein/d‑allose‑inducible als operon transcriptional repressor; autorepressor; repressor of rpiR |
RA | 4,325,822 | G→A | 45.3% | intergenic (‑81/+577) | yjdN ← / ← yjdM | metalloprotein superfamily protein/zinc‑ribbon family protein |
RA | 4,326,047 | C→T | 80.5% | intergenic (‑306/+352) | yjdN ← / ← yjdM | metalloprotein superfamily protein/zinc‑ribbon family protein |
RA | 4,337,024 | G→A | 100% | S3L (TCG→TTG) | adiC ← | arginine:agmatine antiporter |
RA | 4,365,452 | G→T | 15.9% | intergenic (‑96/+20) | cutA ← / ← dcuA | divalent‑cation tolerance protein, copper sensitivity/C4‑dicarboxylate antiporter |
RA | 4,365,453 | A→C | 15.8% | intergenic (‑97/+19) | cutA ← / ← dcuA | divalent‑cation tolerance protein, copper sensitivity/C4‑dicarboxylate antiporter |
RA | 4,376,280 | G→A | 15.1% | intergenic (+15/‑37) | efp → / → ecnA | polyproline‑specific translation elongation factor EF‑P/entericidin A membrane lipoprotein, antidote entericidin B |
RA | 4,377,791 | A→T | 18.3% | intergenic (‑69/+20) | blc ← / ← ampC | outer membrane lipoprotein cell division and growth lipocalin/penicillin‑binding protein; beta‑lactamase, intrinsically weak |
RA | 4,377,792 | A→T | 18.4% | intergenic (‑70/+19) | blc ← / ← ampC | outer membrane lipoprotein cell division and growth lipocalin/penicillin‑binding protein; beta‑lactamase, intrinsically weak |
RA | 4,397,557 | G→T | 100% | G49V (GGT→GTT) | mutL → | methyl‑directed mismatch repair protein |
RA | 4,410,037 | T→C | 15.6% | intergenic (+31/‑96) | rlmB → / → yjfI | 23S rRNA mG2251 2'‑O‑ribose methyltransferase, SAM‑dependent/DUF2170 family protein |
RA | 4,410,053 | (T)9→8 | 100% | intergenic (+47/‑80) | rlmB → / → yjfI | 23S rRNA mG2251 2'‑O‑ribose methyltransferase, SAM‑dependent/DUF2170 family protein |
RA | 4,494,883:1 | (A)7→8 | 100% | coding (261/564 nt) | idnK → | D‑gluconate kinase, thermosensitive |
RA | 4,520,500 | Δ1 bp | 16.3% | intergenic (‑176/+171) | yjhU ← / ← yjhF | putative DNA‑binding transcriptional regulator; KpLE2 phage‑like element/putative transporter |
RA | 4,520,504:1 | +T | 16.7% | intergenic (‑180/+167) | yjhU ← / ← yjhF | putative DNA‑binding transcriptional regulator; KpLE2 phage‑like element/putative transporter |
RA | 4,549,932 | T→A | 17.5% | intergenic (+222/+21) | fimH → / ← gntP | minor component of type 1 fimbriae/fructuronate transporter |
RA | 4,551,608 | G→A | 100% | intergenic (‑312/‑28) | gntP ← / → uxuA | fructuronate transporter/mannonate hydrolase |
RA | 4,573,528 | A→G | 100% | pseudogene (1115/1503 nt) | yjiT → | pseudogene |
RA | 4,638,193:1 | (C)6→7 | 100% | coding (16/1353 nt) | creD → | inner membrane protein |
Unassigned missing coverage evidence | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
seq id | start | end | size | ←reads | reads→ | gene | description | |||
* | * | ÷ | NC_000913 | 3423823–3424601 | 3424601 | 1–779 | 84 [0] | [61] 63 | [rrlD] | [rrlD] |
Unassigned new junction evidence | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
* | ? | NC_000913 | 157667 = | 88 (0.850) | 14 (0.150) | 10/164 | NT | 15.6% | coding (66/480 nt) | folK | 2‑amino‑4‑hydroxy‑6‑hydroxymethyldihyropteridine pyrophosphokinase |
? | NC_000913 | 157709 = | 71 (0.740) | coding (24/480 nt) | folK | 2‑amino‑4‑hydroxy‑6‑hydroxymethyldihyropteridine pyrophosphokinase | |||||
* | ? | NC_000913 | 225154 = | NA (NA) | 34 (0.350) | 11/168 | NT | NA | noncoding (1384/1542 nt) | rrsH | 16S ribosomal RNA of rrnH operon |
? | NC_000913 | 225176 = | NA (NA) | noncoding (1406/1542 nt) | rrsH | 16S ribosomal RNA of rrnH operon | |||||
* | ? | NC_000913 | = 225998 | NA (NA) | 27 (0.270) | 12/170 | NT | NA | noncoding (240/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon |
? | NC_000913 | = 226015 | NA (NA) | noncoding (257/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon | |||||
* | ? | NC_000913 | 227034 = | NA (NA) | 58 (0.600) | 14/166 | NT | NA | noncoding (1276/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon |
? | NC_000913 | 227053 = | NA (NA) | noncoding (1295/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon | |||||
* | ? | NC_000913 | = 227444 | NA (NA) | 31 (0.320) | 12/168 | NT | NA | noncoding (1686/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon |
? | NC_000913 | = 227459 | NA (NA) | noncoding (1701/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon | |||||
* | ? | NC_000913 | 228016 = | NA (NA) | 45 (0.470) | 13/164 | NT | NA | noncoding (2258/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon |
? | NC_000913 | 228041 = | NA (NA) | noncoding (2283/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon | |||||
* | ? | NC_000913 | 228219 = | NA (NA) | 6 (0.060) | 4/166 | NT | NA | noncoding (2461/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon |
? | NC_000913 | 228248 = | NA (NA) | noncoding (2490/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon | |||||
* | ? | NC_000913 | = 228224 | NA (NA) | 15 (0.150) | 10/166 | NT | NA | noncoding (2466/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon |
? | NC_000913 | = 228241 | NA (NA) | noncoding (2483/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon | |||||
* | ? | NC_000913 | = 258602 | NA (NA) | 28 (0.290) | 12/168 | NT | NA | noncoding (74/768 nt) | IS1 | repeat region |
? | NC_000913 | = 279836 | NA (NA) | noncoding (95/768 nt) | IS1 | repeat region | |||||
* | ? | NC_000913 | 274347 = | NA (NA) | 17 (0.180) | 6/164 | NT | NA | noncoding (803/1195 nt) | IS5 | repeat region |
? | NC_000913 | 274410 = | NA (NA) | noncoding (740/1195 nt) | IS5 | repeat region | |||||
* | ? | NC_000913 | 274384 = | NA (NA) | 30 (0.300) | 9/172 | NT | NA | noncoding (766/1195 nt) | IS5 | repeat region |
? | NC_000913 | 274422 = | NA (NA) | noncoding (728/1195 nt) | IS5 | repeat region | |||||
* | ? | NC_000913 | 274620 = | NA (NA) | 15 (0.160) | 8/160 | NT | NA | noncoding (530/1195 nt) | IS5 | repeat region |
? | NC_000913 | 274663 = | NA (NA) | noncoding (487/1195 nt) | IS5 | repeat region | |||||
* | ? | NC_000913 | = 274695 | NA (NA) | 11 (0.110) | 7/170 | NT | NA | noncoding (455/1195 nt) | IS5 | repeat region |
? | NC_000913 | = 274727 | NA (NA) | noncoding (423/1195 nt) | IS5 | repeat region | |||||
* | ? | NC_000913 | 274965 = | NA (NA) | 19 (0.190) | 10/172 | NT | NA | noncoding (185/1195 nt) | IS5 | repeat region |
? | NC_000913 | 274991 = | NA (NA) | noncoding (159/1195 nt) | IS5 | repeat region | |||||
* | ? | NC_000913 | 294856 = | 102 (0.980) | 16 (0.170) | 9/160 | NT | 16.1% | intergenic (‑57/+283) | yagM/yagN | CP4‑6 prophage; uncharacterized protein/CP4‑6 prophage; uncharacterized protein |
? | NC_000913 | 294883 = | 75 (0.800) | intergenic (‑84/+256) | yagM/yagN | CP4‑6 prophage; uncharacterized protein/CP4‑6 prophage; uncharacterized protein | |||||
* | ? | NC_000913 | = 315646 | NA (NA) | 18 (0.180) | 9/168 | NT | NA | noncoding (418/1255 nt) | IS3 | repeat region |
? | NC_000913 | = 315665 | NA (NA) | noncoding (437/1255 nt) | IS3 | repeat region | |||||
* | ? | NC_000913 | 315892 = | NA (NA) | 10 (0.100) | 7/172 | NT | NA | noncoding (664/1255 nt) | IS3 | repeat region |
? | NC_000913 | 315923 = | NA (NA) | noncoding (695/1255 nt) | IS3 | repeat region | |||||
* | ? | NC_000913 | = 316201 | NA (NA) | 15 (0.160) | 7/160 | NT | NA | noncoding (973/1255 nt) | IS3 | repeat region |
? | NC_000913 | = 316220 | NA (NA) | noncoding (992/1255 nt) | IS3 | repeat region | |||||
* | ? | NC_000913 | 349605 = | NA (NA) | 10 (0.100) | 7/164 | NT | NA | noncoding (1/365 nt) | REP25 (repetitive extragenic palindromic) element; contains 8 REP sequences | REP25 (repetitive extragenic palindromic) element; contains 8 REP sequences |
? | NC_000913 | 349730 = | NA (NA) | noncoding (126/365 nt) | REP25 (repetitive extragenic palindromic) element; contains 8 REP sequences | REP25 (repetitive extragenic palindromic) element; contains 8 REP sequences | |||||
* | ? | NC_000913 | 377335 = | NA (NA) | 12 (0.130) | 5/164 | NT | NA | noncoding (1/187 nt) | REP32 (repetitive extragenic palindromic) element; contains 4 REP sequences | REP32 (repetitive extragenic palindromic) element; contains 4 REP sequences |
? | NC_000913 | 377368 = | NA (NA) | noncoding (34/187 nt) | REP32 (repetitive extragenic palindromic) element; contains 4 REP sequences | REP32 (repetitive extragenic palindromic) element; contains 4 REP sequences | |||||
* | ? | NC_000913 | 381663 = | NA (NA) | 19 (0.200) | 6/164 | NT | NA | noncoding (404/1331 nt) | IS2 | repeat region |
? | NC_000913 | 381703 = | NA (NA) | noncoding (444/1331 nt) | IS2 | repeat region | |||||
* | ? | NC_000913 | = 381669 | NA (NA) | 39 (0.410) | 11/164 | NT | NA | noncoding (410/1331 nt) | IS2 | repeat region |
? | NC_000913 | = 381695 | NA (NA) | noncoding (436/1331 nt) | IS2 | repeat region | |||||
* | ? | NC_000913 | = 381910 | NA (NA) | 26 (0.270) | 8/166 | NT | NA | noncoding (651/1331 nt) | IS2 | repeat region |
? | NC_000913 | = 381923 | NA (NA) | noncoding (664/1331 nt) | IS2 | repeat region | |||||
* | ? | NC_000913 | 382282 = | NA (NA) | 9 (0.090) | 7/166 | NT | NA | noncoding (1023/1331 nt) | IS2 | repeat region |
? | NC_000913 | 382313 = | NA (NA) | noncoding (1054/1331 nt) | IS2 | repeat region | |||||
* | ? | NC_000913 | 580753 = | 109 (1.050) | 19 (0.220) | 8/146 | NT | 20.4% | intergenic (‑308/‑81) | ylcI/nohD | DUF3950 family protein, DLP12 prophage/DLP12 prophage; DNA packaging protein |
? | NC_000913 | 580810 = | 59 (0.690) | intergenic (‑365/‑24) | ylcI/nohD | DUF3950 family protein, DLP12 prophage/DLP12 prophage; DNA packaging protein | |||||
* | ? | NC_000913 | 732857 = | NA (NA) | 19 (0.190) | 8/170 | NT | 22.4% | coding (3275/4194 nt) | rhsC | Rhs protein with putative toxin domain; putative neighboring cell growth inhibitor |
? | NC_000913 | 732888 = | 69 (0.660) | coding (3306/4194 nt) | rhsC | Rhs protein with putative toxin domain; putative neighboring cell growth inhibitor | |||||
* | ? | NC_000913 | 737205 = | 70 (0.670) | 13 (0.130) | 5/176 | NT | 15.8% | pseudogene (381/1137 nt) | ybfL | pseudogene, DDE domain transposase family;putative factor; Not classified; putative receptor protein |
? | NC_000913 | 1532171 = | NA (NA) | coding (356/1137 nt) | ydcC | H repeat‑associated putative transposase | |||||
* | ? | NC_000913 | = 737210 | 70 (0.670) | 17 (0.180) | 8/166 | NT | 19.9% | pseudogene (386/1137 nt) | ybfL | pseudogene, DDE domain transposase family;putative factor; Not classified; putative receptor protein |
? | NC_000913 | = 3624726 | 72 (0.740) | coding (349/1137 nt) | yhhI | putative transposase | |||||
* | ? | NC_000913 | 780398 = | 79 (0.760) | 15 (0.170) | 8/154 | NT | 16.3% | intergenic (+9/‑156) | ybgF/lysT | periplasmic TolA‑binding protein/tRNA‑Lys |
? | NC_000913 | 780432 = | 86 (0.960) | intergenic (+43/‑122) | ybgF/lysT | periplasmic TolA‑binding protein/tRNA‑Lys | |||||
* | ? | NC_000913 | = 884917 | 83 (0.800) | 17 (0.180) | 10/160 | NT | 17.3% | intergenic (+12/+29) | mdfA/ybjH | multidrug efflux system protein/uncharacterized protein |
? | NC_000913 | = 884930 | 88 (0.940) | intergenic (+25/+16) | mdfA/ybjH | multidrug efflux system protein/uncharacterized protein | |||||
* | ? | NC_000913 | = 1083403 | 85 (0.820) | 16 (0.170) | 13/162 | NT | 16.7% | coding (28/1272 nt) | efeB | deferrrochelatase, periplasmic |
? | NC_000913 | = 1083411 | 82 (0.870) | coding (36/1272 nt) | efeB | deferrrochelatase, periplasmic | |||||
* | ? | NC_000913 | 1165696 = | NA (NA) | 17 (0.190) | 8/156 | NT | NA | intergenic (+11/‑389) | ycfP/ndh | putative UPF0227 family esterase/respiratory NADH dehydrogenase 2/cupric reductase |
? | NC_000913 | 1165728 = | NA (NA) | intergenic (+43/‑357) | ycfP/ndh | putative UPF0227 family esterase/respiratory NADH dehydrogenase 2/cupric reductase | |||||
* | ? | NC_000913 | = 1269275 | NA (NA) | 23 (0.240) | 8/162 | NT | 22.3% | coding (1/108 nt) | ldrA | toxic polypeptide, small |
? | NC_000913 | = 1269313 | 88 (0.850) | intergenic (‑38/+390) | ldrA/ldrB | toxic polypeptide, small/toxic polypeptide, small | |||||
* | ? | NC_000913 | 1269306 = | 85 (0.820) | 16 (0.170) | 4/162 | NT | 20.6% | intergenic (‑31/+397) | ldrA/ldrB | toxic polypeptide, small/toxic polypeptide, small |
? | NC_000913 | 1270354 = | 46 (0.490) | intergenic (‑9/+395) | ldrC/chaA | toxic polypeptide, small/calcium/sodium:proton antiporter | |||||
* | ? | NC_000913 | = 1299498 | 0 (0.000) | 90 (0.910) | 63/170 | NT | 100% | intergenic (+253/‑1684) | ychE/oppA | UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein |
? | NC_000913 | 1300698 = | 0 (0.000) | intergenic (+1453/‑484) | ychE/oppA | UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein | |||||
* | ? | NC_000913 | = 1322981 | 76 (0.730) | 13 (0.140) | 12/164 | NT | 15.1% | intergenic (‑35/+57) | trpE/trpL | component I of anthranilate synthase/trp operon leader peptide |
? | NC_000913 | = 1322988 | 76 (0.790) | intergenic (‑42/+50) | trpE/trpL | component I of anthranilate synthase/trp operon leader peptide | |||||
* | ? | NC_000913 | 1396316 = | NA (NA) | 19 (0.200) | 9/164 | NT | 20.5% | noncoding (273/1195 nt) | IS5 | repeat region |
? | NC_000913 | = 1428549 | 80 (0.770) | noncoding (246/1196 nt) | IS5 | repeat region | |||||
* | ? | NC_000913 | = 1432784 | NA (NA) | 9 (0.090) | 8/168 | NT | NA | coding (374/576 nt) | tfaR | Rac prophage; putative tail fiber assembly protein |
? | NC_000913 | = 1432795 | NA (NA) | coding (385/576 nt) | tfaR | Rac prophage; putative tail fiber assembly protein | |||||
* | ? | NC_000913 | = 1434766 | 75 (0.720) | 15 (0.160) | 8/162 | NT | 16.2% | intergenic (‑542/+192) | ynaE/ttcC | cold shock protein, Rac prophage/pseudogene, prophage Rac integration site ttcA duplication;Phage or Prophage Related |
? | NC_000913 | 1632568 = | 87 (0.920) | intergenic (‑283/‑504) | ydfJ/ydfK | pseudogene, MFS transporter family; interrupted by Qin prophage;Phage or Prophage Related; putative transport protein/cold shock protein, function unknown, Qin prophage | |||||
* | ? | NC_000913 | 1691370 = | 81 (0.780) | 14 (0.160) | 8/154 | NT | 16.7% | intergenic (+10/+216) | ydgA/uidC | DUF945 family protein/putative outer membrane porin for beta‑glucuronides porin protein |
? | NC_000913 | 1691402 = | NA (NA) | intergenic (+42/+184) | ydgA/uidC | DUF945 family protein/putative outer membrane porin for beta‑glucuronides porin protein | |||||
* | ? | NC_000913 | = 1816343 | NA (NA) | 15 (0.150) | 9/172 | NT | NA | noncoding (159/189 nt) | RIP129 (repetitive extragenic palindromic) element; contains 3 REP sequences and 1 IHF site | RIP129 (repetitive extragenic palindromic) element; contains 3 REP sequences and 1 IHF site |
? | NC_000913 | = 1816373 | NA (NA) | noncoding (189/189 nt) | RIP129 (repetitive extragenic palindromic) element; contains 3 REP sequences and 1 IHF site | RIP129 (repetitive extragenic palindromic) element; contains 3 REP sequences and 1 IHF site | |||||
* | ? | NC_000913 | 1852545 = | NA (NA) | 14 (0.150) | 7/156 | NT | NA | intergenic (+17/+76) | pncA/ydjE | nicotinamidase/pyrazinamidase/putative MFS sugar transporter, membrane protein |
? | NC_000913 | 1852562 = | NA (NA) | noncoding (1/36 nt) | REP132 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP132 (repetitive extragenic palindromic) element; contains 1 REP sequences | |||||
* | ? | NC_000913 | = 2066832 | 0 (0.000) | 19 (0.200) | 10/160 | NT | 100% | noncoding (522/1195 nt) | IS5 | repeat region |
? | NC_000913 | = 2066857 | NA (NA) | noncoding (497/1195 nt) | IS5 | repeat region | |||||
* | ? | NC_000913 | = 2252869 | NA (NA) | 11 (0.120) | 7/164 | NT | NA | noncoding (74/91 nt) | RIP157 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | RIP157 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site |
? | NC_000913 | = 2252879 | NA (NA) | noncoding (84/91 nt) | RIP157 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | RIP157 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | |||||
* | ? | NC_000913 | = 2304816 | 104 (1.000) | 19 (0.200) | 9/164 | NT | 18.2% | noncoding (400/655 nt) | REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences | REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences |
? | NC_000913 | = 2304834 | 75 (0.780) | noncoding (418/655 nt) | REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences | REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences | |||||
* | ? | NC_000913 | = 2618037 | NA (NA) | 13 (0.130) | 10/166 | NT | NA | intergenic (+100/+38) | yfgD/hda | putative oxidoreductase/ATPase regulatory factor involved in DnaA inactivation |
? | NC_000913 | = 2618053 | NA (NA) | intergenic (+116/+22) | yfgD/hda | putative oxidoreductase/ATPase regulatory factor involved in DnaA inactivation | |||||
* | ? | NC_000913 | 2728214 = | NA (NA) | 41 (0.410) | 12/170 | NT | NA | noncoding (971/2904 nt) | rrlG | 23S ribosomal RNA of rrnG operon |
? | NC_000913 | 2728240 = | NA (NA) | noncoding (945/2904 nt) | rrlG | 23S ribosomal RNA of rrnG operon | |||||
* | ? | NC_000913 | = 2729452 | NA (NA) | 17 (0.180) | 7/158 | NT | NA | intergenic (‑8/+164) | gltW/rrsG | tRNA‑Glu/16S ribosomal RNA of rrnG operon |
? | NC_000913 | = 2729474 | NA (NA) | intergenic (‑30/+142) | gltW/rrsG | tRNA‑Glu/16S ribosomal RNA of rrnG operon | |||||
* | ? | NC_000913 | 2731304 = | 47 (0.450) | 21 (0.220) | 10/166 | NT | 32.4% | intergenic (‑147/+296) | rrsG/clpB | 16S ribosomal RNA of rrnG operon/protein disaggregation chaperone |
? | NC_000913 | = 4035360 | NA (NA) | intergenic (+207/‑171) | hemG/rrsA | protoporphyrin oxidase, flavoprotein/16S ribosomal RNA of rrnA operon | |||||
* | ? | NC_000913 | 2794028 = | NA (NA) | 12 (0.120) | 10/166 | NT | NA | noncoding (1/136 nt) | REP191 (repetitive extragenic palindromic) element; contains 3 REP sequences | REP191 (repetitive extragenic palindromic) element; contains 3 REP sequences |
? | NC_000913 | 2794059 = | NA (NA) | noncoding (32/136 nt) | REP191 (repetitive extragenic palindromic) element; contains 3 REP sequences | REP191 (repetitive extragenic palindromic) element; contains 3 REP sequences | |||||
* | ? | NC_000913 | 2796243 = | 109 (1.050) | 21 (0.230) | 10/160 | NT | 18.4% | coding (570/663 nt) | csiR | transcriptional repressor of csiD |
? | NC_000913 | 2796271 = | 89 (0.950) | coding (598/663 nt) | csiR | transcriptional repressor of csiD | |||||
* | ? | NC_000913 | 2888334 = | NA (NA) | 14 (0.150) | 8/164 | NT | NA | noncoding (1/37 nt) | REP200 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP200 (repetitive extragenic palindromic) element; contains 1 REP sequences |
? | NC_000913 | 2888367 = | NA (NA) | noncoding (34/37 nt) | REP200 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP200 (repetitive extragenic palindromic) element; contains 1 REP sequences | |||||
* | ? | NC_000913 | 3163644 = | NA (NA) | 16 (0.170) | 4/160 | NT | NA | noncoding (1/30 nt) | REP223 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP223 (repetitive extragenic palindromic) element; contains 1 REP sequences |
? | NC_000913 | 3163674 = | NA (NA) | intergenic (‑193/+41) | plsC/parC | 1‑acyl‑sn‑glycerol‑3‑phosphate acyltransferase/DNA topoisomerase IV, subunit A | |||||
* | ? | NC_000913 | 3214896 = | NA (NA) | 9 (0.090) | 7/168 | NT | NA | noncoding (5/33 nt) | REP227 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP227 (repetitive extragenic palindromic) element; contains 1 REP sequences |
? | NC_000913 | 3214925 = | NA (NA) | intergenic (+37/+42) | rpoD/mug | RNA polymerase, sigma 70 (sigma D) factor/G/U mismatch‑specific DNA glycosylase; xanthine DNA glycosylase | |||||
* | ? | NC_000913 | 3227693 = | 99 (0.950) | 15 (0.170) | 10/156 | NT | 15.3% | intergenic (+26/‑108) | ygjI/ygjJ | putative transporter/putative periplasmic protein |
? | NC_000913 | 3227727 = | 80 (0.880) | intergenic (+60/‑74) | ygjI/ygjJ | putative transporter/putative periplasmic protein | |||||
* | ? | NC_000913 | 3344992 = | 91 (0.880) | 13 (0.140) | 5/158 | NT | 15.1% | coding (276/1434 nt) | rpoN | RNA polymerase, sigma 54 (sigma N) factor |
? | NC_000913 | 3345024 = | 66 (0.720) | coding (308/1434 nt) | rpoN | RNA polymerase, sigma 54 (sigma N) factor | |||||
* | ? | NC_000913 | = 3423822 | 0 (0.000) | 48 (0.500) | 9/166 | NT | 100% | intergenic (‑35/+58) | rrfD/rrlD | 5S ribosomal RNA of rrnD operon/23S ribosomal RNA of rrnD operon |
? | NC_000913 | 4040506 = | NA (NA) | intergenic (+83/‑11) | rrlA/rrfA | 23S ribosomal RNA of rrnA operon/5S ribosomal RNA of rrnA operon | |||||
* | ? | NC_000913 | 3470277 = | NA (NA) | 24 (0.250) | 13/164 | NT | NA | coding (1053/1185 nt) | tufA | translation elongation factor EF‑Tu 1 |
? | NC_000913 | 3470311 = | NA (NA) | coding (1019/1185 nt) | tufA | translation elongation factor EF‑Tu 1 | |||||
* | ? | NC_000913 | 3620123 = | NA (NA) | 7 (0.070) | 6/166 | NT | 100% | coding (932/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor |
? | NC_000913 | 3620147 = | 0 (0.000) | coding (956/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor | |||||
* | ? | NC_000913 | = 3620220 | NA (NA) | 11 (0.110) | 7/166 | NT | 100% | coding (1029/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor |
? | NC_000913 | = 3620255 | 0 (0.000) | coding (1064/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor | |||||
* | ? | NC_000913 | 3620569 = | NA (NA) | 35 (0.360) | 9/166 | NT | 100% | coding (1378/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor |
? | NC_000913 | 3620582 = | 0 (0.000) | coding (1391/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor | |||||
* | ? | NC_000913 | = 3620614 | NA (NA) | 17 (0.180) | 6/166 | NT | 100% | coding (1423/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor |
? | NC_000913 | = 3620635 | 0 (0.000) | coding (1444/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor | |||||
* | ? | NC_000913 | = 3621534 | NA (NA) | 7 (0.070) | 4/162 | NT | 100% | coding (2343/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor |
? | NC_000913 | = 3621592 | 0 (0.000) | coding (2401/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor | |||||
* | ? | NC_000913 | 3910443 = | NA (NA) | 9 (0.090) | 9/168 | NT | NA | noncoding (1/35 nt) | REP284 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP284 (repetitive extragenic palindromic) element; contains 1 REP sequences |
? | NC_000913 | 3910474 = | NA (NA) | noncoding (32/35 nt) | REP284 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP284 (repetitive extragenic palindromic) element; contains 1 REP sequences | |||||
* | ? | NC_000913 | = 3944978 | NA (NA) | 54 (0.560) | 14/166 | NT | 65.1% | noncoding (1275/2904 nt) | rrlC | 23S ribosomal RNA of rrnC operon |
? | NC_000913 | = 4038811 | 31 (0.300) | noncoding (1293/2905 nt) | rrlA | 23S ribosomal RNA of rrnA operon | |||||
* | ? | NC_000913 | = 4040481 | NA (NA) | 67 (0.690) | 13/166 | NT | 100% | intergenic (+58/‑36) | rrlA/rrfA | 23S ribosomal RNA of rrnA operon/5S ribosomal RNA of rrnA operon |
? | NC_000913 | = 4040505 | 0 (0.000) | intergenic (+82/‑12) | rrlA/rrfA | 23S ribosomal RNA of rrnA operon/5S ribosomal RNA of rrnA operon | |||||
* | ? | NC_000913 | 4086854 = | 79 (0.760) | 14 (0.160) | 8/154 | NT | 17.2% | intergenic (+5/‑148) | fdhD/yiiG | formate dehydrogenase formation protein/DUF3829 family lipoprotein |
? | NC_000913 | 4086893 = | 67 (0.750) | intergenic (+44/‑109) | fdhD/yiiG | formate dehydrogenase formation protein/DUF3829 family lipoprotein | |||||
* | ? | NC_000913 | = 4171803 | 92 (0.890) | 24 (0.240) | 6/174 | NT | 21.1% | intergenic (+47/‑254) | rrfB/murB | 5S ribosomal RNA of rrnB operon/UDP‑N‑acetylenolpyruvoylglucosamine reductase, FAD‑binding |
? | NC_000913 | = 4213162 | NA (NA) | intergenic (+3/‑72) | rrfE/yjaA | 5S ribosomal RNA of rrnE operon/stress‑induced protein | |||||
* | ? | NC_000913 | 4295912 = | NA (NA) | 6 (0.060) | 4/164 | NT | NA | noncoding (78/600 nt) | RIP321 (repetitive extragenic palindromic) element; contains 11 REP sequences and 4 IHF sites | RIP321 (repetitive extragenic palindromic) element; contains 11 REP sequences and 4 IHF sites |
? | NC_000913 | 4295942 = | NA (NA) | noncoding (108/600 nt) | RIP321 (repetitive extragenic palindromic) element; contains 11 REP sequences and 4 IHF sites | RIP321 (repetitive extragenic palindromic) element; contains 11 REP sequences and 4 IHF sites | |||||
* | ? | NC_000913 | 4325805 = | NA (NA) | 82 (1.020) +TACAAATTCCCGCACCCTCC |
4/138 | NT | 52.5% | noncoding (4/583 nt) | REP325 (repetitive extragenic palindromic) element; contains 12 REP sequences | REP325 (repetitive extragenic palindromic) element; contains 12 REP sequences |
? | NC_000913 | = 4374531 | 96 (0.920) | noncoding (34/99 nt) | RIP329 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | RIP329 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | |||||
* | ? | NC_000913 | 4325861 = | 148 (1.420) | 201 (2.660) | 78/130 | NT | 69.8% | noncoding (60/583 nt) | REP325 (repetitive extragenic palindromic) element; contains 12 REP sequences | REP325 (repetitive extragenic palindromic) element; contains 12 REP sequences |
? | NC_000913 | = 4374507 | 66 (0.870) | noncoding (10/99 nt) | RIP329 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | RIP329 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | |||||
* | ? | NC_000913 | 4326031 = | 212 (2.040) | 70 (0.730) | 9/164 | NT | 26.7% | noncoding (230/583 nt) | REP325 (repetitive extragenic palindromic) element; contains 12 REP sequences | REP325 (repetitive extragenic palindromic) element; contains 12 REP sequences |
? | NC_000913 | 4326213 = | 189 (1.980) | noncoding (412/583 nt) | REP325 (repetitive extragenic palindromic) element; contains 12 REP sequences | REP325 (repetitive extragenic palindromic) element; contains 12 REP sequences | |||||
* | ? | NC_000913 | = 4326250 | NA (NA) | 25 (0.260) | 8/164 | NT | NA | noncoding (449/583 nt) | REP325 (repetitive extragenic palindromic) element; contains 12 REP sequences | REP325 (repetitive extragenic palindromic) element; contains 12 REP sequences |
? | NC_000913 | = 4326380 | NA (NA) | noncoding (579/583 nt) | REP325 (repetitive extragenic palindromic) element; contains 12 REP sequences | REP325 (repetitive extragenic palindromic) element; contains 12 REP sequences | |||||
* | ? | NC_000913 | = 4326350 | NA (NA) | 28 (0.290) | 9/164 | NT | NA | noncoding (549/583 nt) | REP325 (repetitive extragenic palindromic) element; contains 12 REP sequences | REP325 (repetitive extragenic palindromic) element; contains 12 REP sequences |
? | NC_000913 | = 4326380 | NA (NA) | noncoding (579/583 nt) | REP325 (repetitive extragenic palindromic) element; contains 12 REP sequences | REP325 (repetitive extragenic palindromic) element; contains 12 REP sequences | |||||
* | ? | NC_000913 | 4332016 = | NA (NA) | 15 (0.160) | 8/160 | NT | NA | noncoding (3/32 nt) | REP326 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP326 (repetitive extragenic palindromic) element; contains 1 REP sequences |
? | NC_000913 | 4332047 = | NA (NA) | intergenic (+43/‑69) | proP/pmrR | proline/glycine betaine transporter/putative membrane‑bound BasS regulator |