breseq  version 0.29.0  revision 8f9c342918e4
mutation predictions | marginal predictions | summary statistics | genome diff | command line log

Predicted mutations
evidence position mutation freq annotation gene description
RA 14,116 A→G 15.6% intergenic (+37/‑52) dnaK → / → dnaJ chaperone Hsp70, with co‑chaperone DnaJ/chaperone Hsp40, DnaK co‑chaperone
RA 14,119 G→A 15.9% intergenic (+40/‑49) dnaK → / → dnaJ chaperone Hsp70, with co‑chaperone DnaJ/chaperone Hsp40, DnaK co‑chaperone
RA 14,124 T→A 15.2% intergenic (+45/‑44) dnaK → / → dnaJ chaperone Hsp70, with co‑chaperone DnaJ/chaperone Hsp40, DnaK co‑chaperone
RA 87,881 A→G 18.0% intergenic (+33/‑147) ilvH → / → cra acetolactate synthase 3, small subunit, valine‑sensitive/transcriptional repressor‑activator for carbon metabolism
RA 87,884 T→A 17.4% intergenic (+36/‑144) ilvH → / → cra acetolactate synthase 3, small subunit, valine‑sensitive/transcriptional repressor‑activator for carbon metabolism
RA 87,887 C→T 17.3% intergenic (+39/‑141) ilvH → / → cra acetolactate synthase 3, small subunit, valine‑sensitive/transcriptional repressor‑activator for carbon metabolism
RA 107,553 (T)9→8 100% intergenic (+79/‑152) lpxC → / → secM UDP‑3‑O‑acyl N‑acetylglucosamine deacetylase/regulator of secA translation
RA 120,154 Δ1 bp 20.7% intergenic (+19/+24) ampE → / ← aroP ampicillin resistance inner membrane protein; putative signaling protein in beta‑lactamase regulation/aromatic amino acid transporter
RA 120,158:1 +A 20.8% intergenic (+23/+20) ampE → / ← aroP ampicillin resistance inner membrane protein; putative signaling protein in beta‑lactamase regulation/aromatic amino acid transporter
RA 151,519 A→C 22.2% I27M (ATT→ATG)  yadK ← putative fimbrial‑like adhesin protein
RA 151,522 G→T 21.7% A26A (GCC→GCA)  yadK ← putative fimbrial‑like adhesin protein
RA 217,030 C→T 19.0% intergenic (‑27/+27) yaeF ← / ← proS putative lipoprotein/prolyl‑tRNA synthetase
RA 217,037 A→T 20.1% intergenic (‑34/+20) yaeF ← / ← proS putative lipoprotein/prolyl‑tRNA synthetase
RA 217,044 A→G 21.2% intergenic (‑41/+13) yaeF ← / ← proS putative lipoprotein/prolyl‑tRNA synthetase
RA 220,849 (T)5→4 100% coding (80/816 nt) metQ ← DL‑methionine transporter subunit
RA 236,569 C→T 17.2% A168V (GCC→GTC)  dnaQ → DNA polymerase III epsilon subunit
RA 254,223 A→T 19.0% intergenic (+21/+36) prfH → / ← pepD pseudogene, RF‑1 domain family; probable peptide chain release factor/aminoacyl‑histidine dipeptidase (peptidase D)
RA 254,228 A→T 16.9% intergenic (+26/+31) prfH → / ← pepD pseudogene, RF‑1 domain family; probable peptide chain release factor/aminoacyl‑histidine dipeptidase (peptidase D)
RA 254,233 A→T 16.7% intergenic (+31/+26) prfH → / ← pepD pseudogene, RF‑1 domain family; probable peptide chain release factor/aminoacyl‑histidine dipeptidase (peptidase D)
RA 254,238 A→T 16.6% intergenic (+36/+21) prfH → / ← pepD pseudogene, RF‑1 domain family; probable peptide chain release factor/aminoacyl‑histidine dipeptidase (peptidase D)
RA 256,454 C→G 16.5% intergenic (+19/‑73) gpt → / → frsA xanthine phosphoribosyltransferase; xanthine‑guanine phosphoribosyltransferase/fermentation‑respiration switch protein; PTS Enzyme IIA(Glc)‑binding protein; pNP‑butyrate esterase activity
RA 256,459 G→A 16.4% intergenic (+24/‑68) gpt → / → frsA xanthine phosphoribosyltransferase; xanthine‑guanine phosphoribosyltransferase/fermentation‑respiration switch protein; PTS Enzyme IIA(Glc)‑binding protein; pNP‑butyrate esterase activity
MC JC 257,908 Δ776 bp 100% [crl] [crl]
RA 317,566 G→A 20.8% pseudogene (128/129 nt) ykgQ → pseudogene, putative dehydrogenase
RA 317,571 T→C 18.2% intergenic (+4/+155) ykgQ → / ← rclC pseudogene, putative dehydrogenase/reactive chlorine species (RCS) stress resistance inner membrane protein
RA 349,717 T→C 69.6% intergenic (+145/‑295) prpB → / → prpC 2‑methylisocitrate lyase/2‑methylcitrate synthase
RA 379,603 C→T 84.9% intergenic (‑32/+3) frmA ← / ← frmR alcohol dehydrogenase class III; glutathione‑dependent formaldehyde dehydrogenase/regulator protein that represses frmRAB operon
JC 380,020 (G)10→7 100% intergenic (‑139/+47) frmR ← / ← yaiO regulator protein that represses frmRAB operon/outer membrane protein
RA 380,022:1 (G)10→11 100% intergenic (‑141/+47) frmR ← / ← yaiO regulator protein that represses frmRAB operon/outer membrane protein
RA 383,897 C→T 15.5% M13I (ATG→ATA) ‡ yaiP ← putative family 2 glycosyltransferase
RA 383,898 A→G 15.5% M13T (ATG→ACG) ‡ yaiP ← putative family 2 glycosyltransferase
RA 410,479 A→G 100% S112S (TCA→TCG)  mak → manno(fructo)kinase
RA 452,478 C→T 100% L356L (CTG→CTA)  ampG ← muropeptide transporter
RA 454,853 T→C 17.2% intergenic (+64/‑280) bolA → / → tig stationary‑phase morphogene, transcriptional repressor for mreB; also regulator for dacA, dacC, and ampC/peptidyl‑prolyl cis/trans isomerase (trigger factor)
RA 454,856 G→A 16.9% intergenic (+67/‑277) bolA → / → tig stationary‑phase morphogene, transcriptional repressor for mreB; also regulator for dacA, dacC, and ampC/peptidyl‑prolyl cis/trans isomerase (trigger factor)
RA 459,440 G→A 79.0% E185K (GAG→AAG)  lon → DNA‑binding ATP‑dependent protease La
RA 478,750 C→T 16.5% intergenic (‑133/+31) ylaB ← / ← ylaC putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase/DUF1449 family inner membrane protein
RA 478,757 T→C 16.2% intergenic (‑140/+24) ylaB ← / ← ylaC putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase/DUF1449 family inner membrane protein
RA 478,759 A→G 15.9% intergenic (‑142/+22) ylaB ← / ← ylaC putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase/DUF1449 family inner membrane protein
RA 518,860 A→G 16.1% F97S (TTC→TCC)  ybbO ← putative oxidoreductase
RA 518,863 C→T 17.1% G96E (GGA→GAA)  ybbO ← putative oxidoreductase
RA 569,160 G→T 17.1% D87Y (GAC→TAC) ‡ ybcK → DLP12 prophage; putative recombinase
RA 569,161 A→C 15.8% D87A (GAC→GCC) ‡ ybcK → DLP12 prophage; putative recombinase
RA 605,022 C→G 15.8% D135H (GAT→CAT)  nfsB ← dihydropteridine reductase, NAD(P)H‑dependent, oxygen‑insensitive
RA 605,025 C→G 15.9% D134H (GAT→CAT)  nfsB ← dihydropteridine reductase, NAD(P)H‑dependent, oxygen‑insensitive
RA 654,560 A→C 16.7% intergenic (+18/+23) citB → / ← dcuC response regulator in two‑component regulatory system with CitA/anaerobic C4‑dicarboxylate transport
RA 654,563 C→G 16.2% intergenic (+21/+20) citB → / ← dcuC response regulator in two‑component regulatory system with CitA/anaerobic C4‑dicarboxylate transport
RA 654,566 G→T 16.4% intergenic (+24/+17) citB → / ← dcuC response regulator in two‑component regulatory system with CitA/anaerobic C4‑dicarboxylate transport
RA 740,004 G→A 84.3% M166I (ATG→ATA)  phr → deoxyribodipyrimidine photolyase, FAD‑binding
RA 781,818:1 (A)6→7 100% intergenic (+166/‑267) lysQ → / → nadA tRNA‑Lys/quinolinate synthase, subunit A
RA 801,861 G→C 16.1% intergenic (+50/‑26) ybhH → / → ybhI putative PrpF family isomerase/putative DASS family tricarboxylate or dicarboxylate transporter
RA 844,513 T→A 44.1% Q323L (CAG→CTG)  ybiO ← mechanosensitive channel protein, intermediate conductance
RA 940,751 T→C 15.5% intergenic (+31/‑208) serS → / → dmsA seryl‑tRNA synthetase/dimethyl sulfoxide reductase, anaerobic, subunit A
RA 940,754 G→A 15.9% intergenic (+34/‑205) serS → / → dmsA seryl‑tRNA synthetase/dimethyl sulfoxide reductase, anaerobic, subunit A
RA 949,741 Δ1 bp 17.2% coding (74/591 nt) ycaK → putative NAD(P)H‑dependent oxidoreductase
RA 949,745:1 +G 16.7% coding (78/591 nt) ycaK → putative NAD(P)H‑dependent oxidoreductase
RA 953,802 A→G 100% V222A (GTA→GCA)  focA ← formate channel
RA 987,560 G→C 18.1% intergenic (‑578/+25) ompF ← / ← asnS outer membrane porin 1a (Ia;b;F)/asparaginyl tRNA synthetase
RA 987,561 G→C 17.8% intergenic (‑579/+24) ompF ← / ← asnS outer membrane porin 1a (Ia;b;F)/asparaginyl tRNA synthetase
RA 1,015,912 T→A 15.5% intergenic (+30/+40) rmf → / ← fabA ribosome modulation factor/beta‑hydroxydecanoyl thioester dehydrase
RA 1,143,641 G→A 100% H243Y (CAT→TAT)  rne ← endoribonuclease; RNA‑binding protein;RNA degradosome binding protein
RA 1,156,112 T→C 100% A117A (GCT→GCC)  holB → DNA polymerase III, delta prime subunit
RA 1,159,335 G→T 15.5% intergenic (+33/+27) ptsG → / ← fhuE fused glucose‑specific PTS enzymes: IIB component/IIC component/ferric‑rhodotorulic acid outer membrane transporter
RA 1,196,408 A→T 15.4% intergenic (+35/+459) icd → / ← ymfD isocitrate dehydrogenase; e14 prophage attachment site; tellurite reductase/e14 prophage; putative SAM‑dependent methyltransferase
RA 1,224,239 A→T 15.7% intergenic (+332/+40) ycgI → / ← minE pseudogene/cell division topological specificity factor
RA 1,224,242 A→T 15.5% intergenic (+335/+37) ycgI → / ← minE pseudogene/cell division topological specificity factor
RA 1,232,481 C→T 22.5% intergenic (+27/+19) umuC → / ← dsbB translesion error‑prone DNA polymerase V subunit; DNA polymerase activity/oxidoreductase that catalyzes reoxidation of DsbA protein disulfide isomerase I
RA 1,232,484 A→G 22.4% intergenic (+30/+16) umuC → / ← dsbB translesion error‑prone DNA polymerase V subunit; DNA polymerase activity/oxidoreductase that catalyzes reoxidation of DsbA protein disulfide isomerase I
RA 1,233,154 T→A 15.5% intergenic (‑124/+22) dsbB ← / ← nhaB oxidoreductase that catalyzes reoxidation of DsbA protein disulfide isomerase I/sodium:proton antiporter
RA 1,246,073 C→T 100% G435D (GGC→GAC)  treA ← periplasmic trehalase
RA 1,327,213 C→T 16.4% T121I (ACC→ATC)  rluB → 23S rRNA pseudouridine(2605) synthase
RA 1,388,283 C→T 15.1% intergenic (+22/+22) tyrR → / ← tpx aromatic amino acid biosynthesis and transport regulon transcriptional regulator; autorepressor; ATPase; phosphatase/lipid hydroperoxide peroxidase
RA 1,428,391 G→C 15.7% L112L (CTC→CTG)  insH1 ← IS5 transposase and trans‑activator
RA 1,441,833 G→C 15.8% intergenic (‑90/+21) hslJ ← / ← ldhA heat‑inducible lipoprotein involved in novobiocin resistance/fermentative D‑lactate dehydrogenase, NAD‑dependent
RA 1,441,835 A→T 15.6% intergenic (‑92/+19) hslJ ← / ← ldhA heat‑inducible lipoprotein involved in novobiocin resistance/fermentative D‑lactate dehydrogenase, NAD‑dependent
RA 1,441,837 G→C 16.6% intergenic (‑94/+17) hslJ ← / ← ldhA heat‑inducible lipoprotein involved in novobiocin resistance/fermentative D‑lactate dehydrogenase, NAD‑dependent
RA 1,446,357:1 +T 24.5% intergenic (+151/+21) ydbL → / ← feaR DUF1318 family protein/transcriptional activator for tynA and feaB
RA 1,446,362 Δ1 bp 23.6% intergenic (+156/+16) ydbL → / ← feaR DUF1318 family protein/transcriptional activator for tynA and feaB
RA 1,489,197 C→T 100% D322D (GAC→GAT)  aldA → aldehyde dehydrogenase A, NAD‑linked
RA 1,597,313:1 (C)7→8 100% pseudogene (675/3861 nt) yneO ← pseudogene, AidA homolog
RA 1,650,147 G→A 15.2% pseudogene (70/765 nt) ydfE → Qin prophage; pseudogene;Phage or Prophage Related
RA 1,650,148 T→C 15.5% pseudogene (71/765 nt) ydfE → Qin prophage; pseudogene;Phage or Prophage Related
RA 1,657,898 A→T 15.8% intergenic (+28/‑171) ynfD → / → ynfE DUF1161 family periplasmic protein/putative selenate reductase, periplasmic
RA 1,657,901 A→T 15.5% intergenic (+31/‑168) ynfD → / → ynfE DUF1161 family periplasmic protein/putative selenate reductase, periplasmic
RA 1,666,466 T→G 23.8% Y384* (TAT→TAG)  clcB → H(+)/Cl(‑) exchange transporter
RA 1,666,468 A→T 23.5% Q385L (CAG→CTG)  clcB → H(+)/Cl(‑) exchange transporter
RA 1,666,470 C→A 23.2% L386I (CTA→ATA)  clcB → H(+)/Cl(‑) exchange transporter
RA 1,701,108 A→T 15.9% N51I (AAT→ATT)  malY → PLP‑dependent beta‑cystathionase and maltose regulon regulator
RA 1,755,639 G→A 100% intergenic (‑498/‑59) ydhZ ← / → pykF uncharacterized protein/pyruvate kinase I
RA 1,764,687 T→C 20.8% intergenic (‑301/+247) sufA ← / ← ydiH Fe‑S cluster assembly protein/uncharacterized protein
RA 1,764,701 G→A 18.2% intergenic (‑315/+233) sufA ← / ← ydiH Fe‑S cluster assembly protein/uncharacterized protein
RA 1,810,065 T→G 15.3% intergenic (+17/‑146) yniC → / → ydjM 2‑deoxyglucose‑6‑P phosphatase/inner membrane protein regulated by LexA
RA 1,810,066 C→A 15.2% intergenic (+18/‑145) yniC → / → ydjM 2‑deoxyglucose‑6‑P phosphatase/inner membrane protein regulated by LexA
RA 1,850,715 Δ1 bp 17.3% intergenic (+22/‑145) sppA → / → ansA protease IV (signal peptide peptidase)/cytoplasmic L‑asparaginase 1
RA 1,850,719:1 +T 16.7% intergenic (+26/‑141) sppA → / → ansA protease IV (signal peptide peptidase)/cytoplasmic L‑asparaginase 1
RA 1,861,419 A→G 19.8% intergenic (‑87/+283) ydjL ← / ← yeaC putative Zn‑dependent NAD(P)‑binding oxidoreductase/DUF1315 family protein
RA 1,861,425 A→C 19.3% intergenic (‑93/+277) ydjL ← / ← yeaC putative Zn‑dependent NAD(P)‑binding oxidoreductase/DUF1315 family protein
RA 1,861,428 G→T 17.9% intergenic (‑96/+274) ydjL ← / ← yeaC putative Zn‑dependent NAD(P)‑binding oxidoreductase/DUF1315 family protein
RA 1,861,434 C→T 19.4% intergenic (‑102/+268) ydjL ← / ← yeaC putative Zn‑dependent NAD(P)‑binding oxidoreductase/DUF1315 family protein
RA 1,868,250 A→G 100% Y448C (TAC→TGC)  yeaG → protein kinase, endogenous substrate unidentified; autokinase
RA 1,868,859 Δ1 bp 16.7% intergenic (+17/‑96) yeaG → / → yeaH protein kinase, endogenous substrate unidentified; autokinase/UPF0229 family protein
RA 1,868,865:1 +G 15.6% intergenic (+23/‑90) yeaG → / → yeaH protein kinase, endogenous substrate unidentified; autokinase/UPF0229 family protein
RA 1,883,027 C→G 19.4% intergenic (+30/‑161) dmlA → / → yeaV D‑malate oxidase, NAD‑dependent; putative tartrate dehydrogenase/putative transporter
RA 1,932,094 C→G 21.3% intergenic (+35/+21) purT → / ← eda phosphoribosylglycinamide formyltransferase 2/KHG/KDPG aldolase; 2‑dehydro‑3‑deoxy‑phosphogluconate/4‑hydroxy‑2‑ oxoglutarate aldolase
RA 1,932,095 T→A 20.1% intergenic (+36/+20) purT → / ← eda phosphoribosylglycinamide formyltransferase 2/KHG/KDPG aldolase; 2‑dehydro‑3‑deoxy‑phosphogluconate/4‑hydroxy‑2‑ oxoglutarate aldolase
RA 1,932,096 C→G 19.7% intergenic (+37/+19) purT → / ← eda phosphoribosylglycinamide formyltransferase 2/KHG/KDPG aldolase; 2‑dehydro‑3‑deoxy‑phosphogluconate/4‑hydroxy‑2‑ oxoglutarate aldolase
RA 1,945,839 G→A 100% I46I (ATC→ATT)  ruvA ← component of RuvABC resolvasome, regulatory subunit
RA 1,950,955 Δ1 bp 16.8% coding (124/567 nt) yecD → isochorismatase family protein
RA 1,950,966:1 +C 15.8% coding (135/567 nt) yecD → isochorismatase family protein
MC JC 1,978,503 Δ776 bp 100% insB1–insA insB1, insA
JC JC 1,979,486 IS5 (+) +4 bp 100% intergenic (‑271/‑264) insA ← / → uspC IS1 repressor TnpA/universal stress protein
RA 1,985,112 C→G 16.0% intergenic (‑43/+27) araG ← / ← araF L‑arabinose ABC transporter ATPase/L‑arabinose ABC transporter periplasmic binding protein
RA 2,018,260 (A)8→7 100% coding (315/444 nt) fliJ → flagellar protein
RA 2,028,158 G→C 16.9% intergenic (‑141/+30) yedQ ← / ← yodC putative membrane‑anchored diguanylate cyclase/uncharacterized protein
RA 2,028,159 T→A 16.9% intergenic (‑142/+29) yedQ ← / ← yodC putative membrane‑anchored diguanylate cyclase/uncharacterized protein
RA 2,028,160 G→C 16.7% intergenic (‑143/+28) yedQ ← / ← yodC putative membrane‑anchored diguanylate cyclase/uncharacterized protein
RA 2,032,336 G→C 20.8% intergenic (‑19/+48) dcm ← / ← yedJ DNA cytosine methyltransferase/putative HD superfamily phosphohydrolase
RA 2,079,004 G→C 15.4% intergenic (+73/+28) yoeF → / ← yeeX pseudogene, CP4‑44 putative prophage remnant;Phage or Prophage Related/UPF0265 family protein
RA 2,089,854 A→T 16.2% intergenic (‑141/‑142) yefM ← / → hisL antitoxin of the YoeB‑YefM toxin‑antitoxin system/his operon leader peptide
RA 2,143,720 C→G 15.7% P152R (CCT→CGT)  yegE → putative diguanylate cyclase
RA 2,143,725 A→C 15.3% R154R (AGG→CGG)  yegE → putative diguanylate cyclase
RA 2,173,363 Δ2 bp 100% intergenic (‑1/+1) gatC ← / ← gatC pseudogene, galactitol‑specific enzyme IIC component of PTS;transport; Transport of small molecules: Carbohydrates, organic acids, alcohols; PTS system galactitol‑specific enzyme IIC/pseudogene, galactitol‑specific enzyme IIC component of PTS;transport; Transport of small molecules: Carbohydrates, organic acids, alcohols; PTS system galactitol‑specific enzyme IIC
RA 2,187,314 C→G 17.0% intergenic (+16/+66) rcnB → / ← yehA periplasmic modulator of Ni and Co efflux/putative fimbrial‑like adhesin protein
RA 2,202,110 T→C 81.5% F611S (TTT→TCT)  yehI → DUF4132 domain‑containing protein
RA 2,286,311 C→G 19.8% intergenic (+24/+79) proL → / ← yejO tRNA‑Pro/pseudogene, autotransporter outer membrane homology;putative transport; Not classified; putative ATP‑binding component of a transport system
RA 2,286,313 T→A 18.8% intergenic (+26/+77) proL → / ← yejO tRNA‑Pro/pseudogene, autotransporter outer membrane homology;putative transport; Not classified; putative ATP‑binding component of a transport system
RA 2,286,315 C→G 18.0% intergenic (+28/+75) proL → / ← yejO tRNA‑Pro/pseudogene, autotransporter outer membrane homology;putative transport; Not classified; putative ATP‑binding component of a transport system
RA 2,304,221 C→T 100% A106V (GCC→GTC)  eco → ecotin, a serine protease inhibitor
RA 2,304,649 C→T 16.6% intergenic (+256/+459) eco → / ← mqo ecotin, a serine protease inhibitor/malate dehydrogenase, FAD/NAD(P)‑binding domain
RA 2,314,800 A→C 17.4% Q438P (CAG→CCG) ‡ rcsD → phosphotransfer intermediate protein in two‑component regulatory system with RcsBC
RA 2,314,801 G→T 17.3% Q438H (CAG→CAT) ‡ rcsD → phosphotransfer intermediate protein in two‑component regulatory system with RcsBC
RA 2,391,414 C→G 18.1% R31P (CGA→CCA)  nuoN ← NADH:ubiquinone oxidoreductase, membrane subunit N
RA 2,391,417 C→G 18.2% W30S (TGG→TCG)  nuoN ← NADH:ubiquinone oxidoreductase, membrane subunit N
RA 2,405,941 C→G 15.3% G234A (GGC→GCC)  lrhA ← transcriptional repressor of flagellar, motility and chemotaxis genes
RA 2,405,946 A→G 15.0% G232G (GGT→GGC)  lrhA ← transcriptional repressor of flagellar, motility and chemotaxis genes
RA 2,470,410 (T)7→6 100% coding (1280/1332 nt) gtrS → serotype‑specific glucosyl transferase, CPS‑53 (KpLE1) prophage
RA 2,474,878 T→C 17.1% intergenic (+22/‑106) yfdQ → / → yfdR CPS‑53 (KpLE1) prophage; uncharacterized protein/CPS‑53 (KpLE1) prophage; conserved protein
RA 2,474,881 G→A 19.2% intergenic (+25/‑103) yfdQ → / → yfdR CPS‑53 (KpLE1) prophage; uncharacterized protein/CPS‑53 (KpLE1) prophage; conserved protein
RA 2,516,689 T→C 100% T382A (ACG→GCG)  yfeA ← putative diguanylate cyclase
RA 2,589,122 G→A 15.6% G510S (GGC→AGC)  acrD → aminoglycoside/multidrug efflux system
RA 2,589,125 T→C 17.2% F511L (TTT→CTT)  acrD → aminoglycoside/multidrug efflux system
RA 2,596,874 Δ1 bp 16.1% intergenic (‑137/+31) ypfJ ← / ← purC putative neutral zinc metallopeptidase/phosphoribosylaminoimidazole‑succinocarboxamide synthetase
RA 2,596,879:1 +G 16.1% intergenic (‑142/+26) ypfJ ← / ← purC putative neutral zinc metallopeptidase/phosphoribosylaminoimidazole‑succinocarboxamide synthetase
RA 2,652,855:1 (G)6→7 100% coding (362/846 nt) sseA → 3‑mercaptopyruvate sulfurtransferase
RA 2,653,367 G→A 17.0% intergenic (+28/+790) sseA → / ← sseB 3‑mercaptopyruvate sulfurtransferase/rhodanase‑like enzyme, sulfur transfer from thiosulfate
RA 2,663,466 G→T 15.6% V9L (GTG→TTG)  suhB → inositol monophosphatase
RA 2,663,474 A→T 15.4% A11A (GCA→GCT)  suhB → inositol monophosphatase
RA 2,679,430 Δ1 bp 23.7% intergenic (‑63/+34) yphF ← / ← yphG putative sugar ABC transporter periplasmic binding protein/DUF4380 domain‑containing TPR repeat protein
RA 2,679,434:1 +C 23.9% intergenic (‑67/+30) yphF ← / ← yphG putative sugar ABC transporter periplasmic binding protein/DUF4380 domain‑containing TPR repeat protein
RA 2,731,312 G→A 70.1% intergenic (‑155/+288) rrsG ← / ← clpB 16S ribosomal RNA of rrnG operon/protein disaggregation chaperone
RA 2,732,147 A→T 16.3% L676Q (CTG→CAG)  clpB ← protein disaggregation chaperone
RA 2,732,150 A→T 16.7% L675Q (CTG→CAG)  clpB ← protein disaggregation chaperone
RA 2,736,911 C→T 15.1% intergenic (+28/‑243) bamD → / → raiA BamABCDE complex OM biogenesis lipoprotein/cold shock protein associated with 30S ribosomal subunit
RA 2,790,586 T→C 100% L202P (CTG→CCG)  lhgO → L‑2‑hydroxyglutarate oxidase
RA 2,809,774:1 (T)7→8 100% coding (158/738 nt) ygaZ → putative L‑valine exporter, norvaline resistance protein
RA 2,810,872 C→T 21.2% H35Y (CAC→TAC) ‡ mprA → transcriptional repressor of microcin B17 synthesis and multidrug efflux
RA 2,810,873 A→G 19.5% H35R (CAC→CGC) ‡ mprA → transcriptional repressor of microcin B17 synthesis and multidrug efflux
RA 2,814,174 T→A 21.5% intergenic (+20/+44) emrB → / ← luxS multidrug efflux system protein/S‑ribosylhomocysteine lyase
RA 2,814,175 T→A 20.6% intergenic (+21/+43) emrB → / ← luxS multidrug efflux system protein/S‑ribosylhomocysteine lyase
RA 2,838,222 A→T 17.8% intergenic (‑117/+32) hydN ← / ← ascG formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit/asc operon transcriptional repressor; prpBC operon repressor
RA 2,838,231 A→T 17.0% intergenic (‑126/+23) hydN ← / ← ascG formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit/asc operon transcriptional repressor; prpBC operon repressor
RA 2,856,887 C→T 81.4% intergenic (‑81/‑206) ygbA ← / → mutS uncharacterized protein/methyl‑directed mismatch repair protein
RA 2,866,592:1 +C 100% coding (960/993 nt) rpoS ← RNA polymerase, sigma S (sigma 38) factor
RA 2,890,521 G→A 52.7% P460S (CCA→TCA)  cysJ ← sulfite reductase, alpha subunit, flavoprotein
RA 2,900,327 A→C 15.0% intergenic (‑54/‑265) ygcW ← / → yqcE putative SDR family oxidoreductase/putative MFS transporter, inner membrane protein
RA 2,933,398 A→T 15.4% H97Q (CAT→CAA)  fucA ← L‑fuculose‑1‑phosphate aldolase
RA 2,933,401 A→C 15.3% V96V (GTT→GTG)  fucA ← L‑fuculose‑1‑phosphate aldolase
RA 2,967,887 G→A 100% A183V (GCC→GTC)  ptsP ← PEP‑protein phosphotransferase enzyme I; GAF domain containing protein
RA 2,993,889 T→A 15.2% intergenic (+33/‑50) ygeI → / → pbl uncharacterized protein/pseudogene, peptidoglycan‑binding enzyme family
RA 3,001,304:1 (G)7→8 100% coding (960/2259 nt) xdhA → xanthine dehydrogenase, molybdenum binding subunit
RA 3,007,187 A→T 84.7% D309V (GAC→GTC)  ygeW → putative carbamoyltransferase
RA 3,008,075 A→G 100% D189G (GAC→GGC)  ygeX → 2,3‑diaminopropionate ammonia lyase, PLP‑dependent
RA 3,037,957 G→T 15.1% P50P (CCC→CCA)  recJ ← ssDNA exonuclease, 5' ‑‑> 3'‑specific
RA 3,057,140 A→G 16.2% intergenic (‑191/+38) ibsC ← / ← serA toxic membrane protein/D‑3‑phosphoglycerate dehydrogenase
RA 3,057,145 G→C 15.8% intergenic (‑196/+33) ibsC ← / ← serA toxic membrane protein/D‑3‑phosphoglycerate dehydrogenase
RA 3,057,150 C→T 15.3% intergenic (‑201/+28) ibsC ← / ← serA toxic membrane protein/D‑3‑phosphoglycerate dehydrogenase
RA 3,066,319 Δ1 bp 16.1% coding (855/897 nt) ygfI ← putative DNA‑binding transcriptional regulator
RA 3,068,922 G→T 17.1% intergenic (‑114/+25) argO ← / ← mscS arginine transporter/mechanosensitive channel protein, small conductance
RA 3,068,924 G→A 17.6% intergenic (‑116/+23) argO ← / ← mscS arginine transporter/mechanosensitive channel protein, small conductance
RA 3,068,927 T→C 17.7% intergenic (‑119/+20) argO ← / ← mscS arginine transporter/mechanosensitive channel protein, small conductance
RA 3,068,929 A→C 17.0% intergenic (‑121/+18) argO ← / ← mscS arginine transporter/mechanosensitive channel protein, small conductance
RA 3,111,961 T→C 15.2% pseudogene (130/963 nt) yghE ← pseudogene, secretion pathway protein, L‑type protein homology; putative general secretion pathway for protein export (GSP)
RA 3,111,962 G→A 15.1% pseudogene (129/963 nt) yghE ← pseudogene, secretion pathway protein, L‑type protein homology; putative general secretion pathway for protein export (GSP)
RA 3,183,345:1 +T 18.8% intergenic (+22/+468) zupT → / ← ribB zinc transporter/3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase
RA 3,183,350 Δ1 bp 17.1% intergenic (+27/+463) zupT → / ← ribB zinc transporter/3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase
RA 3,194,516 A→G 100% K551K (AAA→AAG)  yqiK → PHB family membrane protein, function unknown
RA 3,247,812 C→T 35.9% Q14* (CAG→TAG)  yqjA → general envelope maintenance protein; DedA family inner membrane protein; putative multidrug efflux transporter
RA 3,249,628 G→A 100% G85D (GGC→GAC)  yqjD → membrane‑anchored ribosome‑binding protein
RA 3,288,032 C→A 16.5% intergenic (+22/‑58) yraH → / → yraI putative fimbrial‑like adhesin protein/putative periplasmic pilin chaperone
RA 3,288,033 T→G 15.7% intergenic (+23/‑57) yraH → / → yraI putative fimbrial‑like adhesin protein/putative periplasmic pilin chaperone
RA 3,298,809 A→G 82.7% V13A (GTG→GCG)  yraR ← putative nucleoside‑diphosphate‑sugar epimerase
RA 3,331,979 T→C 16.1% T253A (ACG→GCG)  yhbE ← EamA family inner membrane putative transporter
RA 3,331,983 G→C 17.2% I251M (ATC→ATG)  yhbE ← EamA family inner membrane putative transporter
RA 3,331,987 G→A 16.4% A250V (GCG→GTG)  yhbE ← EamA family inner membrane putative transporter
RA 3,352,673 T→C 100% E118G (GAA→GGA)  arcB ← aerobic respiration control sensor histidine protein kinase, cognate to two‑component response regulators ArcA and RssB
RA 3,379,266:1 (C)7→8 100% coding (732/1128 nt) zapE ← divisome ATPase
RA 3,395,910 T→C 38.6% T117A (ACC→GCC)  yhdP ← DUF3971‑AsmA2 domains protein
RA 3,407,293 T→A 18.3% intergenic (+27/‑82) accC → / → yhdT acetyl‑CoA carboxylase, biotin carboxylase subunit/DUF997 family putative inner membrane protein
RA 3,407,294 T→A 17.0% intergenic (+28/‑81) accC → / → yhdT acetyl‑CoA carboxylase, biotin carboxylase subunit/DUF997 family putative inner membrane protein
RA 3,407,295 T→A 17.4% intergenic (+29/‑80) accC → / → yhdT acetyl‑CoA carboxylase, biotin carboxylase subunit/DUF997 family putative inner membrane protein
RA 3,411,299 T→C 100% V10A (GTA→GCA)  fis → global DNA‑binding transcriptional dual regulator
RA 3,468,389 T→C 15.9% S489G (AGT→GGT)  chiA ← periplasmic endochitinase
RA 3,471,357 C→T 17.1% intergenic (‑28/+43) tufA ← / ← fusA translation elongation factor EF‑Tu 1/protein chain elongation factor EF‑G, GTP‑binding
RA 3,471,361 T→G 16.3% intergenic (‑32/+39) tufA ← / ← fusA translation elongation factor EF‑Tu 1/protein chain elongation factor EF‑G, GTP‑binding
RA 3,471,362 C→A 15.8% intergenic (‑33/+38) tufA ← / ← fusA translation elongation factor EF‑Tu 1/protein chain elongation factor EF‑G, GTP‑binding
RA 3,520,513 T→C 100% D64G (GAT→GGT)  hofQ ← DNA catabolic putative fimbrial transporter
JC 3,525,968 (ATCAGG)2→1 23.3% coding (177‑182/561 nt) nudE ← adenosine nucleotide hydrolase; Ap3A/Ap2A/ADP‑ribose/NADH hydrolase
RA 3,549,792 (C)6→5 100% coding (279/2085 nt) malQ ← 4‑alpha‑glucanotransferase (amylomaltase)
RA 3,560,455:1 +G 100% intergenic (‑2/+1) glpR ← / ← glpR pseudogene, DNA‑binding transcriptional repressor;regulator; Energy metabolism, carbon: Anaerobic respiration; repressor of the glp operon/pseudogene, DNA‑binding transcriptional repressor;regulator; Energy metabolism, carbon: Anaerobic respiration; repressor of the glp operon
MC JC 3,582,206 Δ1,222 bp 100% IS1‑mediated [yhhZ]–yrhA [yhhZ], yrhA
RA 3,646,678 G→A 100% G127D (GGC→GAC)  gor → glutathione oxidoreductase
RA 3,648,144 (T)7→6 100% intergenic (‑356/‑384) dinQ ← / → arsR UV‑inducible membrane toxin, DinQ‑AgrB type I toxin‑antitoxin system/arsenical resistance operon transcriptional repressor; autorepressor
RA 3,705,970 G→A 25.9% intergenic (‑180/+128) dppB ← / ← dppA dipeptide/heme ABC transporter permease/dipeptide/heme ABC transporter periplasmic binding protein; dipeptide chemotaxis receptor
RA 3,705,971 C→A 26.3% intergenic (‑181/+127) dppB ← / ← dppA dipeptide/heme ABC transporter permease/dipeptide/heme ABC transporter periplasmic binding protein; dipeptide chemotaxis receptor
RA 3,705,984 T→G 32.3% intergenic (‑194/+114) dppB ← / ← dppA dipeptide/heme ABC transporter permease/dipeptide/heme ABC transporter periplasmic binding protein; dipeptide chemotaxis receptor
RA 3,705,985 T→C 32.0% intergenic (‑195/+113) dppB ← / ← dppA dipeptide/heme ABC transporter permease/dipeptide/heme ABC transporter periplasmic binding protein; dipeptide chemotaxis receptor
RA 3,781,145 C→G 17.2% intergenic (+128/‑70) lldD → / → trmL L‑lactate dehydrogenase, FMN‑linked/tRNA Leu mC34,mU34 2'‑O‑methyltransferase, SAM‑dependent
RA 3,810,324 G→A 15.5% intergenic (+20/+19) coaD → / ← mutM pantetheine‑phosphate adenylyltransferase/formamidopyrimidine/5‑formyluracil/ 5‑hydroxymethyluracil DNA glycosylase
RA 3,815,816 C→G 17.8% intergenic (‑48/+18) pyrE ← / ← rph orotate phosphoribosyltransferase/ribonuclease PH (defective);enzyme; Degradation of RNA; RNase PH
RA 3,815,819 C→G 17.8% intergenic (‑51/+15) pyrE ← / ← rph orotate phosphoribosyltransferase/ribonuclease PH (defective);enzyme; Degradation of RNA; RNase PH
MC JC 3,815,859 Δ82 bp 100% [rph]–[rph] [rph], [rph]
RA 3,891,502 C→G 18.0% intergenic (+19/‑113) tnaB → / → mdtL tryptophan transporter of low affinity/multidrug efflux system protein
RA 3,891,504 T→A 17.4% intergenic (+21/‑111) tnaB → / → mdtL tryptophan transporter of low affinity/multidrug efflux system protein
RA 3,891,506 C→G 17.3% intergenic (+23/‑109) tnaB → / → mdtL tryptophan transporter of low affinity/multidrug efflux system protein
RA 3,903,585 G→A 80.9% G39G (GGC→GGT)  bglB ← cryptic phospho‑beta‑glucosidase B
RA 3,946,246 G→A 21.9% noncoding (2543/2904 nt) rrlC → 23S ribosomal RNA of rrnC operon
RA 3,951,559:1 +A 100% pseudogene (18/663 nt) ilvG → pseudogene, acetolactate synthase 2 large subunit, valine‑insensitive; acetolactate synthase II, large subunit, cryptic, interrupted
RA 4,022,007 C→T 17.9% G21G (GGC→GGT)  tatA → TatABCE protein translocation system subunit
RA 4,022,008 A→G 16.3% T22A (ACC→GCC)  tatA → TatABCE protein translocation system subunit
RA 4,051,259 G→T 15.3% intergenic (‑494/‑88) yihA ← / → yihI cell division GTP‑binding protein/activator of Der GTPase
RA 4,110,719 G→C 15.2% intergenic (+34/+21) cdh → / ← tpiA CDP‑diacylglycerol phosphotidylhydrolase/triosephosphate isomerase
RA 4,110,721 A→T 15.3% intergenic (+36/+19) cdh → / ← tpiA CDP‑diacylglycerol phosphotidylhydrolase/triosephosphate isomerase
RA 4,128,197 T→C 100% T67A (ACC→GCC)  metJ ← transcriptional repressor, S‑adenosylmethionine‑binding
RA 4,130,005 G→A 15.1% L57L (TTG→TTA)  metL → Bifunctional aspartokinase/homoserine dehydrogenase 2
RA 4,130,008 T→C 15.0% I58I (ATT→ATC)  metL → Bifunctional aspartokinase/homoserine dehydrogenase 2
RA 4,214,649 A→T 81.5% I124F (ATC→TTC)  metA → homoserine O‑transsuccinylase
RA 4,223,854 T→C 18.9% R9R (CGT→CGC)  metH → homocysteine‑N5‑methyltetrahydrofolate transmethylase, B12‑dependent
RA 4,223,855 G→A 18.5% A10T (GCG→ACG)  metH → homocysteine‑N5‑methyltetrahydrofolate transmethylase, B12‑dependent
RA 4,227,560 T→C 16.4% intergenic (+49/‑171) metH → / → yjbB homocysteine‑N5‑methyltetrahydrofolate transmethylase, B12‑dependent/putative Na+/Pi‑cotransporter
RA 4,243,370 C→T 81.1% L49L (CTG→CTA)  malG ← maltose transporter subunit
RA 4,261,349 G→A 15.5% intergenic (+43/‑320) yjbM → / → dusA uncharacterized protein/tRNA‑dihydrouridine synthase A
RA 4,261,358 T→A 18.1% intergenic (+52/‑311) yjbM → / → dusA uncharacterized protein/tRNA‑dihydrouridine synthase A
RA 4,261,359 T→A 18.0% intergenic (+53/‑310) yjbM → / → dusA uncharacterized protein/tRNA‑dihydrouridine synthase A
RA 4,291,512 G→A 17.8% M1M (GTG→ATG) †‡ nrfE → heme lyase (NrfEFG) for insertion of heme into c552, subunit NrfE
RA 4,291,513 T→C 18.2% M1A (GTG→GCG) †‡ nrfE → heme lyase (NrfEFG) for insertion of heme into c552, subunit NrfE
RA 4,295,744 G→A 100% A422T (GCT→ACT)  gltP → glutamate/aspartate:proton symporter
RA 4,296,060 C→T 100% intergenic (+266/+376) gltP → / ← yjcO glutamate/aspartate:proton symporter/Sel1 family TPR‑like repeat protein
RA 4,296,381:1 +GC 100% intergenic (+587/+55) gltP → / ← yjcO glutamate/aspartate:proton symporter/Sel1 family TPR‑like repeat protein
RA 4,312,074 C→T 18.5% intergenic (‑32/+27) alsB ← / ← alsR D‑allose ABC transporter periplasmic binding protein/d‑allose‑inducible als operon transcriptional repressor; autorepressor; repressor of rpiR
RA 4,312,080 G→C 19.4% intergenic (‑38/+21) alsB ← / ← alsR D‑allose ABC transporter periplasmic binding protein/d‑allose‑inducible als operon transcriptional repressor; autorepressor; repressor of rpiR
RA 4,312,083 G→C 18.9% intergenic (‑41/+18) alsB ← / ← alsR D‑allose ABC transporter periplasmic binding protein/d‑allose‑inducible als operon transcriptional repressor; autorepressor; repressor of rpiR
RA 4,312,089 A→G 19.6% intergenic (‑47/+12) alsB ← / ← alsR D‑allose ABC transporter periplasmic binding protein/d‑allose‑inducible als operon transcriptional repressor; autorepressor; repressor of rpiR
RA 4,325,822 G→A 45.3% intergenic (‑81/+577) yjdN ← / ← yjdM metalloprotein superfamily protein/zinc‑ribbon family protein
RA 4,326,047 C→T 80.5% intergenic (‑306/+352) yjdN ← / ← yjdM metalloprotein superfamily protein/zinc‑ribbon family protein
RA 4,337,024 G→A 100% S3L (TCG→TTG)  adiC ← arginine:agmatine antiporter
RA 4,365,452 G→T 15.9% intergenic (‑96/+20) cutA ← / ← dcuA divalent‑cation tolerance protein, copper sensitivity/C4‑dicarboxylate antiporter
RA 4,365,453 A→C 15.8% intergenic (‑97/+19) cutA ← / ← dcuA divalent‑cation tolerance protein, copper sensitivity/C4‑dicarboxylate antiporter
RA 4,376,280 G→A 15.1% intergenic (+15/‑37) efp → / → ecnA polyproline‑specific translation elongation factor EF‑P/entericidin A membrane lipoprotein, antidote entericidin B
RA 4,377,791 A→T 18.3% intergenic (‑69/+20) blc ← / ← ampC outer membrane lipoprotein cell division and growth lipocalin/penicillin‑binding protein; beta‑lactamase, intrinsically weak
RA 4,377,792 A→T 18.4% intergenic (‑70/+19) blc ← / ← ampC outer membrane lipoprotein cell division and growth lipocalin/penicillin‑binding protein; beta‑lactamase, intrinsically weak
RA 4,397,557 G→T 100% G49V (GGT→GTT)  mutL → methyl‑directed mismatch repair protein
RA 4,410,037 T→C 15.6% intergenic (+31/‑96) rlmB → / → yjfI 23S rRNA mG2251 2'‑O‑ribose methyltransferase, SAM‑dependent/DUF2170 family protein
RA 4,410,053 (T)9→8 100% intergenic (+47/‑80) rlmB → / → yjfI 23S rRNA mG2251 2'‑O‑ribose methyltransferase, SAM‑dependent/DUF2170 family protein
RA 4,494,883:1 (A)7→8 100% coding (261/564 nt) idnK → D‑gluconate kinase, thermosensitive
RA 4,520,500 Δ1 bp 16.3% intergenic (‑176/+171) yjhU ← / ← yjhF putative DNA‑binding transcriptional regulator; KpLE2 phage‑like element/putative transporter
RA 4,520,504:1 +T 16.7% intergenic (‑180/+167) yjhU ← / ← yjhF putative DNA‑binding transcriptional regulator; KpLE2 phage‑like element/putative transporter
RA 4,549,932 T→A 17.5% intergenic (+222/+21) fimH → / ← gntP minor component of type 1 fimbriae/fructuronate transporter
RA 4,551,608 G→A 100% intergenic (‑312/‑28) gntP ← / → uxuA fructuronate transporter/mannonate hydrolase
RA 4,573,528 A→G 100% pseudogene (1115/1503 nt) yjiT → pseudogene
RA 4,638,193:1 (C)6→7 100% coding (16/1353 nt) creD → inner membrane protein

Unassigned missing coverage evidence
   seq id start end size ←reads reads→ gene description
* * ÷ NC_000913 3423823–3424601 3424601 1–779 84 [0] [61] 63 [rrlD] [rrlD]

Unassigned new junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? NC_000913 157667 =88 (0.850)14 (0.150) 10/164 NT 15.6% coding (66/480 nt) folK 2‑amino‑4‑hydroxy‑6‑hydroxymethyldihyropteridine pyrophosphokinase
?NC_000913 157709 = 71 (0.740)coding (24/480 nt) folK 2‑amino‑4‑hydroxy‑6‑hydroxymethyldihyropteridine pyrophosphokinase
* ? NC_000913 225154 =NA (NA)34 (0.350) 11/168 NT NA noncoding (1384/1542 nt) rrsH 16S ribosomal RNA of rrnH operon
?NC_000913 225176 = NA (NA)noncoding (1406/1542 nt) rrsH 16S ribosomal RNA of rrnH operon
* ? NC_000913 = 225998NA (NA)27 (0.270) 12/170 NT NA noncoding (240/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
?NC_000913 = 226015 NA (NA)noncoding (257/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
* ? NC_000913 227034 =NA (NA)58 (0.600) 14/166 NT NA noncoding (1276/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
?NC_000913 227053 = NA (NA)noncoding (1295/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
* ? NC_000913 = 227444NA (NA)31 (0.320) 12/168 NT NA noncoding (1686/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
?NC_000913 = 227459 NA (NA)noncoding (1701/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
* ? NC_000913 228016 =NA (NA)45 (0.470) 13/164 NT NA noncoding (2258/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
?NC_000913 228041 = NA (NA)noncoding (2283/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
* ? NC_000913 228219 =NA (NA)6 (0.060) 4/166 NT NA noncoding (2461/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
?NC_000913 228248 = NA (NA)noncoding (2490/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
* ? NC_000913 = 228224NA (NA)15 (0.150) 10/166 NT NA noncoding (2466/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
?NC_000913 = 228241 NA (NA)noncoding (2483/2904 nt) rrlH 23S ribosomal RNA of rrnH operon
* ? NC_000913 = 258602NA (NA)28 (0.290) 12/168 NT NA noncoding (74/768 nt) IS1 repeat region
?NC_000913 = 279836 NA (NA)noncoding (95/768 nt) IS1 repeat region
* ? NC_000913 274347 =NA (NA)17 (0.180) 6/164 NT NA noncoding (803/1195 nt) IS5 repeat region
?NC_000913 274410 = NA (NA)noncoding (740/1195 nt) IS5 repeat region
* ? NC_000913 274384 =NA (NA)30 (0.300) 9/172 NT NA noncoding (766/1195 nt) IS5 repeat region
?NC_000913 274422 = NA (NA)noncoding (728/1195 nt) IS5 repeat region
* ? NC_000913 274620 =NA (NA)15 (0.160) 8/160 NT NA noncoding (530/1195 nt) IS5 repeat region
?NC_000913 274663 = NA (NA)noncoding (487/1195 nt) IS5 repeat region
* ? NC_000913 = 274695NA (NA)11 (0.110) 7/170 NT NA noncoding (455/1195 nt) IS5 repeat region
?NC_000913 = 274727 NA (NA)noncoding (423/1195 nt) IS5 repeat region
* ? NC_000913 274965 =NA (NA)19 (0.190) 10/172 NT NA noncoding (185/1195 nt) IS5 repeat region
?NC_000913 274991 = NA (NA)noncoding (159/1195 nt) IS5 repeat region
* ? NC_000913 294856 =102 (0.980)16 (0.170) 9/160 NT 16.1% intergenic (‑57/+283) yagM/yagN CP4‑6 prophage; uncharacterized protein/CP4‑6 prophage; uncharacterized protein
?NC_000913 294883 = 75 (0.800)intergenic (‑84/+256) yagM/yagN CP4‑6 prophage; uncharacterized protein/CP4‑6 prophage; uncharacterized protein
* ? NC_000913 = 315646NA (NA)18 (0.180) 9/168 NT NA noncoding (418/1255 nt) IS3 repeat region
?NC_000913 = 315665 NA (NA)noncoding (437/1255 nt) IS3 repeat region
* ? NC_000913 315892 =NA (NA)10 (0.100) 7/172 NT NA noncoding (664/1255 nt) IS3 repeat region
?NC_000913 315923 = NA (NA)noncoding (695/1255 nt) IS3 repeat region
* ? NC_000913 = 316201NA (NA)15 (0.160) 7/160 NT NA noncoding (973/1255 nt) IS3 repeat region
?NC_000913 = 316220 NA (NA)noncoding (992/1255 nt) IS3 repeat region
* ? NC_000913 349605 =NA (NA)10 (0.100) 7/164 NT NA noncoding (1/365 nt) REP25 (repetitive extragenic palindromic) element; contains 8 REP sequences REP25 (repetitive extragenic palindromic) element; contains 8 REP sequences
?NC_000913 349730 = NA (NA)noncoding (126/365 nt) REP25 (repetitive extragenic palindromic) element; contains 8 REP sequences REP25 (repetitive extragenic palindromic) element; contains 8 REP sequences
* ? NC_000913 377335 =NA (NA)12 (0.130) 5/164 NT NA noncoding (1/187 nt) REP32 (repetitive extragenic palindromic) element; contains 4 REP sequences REP32 (repetitive extragenic palindromic) element; contains 4 REP sequences
?NC_000913 377368 = NA (NA)noncoding (34/187 nt) REP32 (repetitive extragenic palindromic) element; contains 4 REP sequences REP32 (repetitive extragenic palindromic) element; contains 4 REP sequences
* ? NC_000913 381663 =NA (NA)19 (0.200) 6/164 NT NA noncoding (404/1331 nt) IS2 repeat region
?NC_000913 381703 = NA (NA)noncoding (444/1331 nt) IS2 repeat region
* ? NC_000913 = 381669NA (NA)39 (0.410) 11/164 NT NA noncoding (410/1331 nt) IS2 repeat region
?NC_000913 = 381695 NA (NA)noncoding (436/1331 nt) IS2 repeat region
* ? NC_000913 = 381910NA (NA)26 (0.270) 8/166 NT NA noncoding (651/1331 nt) IS2 repeat region
?NC_000913 = 381923 NA (NA)noncoding (664/1331 nt) IS2 repeat region
* ? NC_000913 382282 =NA (NA)9 (0.090) 7/166 NT NA noncoding (1023/1331 nt) IS2 repeat region
?NC_000913 382313 = NA (NA)noncoding (1054/1331 nt) IS2 repeat region
* ? NC_000913 580753 =109 (1.050)19 (0.220) 8/146 NT 20.4% intergenic (‑308/‑81) ylcI/nohD DUF3950 family protein, DLP12 prophage/DLP12 prophage; DNA packaging protein
?NC_000913 580810 = 59 (0.690)intergenic (‑365/‑24) ylcI/nohD DUF3950 family protein, DLP12 prophage/DLP12 prophage; DNA packaging protein
* ? NC_000913 732857 =NA (NA)19 (0.190) 8/170 NT 22.4% coding (3275/4194 nt) rhsC Rhs protein with putative toxin domain; putative neighboring cell growth inhibitor
?NC_000913 732888 = 69 (0.660)coding (3306/4194 nt) rhsC Rhs protein with putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 737205 =70 (0.670)13 (0.130) 5/176 NT 15.8% pseudogene (381/1137 nt) ybfL pseudogene, DDE domain transposase family;putative factor; Not classified; putative receptor protein
?NC_000913 1532171 = NA (NA)coding (356/1137 nt) ydcC H repeat‑associated putative transposase
* ? NC_000913 = 73721070 (0.670)17 (0.180) 8/166 NT 19.9% pseudogene (386/1137 nt) ybfL pseudogene, DDE domain transposase family;putative factor; Not classified; putative receptor protein
?NC_000913 = 3624726 72 (0.740)coding (349/1137 nt) yhhI putative transposase
* ? NC_000913 780398 =79 (0.760)15 (0.170) 8/154 NT 16.3% intergenic (+9/‑156) ybgF/lysT periplasmic TolA‑binding protein/tRNA‑Lys
?NC_000913 780432 = 86 (0.960)intergenic (+43/‑122) ybgF/lysT periplasmic TolA‑binding protein/tRNA‑Lys
* ? NC_000913 = 88491783 (0.800)17 (0.180) 10/160 NT 17.3% intergenic (+12/+29) mdfA/ybjH multidrug efflux system protein/uncharacterized protein
?NC_000913 = 884930 88 (0.940)intergenic (+25/+16) mdfA/ybjH multidrug efflux system protein/uncharacterized protein
* ? NC_000913 = 108340385 (0.820)16 (0.170) 13/162 NT 16.7% coding (28/1272 nt) efeB deferrrochelatase, periplasmic
?NC_000913 = 1083411 82 (0.870)coding (36/1272 nt) efeB deferrrochelatase, periplasmic
* ? NC_000913 1165696 =NA (NA)17 (0.190) 8/156 NT NA intergenic (+11/‑389) ycfP/ndh putative UPF0227 family esterase/respiratory NADH dehydrogenase 2/cupric reductase
?NC_000913 1165728 = NA (NA)intergenic (+43/‑357) ycfP/ndh putative UPF0227 family esterase/respiratory NADH dehydrogenase 2/cupric reductase
* ? NC_000913 = 1269275NA (NA)23 (0.240) 8/162 NT 22.3% coding (1/108 nt) ldrA toxic polypeptide, small
?NC_000913 = 1269313 88 (0.850)intergenic (‑38/+390) ldrA/ldrB toxic polypeptide, small/toxic polypeptide, small
* ? NC_000913 1269306 =85 (0.820)16 (0.170) 4/162 NT 20.6% intergenic (‑31/+397) ldrA/ldrB toxic polypeptide, small/toxic polypeptide, small
?NC_000913 1270354 = 46 (0.490)intergenic (‑9/+395) ldrC/chaA toxic polypeptide, small/calcium/sodium:proton antiporter
* ? NC_000913 = 12994980 (0.000)90 (0.910) 63/170 NT 100% intergenic (+253/‑1684) ychE/oppA UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein
?NC_000913 1300698 = 0 (0.000)intergenic (+1453/‑484) ychE/oppA UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein
* ? NC_000913 = 132298176 (0.730)13 (0.140) 12/164 NT 15.1% intergenic (‑35/+57) trpE/trpL component I of anthranilate synthase/trp operon leader peptide
?NC_000913 = 1322988 76 (0.790)intergenic (‑42/+50) trpE/trpL component I of anthranilate synthase/trp operon leader peptide
* ? NC_000913 1396316 =NA (NA)19 (0.200) 9/164 NT 20.5% noncoding (273/1195 nt) IS5 repeat region
?NC_000913 = 1428549 80 (0.770)noncoding (246/1196 nt) IS5 repeat region
* ? NC_000913 = 1432784NA (NA)9 (0.090) 8/168 NT NA coding (374/576 nt) tfaR Rac prophage; putative tail fiber assembly protein
?NC_000913 = 1432795 NA (NA)coding (385/576 nt) tfaR Rac prophage; putative tail fiber assembly protein
* ? NC_000913 = 143476675 (0.720)15 (0.160) 8/162 NT 16.2% intergenic (‑542/+192) ynaE/ttcC cold shock protein, Rac prophage/pseudogene, prophage Rac integration site ttcA duplication;Phage or Prophage Related
?NC_000913 1632568 = 87 (0.920)intergenic (‑283/‑504) ydfJ/ydfK pseudogene, MFS transporter family; interrupted by Qin prophage;Phage or Prophage Related; putative transport protein/cold shock protein, function unknown, Qin prophage
* ? NC_000913 1691370 =81 (0.780)14 (0.160) 8/154 NT 16.7% intergenic (+10/+216) ydgA/uidC DUF945 family protein/putative outer membrane porin for beta‑glucuronides porin protein
?NC_000913 1691402 = NA (NA)intergenic (+42/+184) ydgA/uidC DUF945 family protein/putative outer membrane porin for beta‑glucuronides porin protein
* ? NC_000913 = 1816343NA (NA)15 (0.150) 9/172 NT NA noncoding (159/189 nt) RIP129 (repetitive extragenic palindromic) element; contains 3 REP sequences and 1 IHF site RIP129 (repetitive extragenic palindromic) element; contains 3 REP sequences and 1 IHF site
?NC_000913 = 1816373 NA (NA)noncoding (189/189 nt) RIP129 (repetitive extragenic palindromic) element; contains 3 REP sequences and 1 IHF site RIP129 (repetitive extragenic palindromic) element; contains 3 REP sequences and 1 IHF site
* ? NC_000913 1852545 =NA (NA)14 (0.150) 7/156 NT NA intergenic (+17/+76) pncA/ydjE nicotinamidase/pyrazinamidase/putative MFS sugar transporter, membrane protein
?NC_000913 1852562 = NA (NA)noncoding (1/36 nt) REP132 (repetitive extragenic palindromic) element; contains 1 REP sequences REP132 (repetitive extragenic palindromic) element; contains 1 REP sequences
* ? NC_000913 = 20668320 (0.000)19 (0.200) 10/160 NT 100% noncoding (522/1195 nt) IS5 repeat region
?NC_000913 = 2066857 NA (NA)noncoding (497/1195 nt) IS5 repeat region
* ? NC_000913 = 2252869NA (NA)11 (0.120) 7/164 NT NA noncoding (74/91 nt) RIP157 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site RIP157 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site
?NC_000913 = 2252879 NA (NA)noncoding (84/91 nt) RIP157 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site RIP157 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site
* ? NC_000913 = 2304816104 (1.000)19 (0.200) 9/164 NT 18.2% noncoding (400/655 nt) REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences
?NC_000913 = 2304834 75 (0.780)noncoding (418/655 nt) REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences
* ? NC_000913 = 2618037NA (NA)13 (0.130) 10/166 NT NA intergenic (+100/+38) yfgD/hda putative oxidoreductase/ATPase regulatory factor involved in DnaA inactivation
?NC_000913 = 2618053 NA (NA)intergenic (+116/+22) yfgD/hda putative oxidoreductase/ATPase regulatory factor involved in DnaA inactivation
* ? NC_000913 2728214 =NA (NA)41 (0.410) 12/170 NT NA noncoding (971/2904 nt) rrlG 23S ribosomal RNA of rrnG operon
?NC_000913 2728240 = NA (NA)noncoding (945/2904 nt) rrlG 23S ribosomal RNA of rrnG operon
* ? NC_000913 = 2729452NA (NA)17 (0.180) 7/158 NT NA intergenic (‑8/+164) gltW/rrsG tRNA‑Glu/16S ribosomal RNA of rrnG operon
?NC_000913 = 2729474 NA (NA)intergenic (‑30/+142) gltW/rrsG tRNA‑Glu/16S ribosomal RNA of rrnG operon
* ? NC_000913 2731304 =47 (0.450)21 (0.220) 10/166 NT 32.4% intergenic (‑147/+296) rrsG/clpB 16S ribosomal RNA of rrnG operon/protein disaggregation chaperone
?NC_000913 = 4035360 NA (NA)intergenic (+207/‑171) hemG/rrsA protoporphyrin oxidase, flavoprotein/16S ribosomal RNA of rrnA operon
* ? NC_000913 2794028 =NA (NA)12 (0.120) 10/166 NT NA noncoding (1/136 nt) REP191 (repetitive extragenic palindromic) element; contains 3 REP sequences REP191 (repetitive extragenic palindromic) element; contains 3 REP sequences
?NC_000913 2794059 = NA (NA)noncoding (32/136 nt) REP191 (repetitive extragenic palindromic) element; contains 3 REP sequences REP191 (repetitive extragenic palindromic) element; contains 3 REP sequences
* ? NC_000913 2796243 =109 (1.050)21 (0.230) 10/160 NT 18.4% coding (570/663 nt) csiR transcriptional repressor of csiD
?NC_000913 2796271 = 89 (0.950)coding (598/663 nt) csiR transcriptional repressor of csiD
* ? NC_000913 2888334 =NA (NA)14 (0.150) 8/164 NT NA noncoding (1/37 nt) REP200 (repetitive extragenic palindromic) element; contains 1 REP sequences REP200 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 2888367 = NA (NA)noncoding (34/37 nt) REP200 (repetitive extragenic palindromic) element; contains 1 REP sequences REP200 (repetitive extragenic palindromic) element; contains 1 REP sequences
* ? NC_000913 3163644 =NA (NA)16 (0.170) 4/160 NT NA noncoding (1/30 nt) REP223 (repetitive extragenic palindromic) element; contains 1 REP sequences REP223 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 3163674 = NA (NA)intergenic (‑193/+41) plsC/parC 1‑acyl‑sn‑glycerol‑3‑phosphate acyltransferase/DNA topoisomerase IV, subunit A
* ? NC_000913 3214896 =NA (NA)9 (0.090) 7/168 NT NA noncoding (5/33 nt) REP227 (repetitive extragenic palindromic) element; contains 1 REP sequences REP227 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 3214925 = NA (NA)intergenic (+37/+42) rpoD/mug RNA polymerase, sigma 70 (sigma D) factor/G/U mismatch‑specific DNA glycosylase; xanthine DNA glycosylase
* ? NC_000913 3227693 =99 (0.950)15 (0.170) 10/156 NT 15.3% intergenic (+26/‑108) ygjI/ygjJ putative transporter/putative periplasmic protein
?NC_000913 3227727 = 80 (0.880)intergenic (+60/‑74) ygjI/ygjJ putative transporter/putative periplasmic protein
* ? NC_000913 3344992 =91 (0.880)13 (0.140) 5/158 NT 15.1% coding (276/1434 nt) rpoN RNA polymerase, sigma 54 (sigma N) factor
?NC_000913 3345024 = 66 (0.720)coding (308/1434 nt) rpoN RNA polymerase, sigma 54 (sigma N) factor
* ? NC_000913 = 34238220 (0.000)48 (0.500) 9/166 NT 100% intergenic (‑35/+58) rrfD/rrlD 5S ribosomal RNA of rrnD operon/23S ribosomal RNA of rrnD operon
?NC_000913 4040506 = NA (NA)intergenic (+83/‑11) rrlA/rrfA 23S ribosomal RNA of rrnA operon/5S ribosomal RNA of rrnA operon
* ? NC_000913 3470277 =NA (NA)24 (0.250) 13/164 NT NA coding (1053/1185 nt) tufA translation elongation factor EF‑Tu 1
?NC_000913 3470311 = NA (NA)coding (1019/1185 nt) tufA translation elongation factor EF‑Tu 1
* ? NC_000913 3620123 =NA (NA)7 (0.070) 6/166 NT 100% coding (932/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
?NC_000913 3620147 = 0 (0.000)coding (956/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 = 3620220NA (NA)11 (0.110) 7/166 NT 100% coding (1029/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
?NC_000913 = 3620255 0 (0.000)coding (1064/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 3620569 =NA (NA)35 (0.360) 9/166 NT 100% coding (1378/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
?NC_000913 3620582 = 0 (0.000)coding (1391/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 = 3620614NA (NA)17 (0.180) 6/166 NT 100% coding (1423/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
?NC_000913 = 3620635 0 (0.000)coding (1444/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 = 3621534NA (NA)7 (0.070) 4/162 NT 100% coding (2343/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
?NC_000913 = 3621592 0 (0.000)coding (2401/4236 nt) rhsB Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor
* ? NC_000913 3910443 =NA (NA)9 (0.090) 9/168 NT NA noncoding (1/35 nt) REP284 (repetitive extragenic palindromic) element; contains 1 REP sequences REP284 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 3910474 = NA (NA)noncoding (32/35 nt) REP284 (repetitive extragenic palindromic) element; contains 1 REP sequences REP284 (repetitive extragenic palindromic) element; contains 1 REP sequences
* ? NC_000913 = 3944978NA (NA)54 (0.560) 14/166 NT 65.1% noncoding (1275/2904 nt) rrlC 23S ribosomal RNA of rrnC operon
?NC_000913 = 4038811 31 (0.300)noncoding (1293/2905 nt) rrlA 23S ribosomal RNA of rrnA operon
* ? NC_000913 = 4040481NA (NA)67 (0.690) 13/166 NT 100% intergenic (+58/‑36) rrlA/rrfA 23S ribosomal RNA of rrnA operon/5S ribosomal RNA of rrnA operon
?NC_000913 = 4040505 0 (0.000)intergenic (+82/‑12) rrlA/rrfA 23S ribosomal RNA of rrnA operon/5S ribosomal RNA of rrnA operon
* ? NC_000913 4086854 =79 (0.760)14 (0.160) 8/154 NT 17.2% intergenic (+5/‑148) fdhD/yiiG formate dehydrogenase formation protein/DUF3829 family lipoprotein
?NC_000913 4086893 = 67 (0.750)intergenic (+44/‑109) fdhD/yiiG formate dehydrogenase formation protein/DUF3829 family lipoprotein
* ? NC_000913 = 417180392 (0.890)24 (0.240) 6/174 NT 21.1% intergenic (+47/‑254) rrfB/murB 5S ribosomal RNA of rrnB operon/UDP‑N‑acetylenolpyruvoylglucosamine reductase, FAD‑binding
?NC_000913 = 4213162 NA (NA)intergenic (+3/‑72) rrfE/yjaA 5S ribosomal RNA of rrnE operon/stress‑induced protein
* ? NC_000913 4295912 =NA (NA)6 (0.060) 4/164 NT NA noncoding (78/600 nt) RIP321 (repetitive extragenic palindromic) element; contains 11 REP sequences and 4 IHF sites RIP321 (repetitive extragenic palindromic) element; contains 11 REP sequences and 4 IHF sites
?NC_000913 4295942 = NA (NA)noncoding (108/600 nt) RIP321 (repetitive extragenic palindromic) element; contains 11 REP sequences and 4 IHF sites RIP321 (repetitive extragenic palindromic) element; contains 11 REP sequences and 4 IHF sites
* ? NC_000913 4325805 =NA (NA)82 (1.020)
+TACAAATTCCCGCACCCTCC
4/138 NT 52.5% noncoding (4/583 nt) REP325 (repetitive extragenic palindromic) element; contains 12 REP sequences REP325 (repetitive extragenic palindromic) element; contains 12 REP sequences
?NC_000913 = 4374531 96 (0.920)noncoding (34/99 nt) RIP329 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site RIP329 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site
* ? NC_000913 4325861 =148 (1.420)201 (2.660) 78/130 NT 69.8% noncoding (60/583 nt) REP325 (repetitive extragenic palindromic) element; contains 12 REP sequences REP325 (repetitive extragenic palindromic) element; contains 12 REP sequences
?NC_000913 = 4374507 66 (0.870)noncoding (10/99 nt) RIP329 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site RIP329 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site
* ? NC_000913 4326031 =212 (2.040)70 (0.730) 9/164 NT 26.7% noncoding (230/583 nt) REP325 (repetitive extragenic palindromic) element; contains 12 REP sequences REP325 (repetitive extragenic palindromic) element; contains 12 REP sequences
?NC_000913 4326213 = 189 (1.980)noncoding (412/583 nt) REP325 (repetitive extragenic palindromic) element; contains 12 REP sequences REP325 (repetitive extragenic palindromic) element; contains 12 REP sequences
* ? NC_000913 = 4326250NA (NA)25 (0.260) 8/164 NT NA noncoding (449/583 nt) REP325 (repetitive extragenic palindromic) element; contains 12 REP sequences REP325 (repetitive extragenic palindromic) element; contains 12 REP sequences
?NC_000913 = 4326380 NA (NA)noncoding (579/583 nt) REP325 (repetitive extragenic palindromic) element; contains 12 REP sequences REP325 (repetitive extragenic palindromic) element; contains 12 REP sequences
* ? NC_000913 = 4326350NA (NA)28 (0.290) 9/164 NT NA noncoding (549/583 nt) REP325 (repetitive extragenic palindromic) element; contains 12 REP sequences REP325 (repetitive extragenic palindromic) element; contains 12 REP sequences
?NC_000913 = 4326380 NA (NA)noncoding (579/583 nt) REP325 (repetitive extragenic palindromic) element; contains 12 REP sequences REP325 (repetitive extragenic palindromic) element; contains 12 REP sequences
* ? NC_000913 4332016 =NA (NA)15 (0.160) 8/160 NT NA noncoding (3/32 nt) REP326 (repetitive extragenic palindromic) element; contains 1 REP sequences REP326 (repetitive extragenic palindromic) element; contains 1 REP sequences
?NC_000913 4332047 = NA (NA)intergenic (+43/‑69) proP/pmrR proline/glycine betaine transporter/putative membrane‑bound BasS regulator