mutation predictions | marginal predictions | summary statistics | genome diff | command line log
|
breseq version 0.33.1 revision 8505477f25b3
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Predicted mutations | ||||||
|---|---|---|---|---|---|---|
| evidence | position | mutation | freq | annotation | gene | description |
| RA | 9,907 | A→C | 10.1% | intergenic (+14/+21) | mog → / ← satP | molybdochelatase incorporating molybdenum into molybdopterin/succinate‑acetate transporter |
| RA | 9,908 | G→T | 10.1% | intergenic (+15/+20) | mog → / ← satP | molybdochelatase incorporating molybdenum into molybdopterin/succinate‑acetate transporter |
| RA | 11,127 | C→G | 5.4% | S77T (AGT→ACT) | yaaW ← | UPF0174 family protein |
| RA | 25,773 | A→G | 16.2% | intergenic (+72/‑53) | lspA → / → fkpB | prolipoprotein signal peptidase (signal peptidase II)/FKBP‑type peptidyl‑prolyl cis‑trans isomerase (rotamase) |
| RA | 25,774 | A→C | 16.1% | intergenic (+73/‑52) | lspA → / → fkpB | prolipoprotein signal peptidase (signal peptidase II)/FKBP‑type peptidyl‑prolyl cis‑trans isomerase (rotamase) |
| RA | 53,376 | G→A | 8.0% | P14L (CCC→CTC) | pdxA ← | 4‑hydroxy‑L‑threonine phosphate dehydrogenase, NAD‑dependent |
| RA | 53,379 | T→C | 7.9% | E13G (GAG→GGG) | pdxA ← | 4‑hydroxy‑L‑threonine phosphate dehydrogenase, NAD‑dependent |
| RA | 72,198 | A→G | 5.3% | intergenic (+83/+31) | yabI → / ← thiQ | DedA family inner membrane protein/thiamine/thiamine pyrophosphate ABC transporter ATPase |
| RA | 72,199 | A→C | 5.3% | intergenic (+84/+30) | yabI → / ← thiQ | DedA family inner membrane protein/thiamine/thiamine pyrophosphate ABC transporter ATPase |
| RA | 72,205 | T→G | 5.4% | intergenic (+90/+24) | yabI → / ← thiQ | DedA family inner membrane protein/thiamine/thiamine pyrophosphate ABC transporter ATPase |
| RA | 72,206 | C→A | 5.3% | intergenic (+91/+23) | yabI → / ← thiQ | DedA family inner membrane protein/thiamine/thiamine pyrophosphate ABC transporter ATPase |
| RA | 83,587 | A→C | 37.5% | intergenic (‑58/+35) | leuA ← / ← leuL | 2‑isopropylmalate synthase/leu operon leader peptide |
| RA | 83,590 | G→T | 38.5% | intergenic (‑61/+32) | leuA ← / ← leuL | 2‑isopropylmalate synthase/leu operon leader peptide |
| RA | 85,337 | G→T | 6.9% | intergenic (+25/‑293) | leuO → / → ilvI | global transcription factor/acetolactate synthase 3 large subunit |
| RA | 85,338 | A→C | 7.2% | intergenic (+26/‑292) | leuO → / → ilvI | global transcription factor/acetolactate synthase 3 large subunit |
| RA | 93,800 | T→A | 5.2% | L212H (CTT→CAT) | murE → | UDP‑N‑acetylmuramoyl‑L‑alanyl‑D‑glutamate:meso‑ diaminopimelate ligase |
| RA | 93,805 | T→A | 5.2% | Y214N (TAT→AAT) | murE → | UDP‑N‑acetylmuramoyl‑L‑alanyl‑D‑glutamate:meso‑ diaminopimelate ligase |
| RA | 93,810 | T→A | 5.3% | H215Q (CAT→CAA) | murE → | UDP‑N‑acetylmuramoyl‑L‑alanyl‑D‑glutamate:meso‑ diaminopimelate ligase |
| RA | 106,831 | T→A | 5.5% | I92N (ATT→AAT) | lpxC → | UDP‑3‑O‑acyl N‑acetylglucosamine deacetylase |
| RA | 111,013 | G→A | 12.5% | intergenic (+29/‑31) | secA → / → mutT | preprotein translocase subunit, ATPase/dGTP‑preferring nucleoside triphosphate pyrophosphohydrolase |
| RA | 111,016 | T→C | 13.5% | intergenic (+32/‑28) | secA → / → mutT | preprotein translocase subunit, ATPase/dGTP‑preferring nucleoside triphosphate pyrophosphohydrolase |
| RA | 120,154 | Δ1 bp | 22.4% | intergenic (+19/+24) | ampE → / ← aroP | ampicillin resistance inner membrane protein; putative signaling protein in beta‑lactamase regulation/aromatic amino acid transporter |
| RA | 120,158:1 | +A | 23.0% | intergenic (+23/+20) | ampE → / ← aroP | ampicillin resistance inner membrane protein; putative signaling protein in beta‑lactamase regulation/aromatic amino acid transporter |
| RA | 125,226 | G→T | 6.5% | R737L (CGT→CTT) | aceE → | pyruvate dehydrogenase, decarboxylase component E1, thiamine triphosphate‑binding |
| RA | 125,232 | T→G | 7.5% | V739G (GTC→GGC) ‡ | aceE → | pyruvate dehydrogenase, decarboxylase component E1, thiamine triphosphate‑binding |
| RA | 125,233 | C→A | 7.5% | V739V (GTC→GTA) ‡ | aceE → | pyruvate dehydrogenase, decarboxylase component E1, thiamine triphosphate‑binding |
| RA | 127,789:1 | +T | 6.2% | intergenic (+202/‑123) | aceF → / → lpd | pyruvate dehydrogenase, dihydrolipoyltransacetylase component E2/dihydrolipoyl dehydrogenase; E3 component of pyruvate and 2‑oxoglutarate dehydrogenases complexes; glycine cleavage system L protein; dihydrolipoamide dehydrogenase |
| RA | 127,790 | A→T | 6.2% | intergenic (+203/‑122) | aceF → / → lpd | pyruvate dehydrogenase, dihydrolipoyltransacetylase component E2/dihydrolipoyl dehydrogenase; E3 component of pyruvate and 2‑oxoglutarate dehydrogenases complexes; glycine cleavage system L protein; dihydrolipoamide dehydrogenase |
| RA | 127,791 | A→C | 6.2% | intergenic (+204/‑121) | aceF → / → lpd | pyruvate dehydrogenase, dihydrolipoyltransacetylase component E2/dihydrolipoyl dehydrogenase; E3 component of pyruvate and 2‑oxoglutarate dehydrogenases complexes; glycine cleavage system L protein; dihydrolipoamide dehydrogenase |
| RA | 127,792 | G→A | 6.1% | intergenic (+205/‑120) | aceF → / → lpd | pyruvate dehydrogenase, dihydrolipoyltransacetylase component E2/dihydrolipoyl dehydrogenase; E3 component of pyruvate and 2‑oxoglutarate dehydrogenases complexes; glycine cleavage system L protein; dihydrolipoamide dehydrogenase |
| RA | 136,530 | C→T | 6.1% | intergenic (‑66/+40) | speE ← / ← yacC | spermidine synthase (putrescine aminopropyltransferase)/PulS_OutS family protein |
| RA | 136,532 | G→C | 6.1% | intergenic (‑68/+38) | speE ← / ← yacC | spermidine synthase (putrescine aminopropyltransferase)/PulS_OutS family protein |
| RA | 136,535 | G→C | 6.1% | intergenic (‑71/+35) | speE ← / ← yacC | spermidine synthase (putrescine aminopropyltransferase)/PulS_OutS family protein |
| RA | 136,537 | A→G | 6.1% | intergenic (‑73/+33) | speE ← / ← yacC | spermidine synthase (putrescine aminopropyltransferase)/PulS_OutS family protein |
| RA | 137,018 | G→C | 6.8% | intergenic (‑101/‑65) | yacC ← / → cueO | PulS_OutS family protein/multicopper oxidase (laccase) |
| RA | 137,020 | A→T | 6.7% | intergenic (‑103/‑63) | yacC ← / → cueO | PulS_OutS family protein/multicopper oxidase (laccase) |
| RA | 137,022 | G→C | 7.0% | intergenic (‑105/‑61) | yacC ← / → cueO | PulS_OutS family protein/multicopper oxidase (laccase) |
| RA | 151,519 | A→C | 7.7% | I27M (ATT→ATG) | yadK ← | putative fimbrial‑like adhesin protein |
| RA | 151,522 | G→T | 7.8% | A26A (GCC→GCA) | yadK ← | putative fimbrial‑like adhesin protein |
| RA | 164,556 | T→A | 8.4% | intergenic (+22/‑174) | hrpB → / → mrcB | putative ATP‑dependent helicase/fused glycosyl transferase and transpeptidase |
| RA | 164,557 | G→C | 8.1% | intergenic (+23/‑173) | hrpB → / → mrcB | putative ATP‑dependent helicase/fused glycosyl transferase and transpeptidase |
| RA | 164,558 | T→A | 8.1% | intergenic (+24/‑172) | hrpB → / → mrcB | putative ATP‑dependent helicase/fused glycosyl transferase and transpeptidase |
| RA | 164,620 | C→T | 5.8% | intergenic (+86/‑110) | hrpB → / → mrcB | putative ATP‑dependent helicase/fused glycosyl transferase and transpeptidase |
| RA | 164,621 | A→G | 6.1% | intergenic (+87/‑109) | hrpB → / → mrcB | putative ATP‑dependent helicase/fused glycosyl transferase and transpeptidase |
| RA | 169,748 | T→A | 10.0% | intergenic (+21/‑30) | fhuA → / → fhuC | ferrichrome outer membrane transporter/iron(3+)‑hydroxamate import ABC transporter ATPase |
| RA | 169,749 | T→A | 10.0% | intergenic (+22/‑29) | fhuA → / → fhuC | ferrichrome outer membrane transporter/iron(3+)‑hydroxamate import ABC transporter ATPase |
| RA | 175,144 | Δ1 bp | 8.9% | coding (38/1422 nt) | clcA → | H(+)/Cl(‑) exchange transporter |
| RA | 175,149:1 | +G | 9.0% | coding (43/1422 nt) | clcA → | H(+)/Cl(‑) exchange transporter |
| RA | 175,157 | A→G | 6.4% | R17R (CGA→CGG) | clcA → | H(+)/Cl(‑) exchange transporter |
| RA | 201,032 | G→A | 6.2% | G21D (GGC→GAC) | lpxD → | UDP‑3‑O‑(3‑hydroxymyristoyl)‑glucosamine N‑acyltransferase |
| RA | 208,552 | T→A | 10.0% | L1143I (TTA→ATA) | dnaE → | DNA polymerase III alpha subunit |
| RA | 217,030 | C→T | 5.9% | intergenic (‑27/+27) | yaeF ← / ← proS | putative lipoprotein/prolyl‑tRNA synthetase |
| RA | 217,037 | A→T | 6.1% | intergenic (‑34/+20) | yaeF ← / ← proS | putative lipoprotein/prolyl‑tRNA synthetase |
| RA | 217,044 | A→G | 5.8% | intergenic (‑41/+13) | yaeF ← / ← proS | putative lipoprotein/prolyl‑tRNA synthetase |
| RA | 242,344 | C→G | 6.7% | P320P (CCG→CCC) | fadE ← | acyl coenzyme A dehydrogenase |
| RA | 248,868 | C→G | 6.7% | pseudogene (1203/1713 nt) | lfhA ← | pseudogene, flagellar system protein, promoterless fragment; flagellar biosynthesis |
| RA | 253,282 | A→G | 6.1% | intergenic (+121/‑197) | yafP → / → ykfJ | GNAT family putative N‑acetyltransferase/pseudogene |
| RA | 254,223 | A→T | 9.8% | intergenic (+21/+36) | prfH → / ← pepD | pseudogene, RF‑1 domain family; probable peptide chain release factor/aminoacyl‑histidine dipeptidase (peptidase D) |
| RA | 254,228 | A→T | 7.4% | intergenic (+26/+31) | prfH → / ← pepD | pseudogene, RF‑1 domain family; probable peptide chain release factor/aminoacyl‑histidine dipeptidase (peptidase D) |
| RA | 254,233 | A→T | 7.8% | intergenic (+31/+26) | prfH → / ← pepD | pseudogene, RF‑1 domain family; probable peptide chain release factor/aminoacyl‑histidine dipeptidase (peptidase D) |
| RA | 256,449 | T→C | 14.5% | intergenic (+14/‑78) | gpt → / → frsA | xanthine phosphoribosyltransferase; xanthine‑guanine phosphoribosyltransferase/fermentation‑respiration switch protein; PTS Enzyme IIA(Glc)‑binding protein; pNP‑butyrate esterase activity |
| RA | 256,454 | C→G | 15.7% | intergenic (+19/‑73) | gpt → / → frsA | xanthine phosphoribosyltransferase; xanthine‑guanine phosphoribosyltransferase/fermentation‑respiration switch protein; PTS Enzyme IIA(Glc)‑binding protein; pNP‑butyrate esterase activity |
| RA | 256,459 | G→A | 16.0% | intergenic (+24/‑68) | gpt → / → frsA | xanthine phosphoribosyltransferase; xanthine‑guanine phosphoribosyltransferase/fermentation‑respiration switch protein; PTS Enzyme IIA(Glc)‑binding protein; pNP‑butyrate esterase activity |
| MC JC | 257,908 | Δ776 bp | 100% | [crl] | [crl] | |
| RA | 272,330:1 | +G | 5.7% | intergenic (+141/‑250) | insN → / → eyeA | pseudogene, IS911 transposase A;IS, phage, Tn; Transposon‑related functions; extrachromosomal; transposon related/novel sRNA, function unknown, CP4‑6 propahge |
| RA | 282,513 | T→C | 7.9% | L79P (CTG→CCG) | yagE → | 2‑keto‑3‑deoxy gluconate (KDG) aldolase; CP4‑6 prophage |
| RA | 285,882 | T→G | 7.3% | I163S (ATC→AGC) | yagG → | CP4‑6 prophage; putative sugar transporter |
| RA | 285,887 | C→A | 7.5% | L165M (CTG→ATG) | yagG → | CP4‑6 prophage; putative sugar transporter |
| RA | 288,399 | A→C | 5.1% | *537Y (TAA→TAC) | yagH → | CP4‑6 prophage; putative xylosidase/arabinosidase |
| RA | 289,255 | T→A | 9.7% | intergenic (‑93/+46) | yagI ← / ← argF | CP4‑6 prophage; putative DNA‑binding transcriptional regulator/ornithine carbamoyltransferase 2, chain F; CP4‑6 prophage |
| RA | 289,256 | G→C | 12.9% | intergenic (‑94/+45) | yagI ← / ← argF | CP4‑6 prophage; putative DNA‑binding transcriptional regulator/ornithine carbamoyltransferase 2, chain F; CP4‑6 prophage |
| RA | 289,257 | T→A | 12.9% | intergenic (‑95/+44) | yagI ← / ← argF | CP4‑6 prophage; putative DNA‑binding transcriptional regulator/ornithine carbamoyltransferase 2, chain F; CP4‑6 prophage |
| RA | 292,302 | C→G | 5.3% | intergenic (+71/+20) | yagJ → / ← yagK | CP4‑6 prophage; uncharacterized protein;Phage or Prophage Related/CP4‑6 prophage; conserved protein |
| RA | 314,255 | T→C | 17.7% | intergenic (‑450/‑102) | ykgP ← / → eaeH | pseudogene, oxidoreductase family/pseudogene, attaching and effacing protein homology;factor; Not classified |
| RA | 314,258 | G→A | 18.1% | intergenic (‑453/‑99) | ykgP ← / → eaeH | pseudogene, oxidoreductase family/pseudogene, attaching and effacing protein homology;factor; Not classified |
| RA | 344,704 | A→T | 5.9% | K177* (AAA→TAA) ‡ | yahL → | uncharacterized protein |
| RA | 344,705 | A→T | 5.9% | K177I (AAA→ATA) ‡ | yahL → | uncharacterized protein |
| RA | 373,332 | C→G | 6.0% | P138A (CCA→GCA) ‡ | mhpF → | acetaldehyde‑CoA dehydrogenase II, NAD‑binding |
| RA | 373,333 | C→G | 6.0% | P138R (CCA→CGA) ‡ | mhpF → | acetaldehyde‑CoA dehydrogenase II, NAD‑binding |
| RA | 374,682 | C→T | 6.5% | P272L (CCG→CTG) ‡ | mhpE → | 4‑hyroxy‑2‑oxovalerate/4‑hydroxy‑2‑oxopentanoic acid aldolase, class I |
| RA | 374,683 | G→C | 6.4% | P272P (CCG→CCC) ‡ | mhpE → | 4‑hyroxy‑2‑oxovalerate/4‑hydroxy‑2‑oxopentanoic acid aldolase, class I |
| RA | 374,688 | G→C | 6.6% | R274P (CGA→CCA) ‡ | mhpE → | 4‑hyroxy‑2‑oxovalerate/4‑hydroxy‑2‑oxopentanoic acid aldolase, class I |
| RA | 374,689 | A→G | 7.1% | R274R (CGA→CGG) ‡ | mhpE → | 4‑hyroxy‑2‑oxovalerate/4‑hydroxy‑2‑oxopentanoic acid aldolase, class I |
| RA | 380,091 | G→T | 5.7% | A251D (GCC→GAC) | yaiO ← | outer membrane protein |
| RA | 383,897 | C→T | 10.0% | M13I (ATG→ATA) ‡ | yaiP ← | putative family 2 glycosyltransferase |
| RA | 383,898 | A→G | 10.0% | M13T (ATG→ACG) ‡ | yaiP ← | putative family 2 glycosyltransferase |
| RA | 403,178 | T→C | 8.1% | intergenic (+16/‑103) | phoA → / → psiF | bacterial alkaline phosphatase/PsiF family protein |
| RA | 403,182 | T→A | 7.0% | intergenic (+20/‑99) | phoA → / → psiF | bacterial alkaline phosphatase/PsiF family protein |
| RA | 403,183 | T→A | 7.0% | intergenic (+21/‑98) | phoA → / → psiF | bacterial alkaline phosphatase/PsiF family protein |
| RA | 403,187 | G→A | 7.0% | intergenic (+25/‑94) | phoA → / → psiF | bacterial alkaline phosphatase/PsiF family protein |
| RA | 423,989 | A→C | 5.0% | N491T (AAC→ACC) | malZ → | maltodextrin glucosidase |
| RA | 423,995 | C→G | 5.1% | P493R (CCG→CGG) | malZ → | maltodextrin glucosidase |
| RA | 435,390 | T→A | 5.6% | L85Q (CTG→CAG) | nusB → | transcription antitermination protein |
| RA | 435,396 | T→A | 5.5% | I87N (ATT→AAT) | nusB → | transcription antitermination protein |
| RA | 435,402 | T→A | 5.1% | L89Q (CTG→CAG) | nusB → | transcription antitermination protein |
| RA | 443,022 | G→A | 10.8% | intergenic (+25/+29) | thiI → / ← yajL | tRNA s(4)U8 sulfurtransferase/oxidative‑stress‑resistance chaperone |
| RA | 443,023 | T→C | 11.1% | intergenic (+26/+28) | thiI → / ← yajL | tRNA s(4)U8 sulfurtransferase/oxidative‑stress‑resistance chaperone |
| RA | 454,853 | T→C | 13.0% | intergenic (+64/‑280) | bolA → / → tig | stationary‑phase morphogene, transcriptional repressor for mreB; also regulator for dacA, dacC, and ampC/peptidyl‑prolyl cis/trans isomerase (trigger factor) |
| RA | 454,856 | G→A | 12.3% | intergenic (+67/‑277) | bolA → / → tig | stationary‑phase morphogene, transcriptional repressor for mreB; also regulator for dacA, dacC, and ampC/peptidyl‑prolyl cis/trans isomerase (trigger factor) |
| RA | 464,354 | C→A | 6.0% | intergenic (+46/‑48) | ybaV → / → fadM | putative competence‑suppressing periplasmic helix‑hairpin‑helix DNA‑binding protein/long‑chain acyl‑CoA thioesterase III |
| RA | 464,356 | A→T | 5.8% | intergenic (+48/‑46) | ybaV → / → fadM | putative competence‑suppressing periplasmic helix‑hairpin‑helix DNA‑binding protein/long‑chain acyl‑CoA thioesterase III |
| RA | 464,358 | T→G | 6.2% | intergenic (+50/‑44) | ybaV → / → fadM | putative competence‑suppressing periplasmic helix‑hairpin‑helix DNA‑binding protein/long‑chain acyl‑CoA thioesterase III |
| RA | 475,971 | C→G | 15.6% | intergenic (+20/+11) | ybaY → / ← ybaZ | outer membrane lipoprotein/excision repair protein, alkyltransferase‑like protein ATL |
| RA | 475,972 | C→G | 15.6% | intergenic (+21/+10) | ybaY → / ← ybaZ | outer membrane lipoprotein/excision repair protein, alkyltransferase‑like protein ATL |
| RA | 481,225 | T→G | 43.7% | intergenic (‑517/+29) | tomB ← / ← acrB | Hha toxicity attenuator; conjugation‑related protein/multidrug efflux system protein |
| RA | 481,228 | C→A | 31.6% | intergenic (‑520/+26) | tomB ← / ← acrB | Hha toxicity attenuator; conjugation‑related protein/multidrug efflux system protein |
| RA | 484,877 | G→A | 5.6% | T248I (ACC→ATC) | acrA ← | multidrug efflux system |
| RA | 484,879 | G→C | 5.6% | I247M (ATC→ATG) ‡ | acrA ← | multidrug efflux system |
| RA | 484,881 | T→C | 5.5% | I247V (ATC→GTC) ‡ | acrA ← | multidrug efflux system |
| RA | 543,091 | G→C | 18.5% | intergenic (+58/+170) | glxK → / ← allE | glycerate kinase II/S‑ureidoglycine aminohydrolase |
| RA | 543,094 | G→C | 15.4% | intergenic (+61/+167) | glxK → / ← allE | glycerate kinase II/S‑ureidoglycine aminohydrolase |
| RA | 543,207 | A→T | 7.0% | intergenic (+174/+54) | glxK → / ← allE | glycerate kinase II/S‑ureidoglycine aminohydrolase |
| RA | 543,210 | A→T | 6.8% | intergenic (+177/+51) | glxK → / ← allE | glycerate kinase II/S‑ureidoglycine aminohydrolase |
| RA | 553,885 | G→A | 5.2% | T19I (ACC→ATC) | lpxH ← | UDP‑2,3‑diacylglucosamine pyrophosphohydrolase |
| RA | 553,889 | T→C | 5.0% | I18V (ATC→GTC) | lpxH ← | UDP‑2,3‑diacylglucosamine pyrophosphohydrolase |
| RA | 569,160 | G→T | 12.3% | D87Y (GAC→TAC) ‡ | ybcK → | DLP12 prophage; putative recombinase |
| RA | 569,161 | A→C | 11.5% | D87A (GAC→GCC) ‡ | ybcK → | DLP12 prophage; putative recombinase |
| RA | 577,260:1 | +T | 6.0% | intergenic (‑435/‑138) | nmpC ← / → essD | DLP12 prophage; truncated outer membrane porin (pseudogene);IS, phage, Tn; Phage or Prophage Related; outer membrane porin protein; locus of qsr prophage/DLP12 prophage; putative phage lysis protein |
| RA | 577,263 | T→A | 5.6% | intergenic (‑438/‑135) | nmpC ← / → essD | DLP12 prophage; truncated outer membrane porin (pseudogene);IS, phage, Tn; Phage or Prophage Related; outer membrane porin protein; locus of qsr prophage/DLP12 prophage; putative phage lysis protein |
| RA | 577,266 | Δ1 bp | 5.7% | intergenic (‑441/‑132) | nmpC ← / → essD | DLP12 prophage; truncated outer membrane porin (pseudogene);IS, phage, Tn; Phage or Prophage Related; outer membrane porin protein; locus of qsr prophage/DLP12 prophage; putative phage lysis protein |
| RA | 585,863 | T→C | 10.7% | intergenic (‑230/‑194) | ompT ← / → pauD | DLP12 prophage; outer membrane protease VII; outer membrane protein 3b/tRNA‑OTHER |
| RA | 585,866 | G→A | 10.6% | intergenic (‑233/‑191) | ompT ← / → pauD | DLP12 prophage; outer membrane protease VII; outer membrane protein 3b/tRNA‑OTHER |
| RA | 594,946 | C→A | 8.1% | Q166H (CAG→CAT) ‡ | cusR ← | response regulator in two‑component regulatory system with CusS |
| RA | 594,948 | G→C | 7.7% | Q166E (CAG→GAG) ‡ | cusR ← | response regulator in two‑component regulatory system with CusS |
| RA | 594,950 | T→G | 7.9% | H165P (CAT→CCT) | cusR ← | response regulator in two‑component regulatory system with CusS |
| RA | 595,519 | T→A | 6.2% | intergenic (‑76/‑81) | cusR ← / → cusC | response regulator in two‑component regulatory system with CusS/copper/silver efflux system, outer membrane component |
| RA | 595,520 | T→A | 6.2% | intergenic (‑77/‑80) | cusR ← / → cusC | response regulator in two‑component regulatory system with CusS/copper/silver efflux system, outer membrane component |
| RA | 603,391 | C→G | 30.1% | intergenic (+56/+25) | pheP → / ← ybdG | phenylalanine transporter/mechanosensitive channel protein, miniconductance |
| RA | 603,393 | T→A | 30.5% | intergenic (+58/+23) | pheP → / ← ybdG | phenylalanine transporter/mechanosensitive channel protein, miniconductance |
| RA | 603,395 | C→G | 28.2% | intergenic (+60/+21) | pheP → / ← ybdG | phenylalanine transporter/mechanosensitive channel protein, miniconductance |
| RA | 610,202 | C→T | 7.4% | intergenic (‑123/+52) | entD ← / ← fepA | phosphopantetheinyltransferase component of enterobactin synthase multienzyme complex/ferrienterobactin outer membrane transporter |
| RA | 610,207 | C→G | 7.6% | intergenic (‑128/+47) | entD ← / ← fepA | phosphopantetheinyltransferase component of enterobactin synthase multienzyme complex/ferrienterobactin outer membrane transporter |
| RA | 610,210 | C→G | 6.7% | intergenic (‑131/+44) | entD ← / ← fepA | phosphopantetheinyltransferase component of enterobactin synthase multienzyme complex/ferrienterobactin outer membrane transporter |
| RA | 610,215 | A→G | 6.2% | intergenic (‑136/+39) | entD ← / ← fepA | phosphopantetheinyltransferase component of enterobactin synthase multienzyme complex/ferrienterobactin outer membrane transporter |
| RA | 644,030 | A→G | 8.3% | intergenic (‑63/+167) | rnk ← / ← rna | regulator of nucleoside diphosphate kinase/ribonuclease I |
| RA | 644,034 | T→C | 8.4% | intergenic (‑67/+163) | rnk ← / ← rna | regulator of nucleoside diphosphate kinase/ribonuclease I |
| RA | 644,036 | A→T | 8.5% | intergenic (‑69/+161) | rnk ← / ← rna | regulator of nucleoside diphosphate kinase/ribonuclease I |
| RA | 644,038 | G→A | 9.0% | intergenic (‑71/+159) | rnk ← / ← rna | regulator of nucleoside diphosphate kinase/ribonuclease I |
| RA | 644,042 | C→T | 8.9% | intergenic (‑75/+155) | rnk ← / ← rna | regulator of nucleoside diphosphate kinase/ribonuclease I |
| RA | 645,062 | G→A | 23.5% | intergenic (‑59/+55) | rna ← / ← citT | ribonuclease I/citrate/succinate antiporter; citrate carrier |
| RA | 645,065 | A→T | 19.1% | intergenic (‑62/+52) | rna ← / ← citT | ribonuclease I/citrate/succinate antiporter; citrate carrier |
| RA | 645,068 | T→C | 20.0% | intergenic (‑65/+49) | rna ← / ← citT | ribonuclease I/citrate/succinate antiporter; citrate carrier |
| RA | 650,529 | G→A | 5.1% | R85R (CGC→CGT) | citD ← | citrate lyase, acyl carrier (gamma) subunit |
| RA | 654,560 | A→C | 7.7% | intergenic (+18/+23) | citB → / ← dcuC | response regulator in two‑component regulatory system with CitA/anaerobic C4‑dicarboxylate transport |
| RA | 654,563 | C→G | 7.5% | intergenic (+21/+20) | citB → / ← dcuC | response regulator in two‑component regulatory system with CitA/anaerobic C4‑dicarboxylate transport |
| RA | 654,566 | G→T | 5.9% | intergenic (+24/+17) | citB → / ← dcuC | response regulator in two‑component regulatory system with CitA/anaerobic C4‑dicarboxylate transport |
| RA | 657,531 | T→G | 7.2% | intergenic (+30/+24) | cspE → / ← flc | constitutive cold shock family transcription antitermination protein; negative regulator of cspA transcription; RNA melting protein; ssDNA‑binding protein/fluoride efflux channel, dual topology membrane protein |
| RA | 657,533 | A→T | 7.3% | intergenic (+32/+22) | cspE → / ← flc | constitutive cold shock family transcription antitermination protein; negative regulator of cspA transcription; RNA melting protein; ssDNA‑binding protein/fluoride efflux channel, dual topology membrane protein |
| RA | 657,535 | C→A | 7.2% | intergenic (+34/+20) | cspE → / ← flc | constitutive cold shock family transcription antitermination protein; negative regulator of cspA transcription; RNA melting protein; ssDNA‑binding protein/fluoride efflux channel, dual topology membrane protein |
| RA | 672,110 | G→A | 5.4% | T26I (ACC→ATC) | lptE ← | LPS assembly OM complex LptDE, lipoprotein component |
| RA | 672,113 | T→C | 5.3% | D25G (GAT→GGT) | lptE ← | LPS assembly OM complex LptDE, lipoprotein component |
| RA | 681,694 | A→G | 19.1% | intergenic (+31/+29) | djlC → / ← hscC | J domain‑containing HscC co‑chaperone; Hsc56/Hsp70 family chaperone Hsc62; RpoD‑binding transcription inhibitor |
| RA | 681,699 | T→A | 20.0% | intergenic (+36/+24) | djlC → / ← hscC | J domain‑containing HscC co‑chaperone; Hsc56/Hsp70 family chaperone Hsc62; RpoD‑binding transcription inhibitor |
| RA | 681,700 | T→A | 20.0% | intergenic (+37/+23) | djlC → / ← hscC | J domain‑containing HscC co‑chaperone; Hsc56/Hsp70 family chaperone Hsc62; RpoD‑binding transcription inhibitor |
| RA | 681,705 | C→T | 13.2% | intergenic (+42/+18) | djlC → / ← hscC | J domain‑containing HscC co‑chaperone; Hsc56/Hsp70 family chaperone Hsc62; RpoD‑binding transcription inhibitor |
| RA | 696,318 | A→G | 8.0% | intergenic (+42/+112) | ubiF → / ← glnX | 2‑octaprenyl‑3‑methyl‑6‑methoxy‑1,4‑benzoquinol oxygenase/tRNA‑Gln |
| RA | 696,319 | A→C | 8.0% | intergenic (+43/+111) | ubiF → / ← glnX | 2‑octaprenyl‑3‑methyl‑6‑methoxy‑1,4‑benzoquinol oxygenase/tRNA‑Gln |
| RA | 696,325 | G→T | 11.7% | intergenic (+49/+105) | ubiF → / ← glnX | 2‑octaprenyl‑3‑methyl‑6‑methoxy‑1,4‑benzoquinol oxygenase/tRNA‑Gln |
| RA | 696,328 | A→C | 12.5% | intergenic (+52/+102) | ubiF → / ← glnX | 2‑octaprenyl‑3‑methyl‑6‑methoxy‑1,4‑benzoquinol oxygenase/tRNA‑Gln |
| RA | 699,424 | T→C | 6.8% | intergenic (‑247/+150) | asnB ← / ← umpH | asparagine synthetase B/UMP phosphatase |
| RA | 699,429 | G→C | 6.8% | intergenic (‑252/+145) | asnB ← / ← umpH | asparagine synthetase B/UMP phosphatase |
| RA | 699,432 | G→C | 7.3% | intergenic (‑255/+142) | asnB ← / ← umpH | asparagine synthetase B/UMP phosphatase |
| RA | 699,437 | G→A | 7.1% | intergenic (‑260/+137) | asnB ← / ← umpH | asparagine synthetase B/UMP phosphatase |
| RA | 699,439 | G→T | 6.6% | intergenic (‑262/+135) | asnB ← / ← umpH | asparagine synthetase B/UMP phosphatase |
| RA | 699,440 | A→C | 7.1% | intergenic (‑263/+134) | asnB ← / ← umpH | asparagine synthetase B/UMP phosphatase |
| RA | 699,446 | T→G | 7.7% | intergenic (‑269/+128) | asnB ← / ← umpH | asparagine synthetase B/UMP phosphatase |
| RA | 699,447 | T→C | 7.7% | intergenic (‑270/+127) | asnB ← / ← umpH | asparagine synthetase B/UMP phosphatase |
| RA | 699,556 | C→T | 14.3% | intergenic (‑379/+18) | asnB ← / ← umpH | asparagine synthetase B/UMP phosphatase |
| RA | 699,559 | A→G | 13.7% | intergenic (‑382/+15) | asnB ← / ← umpH | asparagine synthetase B/UMP phosphatase |
| RA | 705,916 | T→C | 11.8% | intergenic (+26/‑177) | nagE → / → glnS | N‑acetyl glucosamine specific PTS enzyme IIC, IIB, and IIA components/glutamyl‑tRNA synthetase |
| RA | 705,917 | G→A | 11.9% | intergenic (+27/‑176) | nagE → / → glnS | N‑acetyl glucosamine specific PTS enzyme IIC, IIB, and IIA components/glutamyl‑tRNA synthetase |
| RA | 710,170 | C→T | 16.7% | intergenic (+54/+30) | chiQ → / ← fur | chitosugar‑induced verified lipoprotein/ferric iron uptake regulon transcriptional repressor; autorepressor |
| RA | 710,173 | A→G | 16.3% | intergenic (+57/+27) | chiQ → / ← fur | chitosugar‑induced verified lipoprotein/ferric iron uptake regulon transcriptional repressor; autorepressor |
| RA | 713,195 | G→A | 5.1% | R70H (CGC→CAC) | seqA → | negative modulator of initiation of replication |
| RA | 713,200 | A→T | 5.1% | M72L (ATG→TTG) | seqA → | negative modulator of initiation of replication |
| RA | 713,205 | T→C | 6.0% | R73R (CGT→CGC) | seqA → | negative modulator of initiation of replication |
| RA | 747,895 | C→G | 9.7% | intergenic (‑126/+26) | abrB ← / ← ybgO | regulator of aidB expression; inner membrane protein/putative fimbrial protein |
| RA | 747,897 | G→C | 9.9% | intergenic (‑128/+24) | abrB ← / ← ybgO | regulator of aidB expression; inner membrane protein/putative fimbrial protein |
| RA | 747,900 | G→C | 9.9% | intergenic (‑131/+21) | abrB ← / ← ybgO | regulator of aidB expression; inner membrane protein/putative fimbrial protein |
| RA | 747,902 | C→G | 10.0% | intergenic (‑133/+19) | abrB ← / ← ybgO | regulator of aidB expression; inner membrane protein/putative fimbrial protein |
| RA | 770,679 | G→T | 14.9% | intergenic (+68/‑779) | mngB → / → cydA | alpha‑mannosidase/cytochrome d terminal oxidase, subunit I |
| RA | 770,682 | A→C | 14.8% | intergenic (+71/‑776) | mngB → / → cydA | alpha‑mannosidase/cytochrome d terminal oxidase, subunit I |
| RA | 770,805 | G→A | 14.4% | intergenic (+194/‑653) | mngB → / → cydA | alpha‑mannosidase/cytochrome d terminal oxidase, subunit I |
| RA | 770,810 | T→C | 19.0% | intergenic (+199/‑648) | mngB → / → cydA | alpha‑mannosidase/cytochrome d terminal oxidase, subunit I |
| RA | 781,326 | A→T | 9.5% | intergenic (+104/‑43) | lysY → / → lysZ | tRNA‑Lys/tRNA‑Lys |
| RA | 781,845 | T→C | 8.3% | intergenic (+193/‑240) | lysQ → / → nadA | tRNA‑Lys/quinolinate synthase, subunit A |
| RA | 782,999 | T→G | 5.7% | L305L (CTT→CTG) | nadA → | quinolinate synthase, subunit A |
| RA | 783,000 | C→A | 5.5% | Q306K (CAG→AAG) | nadA → | quinolinate synthase, subunit A |
| RA | 784,012 | T→A | 5.8% | Q271L (CAG→CTG) | zitB ← | zinc efflux system |
| RA | 805,312 | G→T | 6.4% | E604* (GAG→TAG) ‡ | ybhJ → | aconitase family protein |
| RA | 805,313 | A→C | 6.5% | E604A (GAG→GCG) ‡ | ybhJ → | aconitase family protein |
| RA | 813,570:1 | +T | 5.1% | coding (45/2022 nt) | uvrB → | exision nuclease of nucleotide excision repair, DNA damage recognition component |
| RA | 813,575 | Δ1 bp | 5.3% | coding (50/2022 nt) | uvrB → | exision nuclease of nucleotide excision repair, DNA damage recognition component |
| RA | 824,572 | T→A | 5.7% | intergenic (‑75/‑58) | ybhP ← / → ybhQ | endo/exonuclease/phosphatase family protein/inner membrane protein |
| RA | 824,573 | T→A | 5.6% | intergenic (‑76/‑57) | ybhP ← / → ybhQ | endo/exonuclease/phosphatase family protein/inner membrane protein |
| RA | 837,642 | A→T | 8.4% | intergenic (+206/+23) | ybiC → / ← ybiJ | putative dehydrogenase/DUF1471 family putative periplasmic protein |
| RA | 837,643 | A→T | 8.4% | intergenic (+207/+22) | ybiC → / ← ybiJ | putative dehydrogenase/DUF1471 family putative periplasmic protein |
| RA | 837,649 | T→G | 7.8% | intergenic (+213/+16) | ybiC → / ← ybiJ | putative dehydrogenase/DUF1471 family putative periplasmic protein |
| RA | 837,650 | T→C | 7.5% | intergenic (+214/+15) | ybiC → / ← ybiJ | putative dehydrogenase/DUF1471 family putative periplasmic protein |
| RA | 843,338 | C→G | 5.4% | A715P (GCG→CCG) | ybiO ← | mechanosensitive channel protein, intermediate conductance |
| RA | 843,342 | A→T | 5.2% | V713V (GTT→GTA) ‡ | ybiO ← | mechanosensitive channel protein, intermediate conductance |
| RA | 843,343 | A→T | 5.2% | V713D (GTT→GAT) ‡ | ybiO ← | mechanosensitive channel protein, intermediate conductance |
| RA | 843,347 | C→G | 5.3% | G712R (GGC→CGC) | ybiO ← | mechanosensitive channel protein, intermediate conductance |
| RA | 847,213 | A→T | 7.4% | intergenic (‑94/+45) | glnP ← / ← glnH | glutamine transporter subunit/glutamine transporter subunit |
| RA | 847,214 | T→A | 8.3% | intergenic (‑95/+44) | glnP ← / ← glnH | glutamine transporter subunit/glutamine transporter subunit |
| RA | 847,215 | A→T | 7.7% | intergenic (‑96/+43) | glnP ← / ← glnH | glutamine transporter subunit/glutamine transporter subunit |
| RA | 857,576 | T→C | 21.3% | intergenic (+21/+220) | ybiT → / ← ybiU | ABC‑F family putative regulatory ATPase/DUF1479 family protein |
| RA | 857,578 | C→G | 21.3% | intergenic (+23/+218) | ybiT → / ← ybiU | ABC‑F family putative regulatory ATPase/DUF1479 family protein |
| RA | 857,580 | G→A | 22.0% | intergenic (+25/+216) | ybiT → / ← ybiU | ABC‑F family putative regulatory ATPase/DUF1479 family protein |
| RA | 860,178 | A→G | 5.8% | L810P (CTG→CCG) | ybiW ← | putative pyruvate formate lyase |
| RA | 874,623 | Δ1 bp | 5.5% | coding (1645/2349 nt) | yliE → | putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase |
| RA | 874,628:1 | +G | 5.5% | coding (1650/2349 nt) | yliE → | putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase |
| RA | 876,568 | A→T | 5.6% | N412Y (AAT→TAT) ‡ | yliF → | putative membrane‑anchored diguanylate cyclase |
| RA | 876,569 | A→T | 5.6% | N412I (AAT→ATT) ‡ | yliF → | putative membrane‑anchored diguanylate cyclase |
| RA | 887,392 | T→A | 7.4% | intergenic (‑53/‑31) | ybjJ ← / → rcdA | putative drug efflux MFS transporter, inner membrane protein/transcriptional regulator of csgD and ybiJI; autoregulator |
| RA | 887,393 | T→A | 7.4% | intergenic (‑54/‑30) | ybjJ ← / → rcdA | putative drug efflux MFS transporter, inner membrane protein/transcriptional regulator of csgD and ybiJI; autoregulator |
| RA | 892,455 | G→C | 8.0% | V163V (GTG→GTC) | rimK → | ribosomal protein S6 modification protein |
| RA | 892,457 | T→A | 8.2% | I164N (ATT→AAT) | rimK → | ribosomal protein S6 modification protein |
| RA | 892,459 | G→C | 8.2% | D165H (GAC→CAC) | rimK → | ribosomal protein S6 modification protein |
| RA | 894,952 | T→A | 6.0% | intergenic (+56/‑39) | potF → / → potG | putrescine ABC transporter periplasmic binding protein/putrescine ABC transporter ATPase |
| RA | 899,656 | T→C | 6.1% | intergenic (+11/+188) | rlmC → / ← artJ | 23S rRNA m(5)U747 methyltransferase, SAM‑dependent/arginine ABC transporter periplasmic binding protein |
| RA | 899,657 | G→A | 6.1% | intergenic (+12/+187) | rlmC → / ← artJ | 23S rRNA m(5)U747 methyltransferase, SAM‑dependent/arginine ABC transporter periplasmic binding protein |
| RA | 915,080 | G→C | 10.8% | intergenic (‑223/+272) | ybjE ← / ← aqpZ | putative transporter/aquaporin Z |
| RA | 915,081 | G→C | 10.8% | intergenic (‑224/+271) | ybjE ← / ← aqpZ | putative transporter/aquaporin Z |
| RA | 922,314:1 | +C | 10.9% | intergenic (+21/+52) | macB → / ← cspD | macrolide ABC transporter peremase/ATPase/inhibitor of DNA replication, cold shock protein homolog |
| RA | 926,168 | C→T | 6.4% | intergenic (‑197/+57) | serW ← / ← infA | tRNA‑Ser/translation initiation factor IF‑1 |
| RA | 926,174 | A→T | 5.4% | intergenic (‑203/+51) | serW ← / ← infA | tRNA‑Ser/translation initiation factor IF‑1 |
| RA | 926,180 | A→G | 5.2% | intergenic (‑209/+45) | serW ← / ← infA | tRNA‑Ser/translation initiation factor IF‑1 |
| RA | 940,751 | T→C | 42.1% | intergenic (+31/‑208) | serS → / → dmsA | seryl‑tRNA synthetase/dimethyl sulfoxide reductase, anaerobic, subunit A |
| RA | 940,754 | G→A | 38.9% | intergenic (+34/‑205) | serS → / → dmsA | seryl‑tRNA synthetase/dimethyl sulfoxide reductase, anaerobic, subunit A |
| RA | 958,769 | C→G | 13.3% | intergenic (+28/‑43) | serC → / → aroA | 3‑phosphoserine/phosphohydroxythreonine aminotransferase/5‑enolpyruvylshikimate‑3‑phosphate synthetase |
| RA | 958,771 | A→T | 13.2% | intergenic (+30/‑41) | serC → / → aroA | 3‑phosphoserine/phosphohydroxythreonine aminotransferase/5‑enolpyruvylshikimate‑3‑phosphate synthetase |
| RA | 958,773 | C→G | 13.3% | intergenic (+32/‑39) | serC → / → aroA | 3‑phosphoserine/phosphohydroxythreonine aminotransferase/5‑enolpyruvylshikimate‑3‑phosphate synthetase |
| RA | 964,148 | T→C | 19.1% | intergenic (+36/‑172) | ihfB → / → ycaI | integration host factor (IHF), DNA‑binding protein, beta subunit/ComEC family inner membrane protein |
| RA | 964,150 | T→A | 18.6% | intergenic (+38/‑170) | ihfB → / → ycaI | integration host factor (IHF), DNA‑binding protein, beta subunit/ComEC family inner membrane protein |
| RA | 964,152 | G→A | 20.2% | intergenic (+40/‑168) | ihfB → / → ycaI | integration host factor (IHF), DNA‑binding protein, beta subunit/ComEC family inner membrane protein |
| RA | 1,004,741 | T→G | 6.4% | intergenic (+84/‑27) | ycbF → / → pyrD | putative periplasmic pilin chaperone/dihydro‑orotate oxidase, FMN‑linked |
| RA | 1,004,746 | C→A | 6.4% | intergenic (+89/‑22) | ycbF → / → pyrD | putative periplasmic pilin chaperone/dihydro‑orotate oxidase, FMN‑linked |
| RA | 1,015,912 | T→A | 20.9% | intergenic (+30/+40) | rmf → / ← fabA | ribosome modulation factor/beta‑hydroxydecanoyl thioester dehydrase |
| RA | 1,018,983 | A→T | 55.6% | intergenic (+46/+30) | matP → / ← ompA | Ter macrodomain organizer matS‑binding protein/outer membrane protein A (3a;II*;G;d) |
| RA | 1,018,986 | A→T | 55.6% | intergenic (+49/+27) | matP → / ← ompA | Ter macrodomain organizer matS‑binding protein/outer membrane protein A (3a;II*;G;d) |
| RA | 1,041,937 | T→G | 8.0% | intergenic (+22/+93) | appA → / ← etk | phosphoanhydride phosphorylase/tyrosine‑protein kinase, role in O‑antigen capsule formation |
| RA | 1,041,940 | C→A | 7.9% | intergenic (+25/+90) | appA → / ← etk | phosphoanhydride phosphorylase/tyrosine‑protein kinase, role in O‑antigen capsule formation |
| RA | 1,052,257 | C→T | 7.9% | intergenic (+17/+32) | gnsA → / ← yccM | putative phosphatidylethanolamine synthesis regulator/putative 4Fe‑4S membrane protein |
| RA | 1,064,160 | T→C | 18.6% | L42P (CTG→CCG) ‡ | yccE → | uncharacterized protein |
| RA | 1,064,161 | G→A | 17.8% | L42L (CTG→CTA) ‡ | yccE → | uncharacterized protein |
| RA | 1,074,894 | G→T | 9.2% | intergenic (+14/+26) | rutR → / ← putA | rut operon transcriptional repressor for/fused DNA‑binding transcriptional regulator/proline dehydrogenase/pyrroline‑5‑carboxylate dehydrogenase |
| RA | 1,075,515 | G→T | 5.2% | A1123E (GCG→GAG) | putA ← | fused DNA‑binding transcriptional regulator/proline dehydrogenase/pyrroline‑5‑carboxylate dehydrogenase |
| RA | 1,075,518 | A→C | 5.2% | L1122R (CTC→CGC) | putA ← | fused DNA‑binding transcriptional regulator/proline dehydrogenase/pyrroline‑5‑carboxylate dehydrogenase |
| RA | 1,100,789 | G→T | 12.5% | intergenic (+2/+62) | ycdZ → / ← csgG | DUF1097 family inner membrane protein/curli production assembly/transport outer membrane lipoprotein |
| RA | 1,100,791 | G→C | 12.5% | intergenic (+4/+60) | ycdZ → / ← csgG | DUF1097 family inner membrane protein/curli production assembly/transport outer membrane lipoprotein |
| RA | 1,100,793 | A→C | 12.0% | intergenic (+6/+58) | ycdZ → / ← csgG | DUF1097 family inner membrane protein/curli production assembly/transport outer membrane lipoprotein |
| RA | 1,113,544 | G→A | 13.0% | intergenic (+138/‑35) | opgH → / → yceK | OPG biosynthetic ACP‑dependent transmembrane UDP‑glucose beta‑1,2 glycosyltransferase; nutrient‑dependent cell size regulator, FtsZ assembly antagonist/outer membrane integrity lipoprotein |
| RA | 1,113,546 | T→A | 13.3% | intergenic (+140/‑33) | opgH → / → yceK | OPG biosynthetic ACP‑dependent transmembrane UDP‑glucose beta‑1,2 glycosyltransferase; nutrient‑dependent cell size regulator, FtsZ assembly antagonist/outer membrane integrity lipoprotein |
| RA | 1,113,548 | T→C | 13.3% | intergenic (+142/‑31) | opgH → / → yceK | OPG biosynthetic ACP‑dependent transmembrane UDP‑glucose beta‑1,2 glycosyltransferase; nutrient‑dependent cell size regulator, FtsZ assembly antagonist/outer membrane integrity lipoprotein |
| RA | 1,131,310 | A→T | 6.2% | N98I (AAT→ATT) | flgB → | flagellar component of cell‑proximal portion of basal‑body rod |
| RA | 1,134,661 | A→G | 5.4% | intergenic (+104/‑68) | flgF → / → flgG | flagellar component of cell‑proximal portion of basal‑body rod/flagellar component of cell‑distal portion of basal‑body rod |
| RA | 1,134,662 | A→C | 5.4% | intergenic (+105/‑67) | flgF → / → flgG | flagellar component of cell‑proximal portion of basal‑body rod/flagellar component of cell‑distal portion of basal‑body rod |
| RA | 1,147,980 | G→T | 11.0% | K120N (AAG→AAT) | plsX → | putative phosphate acyltransferase |
| RA | 1,147,986 | G→C | 9.2% | L122L (CTG→CTC) | plsX → | putative phosphate acyltransferase |
| RA | 1,147,987 | G→C | 9.8% | E123Q (GAG→CAG) | plsX → | putative phosphate acyltransferase |
| RA | 1,147,993 | A→C | 10.3% | I125L (ATT→CTT) | plsX → | putative phosphate acyltransferase |
| RA | 1,153,208 | T→C | 6.1% | intergenic (+28/‑92) | fabF → / → pabC | 3‑oxoacyl‑[acyl‑carrier‑protein] synthase II/4‑amino‑4‑deoxychorismate lyase component of para‑aminobenzoate synthase multienzyme complex |
| RA | 1,153,213 | T→A | 6.4% | intergenic (+33/‑87) | fabF → / → pabC | 3‑oxoacyl‑[acyl‑carrier‑protein] synthase II/4‑amino‑4‑deoxychorismate lyase component of para‑aminobenzoate synthase multienzyme complex |
| RA | 1,153,214 | T→A | 6.4% | intergenic (+34/‑86) | fabF → / → pabC | 3‑oxoacyl‑[acyl‑carrier‑protein] synthase II/4‑amino‑4‑deoxychorismate lyase component of para‑aminobenzoate synthase multienzyme complex |
| RA | 1,153,219 | G→A | 6.4% | intergenic (+39/‑81) | fabF → / → pabC | 3‑oxoacyl‑[acyl‑carrier‑protein] synthase II/4‑amino‑4‑deoxychorismate lyase component of para‑aminobenzoate synthase multienzyme complex |
| RA | 1,159,335 | G→T | 8.3% | intergenic (+33/+27) | ptsG → / ← fhuE | fused glucose‑specific PTS enzymes: IIB component/IIC component/ferric‑rhodotorulic acid outer membrane transporter |
| RA | 1,159,336 | A→C | 8.3% | intergenic (+34/+26) | ptsG → / ← fhuE | fused glucose‑specific PTS enzymes: IIB component/IIC component/ferric‑rhodotorulic acid outer membrane transporter |
| RA | 1,169,380 | T→C | 22.2% | intergenic (+50/+32) | bhsA → / ← ldtC | biofilm, cell surface and signaling protein/L,D‑transpeptidase linking Lpp to murein |
| RA | 1,169,382 | C→G | 21.6% | intergenic (+52/+30) | bhsA → / ← ldtC | biofilm, cell surface and signaling protein/L,D‑transpeptidase linking Lpp to murein |
| RA | 1,169,384 | G→A | 21.0% | intergenic (+54/+28) | bhsA → / ← ldtC | biofilm, cell surface and signaling protein/L,D‑transpeptidase linking Lpp to murein |
| RA | 1,174,077 | G→A | 10.3% | intergenic (‑113/+15) | mfd ← / ← ycfT | transcription‑repair coupling factor/inner membrane protein |
| RA | 1,174,080 | T→C | 10.3% | intergenic (‑116/+12) | mfd ← / ← ycfT | transcription‑repair coupling factor/inner membrane protein |
| RA | 1,174,501 | A→T | 6.6% | L222Q (CTG→CAG) | ycfT ← | inner membrane protein |
| RA | 1,174,504 | A→T | 6.6% | L221Q (CTG→CAG) | ycfT ← | inner membrane protein |
| RA | 1,177,646 | T→G | 5.0% | N109K (AAT→AAG) | lolE → | lipoprotein‑releasing system transmembrane protein |
| RA | 1,177,647 | C→A | 5.0% | L110I (CTT→ATT) | lolE → | lipoprotein‑releasing system transmembrane protein |
| RA | 1,187,090 | G→C | 16.0% | intergenic (+20/+29) | pepT → / ← roxA | peptidase T/50S ribosomal protein L16 arginine hydroxylase; 2‑oxoglutarate oxygenase |
| RA | 1,187,091 | T→A | 16.0% | intergenic (+21/+28) | pepT → / ← roxA | peptidase T/50S ribosomal protein L16 arginine hydroxylase; 2‑oxoglutarate oxygenase |
| RA | 1,187,092 | G→C | 16.0% | intergenic (+22/+27) | pepT → / ← roxA | peptidase T/50S ribosomal protein L16 arginine hydroxylase; 2‑oxoglutarate oxygenase |
| RA | 1,194,650 | G→A | 5.2% | P101L (CCG→CTG) | rluE ← | 23S rRNA pseudouridine(2457) synthase |
| RA | 1,194,653 | T→C | 5.2% | Q100R (CAG→CGG) | rluE ← | 23S rRNA pseudouridine(2457) synthase |
| RA | 1,194,657 | Δ1 bp | 5.4% | coding (295/654 nt) | rluE ← | 23S rRNA pseudouridine(2457) synthase |
| RA | 1,196,408 | A→T | 16.0% | intergenic (+35/+459) | icd → / ← ymfD | isocitrate dehydrogenase; e14 prophage attachment site; tellurite reductase/e14 prophage; putative SAM‑dependent methyltransferase |
| RA | 1,202,957 | G→T | 5.9% | intergenic (‑24/‑67) | cohE ← / → croE | e14 prophage; repressor protein phage e14/e14 prophage; putative DNA‑binding transcriptional regulator |
| RA | 1,202,959 | T→A | 5.7% | intergenic (‑26/‑65) | cohE ← / → croE | e14 prophage; repressor protein phage e14/e14 prophage; putative DNA‑binding transcriptional regulator |
| RA | 1,202,961 | A→C | 6.0% | intergenic (‑28/‑63) | cohE ← / → croE | e14 prophage; repressor protein phage e14/e14 prophage; putative DNA‑binding transcriptional regulator |
| RA | 1,217,099 | T→C | 7.2% | intergenic (+103/‑229) | ymgC → / → ycgG | Blue light, low temperature and stress induced protein/putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase |
| RA | 1,224,239 | A→T | 8.9% | intergenic (+332/+40) | ycgI → / ← minE | pseudogene/cell division topological specificity factor |
| RA | 1,224,242 | A→T | 8.8% | intergenic (+335/+37) | ycgI → / ← minE | pseudogene/cell division topological specificity factor |
| RA | 1,233,154 | T→A | 8.4% | intergenic (‑124/+22) | dsbB ← / ← nhaB | oxidoreductase that catalyzes reoxidation of DsbA protein disulfide isomerase I/sodium:proton antiporter |
| RA | 1,233,157 | T→A | 9.4% | intergenic (‑127/+19) | dsbB ← / ← nhaB | oxidoreductase that catalyzes reoxidation of DsbA protein disulfide isomerase I/sodium:proton antiporter |
| RA | 1,248,064 | T→A | 5.1% | K351* (AAA→TAA) | dhaM ← | putative dihydroxyacetone‑specific PTS enzymes: HPr, EI components |
| RA | 1,256,416 | A→T | 100% | intergenic (‑464/+305) | ycgV ← / ← ychF | putative adhesin/catalase inhibitor protein; ATPase, K+‑dependent, ribosome‑associated |
| RA | 1,260,901 | C→T | 12.5% | intergenic (‑98/+27) | dauA ← / ← prs | C4‑dicarboxylic acid transporter/phosphoribosylpyrophosphate synthase |
| RA | 1,260,904 | A→G | 11.4% | intergenic (‑101/+24) | dauA ← / ← prs | C4‑dicarboxylic acid transporter/phosphoribosylpyrophosphate synthase |
| RA | 1,285,190 | T→A | 5.8% | L18I (TTA→ATA) | narJ → | molybdenum‑cofactor‑assembly chaperone delta subunit of nitrate reductase 1 |
| RA | 1,285,193 | T→A | 6.1% | W19R (TGG→AGG) | narJ → | molybdenum‑cofactor‑assembly chaperone delta subunit of nitrate reductase 1 |
| RA | 1,287,458 | A→C | 9.5% | intergenic (‑130/+80) | tyrV ← / ← tyrT | tRNA‑Tyr/tRNA‑Tyr |
| RA | 1,287,460 | T→A | 9.8% | intergenic (‑132/+78) | tyrV ← / ← tyrT | tRNA‑Tyr/tRNA‑Tyr |
| RA | 1,287,462 | G→T | 9.8% | intergenic (‑134/+76) | tyrV ← / ← tyrT | tRNA‑Tyr/tRNA‑Tyr |
| RA | 1,287,572 | G→T | 5.2% | noncoding (51/85 nt) | tyrT ← | tRNA‑Tyr |
| RA | 1,287,573 | A→G | 5.1% | noncoding (50/85 nt) | tyrT ← | tRNA‑Tyr |
| RA | 1,292,472 | G→A | 40.0% | intergenic (+107/+37) | galU → / ← hns | glucose‑1‑phosphate uridylyltransferase/global DNA‑binding transcriptional dual regulator H‑NS |
| RA | 1,292,473 | C→G | 40.0% | intergenic (+108/+36) | galU → / ← hns | glucose‑1‑phosphate uridylyltransferase/global DNA‑binding transcriptional dual regulator H‑NS |
| RA | 1,292,474 | T→C | 33.2% | intergenic (+109/+35) | galU → / ← hns | glucose‑1‑phosphate uridylyltransferase/global DNA‑binding transcriptional dual regulator H‑NS |
| RA | 1,304,469 | C→G | 5.2% | R212R (CGC→CGG) | oppC → | oligopeptide ABC transporter permease |
| RA | 1,304,474 | T→A | 5.4% | I214N (ATT→AAT) | oppC → | oligopeptide ABC transporter permease |
| RA | 1,304,479 | C→G | 5.6% | P216A (CCG→GCG) | oppC → | oligopeptide ABC transporter permease |
| RA | 1,306,787 | G→A | 13.3% | intergenic (+19/+34) | oppF → / ← yciU | oligopeptide ABC transporter ATPase/UPF0263 family protein |
| RA | 1,306,788 | T→C | 14.3% | intergenic (+20/+33) | oppF → / ← yciU | oligopeptide ABC transporter ATPase/UPF0263 family protein |
| RA | 1,311,830 | A→G | 34.6% | intergenic (+22/+18) | tonB → / ← yciA | membrane spanning protein in TonB‑ExbB‑ExbD transport complex/acyl‑CoA esterase |
| RA | 1,311,831 | C→T | 39.1% | intergenic (+23/+17) | tonB → / ← yciA | membrane spanning protein in TonB‑ExbB‑ExbD transport complex/acyl‑CoA esterase |
| RA | 1,318,469 | T→C | 9.7% | A440A (GCA→GCG) ‡ | trpC ← | indole‑3‑glycerolphosphate synthetase and N‑(5‑phosphoribosyl)anthranilate isomerase |
| RA | 1,318,470 | G→A | 8.5% | A440V (GCA→GTA) ‡ | trpC ← | indole‑3‑glycerolphosphate synthetase and N‑(5‑phosphoribosyl)anthranilate isomerase |
| RA | 1,322,394 | C→G | 6.2% | D185H (GAC→CAC) | trpE ← | component I of anthranilate synthase |
| RA | 1,322,396 | A→T | 6.3% | I184N (ATT→AAT) | trpE ← | component I of anthranilate synthase |
| RA | 1,322,398 | C→G | 6.1% | V183V (GTG→GTC) | trpE ← | component I of anthranilate synthase |
| RA | 1,324,836:1 | +C | 6.6% | coding (91/1896 nt) | yciQ → | enhancer of membrane protein expression; putative inner membrane protein |
| RA | 1,324,837 | A→C | 9.4% | Y31S (TAT→TCT) ‡ | yciQ → | enhancer of membrane protein expression; putative inner membrane protein |
| RA | 1,324,838 | T→A | 9.4% | Y31* (TAT→TAA) ‡ | yciQ → | enhancer of membrane protein expression; putative inner membrane protein |
| RA | 1,324,839 | G→T | 10.7% | E32* (GAA→TAA) | yciQ → | enhancer of membrane protein expression; putative inner membrane protein |
| RA | 1,327,213 | C→T | 5.6% | T121I (ACC→ATC) | rluB → | 23S rRNA pseudouridine(2605) synthase |
| RA | 1,327,216 | A→G | 5.1% | D122G (GAT→GGT) | rluB → | 23S rRNA pseudouridine(2605) synthase |
| RA | 1,346,764 | A→C | 7.0% | intergenic (‑22/‑32) | gmr ← / → ymiB | cyclic‑di‑GMP phosphodiesterase; csgD regulator; modulator of RNase II stability/uncharacterized protein |
| RA | 1,346,770 | G→C | 8.2% | intergenic (‑28/‑26) | gmr ← / → ymiB | cyclic‑di‑GMP phosphodiesterase; csgD regulator; modulator of RNase II stability/uncharacterized protein |
| RA | 1,346,776 | G→T | 8.6% | intergenic (‑34/‑20) | gmr ← / → ymiB | cyclic‑di‑GMP phosphodiesterase; csgD regulator; modulator of RNase II stability/uncharacterized protein |
| RA | 1,351,222 | T→G | 6.2% | intergenic (‑183/+185) | fabI ← / ← ycjD | enoyl‑[acyl‑carrier‑protein] reductase, NADH‑dependent/DUF559 family endonuclease‑related protein |
| RA | 1,359,877 | C→A | 5.4% | Q344H (CAG→CAT) ‡ | puuA ← | glutamate‑‑putrescine ligase |
| RA | 1,359,878 | T→G | 5.2% | Q344P (CAG→CCG) ‡ | puuA ← | glutamate‑‑putrescine ligase |
| RA | 1,388,283 | C→T | 26.1% | intergenic (+22/+22) | tyrR → / ← tpx | aromatic amino acid biosynthesis and transport regulon transcriptional regulator; autorepressor; ATPase; phosphatase/lipid hydroperoxide peroxidase |
| RA | 1,388,284 | A→T | 26.6% | intergenic (+23/+21) | tyrR → / ← tpx | aromatic amino acid biosynthesis and transport regulon transcriptional regulator; autorepressor; ATPase; phosphatase/lipid hydroperoxide peroxidase |
| RA | 1,388,285 | A→G | 27.0% | intergenic (+24/+20) | tyrR → / ← tpx | aromatic amino acid biosynthesis and transport regulon transcriptional regulator; autorepressor; ATPase; phosphatase/lipid hydroperoxide peroxidase |
| RA | 1,410,986 | A→G | 10.8% | intergenic (+102/+27) | dbpA → / ← ttcA | ATP‑dependent RNA helicase, specific for 23S rRNA/tRNA s(2)C32 thioltransferase, iron sulfur cluster protein |
| RA | 1,410,990 | T→A | 10.4% | intergenic (+106/+23) | dbpA → / ← ttcA | ATP‑dependent RNA helicase, specific for 23S rRNA/tRNA s(2)C32 thioltransferase, iron sulfur cluster protein |
| RA | 1,410,991 | T→A | 10.5% | intergenic (+107/+22) | dbpA → / ← ttcA | ATP‑dependent RNA helicase, specific for 23S rRNA/tRNA s(2)C32 thioltransferase, iron sulfur cluster protein |
| RA | 1,410,995 | C→T | 10.5% | intergenic (+111/+18) | dbpA → / ← ttcA | ATP‑dependent RNA helicase, specific for 23S rRNA/tRNA s(2)C32 thioltransferase, iron sulfur cluster protein |
| RA | 1,413,029 | G→C | 6.1% | S69R (AGC→AGG) ‡ | intR ← | Rac prophage; integrase |
| RA | 1,413,031 | T→A | 6.1% | S69C (AGC→TGC) ‡ | intR ← | Rac prophage; integrase |
| RA | 1,413,033 | G→C | 6.0% | S68C (TCC→TGC) | intR ← | Rac prophage; integrase |
| RA | 1,426,178 | A→T | 5.0% | intergenic (+96/‑276) | ydaY → / → tmpR | pseudogene, Rac prophage;Phage or Prophage Related/Rac prophage; pseudogene, tail protein family;Phage or Prophage Related; putative alpha helix protein |
| RA | 1,445,616 | G→C | 6.3% | A856P (GCA→CCA) | ydbH → | putative membrane‑anchored protein, function unknown |
| RA | 1,445,621 | G→C | 6.5% | W857C (TGG→TGC) | ydbH → | putative membrane‑anchored protein, function unknown |
| RA | 1,449,050 | T→A | 25.0% | intergenic (+32/+26) | feaB → / ← tynA | phenylacetaldehyde dehydrogenase/tyramine oxidase, copper‑requiring |
| RA | 1,462,028 | G→A | 5.0% | G379D (GGT→GAT) | paaJ → | 3‑oxoadipyl‑CoA/3‑oxo‑5,6‑dehydrosuberyl‑CoA thiolase |
| RA | 1,517,481 | C→G | 8.9% | R31R (CGC→CGG) | ydcX → | DUF2566 family protein |
| RA | 1,517,484 | C→G | 9.0% | I32M (ATC→ATG) | ydcX → | DUF2566 family protein |
| RA | 1,530,490 | T→C | 7.3% | intergenic (+86/‑96) | ydcD → / → yncI | putative immunity protein for RhsE/pseudogene |
| RA | 1,530,496 | G→T | 7.3% | intergenic (+92/‑90) | ydcD → / → yncI | putative immunity protein for RhsE/pseudogene |
| RA | 1,530,499 | A→C | 7.3% | intergenic (+95/‑87) | ydcD → / → yncI | putative immunity protein for RhsE/pseudogene |
| RA | 1,552,388 | T→C | 5.3% | intergenic (+397/+10) | fdnI → / ← yddM | formate dehydrogenase‑N, cytochrome B556 (gamma) subunit, nitrate‑inducible/putative DNA‑binding transcriptional regulator |
| RA | 1,579,563 | G→T | 5.2% | intergenic (‑221/+70) | yddA ← / ← ydeM | putative multidrug ABC transporter permease/ATPase/putative YdeN‑specific sulfatase‑maturating enzyme |
| RA | 1,579,564 | G→A | 5.3% | intergenic (‑222/+69) | yddA ← / ← ydeM | putative multidrug ABC transporter permease/ATPase/putative YdeN‑specific sulfatase‑maturating enzyme |
| RA | 1,579,569 | T→C | 5.3% | intergenic (‑227/+64) | yddA ← / ← ydeM | putative multidrug ABC transporter permease/ATPase/putative YdeN‑specific sulfatase‑maturating enzyme |
| RA | 1,585,149 | Δ1 bp | 7.0% | coding (1338/2280 nt) | ydeP ← | putative oxidoreductase |
| RA | 1,585,156:1 | +C | 6.8% | coding (1331/2280 nt) | ydeP ← | putative oxidoreductase |
| RA | 1,597,272 | T→A | 5.9% | pseudogene (716/3861 nt) | yneO ← | pseudogene, AidA homolog |
| RA | 1,603,724 | A→C | 6.1% | T236P (ACC→CCC) | lsrC → | autoinducer 2 import system permease protein |
| RA | 1,603,735 | G→T | 5.7% | G239G (GGG→GGT) | lsrC → | autoinducer 2 import system permease protein |
| RA | 1,609,555 | Δ1 bp | 9.2% | coding (1126/1452 nt) | uxaB ← | altronate oxidoreductase, NAD‑dependent |
| RA | 1,609,561:1 | +C | 8.6% | coding (1120/1452 nt) | uxaB ← | altronate oxidoreductase, NAD‑dependent |
| RA | 1,647,873 | C→T | 5.2% | intergenic (‑23/‑61) | dicC ← / → dicA | Qin prophage; DNA‑binding transcriptional regulator for DicB/Qin prophage; putative regulator for DicB |
| RA | 1,648,343 | Δ1 bp | 5.6% | intergenic (+2/‑165) | dicA → / → ydfA | Qin prophage; putative regulator for DicB/Qin prophage; uncharacterized protein |
| RA | 1,648,348 | C→T | 5.5% | intergenic (+7/‑160) | dicA → / → ydfA | Qin prophage; putative regulator for DicB/Qin prophage; uncharacterized protein |
| RA | 1,648,349 | A→G | 5.3% | intergenic (+8/‑159) | dicA → / → ydfA | Qin prophage; putative regulator for DicB/Qin prophage; uncharacterized protein |
| RA | 1,657,895 | A→T | 5.6% | intergenic (+25/‑174) | ynfD → / → ynfE | DUF1161 family periplasmic protein/putative selenate reductase, periplasmic |
| RA | 1,660,194 | A→C | 8.5% | K709T (AAG→ACG) | ynfE → | putative selenate reductase, periplasmic |
| RA | 1,660,198 | T→A | 8.4% | A710A (GCT→GCA) | ynfE → | putative selenate reductase, periplasmic |
| RA | 1,660,200 | C→G | 8.5% | A711G (GCC→GGC) | ynfE → | putative selenate reductase, periplasmic |
| RA | 1,660,202 | T→A | 8.5% | C712S (TGC→AGC) | ynfE → | putative selenate reductase, periplasmic |
| RA | 1,660,206 | G→T | 8.0% | R713L (CGT→CTT) | ynfE → | putative selenate reductase, periplasmic |
| RA | 1,660,438 | A→G | 5.6% | S790S (TCA→TCG) | ynfE → | putative selenate reductase, periplasmic |
| RA | 1,660,442 | C→G | 5.6% | L792V (CTG→GTG) | ynfE → | putative selenate reductase, periplasmic |
| RA | 1,660,446 | C→T | 5.3% | A793V (GCG→GTG) | ynfE → | putative selenate reductase, periplasmic |
| RA | 1,664,584 | Δ1 bp | 14.6% | coding (79/615 nt) | dmsD → | twin‑argninine leader‑binding protein for DmsA and TorA |
| RA | 1,664,591 | A→C | 11.5% | E29A (GAA→GCA) ‡ | dmsD → | twin‑argninine leader‑binding protein for DmsA and TorA |
| RA | 1,664,592 | A→T | 11.5% | E29D (GAA→GAT) ‡ | dmsD → | twin‑argninine leader‑binding protein for DmsA and TorA |
| RA | 1,664,593 | G→T | 11.6% | A30S (GCC→TCC) | dmsD → | twin‑argninine leader‑binding protein for DmsA and TorA |
| RA | 1,664,599:1 | +T | 9.2% | coding (94/615 nt) | dmsD → | twin‑argninine leader‑binding protein for DmsA and TorA |
| RA | 1,666,466 | T→G | 5.2% | Y384* (TAT→TAG) | clcB → | H(+)/Cl(‑) exchange transporter |
| RA | 1,666,468 | A→T | 5.4% | Q385L (CAG→CTG) | clcB → | H(+)/Cl(‑) exchange transporter |
| RA | 1,666,470 | C→A | 5.1% | L386I (CTA→ATA) | clcB → | H(+)/Cl(‑) exchange transporter |
| RA | 1,674,955 | A→T | 12.7% | intergenic (+8/+17) | tqsA → / ← pntB | pheromone AI‑2 transporter/pyridine nucleotide transhydrogenase, beta subunit |
| RA | 1,674,958 | A→T | 13.3% | intergenic (+11/+14) | tqsA → / ← pntB | pheromone AI‑2 transporter/pyridine nucleotide transhydrogenase, beta subunit |
| RA | 1,681,622 | T→A | 5.6% | L216Q (CTG→CAG) | folM → | dihydromonapterin reductase, NADPH‑dependent; dihydrofolate reductase isozyme |
| RA | 1,698,585 | T→G | 8.3% | E199A (GAA→GCA) | malI ← | transcriptional repressor of Mal regulon |
| RA | 1,698,587 | T→A | 8.4% | A198A (GCA→GCT) ‡ | malI ← | transcriptional repressor of Mal regulon |
| RA | 1,698,589 | C→A | 8.5% | A198S (GCA→TCA) ‡ | malI ← | transcriptional repressor of Mal regulon |
| RA | 1,702,495 | C→G | 5.1% | A88G (GCC→GGC) | add → | adenosine deaminase |
| RA | 1,703,191 | C→T | 5.3% | A320V (GCT→GTT) | add → | adenosine deaminase |
| RA | 1,703,251 | A→T | 47.1% | intergenic (+17/+17) | add → / ← ydgJ | adenosine deaminase/putative oxidoreductase |
| RA | 1,703,252 | A→T | 47.1% | intergenic (+18/+16) | add → / ← ydgJ | adenosine deaminase/putative oxidoreductase |
| RA | 1,703,593 | A→G | 5.8% | I239T (ATC→ACC) | ydgJ ← | putative oxidoreductase |
| RA | 1,703,598 | C→T | 7.8% | R237R (CGG→CGA) | ydgJ ← | putative oxidoreductase |
| RA | 1,707,226 | T→A | 5.0% | L103* (TTA→TAA) | rsxC → | SoxR iron‑sulfur cluster reduction factor component; putative membrane‑associated NADH oxidoreductase of electron transport complex |
| RA | 1,707,755 | T→A | 5.1% | A279A (GCT→GCA) | rsxC → | SoxR iron‑sulfur cluster reduction factor component; putative membrane‑associated NADH oxidoreductase of electron transport complex |
| RA | 1,736,097 | T→A | 7.4% | intergenic (+138/+24) | sodB → / ← ydhP | superoxide dismutase, Fe/putative MFS transporter, inner membrane protein |
| RA | 1,736,100 | T→A | 7.6% | intergenic (+141/+21) | sodB → / ← ydhP | superoxide dismutase, Fe/putative MFS transporter, inner membrane protein |
| RA | 1,764,687 | T→C | 13.8% | intergenic (‑301/+26) | sufA ← / ← rydB | Fe‑S cluster assembly protein/novel sRNA, function unknown |
| RA | 1,764,693 | C→T | 11.8% | intergenic (‑307/+20) | sufA ← / ← rydB | Fe‑S cluster assembly protein/novel sRNA, function unknown |
| RA | 1,764,694 | G→C | 11.8% | intergenic (‑308/+19) | sufA ← / ← rydB | Fe‑S cluster assembly protein/novel sRNA, function unknown |
| RA | 1,764,695 | A→G | 12.1% | intergenic (‑309/+18) | sufA ← / ← rydB | Fe‑S cluster assembly protein/novel sRNA, function unknown |
| RA | 1,764,701 | G→A | 13.5% | intergenic (‑315/+12) | sufA ← / ← rydB | Fe‑S cluster assembly protein/novel sRNA, function unknown |
| RA | 1,776,959 | T→G | 7.9% | L458R (CTC→CGC) | ydiF → | putative acetyl‑CoA:acetoacetyl‑CoA transferase: alpha subunit/beta subunit |
| RA | 1,789,082 | G→T | 7.1% | Q216H (CAG→CAT) | aroH → | 3‑deoxy‑D‑arabino‑heptulosonate‑7‑phosphate synthase, tryptophan repressible |
| RA | 1,789,083 | A→C | 7.6% | M217L (ATG→CTG) | aroH → | 3‑deoxy‑D‑arabino‑heptulosonate‑7‑phosphate synthase, tryptophan repressible |
| RA | 1,792,240 | T→A | 26.5% | intergenic (‑220/+27) | ydiV ← / ← nlpC | anti‑FlhD4C2 factor, inactive EAL family phosphodiesterase/putative C40 clan peptidase lipoprotein |
| RA | 1,792,241 | A→T | 36.4% | intergenic (‑221/+26) | ydiV ← / ← nlpC | anti‑FlhD4C2 factor, inactive EAL family phosphodiesterase/putative C40 clan peptidase lipoprotein |
| RA | 1,792,242 | T→A | 36.4% | intergenic (‑222/+25) | ydiV ← / ← nlpC | anti‑FlhD4C2 factor, inactive EAL family phosphodiesterase/putative C40 clan peptidase lipoprotein |
| RA | 1,797,388 | G→T | 9.3% | P186Q (CCG→CAG) | pheT ← | phenylalanine tRNA synthetase, beta subunit |
| RA | 1,797,391 | A→C | 9.4% | L185R (CTG→CGG) | pheT ← | phenylalanine tRNA synthetase, beta subunit |
| RA | 1,810,062 | T→C | 7.7% | intergenic (+14/‑149) | yniC → / → ydjM | 2‑deoxyglucose‑6‑P phosphatase/inner membrane protein regulated by LexA |
| RA | 1,823,338 | G→C | 14.7% | intergenic (+53/‑177) | nadE → / → cho | NAD synthetase, NH3/glutamine‑dependent/endonuclease of nucleotide excision repair |
| RA | 1,825,113 | G→C | 12.2% | intergenic (‑176/+27) | ves ← / ← spy | cold‑ and stress‑inducible protein/periplasmic ATP‑independent protein refolding chaperone, stress‑induced |
| RA | 1,827,811 | T→G | 7.9% | K150T (AAA→ACA) | astB ← | succinylarginine dihydrolase |
| RA | 1,827,816 | C→A | 8.9% | L148L (CTG→CTT) | astB ← | succinylarginine dihydrolase |
| RA | 1,850,715 | Δ1 bp | 18.2% | intergenic (+22/‑145) | sppA → / → ansA | protease IV (signal peptide peptidase)/cytoplasmic L‑asparaginase 1 |
| RA | 1,850,719:1 | +T | 18.2% | intergenic (+26/‑141) | sppA → / → ansA | protease IV (signal peptide peptidase)/cytoplasmic L‑asparaginase 1 |
| RA | 1,856,333 | T→G | 6.8% | E199A (GAG→GCG) ‡ | ydjH ← | putative kinase |
| RA | 1,856,334 | C→A | 6.5% | E199* (GAG→TAG) ‡ | ydjH ← | putative kinase |
| RA | 1,864,758 | G→A | 25.8% | intergenic (+24/+24) | yeaD → / ← yeaE | D‑hexose‑6‑phosphate epimerase‑like protein/aldo‑keto reductase, methylglyoxal to acetol, NADPH‑dependent |
| RA | 1,864,763 | A→T | 32.2% | intergenic (+29/+19) | yeaD → / ← yeaE | D‑hexose‑6‑phosphate epimerase‑like protein/aldo‑keto reductase, methylglyoxal to acetol, NADPH‑dependent |
| RA | 1,864,768 | T→C | 26.7% | intergenic (+34/+14) | yeaD → / ← yeaE | D‑hexose‑6‑phosphate epimerase‑like protein/aldo‑keto reductase, methylglyoxal to acetol, NADPH‑dependent |
| RA | 1,865,682 | G→C | 13.8% | intergenic (‑46/+44) | yeaE ← / ← mipA | aldo‑keto reductase, methylglyoxal to acetol, NADPH‑dependent/scaffolding protein for murein synthesizing machinery |
| RA | 1,868,859 | Δ1 bp | 5.9% | intergenic (+17/‑96) | yeaG → / → yeaH | protein kinase, endogenous substrate unidentified; autokinase/UPF0229 family protein |
| RA | 1,880,851 | T→A | 6.0% | intergenic (‑92/+35) | leuE ← / ← dmlR | leucine efflux protein/transcriptional activator of dmlA |
| RA | 1,880,852 | T→A | 6.1% | intergenic (‑93/+34) | leuE ← / ← dmlR | leucine efflux protein/transcriptional activator of dmlA |
| RA | 1,881,358 | T→A | 5.4% | D151V (GAC→GTC) | dmlR ← | transcriptional activator of dmlA |
| RA | 1,890,943 | T→C | 100% | T109A (ACC→GCC) | tsaB ← | tRNA(ANN) t(6)A37 threonylcarbamoyladenosine modification protein; binding partner and protease for TsaD |
| RA | 1,912,748 | T→G | 5.4% | intergenic (‑172/+20) | htpX ← / ← prc | putative endopeptidase/carboxy‑terminal protease for penicillin‑binding protein 3 |
| RA | 1,912,749 | T→A | 5.7% | intergenic (‑173/+19) | htpX ← / ← prc | putative endopeptidase/carboxy‑terminal protease for penicillin‑binding protein 3 |
| RA | 1,912,750 | T→A | 5.5% | intergenic (‑174/+18) | htpX ← / ← prc | putative endopeptidase/carboxy‑terminal protease for penicillin‑binding protein 3 |
| RA | 1,914,846 | A→T | 8.0% | L230Q (CTG→CAG) | proQ ← | RNA chaperone, putative ProP translation regulator |
| RA | 1,950,292 | C→G | 13.0% | A77A (GCG→GCC) | aspS ← | aspartyl‑tRNA synthetase |
| RA | 1,950,295:1 | +C | 12.8% | coding (228/1773 nt) | aspS ← | aspartyl‑tRNA synthetase |
| RA | 1,950,301 | Δ1 bp | 12.8% | coding (222/1773 nt) | aspS ← | aspartyl‑tRNA synthetase |
| RA | 1,950,306 | C→G | 14.5% | G73R (GGC→CGC) | aspS ← | aspartyl‑tRNA synthetase |
| RA | 1,954,256 | T→A | 7.9% | I272N (ATT→AAT) | cmoB → | tRNA (cmo5U34)‑carboxymethyltransferase, carboxy‑SAM‑dependent |
| RA | 1,954,436 | G→A | 5.8% | intergenic (+23/+142) | cmoB → / ← torZ | tRNA (cmo5U34)‑carboxymethyltransferase, carboxy‑SAM‑dependent/trimethylamine N‑oxide reductase system III, catalytic subunit |
| RA | 1,954,437 | C→A | 5.8% | intergenic (+24/+141) | cmoB → / ← torZ | tRNA (cmo5U34)‑carboxymethyltransferase, carboxy‑SAM‑dependent/trimethylamine N‑oxide reductase system III, catalytic subunit |
| MC JC | 1,978,503 | Δ776 bp | 100% | insB1–insA | insB1, insA | |
| RA | 1,981,814 | T→A | 6.2% | T192S (ACG→TCG) | otsB ← | trehalose‑6‑phosphate phosphatase, biosynthetic |
| RA | 1,981,815 | T→A | 6.2% | R191R (CGA→CGT) | otsB ← | trehalose‑6‑phosphate phosphatase, biosynthetic |
| RA | 1,985,112 | C→G | 12.7% | intergenic (‑43/+27) | araG ← / ← araF | L‑arabinose ABC transporter ATPase/L‑arabinose ABC transporter periplasmic binding protein |
| RA | 1,988,048 | A→T | 5.4% | intergenic (‑89/‑174) | azuC ← / → yecR | acid‑inducible small membrane‑associated protein/lipoprotein, function unknown |
| RA | 1,988,049 | C→T | 5.4% | intergenic (‑90/‑173) | azuC ← / → yecR | acid‑inducible small membrane‑associated protein/lipoprotein, function unknown |
| RA | 1,988,050 | A→G | 5.9% | intergenic (‑91/‑172) | azuC ← / → yecR | acid‑inducible small membrane‑associated protein/lipoprotein, function unknown |
| RA | 1,988,051 | A→T | 5.9% | intergenic (‑92/‑171) | azuC ← / → yecR | acid‑inducible small membrane‑associated protein/lipoprotein, function unknown |
| RA | 1,991,866 | T→A | 10.2% | noncoding (36/87 nt) | leuZ ← | tRNA‑Leu |
| RA | 1,992,083 | G→C | 6.8% | noncoding (35/76 nt) | glyW ← | tRNA‑Gly |
| RA | 2,009,731 | A→G | 6.1% | intergenic (+19/‑90) | yedF → / → yedK | putative TusA family sulfurtransferase/DUF159 family protein |
| RA | 2,009,732 | C→G | 6.1% | intergenic (+20/‑89) | yedF → / → yedK | putative TusA family sulfurtransferase/DUF159 family protein |
| RA | 2,009,733 | C→T | 6.2% | intergenic (+21/‑88) | yedF → / → yedK | putative TusA family sulfurtransferase/DUF159 family protein |
| RA | 2,025,578 | G→A | 5.3% | S23N (AGT→AAT) ‡ | yedP → | putative mannosyl‑3‑phosphoglycerate phosphatase |
| RA | 2,025,579 | T→C | 5.2% | S23S (AGT→AGC) ‡ | yedP → | putative mannosyl‑3‑phosphoglycerate phosphatase |
| RA | 2,028,158 | G→C | 6.2% | intergenic (‑141/+30) | yedQ ← / ← yodC | putative membrane‑anchored diguanylate cyclase/uncharacterized protein |
| RA | 2,028,159 | T→A | 6.2% | intergenic (‑142/+29) | yedQ ← / ← yodC | putative membrane‑anchored diguanylate cyclase/uncharacterized protein |
| RA | 2,028,160 | G→C | 6.2% | intergenic (‑143/+28) | yedQ ← / ← yodC | putative membrane‑anchored diguanylate cyclase/uncharacterized protein |
| RA | 2,041,166 | G→T | 5.9% | intergenic (+48/‑209) | yedZ → / → zinT | inner membrane heme subunit for periplasmic YedYZ reductase/zinc and cadmium binding protein, periplasmic |
| RA | 2,041,167 | A→C | 5.9% | intergenic (+49/‑208) | yedZ → / → zinT | inner membrane heme subunit for periplasmic YedYZ reductase/zinc and cadmium binding protein, periplasmic |
| RA | 2,044,721 | G→A | 7.3% | intergenic (+97/‑217) | asnT → / → yeeJ | tRNA‑Asn/putative adhesin |
| RA | 2,050,006 | C→G | 5.8% | T1690S (ACT→AGT) | yeeJ → | putative adhesin |
| RA | 2,057,595 | T→C | 22.2% | intergenic (+21/+432) | yeeN → / ← asnW | UPF0082 family protein/tRNA‑Asn |
| RA | 2,057,597 | T→G | 22.2% | intergenic (+23/+430) | yeeN → / ← asnW | UPF0082 family protein/tRNA‑Asn |
| RA | 2,057,599 | T→A | 22.2% | intergenic (+25/+428) | yeeN → / ← asnW | UPF0082 family protein/tRNA‑Asn |
| RA | 2,057,601 | C→A | 30.8% | intergenic (+27/+426) | yeeN → / ← asnW | UPF0082 family protein/tRNA‑Asn |
| RA | 2,057,603 | G→A | 30.8% | intergenic (+29/+424) | yeeN → / ← asnW | UPF0082 family protein/tRNA‑Asn |
| RA | 2,074,691 | C→G | 12.1% | intergenic (+33/‑88) | flu → / → yeeR | CP4‑44 prophage; antigen 43 (Ag43) phase‑variable biofilm formation autotransporter/CP4‑44 prophage; putative membrane protein |
| RA | 2,079,004 | G→C | 29.3% | intergenic (+73/+28) | yoeF → / ← yeeX | pseudogene, CP4‑44 putative prophage remnant;Phage or Prophage Related/UPF0265 family protein |
| RA | 2,089,854 | A→T | 10.6% | intergenic (‑141/‑142) | yefM ← / → hisL | antitoxin of the YoeB‑YefM toxin‑antitoxin system/his operon leader peptide |
| RA | 2,090,122 | A→G | 26.3% | intergenic (+76/‑70) | hisL → / → hisG | his operon leader peptide/ATP phosphoribosyltransferase |
| RA | 2,090,124 | C→G | 24.4% | intergenic (+78/‑68) | hisL → / → hisG | his operon leader peptide/ATP phosphoribosyltransferase |
| RA | 2,090,126 | C→T | 25.6% | intergenic (+80/‑66) | hisL → / → hisG | his operon leader peptide/ATP phosphoribosyltransferase |
| RA | 2,103,105 | C→A | 11.1% | pseudogene (285/446 nt) | wbbL ← | pseudogene, lipopolysaccharide biosynthesis protein |
| RA | 2,103,106 | T→A | 11.3% | pseudogene (284/446 nt) | wbbL ← | pseudogene, lipopolysaccharide biosynthesis protein |
| RA | 2,103,107 | T→G | 11.3% | pseudogene (283/446 nt) | wbbL ← | pseudogene, lipopolysaccharide biosynthesis protein |
| RA | 2,115,839 | A→C | 6.8% | F20V (TTC→GTC) | wcaM ← | colanic acid biosynthesis protein |
| RA | 2,115,847 | G→T | 8.7% | A17E (GCG→GAG) | wcaM ← | colanic acid biosynthesis protein |
| RA | 2,115,849 | C→G | 8.7% | S16S (TCG→TCC) ‡ | wcaM ← | colanic acid biosynthesis protein |
| RA | 2,115,851 | A→C | 9.1% | S16A (TCG→GCG) ‡ | wcaM ← | colanic acid biosynthesis protein |
| RA | 2,115,859 | G→T | 7.0% | T13K (ACG→AAG) | wcaM ← | colanic acid biosynthesis protein |
| RA | 2,141,796 | G→C | 5.3% | Y140* (TAC→TAG) | dcd ← | deoxycytidine triphosphate deaminase; dCTP deaminase |
| RA | 2,141,799 | G→C | 5.3% | F139L (TTC→TTG) | dcd ← | deoxycytidine triphosphate deaminase; dCTP deaminase |
| RA | 2,155,254 | A→G | 5.2% | A413A (GCA→GCG) | mdtA → | multidrug efflux system, subunit A |
| RA | 2,155,255 | C→T | 5.2% | R414C (CGC→TGC) | mdtA → | multidrug efflux system, subunit A |
| RA | 2,165,143 | C→T | 5.1% | intergenic (+145/‑46) | baeR → / → yegP | response regulator in two‑component regulatory system with BaeS/UPF0339 family protein |
| RA | 2,165,146 | T→A | 5.1% | intergenic (+148/‑43) | baeR → / → yegP | response regulator in two‑component regulatory system with BaeS/UPF0339 family protein |
| RA | 2,165,147 | T→A | 5.1% | intergenic (+149/‑42) | baeR → / → yegP | response regulator in two‑component regulatory system with BaeS/UPF0339 family protein |
| RA | 2,165,626 | T→C | 9.0% | intergenic (+105/‑42) | yegP → / → yegQ | UPF0339 family protein/putative peptidase |
| RA | 2,165,628 | A→T | 9.7% | intergenic (+107/‑40) | yegP → / → yegQ | UPF0339 family protein/putative peptidase |
| RA | 2,165,630 | G→A | 8.8% | intergenic (+109/‑38) | yegP → / → yegQ | UPF0339 family protein/putative peptidase |
| RA | 2,168,420 | A→T | 5.0% | intergenic (‑114/‑292) | yegR ← / → yegS | uncharacterized protein/phosphatidylglycerol kinase, metal‑dependent |
| RA | 2,168,423 | A→T | 7.6% | intergenic (‑117/‑289) | yegR ← / → yegS | uncharacterized protein/phosphatidylglycerol kinase, metal‑dependent |
| RA | 2,169,664 | A→T | 6.0% | intergenic (+53/+29) | yegS → / ← gatR | phosphatidylglycerol kinase, metal‑dependent/pseudogene, repressor for gat operon; interrupted by IS3; split galactitol utilization operon repressor, fragment 2; split galactitol utilization operon repressor, interrupted |
| RA | 2,169,665 | A→T | 5.9% | intergenic (+54/+28) | yegS → / ← gatR | phosphatidylglycerol kinase, metal‑dependent/pseudogene, repressor for gat operon; interrupted by IS3; split galactitol utilization operon repressor, fragment 2; split galactitol utilization operon repressor, interrupted |
| RA | 2,169,671 | T→G | 5.8% | intergenic (+60/+22) | yegS → / ← gatR | phosphatidylglycerol kinase, metal‑dependent/pseudogene, repressor for gat operon; interrupted by IS3; split galactitol utilization operon repressor, fragment 2; split galactitol utilization operon repressor, interrupted |
| RA | 2,169,672 | T→C | 5.8% | intergenic (+61/+21) | yegS → / ← gatR | phosphatidylglycerol kinase, metal‑dependent/pseudogene, repressor for gat operon; interrupted by IS3; split galactitol utilization operon repressor, fragment 2; split galactitol utilization operon repressor, interrupted |
| RA | 2,171,904 | C→G | 7.3% | E324Q (GAA→CAA) | gatD ← | galactitol‑1‑phosphate dehydrogenase, Zn‑dependent and NAD(P)‑binding |
| RA | 2,172,350 | A→T | 6.1% | L175Q (CTG→CAG) | gatD ← | galactitol‑1‑phosphate dehydrogenase, Zn‑dependent and NAD(P)‑binding |
| RA | 2,172,353 | A→T | 6.1% | L174Q (CTG→CAG) | gatD ← | galactitol‑1‑phosphate dehydrogenase, Zn‑dependent and NAD(P)‑binding |
| RA | 2,173,361 | Δ2 bp | 100% | pseudogene (1‑2/442 nt) | gatC ← | pseudogene, galactitol‑specific enzyme IIC component of PTS;transport; Transport of small molecules: Carbohydrates, organic acids, alcohols; PTS system galactitol‑specific enzyme IIC |
| RA | 2,177,332 | C→T | 9.1% | intergenic (‑128/+180) | gatY ← / ← fbaB | D‑tagatose 1,6‑bisphosphate aldolase 2, catalytic subunit/fructose‑bisphosphate aldolase class I |
| RA | 2,177,337 | G→T | 11.4% | intergenic (‑133/+175) | gatY ← / ← fbaB | D‑tagatose 1,6‑bisphosphate aldolase 2, catalytic subunit/fructose‑bisphosphate aldolase class I |
| RA | 2,177,340 | A→C | 11.4% | intergenic (‑136/+172) | gatY ← / ← fbaB | D‑tagatose 1,6‑bisphosphate aldolase 2, catalytic subunit/fructose‑bisphosphate aldolase class I |
| RA | 2,177,345 | A→G | 10.8% | intergenic (‑141/+167) | gatY ← / ← fbaB | D‑tagatose 1,6‑bisphosphate aldolase 2, catalytic subunit/fructose‑bisphosphate aldolase class I |
| RA | 2,180,043 | C→T | 100% | T408M (ACG→ATG) | yegT → | nucleoside transporter, low affinity |
| RA | 2,187,314 | C→G | 5.1% | intergenic (+16/+66) | rcnB → / ← yehA | periplasmic modulator of Ni and Co efflux/putative fimbrial‑like adhesin protein |
| RA | 2,252,810 | T→G | 7.0% | intergenic (+22/+85) | yeiI → / ← nupX | putative kinase/nucleoside permease |
| RA | 2,252,812 | A→T | 7.0% | intergenic (+24/+83) | yeiI → / ← nupX | putative kinase/nucleoside permease |
| RA | 2,252,814 | C→A | 7.6% | intergenic (+26/+81) | yeiI → / ← nupX | putative kinase/nucleoside permease |
| RA | 2,252,820 | T→G | 6.1% | intergenic (+32/+75) | yeiI → / ← nupX | putative kinase/nucleoside permease |
| RA | 2,252,821 | T→C | 6.1% | intergenic (+33/+74) | yeiI → / ← nupX | putative kinase/nucleoside permease |
| RA | 2,279,419 | C→T | 5.4% | A114A (GCG→GCA) | bcr ← | bicyclomycin/cysteine/sulfonamide efflux transporter |
| RA | 2,279,422 | A→G | 5.4% | A113A (GCT→GCC) | bcr ← | bicyclomycin/cysteine/sulfonamide efflux transporter |
| RA | 2,279,425 | C→T | 5.4% | A112A (GCG→GCA) | bcr ← | bicyclomycin/cysteine/sulfonamide efflux transporter |
| RA | 2,286,139 | A→T | 8.6% | intergenic (+3/‑72) | yejM → / → proL | essential inner membrane DUF3413 domain‑containing protein; lipid A production and membrane permeability factor/tRNA‑Pro |
| RA | 2,286,142 | T→A | 8.8% | intergenic (+6/‑69) | yejM → / → proL | essential inner membrane DUF3413 domain‑containing protein; lipid A production and membrane permeability factor/tRNA‑Pro |
| RA | 2,286,145 | A→T | 7.8% | intergenic (+9/‑66) | yejM → / → proL | essential inner membrane DUF3413 domain‑containing protein; lipid A production and membrane permeability factor/tRNA‑Pro |
| RA | 2,286,311 | C→G | 21.9% | intergenic (+24/+79) | proL → / ← yejO | tRNA‑Pro/pseudogene, autotransporter outer membrane homology;putative transport; Not classified; putative ATP‑binding component of a transport system |
| RA | 2,286,313 | T→A | 21.3% | intergenic (+26/+77) | proL → / ← yejO | tRNA‑Pro/pseudogene, autotransporter outer membrane homology;putative transport; Not classified; putative ATP‑binding component of a transport system |
| RA | 2,286,315 | C→G | 21.6% | intergenic (+28/+75) | proL → / ← yejO | tRNA‑Pro/pseudogene, autotransporter outer membrane homology;putative transport; Not classified; putative ATP‑binding component of a transport system |
| RA | 2,304,522 | G→T | 9.0% | intergenic (+129/+586) | eco → / ← mqo | ecotin, a serine protease inhibitor/malate dehydrogenase, FAD/NAD(P)‑binding domain |
| RA | 2,304,523 | G→C | 9.2% | intergenic (+130/+585) | eco → / ← mqo | ecotin, a serine protease inhibitor/malate dehydrogenase, FAD/NAD(P)‑binding domain |
| RA | 2,305,013 | A→G | 6.5% | intergenic (+620/+95) | eco → / ← mqo | ecotin, a serine protease inhibitor/malate dehydrogenase, FAD/NAD(P)‑binding domain |
| RA | 2,305,019 | T→C | 7.3% | intergenic (+626/+89) | eco → / ← mqo | ecotin, a serine protease inhibitor/malate dehydrogenase, FAD/NAD(P)‑binding domain |
| RA | 2,305,085 | A→G | 30.5% | intergenic (+692/+23) | eco → / ← mqo | ecotin, a serine protease inhibitor/malate dehydrogenase, FAD/NAD(P)‑binding domain |
| RA | 2,305,086 | C→G | 33.3% | intergenic (+693/+22) | eco → / ← mqo | ecotin, a serine protease inhibitor/malate dehydrogenase, FAD/NAD(P)‑binding domain |
| RA | 2,305,087 | C→T | 33.3% | intergenic (+694/+21) | eco → / ← mqo | ecotin, a serine protease inhibitor/malate dehydrogenase, FAD/NAD(P)‑binding domain |
| RA | 2,314,800 | A→C | 9.9% | Q438P (CAG→CCG) ‡ | rcsD → | phosphotransfer intermediate protein in two‑component regulatory system with RcsBC |
| RA | 2,314,801 | G→T | 10.1% | Q438H (CAG→CAT) ‡ | rcsD → | phosphotransfer intermediate protein in two‑component regulatory system with RcsBC |
| RA | 2,336,763 | A→C | 6.4% | intergenic (‑119/+30) | yfaA ← / ← gyrA | DUF2138 family protein, putative host defense protein/DNA gyrase (type II topoisomerase), subunit A |
| RA | 2,336,766 | G→T | 6.3% | intergenic (‑122/+27) | yfaA ← / ← gyrA | DUF2138 family protein, putative host defense protein/DNA gyrase (type II topoisomerase), subunit A |
| RA | 2,340,372 | A→G | 10.3% | intergenic (+83/+45) | ubiG → / ← yfaL | bifunctional 3‑demethylubiquinone‑9 3‑methyltransferase/ 2‑octaprenyl‑6‑hydroxy phenol methylase/adhesin |
| RA | 2,340,373 | A→C | 10.6% | intergenic (+84/+44) | ubiG → / ← yfaL | bifunctional 3‑demethylubiquinone‑9 3‑methyltransferase/ 2‑octaprenyl‑6‑hydroxy phenol methylase/adhesin |
| RA | 2,340,379 | T→A | 10.1% | intergenic (+90/+38) | ubiG → / ← yfaL | bifunctional 3‑demethylubiquinone‑9 3‑methyltransferase/ 2‑octaprenyl‑6‑hydroxy phenol methylase/adhesin |
| RA | 2,340,380 | T→A | 10.1% | intergenic (+91/+37) | ubiG → / ← yfaL | bifunctional 3‑demethylubiquinone‑9 3‑methyltransferase/ 2‑octaprenyl‑6‑hydroxy phenol methylase/adhesin |
| RA | 2,375,483 | A→T | 9.2% | L160L (CTT→CTA) ‡ | menC ← | O‑succinylbenzoyl‑CoA synthase |
| RA | 2,375,484 | A→T | 9.3% | L160H (CTT→CAT) ‡ | menC ← | O‑succinylbenzoyl‑CoA synthase |
| RA | 2,383,956 | A→T | 22.9% | intergenic (+32/+39) | elaD → / ← yfbK | protease, capable of cleaving an AMC‑ubiquitin model substrate/Von Willebrand factor domain putative lipoprotein |
| RA | 2,383,959 | A→T | 23.5% | intergenic (+35/+36) | elaD → / ← yfbK | protease, capable of cleaving an AMC‑ubiquitin model substrate/Von Willebrand factor domain putative lipoprotein |
| RA | 2,390,012 | Δ1 bp | 9.1% | intergenic (+48/+36) | yfbP → / ← nuoN | TPR‑like repeats‑containing protein/NADH:ubiquinone oxidoreductase, membrane subunit N |
| RA | 2,390,016:1 | +C | 9.2% | intergenic (+52/+32) | yfbP → / ← nuoN | TPR‑like repeats‑containing protein/NADH:ubiquinone oxidoreductase, membrane subunit N |
| RA | 2,391,414 | C→G | 5.4% | R31P (CGA→CCA) | nuoN ← | NADH:ubiquinone oxidoreductase, membrane subunit N |
| RA | 2,391,417 | C→G | 5.2% | W30S (TGG→TCG) | nuoN ← | NADH:ubiquinone oxidoreductase, membrane subunit N |
| RA | 2,416,941 | A→G | 7.6% | intergenic (+50/‑140) | pta → / → yfcC | phosphate acetyltransferase/putative inner membrane transporter; C4‑dicarboxylate anaerobic carrier family protein |
| RA | 2,416,943 | C→G | 7.3% | intergenic (+52/‑138) | pta → / → yfcC | phosphate acetyltransferase/putative inner membrane transporter; C4‑dicarboxylate anaerobic carrier family protein |
| RA | 2,416,945 | C→T | 7.6% | intergenic (+54/‑136) | pta → / → yfcC | phosphate acetyltransferase/putative inner membrane transporter; C4‑dicarboxylate anaerobic carrier family protein |
| RA | 2,425,968 | T→G | 7.0% | intergenic (‑52/+38) | hisQ ← / ← hisJ | histidine ABC transporter permease/histidine ABC transporter periplasmic binding protein |
| RA | 2,425,971 | C→A | 7.3% | intergenic (‑55/+35) | hisQ ← / ← hisJ | histidine ABC transporter permease/histidine ABC transporter periplasmic binding protein |
| RA | 2,425,975 | A→G | 7.1% | intergenic (‑59/+31) | hisQ ← / ← hisJ | histidine ABC transporter permease/histidine ABC transporter periplasmic binding protein |
| RA | 2,432,985 | A→G | 7.1% | intergenic (‑43/+27) | folC ← / ← accD | bifunctional folylpolyglutamate synthase/ dihydrofolate synthase/acetyl‑CoA carboxylase, beta (carboxyltransferase) subunit |
| RA | 2,432,990 | G→C | 7.0% | intergenic (‑48/+22) | folC ← / ← accD | bifunctional folylpolyglutamate synthase/ dihydrofolate synthase/acetyl‑CoA carboxylase, beta (carboxyltransferase) subunit |
| RA | 2,432,995 | C→T | 8.8% | intergenic (‑53/+17) | folC ← / ← accD | bifunctional folylpolyglutamate synthase/ dihydrofolate synthase/acetyl‑CoA carboxylase, beta (carboxyltransferase) subunit |
| RA | 2,449,162 | T→A | 6.2% | intergenic (+5/+66) | smrB → / ← yfcO | putative DNA endonuclease/DUF2544 family putative outer membrane protein |
| RA | 2,462,677 | A→T | 10.6% | intergenic (+31/‑335) | fadL → / → yfdF | long‑chain fatty acid outer membrane transporter/uncharacterized protein |
| RA | 2,462,678 | T→A | 10.9% | intergenic (+32/‑334) | fadL → / → yfdF | long‑chain fatty acid outer membrane transporter/uncharacterized protein |
| RA | 2,462,679 | A→T | 10.0% | intergenic (+33/‑333) | fadL → / → yfdF | long‑chain fatty acid outer membrane transporter/uncharacterized protein |
| RA | 2,474,878 | T→C | 7.7% | intergenic (+22/‑106) | yfdQ → / → yfdR | CPS‑53 (KpLE1) prophage; uncharacterized protein/CPS‑53 (KpLE1) prophage; conserved protein |
| RA | 2,474,881 | G→A | 8.3% | intergenic (+25/‑103) | yfdQ → / → yfdR | CPS‑53 (KpLE1) prophage; uncharacterized protein/CPS‑53 (KpLE1) prophage; conserved protein |
| RA | 2,483,900 | T→A | 5.5% | V49D (GTC→GAC) | evgA → | response regulator in two‑component regulatory system with EvgS |
| RA | 2,493,562 | T→A | 9.7% | intergenic (‑308/+205) | frc ← / ← yfdX | formyl‑CoA transferase, NAD(P)‑binding/uncharacterized protein |
| RA | 2,493,563 | T→A | 9.7% | intergenic (‑309/+204) | frc ← / ← yfdX | formyl‑CoA transferase, NAD(P)‑binding/uncharacterized protein |
| RA | 2,504,200 | T→C | 5.4% | T96A (ACG→GCG) | fryA ← | putative PTS enzyme: Hpr, enzyme I and IIA components |
| RA | 2,518,082 | C→G | 6.5% | noncoding (35/76 nt) | alaX ← | tRNA‑Ala |
| RA | 2,518,197 | C→G | 5.6% | noncoding (35/76 nt) | alaW ← | tRNA‑Ala |
| RA | 2,519,222 | T→G | 7.0% | intergenic (+17/+35) | yfeD → / ← gltX | DUF1323 family putative DNA‑binding protein/glutamyl‑tRNA synthetase |
| RA | 2,519,225 | T→A | 7.0% | intergenic (+20/+32) | yfeD → / ← gltX | DUF1323 family putative DNA‑binding protein/glutamyl‑tRNA synthetase |
| RA | 2,519,228 | C→A | 6.9% | intergenic (+23/+29) | yfeD → / ← gltX | DUF1323 family putative DNA‑binding protein/glutamyl‑tRNA synthetase |
| RA | 2,521,344 | C→T | 37.5% | intergenic (+16/+249) | lysV → / ← xapR | tRNA‑Lys/transcriptional activator of xapAB |
| RA | 2,521,346 | A→T | 50.0% | intergenic (+18/+247) | lysV → / ← xapR | tRNA‑Lys/transcriptional activator of xapAB |
| RA | 2,521,348 | A→G | 50.0% | intergenic (+20/+245) | lysV → / ← xapR | tRNA‑Lys/transcriptional activator of xapAB |
| RA | 2,525,907 | G→A | 5.7% | intergenic (+16/+23) | yfeN → / ← yfeR | putative outer membrane protein/transcriptional regulator of yefH |
| RA | 2,525,908 | C→G | 5.5% | intergenic (+17/+22) | yfeN → / ← yfeR | putative outer membrane protein/transcriptional regulator of yefH |
| RA | 2,532,268 | T→C | 6.6% | intergenic (+44/‑141) | cysZ → / → cysK | sulfate transporter, sulfite inhibited/cysteine synthase A, O‑acetylserine sulfhydrolase A subunit |
| RA | 2,532,272 | T→A | 6.4% | intergenic (+48/‑137) | cysZ → / → cysK | sulfate transporter, sulfite inhibited/cysteine synthase A, O‑acetylserine sulfhydrolase A subunit |
| RA | 2,532,275 | T→A | 6.6% | intergenic (+51/‑134) | cysZ → / → cysK | sulfate transporter, sulfite inhibited/cysteine synthase A, O‑acetylserine sulfhydrolase A subunit |
| RA | 2,532,279 | G→A | 6.8% | intergenic (+55/‑130) | cysZ → / → cysK | sulfate transporter, sulfite inhibited/cysteine synthase A, O‑acetylserine sulfhydrolase A subunit |
| RA | 2,549,533 | G→C | 7.4% | intergenic (+127/+113) | yfeW → / ← yfeX | penicillin binding protein PBP4B; weak DD‑carboxypeptidase activity/porphyrinogen oxidase, cytoplasmic |
| RA | 2,549,541 | A→G | 14.5% | intergenic (+135/+105) | yfeW → / ← yfeX | penicillin binding protein PBP4B; weak DD‑carboxypeptidase activity/porphyrinogen oxidase, cytoplasmic |
| RA | 2,549,542 | A→C | 14.5% | intergenic (+136/+104) | yfeW → / ← yfeX | penicillin binding protein PBP4B; weak DD‑carboxypeptidase activity/porphyrinogen oxidase, cytoplasmic |
| RA | 2,549,548 | T→G | 16.2% | intergenic (+142/+98) | yfeW → / ← yfeX | penicillin binding protein PBP4B; weak DD‑carboxypeptidase activity/porphyrinogen oxidase, cytoplasmic |
| RA | 2,549,549 | C→A | 15.9% | intergenic (+143/+97) | yfeW → / ← yfeX | penicillin binding protein PBP4B; weak DD‑carboxypeptidase activity/porphyrinogen oxidase, cytoplasmic |
| RA | 2,549,555 | G→T | 11.1% | intergenic (+149/+91) | yfeW → / ← yfeX | penicillin binding protein PBP4B; weak DD‑carboxypeptidase activity/porphyrinogen oxidase, cytoplasmic |
| RA | 2,549,556 | C→T | 11.8% | intergenic (+150/+90) | yfeW → / ← yfeX | penicillin binding protein PBP4B; weak DD‑carboxypeptidase activity/porphyrinogen oxidase, cytoplasmic |
| RA | 2,549,601 | T→G | 6.7% | intergenic (+195/+45) | yfeW → / ← yfeX | penicillin binding protein PBP4B; weak DD‑carboxypeptidase activity/porphyrinogen oxidase, cytoplasmic |
| RA | 2,549,608 | T→C | 7.7% | intergenic (+202/+38) | yfeW → / ← yfeX | penicillin binding protein PBP4B; weak DD‑carboxypeptidase activity/porphyrinogen oxidase, cytoplasmic |
| RA | 2,549,609 | G→A | 7.7% | intergenic (+203/+37) | yfeW → / ← yfeX | penicillin binding protein PBP4B; weak DD‑carboxypeptidase activity/porphyrinogen oxidase, cytoplasmic |
| RA | 2,549,616 | C→A | 8.0% | intergenic (+210/+30) | yfeW → / ← yfeX | penicillin binding protein PBP4B; weak DD‑carboxypeptidase activity/porphyrinogen oxidase, cytoplasmic |
| RA | 2,550,574 | C→G | 8.2% | intergenic (‑29/+67) | yfeX ← / ← yfeY | porphyrinogen oxidase, cytoplasmic/RpoE‑regulated lipoprotein |
| RA | 2,550,576 | A→T | 8.2% | intergenic (‑31/+65) | yfeX ← / ← yfeY | porphyrinogen oxidase, cytoplasmic/RpoE‑regulated lipoprotein |
| RA | 2,550,578 | C→G | 8.7% | intergenic (‑33/+63) | yfeX ← / ← yfeY | porphyrinogen oxidase, cytoplasmic/RpoE‑regulated lipoprotein |
| RA | 2,555,201 | T→C | 5.3% | intergenic (‑19/+27) | eutR ← / ← eutK | eut operon transcriptional activator, AraC family/putative ethanol utilization carboxysome structural protein |
| RA | 2,555,202 | G→C | 5.6% | intergenic (‑20/+26) | eutR ← / ← eutK | eut operon transcriptional activator, AraC family/putative ethanol utilization carboxysome structural protein |
| RA | 2,555,205 | G→C | 5.1% | intergenic (‑23/+23) | eutR ← / ← eutK | eut operon transcriptional activator, AraC family/putative ethanol utilization carboxysome structural protein |
| RA | 2,555,206 | G→A | 5.1% | intergenic (‑24/+22) | eutR ← / ← eutK | eut operon transcriptional activator, AraC family/putative ethanol utilization carboxysome structural protein |
| RA | 2,560,317 | A→C | 8.5% | N21H (AAT→CAT) | yffL → | CPZ‑55 prophage; uncharacterized protein |
| RA | 2,560,321 | C→T | 8.8% | A22V (GCT→GTT) | yffL → | CPZ‑55 prophage; uncharacterized protein |
| RA | 2,560,326 | A→G | 6.6% | T24A (ACA→GCA) | yffL → | CPZ‑55 prophage; uncharacterized protein |
| RA | 2,560,330 | G→T | 6.1% | C25F (TGC→TTC) | yffL → | CPZ‑55 prophage; uncharacterized protein |
| RA | 2,561,205 | A→T | 5.6% | intergenic (+307/‑163) | yffL → / → yffM | CPZ‑55 prophage; uncharacterized protein/CPZ‑55 prophage; uncharacterized protein |
| RA | 2,561,206 | A→T | 5.6% | intergenic (+308/‑162) | yffL → / → yffM | CPZ‑55 prophage; uncharacterized protein/CPZ‑55 prophage; uncharacterized protein |
| RA | 2,566,266 | C→A | 7.3% | G207C (GGC→TGC) | eutA ← | reactivating factor for ethanolamine ammonia lyase |
| RA | 2,566,267 | T→G | 7.5% | A206A (GCA→GCC) | eutA ← | reactivating factor for ethanolamine ammonia lyase |
| RA | 2,566,490 | C→T | 8.4% | G132D (GGT→GAT) | eutA ← | reactivating factor for ethanolamine ammonia lyase |
| RA | 2,566,493 | G→C | 8.3% | A131G (GCC→GGC) | eutA ← | reactivating factor for ethanolamine ammonia lyase |
| RA | 2,566,496 | A→G | 8.5% | I130T (ATC→ACC) | eutA ← | reactivating factor for ethanolamine ammonia lyase |
| RA | 2,568,191 | T→C | 13.9% | intergenic (‑84/+133) | eutH ← / ← eutG | ethanolamine transporter/ethanol dehydrogenase involved in ethanolamine utilization; aldehyde reductase |
| RA | 2,568,199 | A→G | 12.6% | intergenic (‑92/+125) | eutH ← / ← eutG | ethanolamine transporter/ethanol dehydrogenase involved in ethanolamine utilization; aldehyde reductase |
| RA | 2,568,204 | G→T | 13.1% | intergenic (‑97/+120) | eutH ← / ← eutG | ethanolamine transporter/ethanol dehydrogenase involved in ethanolamine utilization; aldehyde reductase |
| RA | 2,579,154 | A→C | 9.8% | A163A (GCA→GCC) | talA → | transaldolase A |
| RA | 2,579,157 | G→T | 10.1% | R164R (CGG→CGT) | talA → | transaldolase A |
| RA | 2,581,762 | G→A | 14.7% | A339V (GCC→GTC) | ypfG ← | DUF1176 family protein |
| RA | 2,581,765 | T→C | 15.0% | D338G (GAC→GGC) | ypfG ← | DUF1176 family protein |
| RA | 2,589,122 | G→A | 5.7% | G510S (GGC→AGC) | acrD → | aminoglycoside/multidrug efflux system |
| RA | 2,589,125 | T→C | 5.3% | F511L (TTT→CTT) | acrD → | aminoglycoside/multidrug efflux system |
| RA | 2,590,767 | T→C | 9.0% | intergenic (+59/+40) | acrD → / ← ypfM | aminoglycoside/multidrug efflux system/stress‑induced small enterobacterial protein |
| RA | 2,590,771 | C→G | 8.3% | intergenic (+63/+36) | acrD → / ← ypfM | aminoglycoside/multidrug efflux system/stress‑induced small enterobacterial protein |
| RA | 2,590,775 | G→A | 8.3% | intergenic (+67/+32) | acrD → / ← ypfM | aminoglycoside/multidrug efflux system/stress‑induced small enterobacterial protein |
| RA | 2,596,873 | Δ1 bp | 8.0% | intergenic (‑136/+32) | ypfJ ← / ← purC | putative neutral zinc metallopeptidase/phosphoribosylaminoimidazole‑succinocarboxamide synthetase |
| RA | 2,596,878:1 | +G | 8.3% | intergenic (‑141/+27) | ypfJ ← / ← purC | putative neutral zinc metallopeptidase/phosphoribosylaminoimidazole‑succinocarboxamide synthetase |
| RA | 2,620,216 | C→T | 21.0% | intergenic (‑56/+30) | uraA ← / ← upp | uracil permease/uracil phosphoribosyltransferase |
| RA | 2,620,218 | T→A | 21.1% | intergenic (‑58/+28) | uraA ← / ← upp | uracil permease/uracil phosphoribosyltransferase |
| RA | 2,620,220 | A→G | 25.0% | intergenic (‑60/+26) | uraA ← / ← upp | uracil permease/uracil phosphoribosyltransferase |
| RA | 2,622,348:1 | +A | 6.0% | coding (115/639 nt) | purN → | phosphoribosylglycinamide formyltransferase 1 |
| RA | 2,622,354 | Δ1 bp | 6.0% | coding (121/639 nt) | purN → | phosphoribosylglycinamide formyltransferase 1 |
| RA | 2,632,584 | A→T | 6.1% | intergenic (‑49/+20) | guaA ← / ← guaB | GMP synthetase (glutamine aminotransferase)/IMP dehydrogenase |
| RA | 2,632,586 | G→C | 5.8% | intergenic (‑51/+18) | guaA ← / ← guaB | GMP synthetase (glutamine aminotransferase)/IMP dehydrogenase |
| RA | 2,632,588 | A→T | 6.2% | intergenic (‑53/+16) | guaA ← / ← guaB | GMP synthetase (glutamine aminotransferase)/IMP dehydrogenase |
| RA | 2,637,433 | C→T | 25.0% | intergenic (‑77/+41) | der ← / ← bamB | GTPase; multicopy suppressor of ftsJ/BamABCDE complex OM biogenesis lipoprotein |
| RA | 2,637,438 | T→G | 23.6% | intergenic (‑82/+36) | der ← / ← bamB | GTPase; multicopy suppressor of ftsJ/BamABCDE complex OM biogenesis lipoprotein |
| RA | 2,637,439 | C→A | 23.6% | intergenic (‑83/+35) | der ← / ← bamB | GTPase; multicopy suppressor of ftsJ/BamABCDE complex OM biogenesis lipoprotein |
| RA | 2,637,444 | A→G | 24.3% | intergenic (‑88/+30) | der ← / ← bamB | GTPase; multicopy suppressor of ftsJ/BamABCDE complex OM biogenesis lipoprotein |
| RA | 2,638,584 | A→T | 6.3% | F23L (TTT→TTA) | bamB ← | BamABCDE complex OM biogenesis lipoprotein |
| RA | 2,652,131 | G→T | 6.4% | P53T (CCG→ACG) | yfhM ← | bacterial alpha2‑macroglobulin colonization factor ECAM; anti‑host protease defense factor; periplasmic inner membrane‑anchored lipoprotein |
| RA | 2,652,132 | C→G | 5.6% | V52V (GTG→GTC) ‡ | yfhM ← | bacterial alpha2‑macroglobulin colonization factor ECAM; anti‑host protease defense factor; periplasmic inner membrane‑anchored lipoprotein |
| RA | 2,652,133 | A→C | 5.9% | V52G (GTG→GGG) ‡ | yfhM ← | bacterial alpha2‑macroglobulin colonization factor ECAM; anti‑host protease defense factor; periplasmic inner membrane‑anchored lipoprotein |
| RA | 2,653,104 | G→C | 7.0% | W204S (TGG→TCG) ‡ | sseA → | 3‑mercaptopyruvate sulfurtransferase |
| RA | 2,653,105 | G→C | 6.9% | W204C (TGG→TGC) ‡ | sseA → | 3‑mercaptopyruvate sulfurtransferase |
| RA | 2,653,367 | G→A | 48.4% | intergenic (+28/‑488) | sseA → / → ryfA | 3‑mercaptopyruvate sulfurtransferase/novel sRNA, function unknown |
| RA | 2,653,372 | T→C | 42.4% | intergenic (+33/‑483) | sseA → / → ryfA | 3‑mercaptopyruvate sulfurtransferase/novel sRNA, function unknown |
| RA | 2,660,612 | T→A | 5.0% | Y307F (TAC→TTC) ‡ | iscS ← | cysteine desulfurase (tRNA sulfurtransferase), PLP‑dependent |
| RA | 2,660,613 | A→C | 5.2% | Y307D (TAC→GAC) ‡ | iscS ← | cysteine desulfurase (tRNA sulfurtransferase), PLP‑dependent |
| RA | 2,663,466 | G→T | 7.4% | V9L (GTG→TTG) | suhB → | inositol monophosphatase |
| RA | 2,663,474 | A→T | 7.6% | A11A (GCA→GCT) | suhB → | inositol monophosphatase |
| RA | 2,673,783 | G→A | 9.2% | intergenic (+15/+33) | yphA → / ← yphB | DoxX family inner membrane protein/mutarotase superfamily protein, YphB family |
| RA | 2,673,784 | C→A | 9.3% | intergenic (+16/+32) | yphA → / ← yphB | DoxX family inner membrane protein/mutarotase superfamily protein, YphB family |
| RA | 2,673,790 | G→T | 8.2% | intergenic (+22/+26) | yphA → / ← yphB | DoxX family inner membrane protein/mutarotase superfamily protein, YphB family |
| RA | 2,673,791 | A→C | 8.2% | intergenic (+23/+25) | yphA → / ← yphB | DoxX family inner membrane protein/mutarotase superfamily protein, YphB family |
| RA | 2,673,797 | T→G | 8.6% | intergenic (+29/+19) | yphA → / ← yphB | DoxX family inner membrane protein/mutarotase superfamily protein, YphB family |
| RA | 2,673,798 | T→C | 8.6% | intergenic (+30/+18) | yphA → / ← yphB | DoxX family inner membrane protein/mutarotase superfamily protein, YphB family |
| RA | 2,691,169 | A→T | 8.9% | noncoding (172/184 nt) | glmY ← | sRNA activator of glmS mRNA, glmZ processing antagonist |
| RA | 2,691,171 | T→A | 9.0% | noncoding (170/184 nt) | glmY ← | sRNA activator of glmS mRNA, glmZ processing antagonist |
| RA | 2,691,173 | A→T | 9.3% | noncoding (168/184 nt) | glmY ← | sRNA activator of glmS mRNA, glmZ processing antagonist |
| RA | 2,704,304 | A→G | 27.6% | intergenic (‑241/+31) | rnc ← / ← lepB | RNase III/leader peptidase (signal peptidase I) |
| RA | 2,704,306 | A→T | 25.0% | intergenic (‑243/+29) | rnc ← / ← lepB | RNase III/leader peptidase (signal peptidase I) |
| RA | 2,704,308 | C→T | 23.5% | intergenic (‑245/+27) | rnc ← / ← lepB | RNase III/leader peptidase (signal peptidase I) |
| RA | 2,706,121:1 | +T | 10.1% | coding (1004/1800 nt) | lepA ← | back‑translocating elongation factor EF4, GTPase |
| RA | 2,706,134 | Δ1 bp | 9.9% | coding (991/1800 nt) | lepA ← | back‑translocating elongation factor EF4, GTPase |
| RA | 2,707,320 | A→T | 7.0% | intergenic (‑196/+2) | lepA ← / ← rseC | back‑translocating elongation factor EF4, GTPase/SoxR iron‑sulfur cluster reduction factor component |
| RA | 2,707,321 | A→T | 7.0% | intergenic (‑197/+1) | lepA ← / ← rseC | back‑translocating elongation factor EF4, GTPase/SoxR iron‑sulfur cluster reduction factor component |
| RA | 2,715,258 | A→G | 5.3% | A21A (GCT→GCC) ‡ | yfiE ← | putative DNA‑binding transcriptional regulator |
| RA | 2,715,259 | G→C | 5.3% | A21G (GCT→GGT) ‡ | yfiE ← | putative DNA‑binding transcriptional regulator |
| RA | 2,715,260 | C→T | 5.3% | A21T (GCT→ACT) ‡ | yfiE ← | putative DNA‑binding transcriptional regulator |
| RA | 2,716,030 | T→G | 14.1% | intergenic (+20/+36) | eamB → / ← grcA | cysteine and O‑acetylserine exporter/autonomous glycyl radical cofactor |
| RA | 2,716,033 | C→A | 16.9% | intergenic (+23/+33) | eamB → / ← grcA | cysteine and O‑acetylserine exporter/autonomous glycyl radical cofactor |
| RA | 2,720,209 | T→C | 9.5% | L86P (CTG→CCG) ‡ | pka → | protein lysine acetyltransferase |
| RA | 2,720,210 | G→A | 8.6% | L86L (CTG→CTA) ‡ | pka → | protein lysine acetyltransferase |
| RA | 2,724,095 | C→A | 6.2% | intergenic (+13/‑33) | pssA → / → yfiM | phosphatidylserine synthase; CDP‑diacylglycerol‑serine O‑phosphatidyltransferase/putative lipoprotein |
| RA | 2,724,097 | T→A | 6.2% | intergenic (+15/‑31) | pssA → / → yfiM | phosphatidylserine synthase; CDP‑diacylglycerol‑serine O‑phosphatidyltransferase/putative lipoprotein |
| RA | 2,724,099 | T→G | 6.2% | intergenic (+17/‑29) | pssA → / → yfiM | phosphatidylserine synthase; CDP‑diacylglycerol‑serine O‑phosphatidyltransferase/putative lipoprotein |
| RA | 2,731,073 | A→T | 5.9% | noncoding (85/1542 nt) | rrsG ← | 16S ribosomal RNA of rrnG operon |
| RA | 2,731,074 | A→T | 5.8% | noncoding (84/1542 nt) | rrsG ← | 16S ribosomal RNA of rrnG operon |
| RA | 2,737,703 | A→G | 6.5% | intergenic (+57/‑42) | pheL → / → pheA | pheA gene leader peptide/chorismate mutase and prephenate dehydratase, P‑protein |
| RA | 2,737,705 | A→T | 6.5% | intergenic (+59/‑40) | pheL → / → pheA | pheA gene leader peptide/chorismate mutase and prephenate dehydratase, P‑protein |
| RA | 2,737,707 | C→T | 6.2% | intergenic (+61/‑38) | pheL → / → pheA | pheA gene leader peptide/chorismate mutase and prephenate dehydratase, P‑protein |
| RA | 2,737,711 | G→A | 7.2% | intergenic (+65/‑34) | pheL → / → pheA | pheA gene leader peptide/chorismate mutase and prephenate dehydratase, P‑protein |
| RA | 2,743,187 | A→G | 5.4% | T269A (ACG→GCG) ‡ | yfiN → | putative membrane‑anchored diguanylate cyclase |
| RA | 2,743,188 | C→T | 5.6% | T269M (ACG→ATG) ‡ | yfiN → | putative membrane‑anchored diguanylate cyclase |
| RA | 2,750,073 | G→T | 14.5% | intergenic (+13/+42) | yfjD → / ← grpE | UPF0053 family inner membrane protein/heat shock protein |
| RA | 2,750,078 | T→G | 16.3% | intergenic (+18/+37) | yfjD → / ← grpE | UPF0053 family inner membrane protein/heat shock protein |
| RA | 2,750,081 | C→A | 16.9% | intergenic (+21/+34) | yfjD → / ← grpE | UPF0053 family inner membrane protein/heat shock protein |
| RA | 2,750,086 | A→C | 16.2% | intergenic (+26/+29) | yfjD → / ← grpE | UPF0053 family inner membrane protein/heat shock protein |
| RA | 2,753,986 | A→T | 12.9% | intergenic (+40/+22) | bamE → / ← ratB | lipoprotein component of BamABCDE OM biogenesis complex/UPF0125 family protein |
| RA | 2,761,620 | T→G | 12.0% | K641Q (AAG→CAG) | yfjK ← | radiation resistance protein; DEAD/H helicase‑like protein; CP4‑57 putative defective prophage |
| RA | 2,761,623 | C→A | 11.8% | V640L (GTA→TTA) | yfjK ← | radiation resistance protein; DEAD/H helicase‑like protein; CP4‑57 putative defective prophage |
| RA | 2,767,667 | T→G | 28.6% | intergenic (+312/‑43) | rnlB → / → yfjP | CP4‑57 prophage; uncharacterized protein/CP4‑57 prophage; 50S ribosome‑binding GTPase family protein |
| RA | 2,767,670 | C→A | 30.0% | intergenic (+315/‑40) | rnlB → / → yfjP | CP4‑57 prophage; uncharacterized protein/CP4‑57 prophage; 50S ribosome‑binding GTPase family protein |
| RA | 2,768,609 | T→C | 8.0% | intergenic (+36/‑56) | yfjP → / → yfjQ | CP4‑57 prophage; 50S ribosome‑binding GTPase family protein/CP4‑57 prophage; uncharacterized protein |
| RA | 2,768,614 | A→C | 7.8% | intergenic (+41/‑51) | yfjP → / → yfjQ | CP4‑57 prophage; 50S ribosome‑binding GTPase family protein/CP4‑57 prophage; uncharacterized protein |
| RA | 2,768,615 | G→T | 7.8% | intergenic (+42/‑50) | yfjP → / → yfjQ | CP4‑57 prophage; 50S ribosome‑binding GTPase family protein/CP4‑57 prophage; uncharacterized protein |
| RA | 2,768,620 | G→A | 8.1% | intergenic (+47/‑45) | yfjP → / → yfjQ | CP4‑57 prophage; 50S ribosome‑binding GTPase family protein/CP4‑57 prophage; uncharacterized protein |
| RA | 2,775,085 | T→C | 5.3% | intergenic (+64/‑460) | yfjW → / → ypjI | CP4‑57 prophage; putative inner membrane protein/pseudogene, CP4‑57 putative prophage remnant;Phage or Prophage Related |
| RA | 2,775,089 | T→A | 5.2% | intergenic (+68/‑456) | yfjW → / → ypjI | CP4‑57 prophage; putative inner membrane protein/pseudogene, CP4‑57 putative prophage remnant;Phage or Prophage Related |
| RA | 2,777,571 | A→G | 6.1% | D40G (GAC→GGC) | ypjF → | CP4‑57 prophage; toxin of the YpjF‑YfjZ toxin‑antitoxin system |
| RA | 2,777,573 | A→G | 6.2% | T41A (ACG→GCG) ‡ | ypjF → | CP4‑57 prophage; toxin of the YpjF‑YfjZ toxin‑antitoxin system |
| RA | 2,777,574 | C→T | 6.2% | T41M (ACG→ATG) ‡ | ypjF → | CP4‑57 prophage; toxin of the YpjF‑YfjZ toxin‑antitoxin system |
| RA | 2,777,576 | C→T | 6.1% | P42S (CCG→TCG) | ypjF → | CP4‑57 prophage; toxin of the YpjF‑YfjZ toxin‑antitoxin system |
| RA | 2,798,703 | G→C | 6.5% | intergenic (‑208/‑461) | stpA ← / → alaE | DNA binding protein, nucleoid‑associated/alanine exporter, alanine‑inducible, stress‑responsive |
| RA | 2,800,515 | C→A | 6.8% | intergenic (+40/‑208) | ygaM → / → nrdH | putative membrane‑anchored DUF883 family ribosome‑binding protein/hydrogen donor for NrdEF electron transport system; glutaredoxin‑like protein |
| RA | 2,800,517 | T→A | 6.5% | intergenic (+42/‑206) | ygaM → / → nrdH | putative membrane‑anchored DUF883 family ribosome‑binding protein/hydrogen donor for NrdEF electron transport system; glutaredoxin‑like protein |
| RA | 2,800,519 | T→G | 6.2% | intergenic (+44/‑204) | ygaM → / → nrdH | putative membrane‑anchored DUF883 family ribosome‑binding protein/hydrogen donor for NrdEF electron transport system; glutaredoxin‑like protein |
| RA | 2,801,056 | A→T | 12.8% | N31I (AAT→ATT) | nrdI → | NrdEF cluster assembly flavodoxin |
| RA | 2,810,872 | C→T | 8.1% | H35Y (CAC→TAC) ‡ | mprA → | transcriptional repressor of microcin B17 synthesis and multidrug efflux |
| RA | 2,810,873 | A→G | 8.1% | H35R (CAC→CGC) ‡ | mprA → | transcriptional repressor of microcin B17 synthesis and multidrug efflux |
| RA | 2,814,174 | T→A | 6.7% | intergenic (+20/+44) | emrB → / ← luxS | multidrug efflux system protein/S‑ribosylhomocysteine lyase |
| RA | 2,814,175 | T→A | 6.7% | intergenic (+21/+43) | emrB → / ← luxS | multidrug efflux system protein/S‑ribosylhomocysteine lyase |
| RA | 2,814,829 | C→T | 5.2% | noncoding (28/78 nt) | micA → | sRNA antisense regulator of ompA, lamB, ompX, and phoP; Hfq‑dependent |
| RA | 2,814,840 | A→G | 8.6% | noncoding (39/78 nt) | micA → | sRNA antisense regulator of ompA, lamB, ompX, and phoP; Hfq‑dependent |
| RA | 2,822,673 | C→T | 11.7% | intergenic (‑34/+35) | recX ← / ← recA | regulatory protein for RecA/DNA recombination and repair protein; ssDNA‑dependent ATPase; synaptase; ssDNA and dsDNA binding protein; ATP‑dependent homologous DNA strand exchanger; recombinase A; LexA autocleavage cofactor |
| RA | 2,822,678 | G→T | 10.8% | intergenic (‑39/+30) | recX ← / ← recA | regulatory protein for RecA/DNA recombination and repair protein; ssDNA‑dependent ATPase; synaptase; ssDNA and dsDNA binding protein; ATP‑dependent homologous DNA strand exchanger; recombinase A; LexA autocleavage cofactor |
| RA | 2,822,679 | A→C | 10.9% | intergenic (‑40/+29) | recX ← / ← recA | regulatory protein for RecA/DNA recombination and repair protein; ssDNA‑dependent ATPase; synaptase; ssDNA and dsDNA binding protein; ATP‑dependent homologous DNA strand exchanger; recombinase A; LexA autocleavage cofactor |
| RA | 2,822,684 | A→G | 10.6% | intergenic (‑45/+24) | recX ← / ← recA | regulatory protein for RecA/DNA recombination and repair protein; ssDNA‑dependent ATPase; synaptase; ssDNA and dsDNA binding protein; ATP‑dependent homologous DNA strand exchanger; recombinase A; LexA autocleavage cofactor |
| RA | 2,823,838 | C→A | 7.4% | intergenic (‑69/+11) | recA ← / ← pncC | DNA recombination and repair protein; ssDNA‑dependent ATPase; synaptase; ssDNA and dsDNA binding protein; ATP‑dependent homologous DNA strand exchanger; recombinase A; LexA autocleavage cofactor/nicotinamide‑nucleotide amidohydrolase; NMN amidohydrolase |
| RA | 2,823,839 | T→G | 7.4% | intergenic (‑70/+10) | recA ← / ← pncC | DNA recombination and repair protein; ssDNA‑dependent ATPase; synaptase; ssDNA and dsDNA binding protein; ATP‑dependent homologous DNA strand exchanger; recombinase A; LexA autocleavage cofactor/nicotinamide‑nucleotide amidohydrolase; NMN amidohydrolase |
| RA | 2,838,222 | A→T | 5.7% | intergenic (‑117/+32) | hydN ← / ← ascG | formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit/asc operon transcriptional repressor; prpBC operon repressor |
| RA | 2,859,332 | T→G | 6.7% | L747R (CTC→CGC) ‡ | mutS → | methyl‑directed mismatch repair protein |
| RA | 2,859,333 | C→A | 6.7% | L747L (CTC→CTA) ‡ | mutS → | methyl‑directed mismatch repair protein |
| RA | 2,866,487 | G→C | 24.2% | intergenic (+22/+72) | ygbN → / ← rpoS | putative transporter/RNA polymerase, sigma S (sigma 38) factor |
| RA | 2,866,488 | G→C | 24.2% | intergenic (+23/+71) | ygbN → / ← rpoS | putative transporter/RNA polymerase, sigma S (sigma 38) factor |
| RA | 2,873,915 | A→G | 8.4% | H26H (CAT→CAC) ‡ | cysC ← | adenosine 5'‑phosphosulfate kinase |
| RA | 2,873,917 | G→C | 8.2% | H26D (CAT→GAT) ‡ | cysC ← | adenosine 5'‑phosphosulfate kinase |
| RA | 2,873,919 | C→T | 8.3% | G25D (GGT→GAT) | cysC ← | adenosine 5'‑phosphosulfate kinase |
| RA | 2,888,301 | G→T | 5.3% | L4L (CTC→CTA) | cysH ← | phosphoadenosine phosphosulfate reductase; PAPS reductase, thioredoxin dependent |
| RA | 2,888,820 | T→C | 6.1% | Q427R (CAG→CGG) | cysI ← | sulfite reductase, beta subunit, NAD(P)‑binding, heme‑binding |
| RA | 2,888,823 | G→A | 6.4% | P426L (CCG→CTG) | cysI ← | sulfite reductase, beta subunit, NAD(P)‑binding, heme‑binding |
| RA | 2,892,550 | A→G | 5.5% | T113A (ACC→GCC) ‡ | queD → | 6‑pyruvoyl tetrahydrobiopterin synthase (PTPS) |
| RA | 2,892,551 | C→G | 5.2% | T113S (ACC→AGC) ‡ | queD → | 6‑pyruvoyl tetrahydrobiopterin synthase (PTPS) |
| RA | 2,892,552 | C→T | 5.2% | T113T (ACC→ACT) ‡ | queD → | 6‑pyruvoyl tetrahydrobiopterin synthase (PTPS) |
| RA | 2,906,502 | T→A | 9.0% | G264G (GGT→GGA) | ygcG → | TPM domain protein, putative phosphatase |
| RA | 2,906,503 | T→A | 9.0% | S265T (TCC→ACC) | ygcG → | TPM domain protein, putative phosphatase |
| RA | 2,908,486 | G→C | 7.7% | A394G (GCC→GGC) | pyrG ← | CTP synthetase |
| RA | 2,917,895 | G→A | 5.3% | intergenic (+82/+150) | barA → / ← gudD | hybrid sensory histidine kinase, in two‑component regulatory system with UvrY/D‑glucarate dehydratase 1 |
| RA | 2,917,896 | C→A | 5.3% | intergenic (+83/+149) | barA → / ← gudD | hybrid sensory histidine kinase, in two‑component regulatory system with UvrY/D‑glucarate dehydratase 1 |
| RA | 2,917,909 | T→G | 11.8% | intergenic (+96/+136) | barA → / ← gudD | hybrid sensory histidine kinase, in two‑component regulatory system with UvrY/D‑glucarate dehydratase 1 |
| RA | 2,917,910 | T→C | 12.3% | intergenic (+97/+135) | barA → / ← gudD | hybrid sensory histidine kinase, in two‑component regulatory system with UvrY/D‑glucarate dehydratase 1 |
| RA | 2,933,401 | A→C | 5.1% | V96V (GTT→GTG) | fucA ← | L‑fuculose‑1‑phosphate aldolase |
| RA | 2,937,044 | Δ1 bp | 6.0% | coding (1461/1776 nt) | fucI → | L‑fucose isomerase |
| RA | 2,937,048:1 | +C | 6.2% | coding (1465/1776 nt) | fucI → | L‑fucose isomerase |
| RA | 2,939,331 | A→G | 6.2% | intergenic (+21/‑37) | fucU → / → fucR | L‑fucose mutarotase/l‑fucose operon activator |
| RA | 2,939,333 | G→C | 6.1% | intergenic (+23/‑35) | fucU → / → fucR | L‑fucose mutarotase/l‑fucose operon activator |
| RA | 2,939,335 | C→T | 6.2% | intergenic (+25/‑33) | fucU → / → fucR | L‑fucose mutarotase/l‑fucose operon activator |
| RA | 2,971,146 | T→C | 6.9% | intergenic (+13/‑125) | ygdQ → / → ygdR | UPF0053 family inner membrane protein/DUF903 family verified lipoprotein |
| RA | 2,971,151 | T→C | 7.2% | intergenic (+18/‑120) | ygdQ → / → ygdR | UPF0053 family inner membrane protein/DUF903 family verified lipoprotein |
| RA | 2,971,154 | G→A | 7.0% | intergenic (+21/‑117) | ygdQ → / → ygdR | UPF0053 family inner membrane protein/DUF903 family verified lipoprotein |
| RA | 2,971,159 | G→A | 5.6% | intergenic (+26/‑112) | ygdQ → / → ygdR | UPF0053 family inner membrane protein/DUF903 family verified lipoprotein |
| RA | 2,976,320 | T→G | 5.5% | noncoding (66/82 nt) | omrB ← | sRNA antisense regulator downregulates OM proteins and curli; positively regulated by OmpR/EnvZ, Hfq‑dependent |
| RA | 2,976,321 | C→A | 5.6% | noncoding (65/82 nt) | omrB ← | sRNA antisense regulator downregulates OM proteins and curli; positively regulated by OmpR/EnvZ, Hfq‑dependent |
| RA | 2,980,742 | A→G | 30.0% | intergenic (‑107/+22) | ygeA ← / ← araE | Asp/Glu_racemase family protein/arabinose transporter |
| RA | 2,980,744 | A→T | 36.4% | intergenic (‑109/+20) | ygeA ← / ← araE | Asp/Glu_racemase family protein/arabinose transporter |
| RA | 2,980,746 | C→T | 36.4% | intergenic (‑111/+18) | ygeA ← / ← araE | Asp/Glu_racemase family protein/arabinose transporter |
| RA | 2,987,103 | C→T | 6.8% | intergenic (+27/‑433) | yqeG → / → yqeH | putative transporter/putative LuxR family transcriptional regulator |
| RA | 2,987,104 | T→A | 6.7% | intergenic (+28/‑432) | yqeG → / → yqeH | putative transporter/putative LuxR family transcriptional regulator |
| RA | 2,987,105 | A→G | 6.5% | intergenic (+29/‑431) | yqeG → / → yqeH | putative transporter/putative LuxR family transcriptional regulator |
| RA | 3,007,368 | C→G | 8.2% | A369A (GCC→GCG) | ygeW → | putative carbamoyltransferase |
| RA | 3,007,466 | T→C | 10.7% | intergenic (+14/‑44) | ygeW → / → ygeX | putative carbamoyltransferase/2,3‑diaminopropionate ammonia lyase, PLP‑dependent |
| RA | 3,007,473 | G→A | 5.1% | intergenic (+21/‑37) | ygeW → / → ygeX | putative carbamoyltransferase/2,3‑diaminopropionate ammonia lyase, PLP‑dependent |
| RA | 3,020,510 | G→T | 13.3% | intergenic (+21/‑30) | ssnA → / → ygfM | putative chlorohydrolase/aminohydrolase/putative oxidoreductase |
| RA | 3,020,511 | C→G | 14.0% | intergenic (+22/‑29) | ssnA → / → ygfM | putative chlorohydrolase/aminohydrolase/putative oxidoreductase |
| RA | 3,020,512 | A→C | 14.3% | intergenic (+23/‑28) | ssnA → / → ygfM | putative chlorohydrolase/aminohydrolase/putative oxidoreductase |
| RA | 3,033,624 | A→G | 6.3% | intergenic (+11/+33) | idi → / ← lysS | isopentenyl diphosphate isomerase/lysine tRNA synthetase, constitutive |
| RA | 3,033,627 | T→A | 6.4% | intergenic (+14/+30) | idi → / ← lysS | isopentenyl diphosphate isomerase/lysine tRNA synthetase, constitutive |
| RA | 3,033,628 | T→A | 6.4% | intergenic (+15/+29) | idi → / ← lysS | isopentenyl diphosphate isomerase/lysine tRNA synthetase, constitutive |
| RA | 3,033,631 | C→T | 6.4% | intergenic (+18/+26) | idi → / ← lysS | isopentenyl diphosphate isomerase/lysine tRNA synthetase, constitutive |
| RA | 3,037,956 | A→C | 7.0% | W51G (TGG→GGG) | recJ ← | ssDNA exonuclease, 5' ‑‑> 3'‑specific |
| RA | 3,037,957 | G→T | 5.6% | P50P (CCC→CCA) | recJ ← | ssDNA exonuclease, 5' ‑‑> 3'‑specific |
| RA | 3,057,140 | A→G | 5.3% | intergenic (+152/+38) | sibC → / ← serA | sRNA antisense regulator of toxic IbsC protein/D‑3‑phosphoglycerate dehydrogenase |
| RA | 3,057,145 | G→C | 5.3% | intergenic (+157/+33) | sibC → / ← serA | sRNA antisense regulator of toxic IbsC protein/D‑3‑phosphoglycerate dehydrogenase |
| RA | 3,057,150 | C→T | 5.2% | intergenic (+162/+28) | sibC → / ← serA | sRNA antisense regulator of toxic IbsC protein/D‑3‑phosphoglycerate dehydrogenase |
| RA | 3,059,703 | A→T | 5.9% | intergenic (‑2/‑50) | yqfE ← / → argP | pseudogene, LysR family/transcriptional regulator for arginine transport and DNA replication genes; replication initiation inhibitor |
| RA | 3,059,704 | A→T | 5.9% | intergenic (‑3/‑49) | yqfE ← / → argP | pseudogene, LysR family/transcriptional regulator for arginine transport and DNA replication genes; replication initiation inhibitor |
| RA | 3,061,817 | G→C | 5.7% | W323S (TGG→TCG) ‡ | scpA → | methylmalonyl‑CoA mutase |
| RA | 3,061,818 | G→C | 5.7% | W323C (TGG→TGC) ‡ | scpA → | methylmalonyl‑CoA mutase |
| RA | 3,066,293 | T→C | 6.1% | D294G (GAC→GGC) | ygfI ← | putative DNA‑binding transcriptional regulator |
| RA | 3,066,299:1 | +G | 5.9% | coding (875/897 nt) | ygfI ← | putative DNA‑binding transcriptional regulator |
| RA | 3,066,319 | Δ1 bp | 6.7% | coding (855/897 nt) | ygfI ← | putative DNA‑binding transcriptional regulator |
| RA | 3,072,800 | C→T | 5.1% | D298N (GAT→AAT) | epd ← | D‑erythrose 4‑phosphate dehydrogenase |
| RA | 3,072,802 | A→T | 5.1% | V297D (GTC→GAC) | epd ← | D‑erythrose 4‑phosphate dehydrogenase |
| RA | 3,072,804 | A→G | 5.1% | I296I (ATT→ATC) | epd ← | D‑erythrose 4‑phosphate dehydrogenase |
| RA | 3,090,226 | T→C | 5.7% | C158R (TGC→CGC) | yggI → | Zn‑dependent metalloprotease‑related protein |
| RA | 3,090,229 | G→A | 5.8% | G159S (GGT→AGT) | yggI → | Zn‑dependent metalloprotease‑related protein |
| RA | 3,095,151 | T→C | 5.1% | A18A (GCT→GCC) | yggS → | UPF0001 family protein, PLP‑binding |
| RA | 3,095,164 | G→A | 5.0% | G23S (GGC→AGC) | yggS → | UPF0001 family protein, PLP‑binding |
| RA | 3,101,541 | G→C | 6.3% | P28R (CCG→CGG) | yggN ← | DUF2884 family putative periplasmic protein |
| RA | 3,156,590 | C→A | 14.7% | intergenic (+72/‑33) | yqhD → / → dkgA | aldehyde reductase, NADPH‑dependent/2,5‑diketo‑D‑gluconate reductase A |
| RA | 3,156,591 | T→G | 14.2% | intergenic (+73/‑32) | yqhD → / → dkgA | aldehyde reductase, NADPH‑dependent/2,5‑diketo‑D‑gluconate reductase A |
| RA | 3,166,154 | T→C | 5.1% | Q522R (CAG→CGG) ‡ | ygiS ← | putative ABC transporter permease |
| RA | 3,166,155 | G→C | 5.0% | Q522E (CAG→GAG) ‡ | ygiS ← | putative ABC transporter permease |
| RA | 3,169,260 | Δ1 bp | 5.8% | intergenic (‑29/+24) | ygiV ← / ← ygiW | transcriptional repressor for mcbR biofilm gene/hydrogen peroxide and cadmium resistance periplasmic protein; stress‑induced OB‑fold protein |
| RA | 3,171,852 | C→T | 7.4% | intergenic (+19/+27) | qseC → / ← ygiZ | quorum sensing sensory histidine kinase in two‑component regulatory system with QseB/inner membrane protein |
| RA | 3,171,857 | A→T | 7.5% | intergenic (+24/+22) | qseC → / ← ygiZ | quorum sensing sensory histidine kinase in two‑component regulatory system with QseB/inner membrane protein |
| RA | 3,171,858 | A→T | 7.5% | intergenic (+25/+21) | qseC → / ← ygiZ | quorum sensing sensory histidine kinase in two‑component regulatory system with QseB/inner membrane protein |
| RA | 3,171,863 | A→G | 6.4% | intergenic (+30/+16) | qseC → / ← ygiZ | quorum sensing sensory histidine kinase in two‑component regulatory system with QseB/inner membrane protein |
| RA | 3,172,436 | T→G | 5.1% | intergenic (‑225/‑94) | ygiZ ← / → mdaB | inner membrane protein/NADPH quinone reductase |
| RA | 3,180,497 | Δ1 bp | 10.6% | coding (77/1161 nt) | ygiC → | ATP‑Grasp family ATPase |
| RA | 3,180,505 | G→T | 12.2% | E29* (GAG→TAG) ‡ | ygiC → | ATP‑Grasp family ATPase |
| RA | 3,180,506 | A→C | 12.1% | E29A (GAG→GCG) ‡ | ygiC → | ATP‑Grasp family ATPase |
| RA | 3,180,513:1 | +A | 7.0% | coding (93/1161 nt) | ygiC → | ATP‑Grasp family ATPase |
| RA | 3,183,345:1 | +T | 15.7% | intergenic (+22/+468) | zupT → / ← ribB | zinc transporter/3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase |
| RA | 3,183,350 | Δ1 bp | 14.5% | intergenic (+27/+463) | zupT → / ← ribB | zinc transporter/3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase |
| RA | 3,183,768 | A→G | 5.7% | intergenic (+445/+45) | zupT → / ← ribB | zinc transporter/3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase |
| RA | 3,202,685 | A→G | 6.6% | E265E (GAA→GAG) | cca → | fused tRNA nucleotidyl transferase/2'3'‑cyclic phosphodiesterase/2'nucleotidase and phosphatase |
| RA | 3,202,686 | C→T | 7.0% | L266F (CTC→TTC) | cca → | fused tRNA nucleotidyl transferase/2'3'‑cyclic phosphodiesterase/2'nucleotidase and phosphatase |
| RA | 3,202,693 | C→G | 8.7% | P268R (CCG→CGG) | cca → | fused tRNA nucleotidyl transferase/2'3'‑cyclic phosphodiesterase/2'nucleotidase and phosphatase |
| RA | 3,239,609 | T→G | 5.7% | intergenic (+64/‑335) | alx → / → sstT | putative membrane‑bound redox modulator/sodium:serine/threonine symporter |
| RA | 3,239,610 | C→G | 5.6% | intergenic (+65/‑334) | alx → / → sstT | putative membrane‑bound redox modulator/sodium:serine/threonine symporter |
| RA | 3,239,611 | C→A | 5.6% | intergenic (+66/‑333) | alx → / → sstT | putative membrane‑bound redox modulator/sodium:serine/threonine symporter |
| RA | 3,256,441 | T→G | 5.2% | T71P (ACG→CCG) | yhaM ← | putative L‑serine dehydratase alpha chain |
| RA | 3,256,442 | G→C | 5.7% | G70G (GGC→GGG) ‡ | yhaM ← | putative L‑serine dehydratase alpha chain |
| RA | 3,256,443 | C→A | 5.6% | G70V (GGC→GTC) ‡ | yhaM ← | putative L‑serine dehydratase alpha chain |
| RA | 3,256,450 | C→T | 6.4% | V68I (GTT→ATT) | yhaM ← | putative L‑serine dehydratase alpha chain |
| RA | 3,258,251 | T→A | 6.9% | intergenic (‑241/+34) | yhaO ← / ← tdcG | putative transporter/L‑serine dehydratase 3, anaerobic |
| RA | 3,258,252 | T→A | 6.9% | intergenic (‑242/+33) | yhaO ← / ← tdcG | putative transporter/L‑serine dehydratase 3, anaerobic |
| RA | 3,269,815 | C→G | 5.8% | intergenic (+213/+401) | yhaC → / ← rnpB | pentapetide repeats‑related protein/RNase P, M1 RNA component |
| RA | 3,269,820 | A→G | 5.8% | intergenic (+218/+396) | yhaC → / ← rnpB | pentapetide repeats‑related protein/RNase P, M1 RNA component |
| RA | 3,270,080 | C→T | 6.5% | intergenic (+478/+136) | yhaC → / ← rnpB | pentapetide repeats‑related protein/RNase P, M1 RNA component |
| RA | 3,270,081 | G→T | 6.5% | intergenic (+479/+135) | yhaC → / ← rnpB | pentapetide repeats‑related protein/RNase P, M1 RNA component |
| RA | 3,270,082 | A→C | 6.1% | intergenic (+480/+134) | yhaC → / ← rnpB | pentapetide repeats‑related protein/RNase P, M1 RNA component |
| RA | 3,270,083 | A→G | 6.0% | intergenic (+481/+133) | yhaC → / ← rnpB | pentapetide repeats‑related protein/RNase P, M1 RNA component |
| RA | 3,271,825 | T→A | 7.8% | intergenic (‑55/+42) | garK ← / ← garR | glycerate kinase I/tartronate semialdehyde reductase |
| RA | 3,276,886 | C→A | 8.7% | intergenic (+33/‑116) | garD → / → prlF | D‑galactarate dehydrogenase/antitoxin of the SohA(PrlF)‑YhaV toxin‑antitoxin system |
| RA | 3,276,887 | T→C | 8.6% | intergenic (+34/‑115) | garD → / → prlF | D‑galactarate dehydrogenase/antitoxin of the SohA(PrlF)‑YhaV toxin‑antitoxin system |
| RA | 3,276,890 | G→A | 8.7% | intergenic (+37/‑112) | garD → / → prlF | D‑galactarate dehydrogenase/antitoxin of the SohA(PrlF)‑YhaV toxin‑antitoxin system |
| RA | 3,276,891 | T→G | 8.8% | intergenic (+38/‑111) | garD → / → prlF | D‑galactarate dehydrogenase/antitoxin of the SohA(PrlF)‑YhaV toxin‑antitoxin system |
| RA | 3,282,929 | C→T | 5.1% | I318I (ATC→ATT) | agaS → | tagatose‑6‑phosphate ketose/aldose isomerase |
| RA | 3,288,032 | C→A | 17.4% | intergenic (+22/‑58) | yraH → / → yraI | putative fimbrial‑like adhesin protein/putative periplasmic pilin chaperone |
| RA | 3,288,033 | T→G | 16.0% | intergenic (+23/‑57) | yraH → / → yraI | putative fimbrial‑like adhesin protein/putative periplasmic pilin chaperone |
| RA | 3,309,004 | C→T | 7.1% | intergenic (‑80/+29) | nlpI ← / ← pnp | lipoprotein involved in osmotic sensitivity and filamentation/polynucleotide phosphorylase/polyadenylase |
| RA | 3,309,009 | C→T | 6.6% | intergenic (‑85/+24) | nlpI ← / ← pnp | lipoprotein involved in osmotic sensitivity and filamentation/polynucleotide phosphorylase/polyadenylase |
| RA | 3,309,012 | A→G | 7.3% | intergenic (‑88/+21) | nlpI ← / ← pnp | lipoprotein involved in osmotic sensitivity and filamentation/polynucleotide phosphorylase/polyadenylase |
| RA | 3,318,079 | A→T | 7.8% | intergenic (‑73/+134) | rimP ← / ← metY | ribosome maturation factor for 30S subunits/tRNA‑Met |
| RA | 3,318,080 | A→T | 7.8% | intergenic (‑74/+133) | rimP ← / ← metY | ribosome maturation factor for 30S subunits/tRNA‑Met |
| RA | 3,318,088 | C→T | 5.9% | intergenic (‑82/+125) | rimP ← / ← metY | ribosome maturation factor for 30S subunits/tRNA‑Met |
| RA | 3,324,952 | A→G | 8.8% | intergenic (‑41/+49) | folP ← / ← ftsH | 7,8‑dihydropteroate synthase/protease, ATP‑dependent zinc‑metallo |
| RA | 3,324,955 | A→G | 8.9% | intergenic (‑44/+46) | folP ← / ← ftsH | 7,8‑dihydropteroate synthase/protease, ATP‑dependent zinc‑metallo |
| RA | 3,324,956 | C→T | 9.0% | intergenic (‑45/+45) | folP ← / ← ftsH | 7,8‑dihydropteroate synthase/protease, ATP‑dependent zinc‑metallo |
| RA | 3,324,959 | C→T | 8.4% | intergenic (‑48/+42) | folP ← / ← ftsH | 7,8‑dihydropteroate synthase/protease, ATP‑dependent zinc‑metallo |
| RA | 3,330,415 | Δ1 bp | 10.0% | intergenic (+19/+167) | dacB → / ← obgE | D‑alanyl‑D‑alanine carboxypeptidase/GTPase involved in cell partioning and DNA repair |
| RA | 3,330,419:1 | +T | 9.5% | intergenic (+23/+163) | dacB → / ← obgE | D‑alanyl‑D‑alanine carboxypeptidase/GTPase involved in cell partioning and DNA repair |
| RA | 3,332,822 | G→A | 50.0% | intergenic (‑87/+40) | yhbE ← / ← rpmA | EamA family inner membrane putative transporter/50S ribosomal subunit protein L27 |
| RA | 3,332,823 | T→C | 50.0% | intergenic (‑88/+39) | yhbE ← / ← rpmA | EamA family inner membrane putative transporter/50S ribosomal subunit protein L27 |
| RA | 3,333,057 | C→T | 5.7% | L21L (CTG→CTA) ‡ | rpmA ← | 50S ribosomal subunit protein L27 |
| RA | 3,333,058 | A→G | 5.6% | L21P (CTG→CCG) ‡ | rpmA ← | 50S ribosomal subunit protein L27 |
| RA | 3,334,703 | A→G | 8.9% | intergenic (+22/‑206) | ispB → / → sfsB | octaprenyl diphosphate synthase/malPQ operon transcriptional activator |
| RA | 3,334,704 | G→C | 9.2% | intergenic (+23/‑205) | ispB → / → sfsB | octaprenyl diphosphate synthase/malPQ operon transcriptional activator |
| RA | 3,334,705 | C→T | 8.5% | intergenic (+24/‑204) | ispB → / → sfsB | octaprenyl diphosphate synthase/malPQ operon transcriptional activator |
| RA | 3,354,537 | C→G | 9.9% | intergenic (‑487/‑188) | yhcC ← / → gltB | putative Fe‑S oxidoreductase, Radical SAM superfamily protein/glutamate synthase, large subunit |
| RA | 3,368,134 | A→G | 9.5% | H103R (CAC→CGC) | yhcG → | DUF1016 family protein in the PD‑(D/E)XK nuclease superfamily |
| RA | 3,368,142 | A→T | 13.3% | M106L (ATG→TTG) | yhcG → | DUF1016 family protein in the PD‑(D/E)XK nuclease superfamily |
| RA | 3,368,150 | C→T | 8.4% | G108G (GGC→GGT) | yhcG → | DUF1016 family protein in the PD‑(D/E)XK nuclease superfamily |
| RA | 3,368,982 | G→C | 11.2% | intergenic (+28/+32) | yhcG → / ← yhcH | DUF1016 family protein in the PD‑(D/E)XK nuclease superfamily/DUF386 family protein, cupin superfamily |
| RA | 3,400,846 | A→T | 6.0% | I81N (ATC→AAC) | mreB ← | cell wall structural complex MreBCD, actin‑like component MreB |
| RA | 3,400,849 | A→T | 5.9% | V80D (GTT→GAT) | mreB ← | cell wall structural complex MreBCD, actin‑like component MreB |
| RA | 3,400,855 | T→A | 5.1% | D78V (GAC→GTC) | mreB ← | cell wall structural complex MreBCD, actin‑like component MreB |
| RA | 3,407,293 | T→A | 19.6% | intergenic (+27/‑82) | accC → / → yhdT | acetyl‑CoA carboxylase, biotin carboxylase subunit/DUF997 family putative inner membrane protein |
| RA | 3,407,294 | T→A | 19.6% | intergenic (+28/‑81) | accC → / → yhdT | acetyl‑CoA carboxylase, biotin carboxylase subunit/DUF997 family putative inner membrane protein |
| RA | 3,407,295 | T→A | 19.6% | intergenic (+29/‑80) | accC → / → yhdT | acetyl‑CoA carboxylase, biotin carboxylase subunit/DUF997 family putative inner membrane protein |
| RA | 3,423,620 | A→G | 5.7% | noncoding (36/76 nt) | thrV ← | tRNA‑Thr |
| RA | 3,423,621 | C→G | 5.8% | noncoding (35/76 nt) | thrV ← | tRNA‑Thr |
| RA | 3,423,622 | C→T | 5.8% | noncoding (34/76 nt) | thrV ← | tRNA‑Thr |
| RA | 3,439,588 | G→C | 61.1% | intergenic (‑79/+28) | yhdN ← / ← rplQ | DUF1992 family protein/50S ribosomal subunit protein L17 |
| RA | 3,439,589 | G→C | 56.4% | intergenic (‑80/+27) | yhdN ← / ← rplQ | DUF1992 family protein/50S ribosomal subunit protein L17 |
| RA | 3,441,060 | T→C | 10.9% | K206E (AAG→GAG) | rpsD ← | 30S ribosomal subunit protein S4 |
| RA | 3,441,061 | G→C | 10.6% | S205S (TCC→TCG) ‡ | rpsD ← | 30S ribosomal subunit protein S4 |
| RA | 3,441,062 | G→A | 10.7% | S205F (TCC→TTC) ‡ | rpsD ← | 30S ribosomal subunit protein S4 |
| RA | 3,448,050 | C→A | 5.3% | G34C (GGC→TGC) | rplN ← | 50S ribosomal subunit protein L14 |
| RA | 3,448,051 | T→G | 5.2% | A33A (GCA→GCC) | rplN ← | 50S ribosomal subunit protein L14 |
| RA | 3,451,404 | T→G | 5.9% | D94A (GAC→GCC) | rplW ← | 50S ribosomal subunit protein L23 |
| RA | 3,451,410 | T→A | 6.7% | N92I (AAT→ATT) | rplW ← | 50S ribosomal subunit protein L23 |
| RA | 3,471,357 | C→T | 11.2% | intergenic (‑28/+43) | tufA ← / ← fusA | translation elongation factor EF‑Tu 1/protein chain elongation factor EF‑G, GTP‑binding |
| RA | 3,471,361 | T→G | 9.0% | intergenic (‑32/+39) | tufA ← / ← fusA | translation elongation factor EF‑Tu 1/protein chain elongation factor EF‑G, GTP‑binding |
| RA | 3,471,362 | C→A | 8.5% | intergenic (‑33/+38) | tufA ← / ← fusA | translation elongation factor EF‑Tu 1/protein chain elongation factor EF‑G, GTP‑binding |
| RA | 3,471,366 | A→G | 8.5% | intergenic (‑37/+34) | tufA ← / ← fusA | translation elongation factor EF‑Tu 1/protein chain elongation factor EF‑G, GTP‑binding |
| RA | 3,477,878 | T→A | 13.8% | intergenic (+20/+29) | slyX → / ← slyD | phi X174 lysis protein/FKBP‑type peptidyl prolyl cis‑trans isomerase (rotamase) |
| RA | 3,560,455:1 | +G | 100% | intergenic (‑2/+1) | glpR ← / ← glpR | pseudogene, DNA‑binding transcriptional repressor;regulator; Energy metabolism, carbon: Anaerobic respiration; repressor of the glp operon/pseudogene, DNA‑binding transcriptional repressor;regulator; Energy metabolism, carbon: Anaerobic respiration; repressor of the glp operon |
| RA | 3,561,969 | A→T | 6.1% | intergenic (‑146/‑44) | glpE ← / → glpD | thiosulfate:cyanide sulfurtransferase (rhodanese)/sn‑glycerol‑3‑phosphate dehydrogenase, aerobic, FAD/NAD(P)‑binding |
| RA | 3,561,972 | A→T | 6.1% | intergenic (‑149/‑41) | glpE ← / → glpD | thiosulfate:cyanide sulfurtransferase (rhodanese)/sn‑glycerol‑3‑phosphate dehydrogenase, aerobic, FAD/NAD(P)‑binding |
| RA | 3,563,539 | T→C | 6.9% | intergenic (+21/+248) | glpD → / ← yzgL | sn‑glycerol‑3‑phosphate dehydrogenase, aerobic, FAD/NAD(P)‑binding/pseudogene, periplasmic solute binding protein homology |
| RA | 3,563,546 | T→G | 7.7% | intergenic (+28/+241) | glpD → / ← yzgL | sn‑glycerol‑3‑phosphate dehydrogenase, aerobic, FAD/NAD(P)‑binding/pseudogene, periplasmic solute binding protein homology |
| RA | 3,563,547 | C→A | 7.6% | intergenic (+29/+240) | glpD → / ← yzgL | sn‑glycerol‑3‑phosphate dehydrogenase, aerobic, FAD/NAD(P)‑binding/pseudogene, periplasmic solute binding protein homology |
| RA | 3,563,554 | G→A | 5.6% | intergenic (+36/+233) | glpD → / ← yzgL | sn‑glycerol‑3‑phosphate dehydrogenase, aerobic, FAD/NAD(P)‑binding/pseudogene, periplasmic solute binding protein homology |
| RA | 3,566,210 | A→T | 5.1% | G124G (GGT→GGA) ‡ | glgP ← | glycogen phosphorylase |
| RA | 3,566,212 | C→G | 5.1% | G124R (GGT→CGT) ‡ | glgP ← | glycogen phosphorylase |
| RA | 3,566,215 | T→A | 5.1% | N123Y (AAC→TAC) | glgP ← | glycogen phosphorylase |
| RA | 3,566,218 | C→G | 5.1% | G122R (GGT→CGT) | glgP ← | glycogen phosphorylase |
| RA | 3,566,220 | A→T | 5.6% | L121H (CTC→CAC) | glgP ← | glycogen phosphorylase |
| RA | 3,569,431 | A→G | 6.3% | I630T (ATT→ACT) | glgX ← | glycogen debranching enzyme |
| RA | 3,569,436 | G→A | 5.2% | H628H (CAC→CAT) | glgX ← | glycogen debranching enzyme |
| RA | 3,577,657 | A→G | 5.6% | intergenic (‑65/+74) | gntK ← / ← gntR | gluconate kinase 2/d‑gluconate inducible gluconate regulon transcriptional repressor |
| RA | 3,577,660 | C→T | 5.7% | intergenic (‑68/+71) | gntK ← / ← gntR | gluconate kinase 2/d‑gluconate inducible gluconate regulon transcriptional repressor |
| RA | 3,594,071 | T→C | 5.4% | T46A (ACG→GCG) | livG ← | branched‑chain amino acid ABC transporter ATPase |
| RA | 3,620,413 | A→T | 6.3% | K408* (AAG→TAG) ‡ | rhsB → | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor |
| RA | 3,620,414 | A→C | 6.1% | K408T (AAG→ACG) ‡ | rhsB → | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor |
| RA | 3,620,417 | G→T | 6.3% | R409L (CGG→CTG) | rhsB → | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor |
| RA | 3,620,419 | G→A | 6.3% | V410M (GTG→ATG) | rhsB → | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor |
| RA | 3,639,165 | T→C | 5.8% | intergenic (+24/+220) | pitA → / ← uspB | phosphate transporter, low‑affinity; tellurite importer/universal stress (ethanol tolerance) protein B |
| RA | 3,639,172 | G→A | 6.0% | intergenic (+31/+213) | pitA → / ← uspB | phosphate transporter, low‑affinity; tellurite importer/universal stress (ethanol tolerance) protein B |
| RA | 3,642,358 | T→A | 7.3% | intergenic (+27/+22) | dtpB → / ← rsmJ | dipeptide and tripeptide permease B/16S rRNA m(2)G1516 methyltransferase, SAM‑dependent |
| RA | 3,642,361 | T→A | 6.9% | intergenic (+30/+19) | dtpB → / ← rsmJ | dipeptide and tripeptide permease B/16S rRNA m(2)G1516 methyltransferase, SAM‑dependent |
| RA | 3,657,599 | T→A | 16.3% | intergenic (+32/+387) | hdeD → / ← arrS | acid‑resistance membrane protein/antisense sRNA ArrS, function unknown |
| RA | 3,657,601 | G→C | 16.4% | intergenic (+34/+385) | hdeD → / ← arrS | acid‑resistance membrane protein/antisense sRNA ArrS, function unknown |
| RA | 3,657,603 | T→A | 16.9% | intergenic (+36/+383) | hdeD → / ← arrS | acid‑resistance membrane protein/antisense sRNA ArrS, function unknown |
| RA | 3,676,195 | A→G | 5.3% | intergenic (+87/+95) | yhjE → / ← yhjG | putative MFS transporter; membrane protein/putative inner membrane‑anchored periplasmic AsmA family protein |
| RA | 3,676,196 | A→C | 5.3% | intergenic (+88/+94) | yhjE → / ← yhjG | putative MFS transporter; membrane protein/putative inner membrane‑anchored periplasmic AsmA family protein |
| RA | 3,676,202 | T→G | 5.3% | intergenic (+94/+88) | yhjE → / ← yhjG | putative MFS transporter; membrane protein/putative inner membrane‑anchored periplasmic AsmA family protein |
| RA | 3,676,203 | C→A | 5.0% | intergenic (+95/+87) | yhjE → / ← yhjG | putative MFS transporter; membrane protein/putative inner membrane‑anchored periplasmic AsmA family protein |
| RA | 3,676,209 | G→T | 5.5% | intergenic (+101/+81) | yhjE → / ← yhjG | putative MFS transporter; membrane protein/putative inner membrane‑anchored periplasmic AsmA family protein |
| RA | 3,676,210 | C→T | 5.6% | intergenic (+102/+80) | yhjE → / ← yhjG | putative MFS transporter; membrane protein/putative inner membrane‑anchored periplasmic AsmA family protein |
| RA | 3,676,271 | A→T | 6.4% | intergenic (+163/+19) | yhjE → / ← yhjG | putative MFS transporter; membrane protein/putative inner membrane‑anchored periplasmic AsmA family protein |
| RA | 3,702,835 | G→A | 7.6% | L12L (CTG→TTG) | dppF ← | dipeptide/heme ABC transporter ATPas |
| RA | 3,702,837 | G→C | 7.6% | P11R (CCG→CGG) | dppF ← | dipeptide/heme ABC transporter ATPas |
| RA | 3,702,839 | T→C | 8.0% | Q10Q (CAA→CAG) | dppF ← | dipeptide/heme ABC transporter ATPas |
| RA | 3,704,135 | A→T | 5.3% | I209I (ATT→ATA) | dppC ← | dipeptide/heme ABC transporter permease |
| RA | 3,704,138 | A→T | 5.4% | F208L (TTT→TTA) | dppC ← | dipeptide/heme ABC transporter permease |
| RA | 3,708,595 | G→A | 23.1% | intergenic (‑890/+21) | dppA ← / ← proK | dipeptide/heme ABC transporter periplasmic binding protein; dipeptide chemotaxis receptor/tRNA‑Pro |
| RA | 3,708,596 | T→A | 20.7% | intergenic (‑891/+20) | dppA ← / ← proK | dipeptide/heme ABC transporter periplasmic binding protein; dipeptide chemotaxis receptor/tRNA‑Pro |
| RA | 3,708,597 | T→C | 20.7% | intergenic (‑892/+19) | dppA ← / ← proK | dipeptide/heme ABC transporter periplasmic binding protein; dipeptide chemotaxis receptor/tRNA‑Pro |
| RA | 3,714,163:1 | +T | 11.1% | coding (2232/2334 nt) | bisC ← | biotin sulfoxide reductase |
| RA | 3,714,168 | Δ1 bp | 11.0% | coding (2227/2334 nt) | bisC ← | biotin sulfoxide reductase |
| RA | 3,720,294 | T→C | 6.0% | intergenic (+33/+154) | cspA → / ← hokA | RNA chaperone and antiterminator, cold‑inducible/toxic polypeptide, small |
| RA | 3,720,299 | T→A | 6.5% | intergenic (+38/+149) | cspA → / ← hokA | RNA chaperone and antiterminator, cold‑inducible/toxic polypeptide, small |
| RA | 3,720,300 | T→A | 6.5% | intergenic (+39/+148) | cspA → / ← hokA | RNA chaperone and antiterminator, cold‑inducible/toxic polypeptide, small |
| RA | 3,720,305 | G→A | 6.2% | intergenic (+44/+143) | cspA → / ← hokA | RNA chaperone and antiterminator, cold‑inducible/toxic polypeptide, small |
| RA | 3,729,405 | C→G | 5.3% | intergenic (‑34/+38) | xylB ← / ← xylA | xylulokinase/D‑xylose isomerase |
| RA | 3,729,408 | C→G | 5.5% | intergenic (‑37/+35) | xylB ← / ← xylA | xylulokinase/D‑xylose isomerase |
| RA | 3,732,139 | G→T | 5.0% | intergenic (+16/‑62) | xylF → / → xylG | D‑xylose transporter subunit/D‑xylose ABC transporter dual domain ATPase |
| RA | 3,736,322 | G→T | 6.0% | intergenic (+165/+31) | xylR → / ← bax | xylose divergent operon transcriptional activator/putative glucosaminidase |
| RA | 3,736,323 | A→G | 6.3% | intergenic (+166/+30) | xylR → / ← bax | xylose divergent operon transcriptional activator/putative glucosaminidase |
| RA | 3,736,324 | C→T | 6.2% | intergenic (+167/+29) | xylR → / ← bax | xylose divergent operon transcriptional activator/putative glucosaminidase |
| RA | 3,736,325 | A→C | 6.5% | intergenic (+168/+28) | xylR → / ← bax | xylose divergent operon transcriptional activator/putative glucosaminidase |
| RA | 3,747,168:1 | +C | 6.9% | coding (85/1497 nt) | lyxK → | L‑xylulose kinase |
| RA | 3,747,173 | Δ1 bp | 7.3% | coding (90/1497 nt) | lyxK → | L‑xylulose kinase |
| RA | 3,774,207 | C→T | 10.2% | intergenic (+13/‑217) | mtlA → / → mtlD | mannitol‑specific PTS enzyme: IIA, IIB and IIC components/mannitol‑1‑phosphate dehydrogenase, NAD‑dependent |
| RA | 3,774,214 | C→T | 10.0% | intergenic (+20/‑210) | mtlA → / → mtlD | mannitol‑specific PTS enzyme: IIA, IIB and IIC components/mannitol‑1‑phosphate dehydrogenase, NAD‑dependent |
| RA | 3,774,215 | A→G | 10.0% | intergenic (+21/‑209) | mtlA → / → mtlD | mannitol‑specific PTS enzyme: IIA, IIB and IIC components/mannitol‑1‑phosphate dehydrogenase, NAD‑dependent |
| RA | 3,774,222 | A→G | 9.5% | intergenic (+28/‑202) | mtlA → / → mtlD | mannitol‑specific PTS enzyme: IIA, IIB and IIC components/mannitol‑1‑phosphate dehydrogenase, NAD‑dependent |
| RA | 3,778,876 | G→A | 5.9% | G493D (GGC→GAC) | lldP → | L‑lactate permease |
| RA | 3,778,879 | T→C | 5.7% | V494A (GTC→GCC) | lldP → | L‑lactate permease |
| RA | 3,781,051 | C→G | 14.4% | intergenic (+34/‑164) | lldD → / → trmL | L‑lactate dehydrogenase, FMN‑linked/tRNA Leu mC34,mU34 2'‑O‑methyltransferase, SAM‑dependent |
| RA | 3,790,300 | A→T | 11.6% | intergenic (‑219/+20) | waaH ← / ← tdh | LPS(HepIII)‑glucuronic acid glycosyltransferase/L‑threonine 3‑dehydrogenase, NAD(P)‑binding |
| RA | 3,790,303 | A→T | 11.4% | intergenic (‑222/+17) | waaH ← / ← tdh | LPS(HepIII)‑glucuronic acid glycosyltransferase/L‑threonine 3‑dehydrogenase, NAD(P)‑binding |
| RA | 3,798,234 | A→T | 12.5% | intergenic (+27/+5) | waaL → / ← waaU | O‑antigen ligase/lipopolysaccharide core biosynthesis |
| RA | 3,798,235 | A→T | 12.5% | intergenic (+28/+4) | waaL → / ← waaU | O‑antigen ligase/lipopolysaccharide core biosynthesis |
| RA | 3,815,816 | C→G | 8.2% | intergenic (‑48/+18) | pyrE ← / ← rph | orotate phosphoribosyltransferase/ribonuclease PH (defective);enzyme; Degradation of RNA; RNase PH |
| RA | 3,815,819 | C→G | 8.2% | intergenic (‑51/+15) | pyrE ← / ← rph | orotate phosphoribosyltransferase/ribonuclease PH (defective);enzyme; Degradation of RNA; RNase PH |
| RA | 3,817,940 | T→A | 7.6% | F61I (TTC→ATC) | dinD → | DNA damage‑inducible protein |
| RA | 3,817,948 | G→T | 8.1% | E63D (GAG→GAT) | dinD → | DNA damage‑inducible protein |
| RA | 3,817,949 | A→C | 7.7% | I64L (ATC→CTC) | dinD → | DNA damage‑inducible protein |
| RA | 3,817,957 | T→A | 5.9% | D66E (GAT→GAA) | dinD → | DNA damage‑inducible protein |
| RA | 3,831,768 | A→G | 5.1% | T438A (ACA→GCA) | yicH → | putative inner membrane‑anchored periplasmic AsmA family protein |
| RA | 3,832,188 | A→T | 7.8% | intergenic (+22/+31) | yicH → / ← yicI | putative inner membrane‑anchored periplasmic AsmA family protein/putative alpha‑glucosidase |
| RA | 3,832,191 | C→G | 6.9% | intergenic (+25/+28) | yicH → / ← yicI | putative inner membrane‑anchored periplasmic AsmA family protein/putative alpha‑glucosidase |
| RA | 3,832,194 | A→T | 6.8% | intergenic (+28/+25) | yicH → / ← yicI | putative inner membrane‑anchored periplasmic AsmA family protein/putative alpha‑glucosidase |
| RA | 3,873,375 | C→T | 5.5% | G80S (GGC→AGC) | dgoA ← | 2‑oxo‑3‑deoxygalactonate 6‑phosphate aldolase |
| RA | 3,877,558 | G→C | 60.0% | intergenic (‑93/+147) | yidB ← / ← gyrB | DUF937 family protein/DNA gyrase, subunit B |
| RA | 3,888,212 | Δ1 bp | 10.3% | intergenic (+20/‑223) | mnmE → / → tnaC | tRNA U34 5‑methylaminomethyl‑2‑thiouridine modification GTPase/tryptophanase leader peptide |
| RA | 3,888,219 | T→A | 8.6% | intergenic (+27/‑216) | mnmE → / → tnaC | tRNA U34 5‑methylaminomethyl‑2‑thiouridine modification GTPase/tryptophanase leader peptide |
| RA | 3,888,224:1 | +A | 6.0% | intergenic (+32/‑211) | mnmE → / → tnaC | tRNA U34 5‑methylaminomethyl‑2‑thiouridine modification GTPase/tryptophanase leader peptide |
| RA | 3,891,502 | C→G | 11.3% | intergenic (+19/‑113) | tnaB → / → mdtL | tryptophan transporter of low affinity/multidrug efflux system protein |
| RA | 3,891,504 | T→A | 10.2% | intergenic (+21/‑111) | tnaB → / → mdtL | tryptophan transporter of low affinity/multidrug efflux system protein |
| RA | 3,891,506 | C→G | 5.4% | intergenic (+23/‑109) | tnaB → / → mdtL | tryptophan transporter of low affinity/multidrug efflux system protein |
| RA | 3,908,435 | T→G | 5.3% | intergenic (‑69/+114) | pstB ← / ← pstA | phosphate ABC transporter ATPase/phosphate ABC transporter permease |
| RA | 3,908,436 | C→A | 5.3% | intergenic (‑70/+113) | pstB ← / ← pstA | phosphate ABC transporter ATPase/phosphate ABC transporter permease |
| RA | 3,908,442 | G→T | 5.0% | intergenic (‑76/+107) | pstB ← / ← pstA | phosphate ABC transporter ATPase/phosphate ABC transporter permease |
| RA | 3,908,443 | C→G | 5.0% | intergenic (‑77/+106) | pstB ← / ← pstA | phosphate ABC transporter ATPase/phosphate ABC transporter permease |
| RA | 3,923,717 | G→A | 7.0% | intergenic (‑37/+27) | rsmG ← / ← mnmG | 16S rRNA m(7)G527 methyltransferase, SAM‑dependent; glucose‑inhibited cell‑division protein/5‑methylaminomethyl‑2‑thiouridine modification at tRNA U34 |
| RA | 3,923,718 | G→C | 7.1% | intergenic (‑38/+26) | rsmG ← / ← mnmG | 16S rRNA m(7)G527 methyltransferase, SAM‑dependent; glucose‑inhibited cell‑division protein/5‑methylaminomethyl‑2‑thiouridine modification at tRNA U34 |
| RA | 3,923,719 | G→C | 7.1% | intergenic (‑39/+25) | rsmG ← / ← mnmG | 16S rRNA m(7)G527 methyltransferase, SAM‑dependent; glucose‑inhibited cell‑division protein/5‑methylaminomethyl‑2‑thiouridine modification at tRNA U34 |
| RA | 3,923,720 | T→C | 6.8% | intergenic (‑40/+24) | rsmG ← / ← mnmG | 16S rRNA m(7)G527 methyltransferase, SAM‑dependent; glucose‑inhibited cell‑division protein/5‑methylaminomethyl‑2‑thiouridine modification at tRNA U34 |
| RA | 3,938,255 | T→A | 5.9% | L10Q (CTG→CAG) | rbsR → | transcriptional repressor of ribose metabolism |
| RA | 3,947,048 | G→T | 7.1% | intergenic (+16/+80) | trpT → / ← hdfR | tRNA‑Trp/flhDC operon transcriptional repressor |
| RA | 3,947,049 | A→T | 7.1% | intergenic (+17/+79) | trpT → / ← hdfR | tRNA‑Trp/flhDC operon transcriptional repressor |
| RA | 3,947,050 | A→T | 7.1% | intergenic (+18/+78) | trpT → / ← hdfR | tRNA‑Trp/flhDC operon transcriptional repressor |
| RA | 3,947,051 | A→C | 7.1% | intergenic (+19/+77) | trpT → / ← hdfR | tRNA‑Trp/flhDC operon transcriptional repressor |
| RA | 3,959,480 | A→T | 5.3% | intergenic (+35/+52) | ilvC → / ← ppiC | ketol‑acid reductoisomerase, NAD(P)‑binding/peptidyl‑prolyl cis‑trans isomerase C (rotamase C) |
| RA | 3,959,481 | C→G | 5.3% | intergenic (+36/+51) | ilvC → / ← ppiC | ketol‑acid reductoisomerase, NAD(P)‑binding/peptidyl‑prolyl cis‑trans isomerase C (rotamase C) |
| RA | 3,959,515 | T→A | 8.8% | intergenic (+70/+17) | ilvC → / ← ppiC | ketol‑acid reductoisomerase, NAD(P)‑binding/peptidyl‑prolyl cis‑trans isomerase C (rotamase C) |
| RA | 3,959,924 | A→T | 10.5% | intergenic (‑111/+88) | ppiC ← / ← yifN | peptidyl‑prolyl cis‑trans isomerase C (rotamase C)/PemK toxin family pseudogene |
| RA | 3,959,925 | A→T | 10.4% | intergenic (‑112/+87) | ppiC ← / ← yifN | peptidyl‑prolyl cis‑trans isomerase C (rotamase C)/PemK toxin family pseudogene |
| RA | 3,959,926 | A→T | 10.5% | intergenic (‑113/+86) | ppiC ← / ← yifN | peptidyl‑prolyl cis‑trans isomerase C (rotamase C)/PemK toxin family pseudogene |
| RA | 3,963,415 | A→C | 5.4% | L272R (CTG→CGG) ‡ | gpp ← | guanosine pentaphosphatase/exopolyphosphatase |
| RA | 3,963,416 | G→T | 5.3% | L272M (CTG→ATG) ‡ | gpp ← | guanosine pentaphosphatase/exopolyphosphatase |
| RA | 3,964,891 | A→T | 6.4% | L247Q (CTG→CAG) | rhlB ← | ATP‑dependent RNA helicase |
| RA | 3,971,996 | T→A | 5.4% | L246Q (CTG→CAG) | wecC → | UDP‑N‑acetyl‑D‑mannosaminuronic acid dehydrogenase |
| RA | 3,980,726 | G→A | 5.9% | intergenic (+30/‑161) | wecG → / → yifK | UDP‑N‑acetyl‑D‑mannosaminuronic acid transferase/putative APC family amino acid transporter |
| RA | 3,980,727 | T→C | 5.8% | intergenic (+31/‑160) | wecG → / → yifK | UDP‑N‑acetyl‑D‑mannosaminuronic acid transferase/putative APC family amino acid transporter |
| RA | 3,980,768 | C→A | 6.7% | intergenic (+72/‑119) | wecG → / → yifK | UDP‑N‑acetyl‑D‑mannosaminuronic acid transferase/putative APC family amino acid transporter |
| RA | 3,980,772 | T→A | 5.9% | intergenic (+76/‑115) | wecG → / → yifK | UDP‑N‑acetyl‑D‑mannosaminuronic acid transferase/putative APC family amino acid transporter |
| RA | 3,980,776 | T→G | 6.7% | intergenic (+80/‑111) | wecG → / → yifK | UDP‑N‑acetyl‑D‑mannosaminuronic acid transferase/putative APC family amino acid transporter |
| RA | 3,984,227 | G→A | 5.4% | intergenic (+34/+125) | aslB → / ← aslA | putative AslA‑specific sulfatase‑maturating enzyme/putative Ser‑type periplasmic non‑aryl sulfatase |
| RA | 3,984,228 | C→A | 5.4% | intergenic (+35/+124) | aslB → / ← aslA | putative AslA‑specific sulfatase‑maturating enzyme/putative Ser‑type periplasmic non‑aryl sulfatase |
| RA | 3,984,234 | A→T | 5.1% | intergenic (+41/+118) | aslB → / ← aslA | putative AslA‑specific sulfatase‑maturating enzyme/putative Ser‑type periplasmic non‑aryl sulfatase |
| RA | 3,984,235 | A→T | 5.1% | intergenic (+42/+117) | aslB → / ← aslA | putative AslA‑specific sulfatase‑maturating enzyme/putative Ser‑type periplasmic non‑aryl sulfatase |
| RA | 3,984,241 | T→G | 5.3% | intergenic (+48/+111) | aslB → / ← aslA | putative AslA‑specific sulfatase‑maturating enzyme/putative Ser‑type periplasmic non‑aryl sulfatase |
| RA | 3,984,242 | T→C | 5.3% | intergenic (+49/+110) | aslB → / ← aslA | putative AslA‑specific sulfatase‑maturating enzyme/putative Ser‑type periplasmic non‑aryl sulfatase |
| RA | 3,991,334 | T→A | 5.6% | I61N (ATT→AAT) ‡ | cyaA → | adenylate cyclase |
| RA | 3,991,335 | T→A | 5.6% | I61I (ATT→ATA) ‡ | cyaA → | adenylate cyclase |
| RA | 4,000,230 | A→G | 7.5% | intergenic (+85/+62) | uvrD → / ← yigE | DNA‑dependent ATPase I and helicase II/DUF2233 family protein |
| RA | 4,000,231 | G→C | 7.8% | intergenic (+86/+61) | uvrD → / ← yigE | DNA‑dependent ATPase I and helicase II/DUF2233 family protein |
| RA | 4,000,237 | T→A | 7.8% | intergenic (+92/+55) | uvrD → / ← yigE | DNA‑dependent ATPase I and helicase II/DUF2233 family protein |
| RA | 4,000,238 | T→A | 7.8% | intergenic (+93/+54) | uvrD → / ← yigE | DNA‑dependent ATPase I and helicase II/DUF2233 family protein |
| RA | 4,000,244 | G→C | 5.3% | intergenic (+99/+48) | uvrD → / ← yigE | DNA‑dependent ATPase I and helicase II/DUF2233 family protein |
| RA | 4,000,245 | C→T | 5.3% | intergenic (+100/+47) | uvrD → / ← yigE | DNA‑dependent ATPase I and helicase II/DUF2233 family protein |
| RA | 4,015,333 | A→T | 5.4% | intergenic (+19/+21) | metE → / ← ysgA | 5‑methyltetrahydropteroyltriglutamate‑ homocysteine S‑methyltransferase/putative carboxymethylenebutenolidase |
| RA | 4,017,216:1 | +A | 14.9% | intergenic (+24/‑117) | udp → / → rmuC | uridine phosphorylase/DNA recombination protein |
| RA | 4,017,222 | Δ1 bp | 16.2% | intergenic (+30/‑111) | udp → / → rmuC | uridine phosphorylase/DNA recombination protein |
| RA | 4,040,661 | G→A | 17.6% | intergenic (+25/+245) | rrfA → / ← mobB | 5S ribosomal RNA of rrnA operon/molybdopterin‑guanine dinucleotide biosynthesis protein B |
| RA | 4,041,216 | T→C | 7.3% | Q73R (CAG→CGG) ‡ | mobB ← | molybdopterin‑guanine dinucleotide biosynthesis protein B |
| RA | 4,041,217 | G→A | 7.3% | Q73* (CAG→TAG) ‡ | mobB ← | molybdopterin‑guanine dinucleotide biosynthesis protein B |
| RA | 4,041,220 | T→C | 7.3% | S72G (AGC→GGC) | mobB ← | molybdopterin‑guanine dinucleotide biosynthesis protein B |
| RA | 4,041,221 | G→A | 7.2% | A71A (GCC→GCT) | mobB ← | molybdopterin‑guanine dinucleotide biosynthesis protein B |
| RA | 4,049,986 | G→T | 33.3% | noncoding (88/109 nt) | spf → | Spot 42 sRNA antisense regulator of galK translation, Hfq‑dependent |
| RA | 4,049,989 | A→C | 30.5% | noncoding (91/109 nt) | spf → | Spot 42 sRNA antisense regulator of galK translation, Hfq‑dependent |
| RA | 4,051,259 | G→T | 21.8% | noncoding (224/245 nt) | csrC → | CsrC sRNA sequesters CsrA, a carbon flux regulator |
| RA | 4,051,262 | A→C | 21.7% | noncoding (227/245 nt) | csrC → | CsrC sRNA sequesters CsrA, a carbon flux regulator |
| RA | 4,053,566:1 | +A | 10.0% | intergenic (+148/+81) | hemN → / ← yshB | coproporphyrinogen III oxidase, SAM and NAD(P)H dependent, oxygen‑independent/uncharacterized protein |
| RA | 4,053,569 | A→C | 9.5% | intergenic (+151/+78) | hemN → / ← yshB | coproporphyrinogen III oxidase, SAM and NAD(P)H dependent, oxygen‑independent/uncharacterized protein |
| RA | 4,053,570 | G→T | 9.3% | intergenic (+152/+77) | hemN → / ← yshB | coproporphyrinogen III oxidase, SAM and NAD(P)H dependent, oxygen‑independent/uncharacterized protein |
| RA | 4,053,573 | Δ1 bp | 8.7% | intergenic (+155/+74) | hemN → / ← yshB | coproporphyrinogen III oxidase, SAM and NAD(P)H dependent, oxygen‑independent/uncharacterized protein |
| RA | 4,060,261 | G→T | 20.8% | intergenic (+31/‑186) | typA → / → yihL | GTP‑binding protein/putative DNA‑binding transcriptional regulator |
| RA | 4,060,264 | A→C | 19.1% | intergenic (+34/‑183) | typA → / → yihL | GTP‑binding protein/putative DNA‑binding transcriptional regulator |
| RA | 4,062,371 | A→T | 7.2% | N42I (AAT→ATT) | yihN → | MFS transporter family protein |
| RA | 4,062,811 | C→A | 6.7% | L189M (CTG→ATG) ‡ | yihN → | MFS transporter family protein |
| RA | 4,062,813 | G→T | 6.7% | L189L (CTG→CTT) ‡ | yihN → | MFS transporter family protein |
| RA | 4,062,814 | A→C | 6.9% | N190H (AAT→CAT) ‡ | yihN → | MFS transporter family protein |
| RA | 4,062,816 | T→G | 6.9% | N190K (AAT→AAG) ‡ | yihN → | MFS transporter family protein |
| RA | 4,070,410 | C→A | 12.7% | intergenic (‑9/+105) | yihR ← / ← yihS | putative sulphoquinovose mutarotase/sulphoquinovose isomerase |
| RA | 4,070,413 | T→G | 12.8% | intergenic (‑12/+102) | yihR ← / ← yihS | putative sulphoquinovose mutarotase/sulphoquinovose isomerase |
| RA | 4,071,615 | T→C | 5.7% | T48A (ACC→GCC) | yihS ← | sulphoquinovose isomerase |
| RA | 4,071,616 | G→A | 5.7% | G47G (GGC→GGT) | yihS ← | sulphoquinovose isomerase |
| RA | 4,088,091 | G→C | 14.6% | intergenic (+34/+16) | yiiG → / ← frvR | DUF3829 family lipoprotein/putative frv operon regulator; contains a PTS EIIA domain |
| RA | 4,095,838 | C→A | 5.1% | E49* (GAA→TAA) | rhaA ← | L‑rhamnose isomerase |
| RA | 4,148,049 | C→G | 5.7% | G90A (GGC→GCC) | yijO ← | AraC family putative transcriptional activator |
| RA | 4,168,349 | A→G | 8.8% | intergenic (+149/‑23) | rrsB → / → gltT | 16S ribosomal RNA of rrnB operon/tRNA‑Glu |
| RA | 4,168,350 | A→T | 8.8% | intergenic (+150/‑22) | rrsB → / → gltT | 16S ribosomal RNA of rrnB operon/tRNA‑Glu |
| RA | 4,168,351 | C→T | 8.7% | intergenic (+151/‑21) | rrsB → / → gltT | 16S ribosomal RNA of rrnB operon/tRNA‑Glu |
| RA | 4,185,299 | T→C | 5.3% | intergenic (+26/‑51) | rpoB → / → rpoC | RNA polymerase, beta subunit/RNA polymerase, beta prime subunit |
| RA | 4,185,306 | A→T | 6.3% | intergenic (+33/‑44) | rpoB → / → rpoC | RNA polymerase, beta subunit/RNA polymerase, beta prime subunit |
| RA | 4,185,307 | A→T | 6.3% | intergenic (+34/‑43) | rpoB → / → rpoC | RNA polymerase, beta subunit/RNA polymerase, beta prime subunit |
| RA | 4,185,314 | G→A | 6.0% | intergenic (+41/‑36) | rpoB → / → rpoC | RNA polymerase, beta subunit/RNA polymerase, beta prime subunit |
| RA | 4,196,352 | G→C | 6.0% | R153G (CGC→GGC) | rsd ← | stationary phase protein, binds sigma 70 RNA polymerase subunit |
| RA | 4,196,354 | G→C | 6.0% | A152G (GCC→GGC) | rsd ← | stationary phase protein, binds sigma 70 RNA polymerase subunit |
| RA | 4,196,356 | G→C | 6.0% | A151A (GCC→GCG) | rsd ← | stationary phase protein, binds sigma 70 RNA polymerase subunit |
| RA | 4,207,576 | A→G | 7.2% | intergenic (‑44/‑571) | purH ← / → rrsE | IMP cyclohydrolase and phosphoribosylaminoimidazolecarboxamide formyltransferase/16S ribosomal RNA of rrnE operon |
| RA | 4,207,591 | C→T | 9.6% | intergenic (‑59/‑556) | purH ← / → rrsE | IMP cyclohydrolase and phosphoribosylaminoimidazolecarboxamide formyltransferase/16S ribosomal RNA of rrnE operon |
| RA | 4,208,230 | T→A | 19.6% | noncoding (84/1542 nt) | rrsE → | 16S ribosomal RNA of rrnE operon |
| RA | 4,208,231 | T→A | 19.5% | noncoding (85/1542 nt) | rrsE → | 16S ribosomal RNA of rrnE operon |
| RA | 4,213,131 | C→T | 6.5% | noncoding (92/120 nt) | rrfE → | 5S ribosomal RNA of rrnE operon |
| RA | 4,218,447 | A→G | 8.1% | intergenic (+34/‑149) | aceA → / → aceK | isocitrate lyase/isocitrate dehydrogenase kinase/phosphatase |
| RA | 4,218,448 | A→C | 7.9% | intergenic (+35/‑148) | aceA → / → aceK | isocitrate lyase/isocitrate dehydrogenase kinase/phosphatase |
| RA | 4,218,454 | T→G | 8.3% | intergenic (+41/‑142) | aceA → / → aceK | isocitrate lyase/isocitrate dehydrogenase kinase/phosphatase |
| RA | 4,218,455 | C→A | 8.2% | intergenic (+42/‑141) | aceA → / → aceK | isocitrate lyase/isocitrate dehydrogenase kinase/phosphatase |
| RA | 4,223,855 | G→A | 5.2% | A10T (GCG→ACG) | metH → | homocysteine‑N5‑methyltetrahydrofolate transmethylase, B12‑dependent |
| RA | 4,227,550 | G→A | 9.2% | intergenic (+39/‑181) | metH → / → yjbB | homocysteine‑N5‑methyltetrahydrofolate transmethylase, B12‑dependent/putative Na+/Pi‑cotransporter |
| RA | 4,227,555 | A→T | 7.9% | intergenic (+44/‑176) | metH → / → yjbB | homocysteine‑N5‑methyltetrahydrofolate transmethylase, B12‑dependent/putative Na+/Pi‑cotransporter |
| RA | 4,227,560 | T→C | 9.0% | intergenic (+49/‑171) | metH → / → yjbB | homocysteine‑N5‑methyltetrahydrofolate transmethylase, B12‑dependent/putative Na+/Pi‑cotransporter |
| RA | 4,245,108 | T→G | 6.4% | intergenic (‑33/+121) | malF ← / ← malE | maltose transporter subunit/maltose transporter subunit |
| RA | 4,245,110 | T→G | 6.4% | intergenic (‑35/+119) | malF ← / ← malE | maltose transporter subunit/maltose transporter subunit |
| RA | 4,245,111 | C→A | 6.0% | intergenic (‑36/+118) | malF ← / ← malE | maltose transporter subunit/maltose transporter subunit |
| RA | 4,245,113 | C→A | 6.1% | intergenic (‑38/+116) | malF ← / ← malE | maltose transporter subunit/maltose transporter subunit |
| RA | 4,261,358 | T→A | 5.6% | intergenic (+52/‑311) | yjbM → / → dusA | uncharacterized protein/tRNA‑dihydrouridine synthase A |
| RA | 4,261,359 | T→A | 5.8% | intergenic (+53/‑310) | yjbM → / → dusA | uncharacterized protein/tRNA‑dihydrouridine synthase A |
| RA | 4,262,250 | G→C | 7.8% | G194G (GGG→GGC) | dusA → | tRNA‑dihydrouridine synthase A |
| RA | 4,262,255 | G→C | 7.2% | S196T (AGC→ACC) | dusA → | tRNA‑dihydrouridine synthase A |
| RA | 4,270,013 | A→G | 5.5% | A200A (GCA→GCG) | aphA → | acid phosphatase/phosphotransferase, class B, non‑specific |
| RA | 4,274,740 | G→A | 13.4% | intergenic (+79/+20) | ssb → / ← yjcB | single‑stranded DNA‑binding protein/putative inner membrane protein |
| RA | 4,274,742 | T→A | 13.0% | intergenic (+81/+18) | ssb → / ← yjcB | single‑stranded DNA‑binding protein/putative inner membrane protein |
| RA | 4,274,744 | T→C | 13.0% | intergenic (+83/+16) | ssb → / ← yjcB | single‑stranded DNA‑binding protein/putative inner membrane protein |
| RA | 4,281,677 | T→A | 7.1% | intergenic (+48/+106) | yjcE → / ← yjcF | putative cation/proton antiporter/pentapeptide repeats protein |
| RA | 4,281,678 | C→A | 7.2% | intergenic (+49/+105) | yjcE → / ← yjcF | putative cation/proton antiporter/pentapeptide repeats protein |
| RA | 4,281,679 | T→G | 8.1% | intergenic (+50/+104) | yjcE → / ← yjcF | putative cation/proton antiporter/pentapeptide repeats protein |
| RA | 4,281,680 | T→A | 8.1% | intergenic (+51/+103) | yjcE → / ← yjcF | putative cation/proton antiporter/pentapeptide repeats protein |
| RA | 4,291,512 | G→A | 10.9% | M1M (GTG→ATG) †‡ | nrfE → | heme lyase (NrfEFG) for insertion of heme into c552, subunit NrfE |
| RA | 4,291,513 | T→C | 11.6% | M1A (GTG→GCG) †‡ | nrfE → | heme lyase (NrfEFG) for insertion of heme into c552, subunit NrfE |
| RA | 4,296,060 | C→T | 15.2% | intergenic (+266/+376) | gltP → / ← yjcO | glutamate/aspartate:proton symporter/Sel1 family TPR‑like repeat protein |
| RA | 4,296,380:1 | +CG | 100% | intergenic (+586/+56) | gltP → / ← yjcO | glutamate/aspartate:proton symporter/Sel1 family TPR‑like repeat protein |
| RA | 4,307,294 | A→T | 8.8% | L169Q (CTG→CAG) | alsK ← | D‑allose kinase |
| RA | 4,307,298 | G→A | 8.9% | P168S (CCC→TCC) | alsK ← | D‑allose kinase |
| RA | 4,312,074 | C→T | 6.2% | intergenic (‑32/+27) | alsB ← / ← alsR | D‑allose ABC transporter periplasmic binding protein/d‑allose‑inducible als operon transcriptional repressor; autorepressor; repressor of rpiR |
| RA | 4,312,080 | G→C | 10.6% | intergenic (‑38/+21) | alsB ← / ← alsR | D‑allose ABC transporter periplasmic binding protein/d‑allose‑inducible als operon transcriptional repressor; autorepressor; repressor of rpiR |
| RA | 4,312,083 | G→C | 10.3% | intergenic (‑41/+18) | alsB ← / ← alsR | D‑allose ABC transporter periplasmic binding protein/d‑allose‑inducible als operon transcriptional repressor; autorepressor; repressor of rpiR |
| RA | 4,312,089 | A→G | 10.7% | intergenic (‑47/+12) | alsB ← / ← alsR | D‑allose ABC transporter periplasmic binding protein/d‑allose‑inducible als operon transcriptional repressor; autorepressor; repressor of rpiR |
| RA | 4,323,305 | C→A | 5.1% | intergenic (‑75/+31) | phnE ← / ← phnD | defective phosphonate ABC transporter permease;transport; Transport of small molecules: Anions; membrane channel protein component of Pn transporter; membrane component of ABC superfamily/phosphonate ABC transporter periplasmic binding protein |
| RA | 4,323,312 | G→C | 7.7% | intergenic (‑82/+24) | phnE ← / ← phnD | defective phosphonate ABC transporter permease;transport; Transport of small molecules: Anions; membrane channel protein component of Pn transporter; membrane component of ABC superfamily/phosphonate ABC transporter periplasmic binding protein |
| RA | 4,323,313 | G→C | 7.7% | intergenic (‑83/+23) | phnE ← / ← phnD | defective phosphonate ABC transporter permease;transport; Transport of small molecules: Anions; membrane channel protein component of Pn transporter; membrane component of ABC superfamily/phosphonate ABC transporter periplasmic binding protein |
| RA | 4,323,320 | T→G | 6.2% | intergenic (‑90/+16) | phnE ← / ← phnD | defective phosphonate ABC transporter permease;transport; Transport of small molecules: Anions; membrane channel protein component of Pn transporter; membrane component of ABC superfamily/phosphonate ABC transporter periplasmic binding protein |
| RA | 4,323,321 | T→C | 6.2% | intergenic (‑91/+15) | phnE ← / ← phnD | defective phosphonate ABC transporter permease;transport; Transport of small molecules: Anions; membrane channel protein component of Pn transporter; membrane component of ABC superfamily/phosphonate ABC transporter periplasmic binding protein |
| RA | 4,326,358 | G→A | 8.5% | intergenic (‑617/+41) | yjdN ← / ← yjdM | metalloprotein superfamily protein/zinc‑ribbon family protein |
| RA | 4,326,359 | C→A | 8.5% | intergenic (‑618/+40) | yjdN ← / ← yjdM | metalloprotein superfamily protein/zinc‑ribbon family protein |
| RA | 4,326,365 | G→T | 8.3% | intergenic (‑624/+34) | yjdN ← / ← yjdM | metalloprotein superfamily protein/zinc‑ribbon family protein |
| RA | 4,326,366 | A→C | 8.3% | intergenic (‑625/+33) | yjdN ← / ← yjdM | metalloprotein superfamily protein/zinc‑ribbon family protein |
| RA | 4,326,372 | T→G | 6.8% | intergenic (‑631/+27) | yjdN ← / ← yjdM | metalloprotein superfamily protein/zinc‑ribbon family protein |
| RA | 4,326,373 | T→C | 7.0% | intergenic (‑632/+26) | yjdN ← / ← yjdM | metalloprotein superfamily protein/zinc‑ribbon family protein |
| RA | 4,335,654 | T→A | 19.8% | intergenic (‑64/+40) | eptA ← / ← adiC | lipid A phosphoethanolamine transferase/arginine:agmatine antiporter |
| RA | 4,335,655 | T→A | 19.8% | intergenic (‑65/+39) | eptA ← / ← adiC | lipid A phosphoethanolamine transferase/arginine:agmatine antiporter |
| RA | 4,347,285 | C→G | 8.3% | M14I (ATG→ATC) | fumB ← | anaerobic class I fumarate hydratase (fumarase B) |
| RA | 4,347,288 | C→G | 8.0% | P13P (CCG→CCC) | fumB ← | anaerobic class I fumarate hydratase (fumarase B) |
| RA | 4,353,170 | G→A | 13.5% | intergenic (+89/+30) | ghoT → / ← lysU | toxin of GhoTS toxin‑antitoxin pair; membrane‑lytic protein; stimulator of persister cell formation/lysine tRNA synthetase, inducible |
| RA | 4,353,171 | C→G | 17.0% | intergenic (+90/+29) | ghoT → / ← lysU | toxin of GhoTS toxin‑antitoxin pair; membrane‑lytic protein; stimulator of persister cell formation/lysine tRNA synthetase, inducible |
| RA | 4,353,172 | C→G | 14.3% | intergenic (+91/+28) | ghoT → / ← lysU | toxin of GhoTS toxin‑antitoxin pair; membrane‑lytic protein; stimulator of persister cell formation/lysine tRNA synthetase, inducible |
| RA | 4,353,173 | T→C | 15.0% | intergenic (+92/+27) | ghoT → / ← lysU | toxin of GhoTS toxin‑antitoxin pair; membrane‑lytic protein; stimulator of persister cell formation/lysine tRNA synthetase, inducible |
| RA | 4,356,445 | A→T | 24.0% | intergenic (‑34/+25) | dtpC ← / ← cadA | dipeptide and tripeptide permease/lysine decarboxylase, acid‑inducible |
| RA | 4,356,446 | A→T | 24.0% | intergenic (‑35/+24) | dtpC ← / ← cadA | dipeptide and tripeptide permease/lysine decarboxylase, acid‑inducible |
| RA | 4,362,528 | G→A | 16.3% | intergenic (‑175/+23) | yjdQ ← / ← pheU | pseudogene, P4‑like integrase remnant/tRNA‑Phe |
| RA | 4,362,529 | T→C | 16.9% | intergenic (‑176/+22) | yjdQ ← / ← pheU | pseudogene, P4‑like integrase remnant/tRNA‑Phe |
| RA | 4,367,700 | G→T | 5.3% | L210M (CTG→ATG) | aspA ← | aspartate ammonia‑lyase |
| RA | 4,367,701 | G→C | 5.1% | I209M (ATC→ATG) | aspA ← | aspartate ammonia‑lyase |
| RA | 4,371,931 | G→T | 7.0% | E303* (GAA→TAA) ‡ | groL → | Cpn60 chaperonin GroEL, large subunit of GroESL |
| RA | 4,371,932 | A→C | 7.5% | E303A (GAA→GCA) ‡ | groL → | Cpn60 chaperonin GroEL, large subunit of GroESL |
| RA | 4,376,291 | T→C | 5.9% | intergenic (+26/‑26) | efp → / → ecnA | polyproline‑specific translation elongation factor EF‑P/entericidin A membrane lipoprotein, antidote entericidin B |
| RA | 4,385,206 | T→A | 5.2% | P456P (CCT→CCA) | yjeM → | putative transporter |
| RA | 4,385,207 | G→C | 5.2% | V457L (GTG→CTG) ‡ | yjeM → | putative transporter |
| RA | 4,385,208 | T→A | 5.2% | V457E (GTG→GAG) ‡ | yjeM → | putative transporter |
| RA | 4,398,563 | T→C | 5.1% | S384S (AGT→AGC) | mutL → | methyl‑directed mismatch repair protein |
| RA | 4,398,566 | T→G | 5.1% | R385R (CGT→CGG) | mutL → | methyl‑directed mismatch repair protein |
| RA | 4,398,567 | C→A | 5.0% | P386T (CCG→ACG) | mutL → | methyl‑directed mismatch repair protein |
| RA | 4,408,758 | T→C | 9.0% | L702P (CTG→CCG) ‡ | rnr → | exoribonuclease R, RNase R |
| RA | 4,408,759 | G→A | 9.0% | L702L (CTG→CTA) ‡ | rnr → | exoribonuclease R, RNase R |
| RA | 4,409,402 | Δ1 bp | 6.3% | coding (128/732 nt) | rlmB → | 23S rRNA mG2251 2'‑O‑ribose methyltransferase, SAM‑dependent |
| RA | 4,409,407 | T→A | 9.2% | S45T (TCT→ACT) | rlmB → | 23S rRNA mG2251 2'‑O‑ribose methyltransferase, SAM‑dependent |
| RA | 4,409,410:1 | +A | 8.7% | coding (136/732 nt) | rlmB → | 23S rRNA mG2251 2'‑O‑ribose methyltransferase, SAM‑dependent |
| RA | 4,422,895 | C→G | 5.5% | A17G (GCC→GGC) | ulaE → | L‑xylulose 5‑phosphate 3‑epimerase |
| RA | 4,426,592 | T→A | 35.3% | intergenic (+35/+36) | rplI → / ← yjfZ | 50S ribosomal subunit protein L9/uncharacterized protein |
| RA | 4,439,845 | T→A | 14.5% | intergenic (+52/+27) | ytfK → / ← ytfL | DUF1107 family protein/UPF0053 family inner membrane protein |
| RA | 4,444,192 | C→G | 5.0% | G27G (GGC→GGG) | tamB → | translocation and assembly module for autotransporter export, inner membrane subunit |
| RA | 4,444,193 | A→C | 5.1% | T28P (ACC→CCC) | tamB → | translocation and assembly module for autotransporter export, inner membrane subunit |
| RA | 4,447,964 | T→A | 6.8% | L24* (TTA→TAA) | ytfP → | GGCT‑like protein |
| RA | 4,470,951 | A→C | 11.4% | intergenic (‑38/+35) | ridA ← / ← pyrI | enamine/imine deaminase, reaction intermediate detoxification/aspartate carbamoyltransferase, regulatory subunit |
| RA | 4,470,952 | T→C | 11.9% | intergenic (‑39/+34) | ridA ← / ← pyrI | enamine/imine deaminase, reaction intermediate detoxification/aspartate carbamoyltransferase, regulatory subunit |
| RA | 4,470,957 | G→A | 12.1% | intergenic (‑44/+29) | ridA ← / ← pyrI | enamine/imine deaminase, reaction intermediate detoxification/aspartate carbamoyltransferase, regulatory subunit |
| RA | 4,470,958 | G→T | 12.1% | intergenic (‑45/+28) | ridA ← / ← pyrI | enamine/imine deaminase, reaction intermediate detoxification/aspartate carbamoyltransferase, regulatory subunit |
| RA | 4,479,012 | A→T | 13.6% | intergenic (+123/+22) | rraB → / ← yjgM | protein inhibitor of RNase E/GNAT family putative N‑acetyltransferase |
| RA | 4,479,016 | G→C | 13.3% | intergenic (+127/+18) | rraB → / ← yjgM | protein inhibitor of RNase E/GNAT family putative N‑acetyltransferase |
| RA | 4,479,020 | A→T | 13.6% | intergenic (+131/+14) | rraB → / ← yjgM | protein inhibitor of RNase E/GNAT family putative N‑acetyltransferase |
| RA | 4,496,511 | A→G | 6.8% | intergenic (+22/‑164) | leuX → / → intB | tRNA‑Leu/pseudogene, integrase homology;IS, phage, Tn; Phage‑related functions and prophages; KpLE2 phage‑like element; P4‑like integrase |
| RA | 4,496,512 | C→T | 6.8% | intergenic (+23/‑163) | leuX → / → intB | tRNA‑Leu/pseudogene, integrase homology;IS, phage, Tn; Phage‑related functions and prophages; KpLE2 phage‑like element; P4‑like integrase |
| RA | 4,497,954 | A→T | 6.0% | intergenic (+14/‑318) | intB → / → insC1 | pseudogene, integrase homology;IS, phage, Tn; Phage‑related functions and prophages; KpLE2 phage‑like element; P4‑like integrase/IS2 repressor TnpA |
| RA | 4,498,222 | A→T | 5.1% | intergenic (+282/‑50) | intB → / → insC1 | pseudogene, integrase homology;IS, phage, Tn; Phage‑related functions and prophages; KpLE2 phage‑like element; P4‑like integrase/IS2 repressor TnpA |
| RA | 4,498,223 | A→T | 5.1% | intergenic (+283/‑49) | intB → / → insC1 | pseudogene, integrase homology;IS, phage, Tn; Phage‑related functions and prophages; KpLE2 phage‑like element; P4‑like integrase/IS2 repressor TnpA |
| RA | 4,512,350:1 | +G | 9.1% | coding (65/957 nt) | fecD ← | ferric citrate ABC transporter permease |
| RA | 4,520,500 | Δ1 bp | 42.4% | intergenic (‑176/+171) | yjhU ← / ← yjhF | putative DNA‑binding transcriptional regulator; KpLE2 phage‑like element/putative transporter |
| RA | 4,520,504:1 | +T | 42.4% | intergenic (‑180/+167) | yjhU ← / ← yjhF | putative DNA‑binding transcriptional regulator; KpLE2 phage‑like element/putative transporter |
| RA | 4,532,534 | G→C | 6.9% | A217G (GCC→GGC) | yjhP ← | putative methyltransferase |
| RA | 4,532,537 | G→C | 6.9% | A216G (GCC→GGC) | yjhP ← | putative methyltransferase |
| RA | 4,548,914 | G→C | 9.5% | G36A (GGT→GCT) | fimH → | minor component of type 1 fimbriae |
| RA | 4,548,917 | G→C | 9.9% | G37A (GGC→GCC) | fimH → | minor component of type 1 fimbriae |
| RA | 4,548,920 | G→C | 10.4% | S38T (AGC→ACC) | fimH → | minor component of type 1 fimbriae |
| RA | 4,549,932 | T→A | 11.0% | intergenic (+222/+21) | fimH → / ← gntP | minor component of type 1 fimbriae/fructuronate transporter |
| RA | 4,551,422 | T→A | 8.2% | intergenic (‑126/‑214) | gntP ← / → uxuA | fructuronate transporter/mannonate hydrolase |
| RA | 4,572,070 | G→A | 5.4% | intergenic (+155/‑344) | yjiS → / → yjiT | DUF1127 family protein/pseudogene |
| RA | 4,572,083:1 | +G | 5.2% | intergenic (+168/‑331) | yjiS → / → yjiT | DUF1127 family protein/pseudogene |
| RA | 4,572,086 | T→C | 5.3% | intergenic (+171/‑328) | yjiS → / → yjiT | DUF1127 family protein/pseudogene |
| RA | 4,573,188 | G→A | 5.4% | pseudogene (775/1503 nt) | yjiT → | pseudogene |
| RA | 4,612,329 | A→G | 15.8% | intergenic (+40/‑82) | ytjA → / → yjjU | uncharacterized protein/putative patatin‑like family phospholipase |
| RA | 4,612,330 | G→C | 15.1% | intergenic (+41/‑81) | ytjA → / → yjjU | uncharacterized protein/putative patatin‑like family phospholipase |
| RA | 4,612,331 | C→T | 15.1% | intergenic (+42/‑80) | ytjA → / → yjjU | uncharacterized protein/putative patatin‑like family phospholipase |
| RA | 4,620,090 | C→T | 5.3% | T163I (ACC→ATC) | deoB → | phosphopentomutase |
| RA | 4,620,095 | A→T | 5.2% | K165* (AAG→TAG) ‡ | deoB → | phosphopentomutase |
| RA | 4,620,096 | A→T | 5.2% | K165M (AAG→ATG) ‡ | deoB → | phosphopentomutase |
| RA | 4,620,101 | A→G | 5.0% | I167V (ATT→GTT) | deoB → | phosphopentomutase |
| RA | 4,631,643 | A→G | 5.2% | D304G (GAC→GGC) | slt → | lytic murein transglycosylase, soluble |
| RA | 4,633,213 | G→T | 7.6% | intergenic (+127/+20) | trpR → / ← yjjX | transcriptional repressor, tryptophan‑binding/non‑canonical purine NTP phosphatase, ITPase/XTPase |
| RA | 4,633,216 | A→C | 7.6% | intergenic (+130/+17) | trpR → / ← yjjX | transcriptional repressor, tryptophan‑binding/non‑canonical purine NTP phosphatase, ITPase/XTPase |
| RA | 4,638,690 | C→T | 9.8% | G171G (GGC→GGT) | creD → | inner membrane protein |
| RA | 4,638,691 | A→G | 9.6% | T172A (ACC→GCC) | creD → | inner membrane protein |
| Unassigned missing coverage evidence | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | NC_000913 | 707899 | 708106 | 208 | 37 [35] | [35] 37 | glnS/chiP | glutamyl‑tRNA synthetase/chitoporin, uptake of chitosugars |
| * | * | ÷ | NC_000913 | 3423782–3424522 | 3424522 | 1–741 | 37 [34] | [35] 38 | [rrfD]–[rrlD] | [rrfD],[rrlD] |
| * | * | ÷ | NC_000913 | 4304505 | 4304610 | 106 | 40 [35] | [29] 36 | ytcA/yjcS | putative inner membrane efflux pump‑associated DUF1656 family protein/metallo‑beta‑lactamase superfamily protein |
| Unassigned new junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | 5590 = | NA (NA) | 10 (0.060) | 8/224 | NT | 15.2% | noncoding (26/105 nt) | RIP1 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | RIP1 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site |
| ? | NC_000913 | 2304478 = | 56 (0.320) | noncoding (62/655 nt) | REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences | REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences | |||||
| * | ? | NC_000913 | = 16653 | NA (NA) | 8 (0.050) | 7/224 | NT | NA | noncoding (1267/1345 nt) | IS186 | repeat region |
| ? | NC_000913 | = 16691 | NA (NA) | noncoding (1305/1345 nt) | IS186 | repeat region | |||||
| * | ? | NC_000913 | = 68731 | 258 (1.380) | 17 (0.100) | 13/224 | NT | 6.7% | coding (1318/1701 nt) | araB | L‑ribulokinase |
| ? | NC_000913 | = 68753 | 234 (1.330) | coding (1296/1701 nt) | araB | L‑ribulokinase | |||||
| * | ? | NC_000913 | 88450 = | 201 (1.080) | 14 (0.080) | 8/230 | NT | 7.0% | coding (423/1005 nt) | cra | transcriptional repressor‑activator for carbon metabolism |
| ? | NC_000913 | 88491 = | 180 (1.000) | coding (464/1005 nt) | cra | transcriptional repressor‑activator for carbon metabolism | |||||
| * | ? | NC_000913 | 103901 = | 202 (1.080) | 12 (0.070) | 9/226 | NT | 5.8% | coding (747/831 nt) | ftsQ | divisome assembly protein, membrane anchored protein involved in growth of wall at septum |
| ? | NC_000913 | 103941 = | 199 (1.120) | coding (787/831 nt) | ftsQ | divisome assembly protein, membrane anchored protein involved in growth of wall at septum | |||||
| * | ? | NC_000913 | 111593 = | 89 (0.480) | 14 (0.080) | 12/224 | NT | 12.0% | noncoding (164/200 nt) | RIP8 (repetitive extragenic palindromic) element; contains 4 REP sequences and 1 IHF site | RIP8 (repetitive extragenic palindromic) element; contains 4 REP sequences and 1 IHF site |
| ? | NC_000913 | 111626 = | 121 (0.690) | noncoding (197/200 nt) | RIP8 (repetitive extragenic palindromic) element; contains 4 REP sequences and 1 IHF site | RIP8 (repetitive extragenic palindromic) element; contains 4 REP sequences and 1 IHF site | |||||
| * | ? | NC_000913 | = 127796 | 78 (0.420) | 10 (0.060) | 8/230 | NT | 11.2% | intergenic (+209/‑116) | aceF/lpd | pyruvate dehydrogenase, dihydrolipoyltransacetylase component E2/dihydrolipoyl dehydrogenase; E3 component of pyruvate and 2‑oxoglutarate dehydrogenases complexes; glycine cleavage system L protein; dihydrolipoamide dehydrogenase |
| ? | NC_000913 | = 127837 | 83 (0.460) | intergenic (+250/‑75) | aceF/lpd | pyruvate dehydrogenase, dihydrolipoyltransacetylase component E2/dihydrolipoyl dehydrogenase; E3 component of pyruvate and 2‑oxoglutarate dehydrogenases complexes; glycine cleavage system L protein; dihydrolipoamide dehydrogenase | |||||
| * | ? | NC_000913 | 148707 = | 139 (0.740) | 8 (0.040) | 7/230 | NT | 5.7% | coding (89/852 nt) | panC | pantothenate synthetase |
| ? | NC_000913 | 148742 = | 128 (0.710) | coding (54/852 nt) | panC | pantothenate synthetase | |||||
| * | ? | NC_000913 | 183652 = | 137 (0.730) | 12 (0.070) | 10/218 | NT | 8.1% | intergenic (+32/+57) | cdaR/yaeH | carbohydrate diacid regulon transcriptional regulator; autoregulator/UPF0325 family protein |
| ? | NC_000913 | 183685 = | 147 (0.860) | intergenic (+65/+24) | cdaR/yaeH | carbohydrate diacid regulon transcriptional regulator; autoregulator/UPF0325 family protein | |||||
| * | ? | NC_000913 | = 183661 | 150 (0.800) | 26 (0.150) | 14/218 | NT | 15.5% | intergenic (+41/+48) | cdaR/yaeH | carbohydrate diacid regulon transcriptional regulator; autoregulator/UPF0325 family protein |
| ? | NC_000913 | = 183674 | 147 (0.860) | intergenic (+54/+35) | cdaR/yaeH | carbohydrate diacid regulon transcriptional regulator; autoregulator/UPF0325 family protein | |||||
| * | ? | NC_000913 | = 190654 | 137 (0.730) | 9 (0.050) | 7/228 | NT | 6.6% | intergenic (+55/‑203) | rpsB/tsf | 30S ribosomal subunit protein S2/translation elongation factor EF‑Ts |
| ? | NC_000913 | = 190695 | 123 (0.690) | intergenic (+96/‑162) | rpsB/tsf | 30S ribosomal subunit protein S2/translation elongation factor EF‑Ts | |||||
| * | ? | NC_000913 | 193444 = | 45 (0.240) | 5 (0.030) | 4/218 | NT | 10.3% | intergenic (+15/‑77) | frr/dxr | ribosome recycling factor/1‑deoxy‑D‑xylulose 5‑phosphate reductoisomerase |
| ? | NC_000913 | 193489 = | 46 (0.270) | intergenic (+60/‑32) | frr/dxr | ribosome recycling factor/1‑deoxy‑D‑xylulose 5‑phosphate reductoisomerase | |||||
| * | ? | NC_000913 | 200763 = | 185 (0.990) | 16 (0.090) | 10/226 | NT | 8.5% | coding (282/486 nt) | skp | periplasmic chaperone |
| ? | NC_000913 | 200790 = | 168 (0.950) | coding (309/486 nt) | skp | periplasmic chaperone | |||||
| * | ? | NC_000913 | 223936 = | NA (NA) | 6 (0.030) | 5/222 | NT | NA | noncoding (166/1542 nt) | rrsH | 16S ribosomal RNA of rrnH operon |
| ? | NC_000913 | 224021 = | NA (NA) | noncoding (251/1542 nt) | rrsH | 16S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | 224380 = | NA (NA) | 10 (0.060) | 9/230 | NT | NA | noncoding (610/1542 nt) | rrsH | 16S ribosomal RNA of rrnH operon |
| ? | NC_000913 | 224400 = | NA (NA) | noncoding (630/1542 nt) | rrsH | 16S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | 224539 = | NA (NA) | 10 (0.060) | 6/226 | NT | NA | noncoding (769/1542 nt) | rrsH | 16S ribosomal RNA of rrnH operon |
| ? | NC_000913 | 224581 = | NA (NA) | noncoding (811/1542 nt) | rrsH | 16S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | 225078 = | NA (NA) | 39 (0.220) | 22/224 | NT | NA | noncoding (1308/1542 nt) | rrsH | 16S ribosomal RNA of rrnH operon |
| ? | NC_000913 | 225100 = | NA (NA) | noncoding (1330/1542 nt) | rrsH | 16S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | 227242 = | NA (NA) | 20 (0.110) | 11/226 | NT | NA | noncoding (1484/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon |
| ? | NC_000913 | 227264 = | NA (NA) | noncoding (1506/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | = 227400 | NA (NA) | 4 (0.020) | 4/230 | NT | NA | noncoding (1642/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon |
| ? | NC_000913 | = 227485 | NA (NA) | noncoding (1727/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | = 227444 | NA (NA) | 13 (0.070) | 11/228 | NT | NA | noncoding (1686/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon |
| ? | NC_000913 | = 227459 | NA (NA) | noncoding (1701/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | = 228108 | NA (NA) | 49 (0.270) | 24/230 | NT | NA | noncoding (2350/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon |
| ? | NC_000913 | = 228124 | NA (NA) | noncoding (2366/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | = 228224 | NA (NA) | 11 (0.060) | 10/226 | NT | NA | noncoding (2466/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon |
| ? | NC_000913 | = 228241 | NA (NA) | noncoding (2483/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | 228359 = | NA (NA) | 5 (0.030) | 5/226 | NT | NA | noncoding (2601/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon |
| ? | NC_000913 | 228397 = | NA (NA) | noncoding (2639/2904 nt) | rrlH | 23S ribosomal RNA of rrnH operon | |||||
| * | ? | NC_000913 | 274038 = | NA (NA) | 13 (0.070) | 10/226 | NT | NA | noncoding (1112/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | 274083 = | NA (NA) | noncoding (1067/1195 nt) | IS5 | repeat region | |||||
| * | ? | NC_000913 | 274384 = | NA (NA) | 10 (0.050) | 8/232 | NT | NA | noncoding (766/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | 274422 = | NA (NA) | noncoding (728/1195 nt) | IS5 | repeat region | |||||
| * | ? | NC_000913 | 274620 = | NA (NA) | 9 (0.050) | 7/220 | NT | NA | noncoding (530/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | 274663 = | NA (NA) | noncoding (487/1195 nt) | IS5 | repeat region | |||||
| * | ? | NC_000913 | = 274724 | NA (NA) | 5 (0.030) | 4/232 | NT | NA | noncoding (426/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | = 274784 | NA (NA) | noncoding (366/1195 nt) | IS5 | repeat region | |||||
| * | ? | NC_000913 | 277707 = | NA (NA) | 6 (0.030) | 6/224 | NT | 5.4% | noncoding (33/67 nt) | REP22 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP22 (repetitive extragenic palindromic) element; contains 2 REP sequences |
| ? | NC_000913 | 277738 = | 106 (0.600) | noncoding (64/67 nt) | REP22 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP22 (repetitive extragenic palindromic) element; contains 2 REP sequences | |||||
| * | ? | NC_000913 | = 315689 | NA (NA) | 4 (0.020) | 4/232 | NT | NA | noncoding (461/1255 nt) | IS3 | repeat region |
| ? | NC_000913 | = 315751 | NA (NA) | noncoding (523/1255 nt) | IS3 | repeat region | |||||
| * | ? | NC_000913 | = 315852 | NA (NA) | 12 (0.070) | 7/230 | NT | NA | noncoding (624/1255 nt) | IS3 | repeat region |
| ? | NC_000913 | = 315875 | NA (NA) | noncoding (647/1255 nt) | IS3 | repeat region | |||||
| * | ? | NC_000913 | 316193 = | NA (NA) | 4 (0.020) | 4/220 | NT | NA | noncoding (965/1255 nt) | IS3 | repeat region |
| ? | NC_000913 | 316230 = | NA (NA) | noncoding (1002/1255 nt) | IS3 | repeat region | |||||
| * | ? | NC_000913 | = 381669 | NA (NA) | 6 (0.030) | 6/224 | NT | NA | noncoding (410/1331 nt) | IS2 | repeat region |
| ? | NC_000913 | = 381695 | NA (NA) | noncoding (436/1331 nt) | IS2 | repeat region | |||||
| * | ? | NC_000913 | 382110 = | NA (NA) | 16 (0.090) | 10/228 | NT | NA | noncoding (851/1331 nt) | IS2 | repeat region |
| ? | NC_000913 | 382141 = | NA (NA) | noncoding (882/1331 nt) | IS2 | repeat region | |||||
| * | ? | NC_000913 | = 403626 | 72 (0.390) | 4 (0.020) | 4/220 | NT | 5.0% | intergenic (+25/‑77) | psiF/yaiC | PsiF family protein/diguanylate cyclase, cellulose regualtor |
| ? | NC_000913 | = 403636 | 85 (0.490) | intergenic (+35/‑67) | psiF/yaiC | PsiF family protein/diguanylate cyclase, cellulose regualtor | |||||
| * | ? | NC_000913 | 421005 = | 90 (0.480) | 8 (0.050) | 5/222 | NT | 7.5% | coding (20/1374 nt) | proY | proline‑specific permease |
| ? | NC_000913 | 421041 = | 114 (0.660) | coding (56/1374 nt) | proY | proline‑specific permease | |||||
| * | ? | NC_000913 | 483821 = | 171 (0.920) | 9 (0.050) | 9/224 | NT | 5.0% | coding (583/3150 nt) | acrB | multidrug efflux system protein |
| ? | NC_000913 | 483883 = | 179 (1.020) | coding (521/3150 nt) | acrB | multidrug efflux system protein | |||||
| * | ? | NC_000913 | = 668251 | 180 (0.960) | 18 (0.100) | 11/220 | NT | 9.4% | coding (465/468 nt) | rlmH | 23S rRNA m(3)Psi1915 pseudouridine methyltransferase, SAM‑dependent |
| ? | NC_000913 | = 668256 | 179 (1.040) | coding (460/468 nt) | rlmH | 23S rRNA m(3)Psi1915 pseudouridine methyltransferase, SAM‑dependent | |||||
| * | ? | NC_000913 | 762803 = | NA (NA) | 10 (0.060) +CTACG |
4/228 | NT | 30.3% | noncoding (42/167 nt) | REP68 (repetitive extragenic palindromic) element; contains 4 REP sequences | REP68 (repetitive extragenic palindromic) element; contains 4 REP sequences |
| ? | NC_000913 | 3708527 = | 24 (0.130) | intergenic (‑822/+89) | dppA/proK | dipeptide/heme ABC transporter periplasmic binding protein; dipeptide chemotaxis receptor/tRNA‑Pro | |||||
| * | ? | NC_000913 | 791792 = | 107 (0.570) | 10 (0.060) | 8/226 | NT | 8.3% | coding (264/1017 nt) | galE | UDP‑galactose‑4‑epimerase |
| ? | NC_000913 | 791819 = | 118 (0.670) | coding (237/1017 nt) | galE | UDP‑galactose‑4‑epimerase | |||||
| * | ? | NC_000913 | = 937227 | NA (NA) | 11 (0.060) | 10/222 | NT | NA | noncoding (4/36 nt) | REP85 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP85 (repetitive extragenic palindromic) element; contains 1 REP sequences |
| ? | NC_000913 | = 937259 | NA (NA) | noncoding (36/36 nt) | REP85 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP85 (repetitive extragenic palindromic) element; contains 1 REP sequences | |||||
| * | ? | NC_000913 | 1121419 = | 92 (0.490) | 6 (0.030) | 6/226 | NT | 6.6% | coding (69/246 nt) | dinI | DNA damage‑inducible protein I |
| ? | NC_000913 | 1121450 = | 82 (0.460) | coding (38/246 nt) | dinI | DNA damage‑inducible protein I | |||||
| * | ? | NC_000913 | 1182645 = | 169 (0.910) | 14 (0.080) | 9/224 | NT | 8.4% | coding (185/1047 nt) | potD | spermidine/putrescine ABC transporter periplasmic binding protein |
| ? | NC_000913 | 1182663 = | 145 (0.830) | coding (167/1047 nt) | potD | spermidine/putrescine ABC transporter periplasmic binding protein | |||||
| * | ? | NC_000913 | 1207790 = | 54 (0.290) | 140 (0.870) | 89/206 | NT | 76.2% | coding (290/630 nt) | stfP | e14 prophage; uncharacterized protein |
| ? | NC_000913 | 1209619 = | 41 (0.250) | pseudogene (1/501 nt) | stfE | pseudogene, e14 prophage; side tail fiber protein fragment family;Phage or Prophage Related | |||||
| * | ? | NC_000913 | = 1207805 | 55 (0.290) | 85 (0.530) | 57/206 | NT | 65.8% | coding (305/630 nt) | stfP | e14 prophage; uncharacterized protein |
| ? | NC_000913 | = 1209602 | 41 (0.250) | pseudogene (18/501 nt) | stfE | pseudogene, e14 prophage; side tail fiber protein fragment family;Phage or Prophage Related | |||||
| * | ? | NC_000913 | = 1299498 | 0 (0.000) | 90 (0.500) | 72/230 | NT | 100% | intergenic (+253/‑1684) | ychE/oppA | UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein |
| ? | NC_000913 | 1300698 = | 0 (0.000) | intergenic (+1453/‑484) | ychE/oppA | UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein | |||||
| * | ? | NC_000913 | 1396531 = | NA (NA) | 7 (0.040) | 7/226 | NT | NA | noncoding (488/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | = 1428264 | NA (NA) | noncoding (531/1196 nt) | IS5 | repeat region | |||||
| * | ? | NC_000913 | = 1468681 | NA (NA) | 4 (0.020) +GGTTATCGTCGGG |
4/212 | NT | NA | noncoding (560/1331 nt) | IS2 | repeat region |
| ? | NC_000913 | 1650843 = | NA (NA) | noncoding (1/706 nt) | IS2 | repeat region | |||||
| * | ? | NC_000913 | 1490218 = | 150 (0.800) | 10 (0.060) | 6/224 | NT | 6.4% | pseudogene (496/750 nt) | gapC | pseudogene, GAP dehydrogenase; glyceraldehyde‑3‑phosphate dehydrogenase (second fragment) |
| ? | NC_000913 | 1490258 = | 151 (0.860) | pseudogene (456/750 nt) | gapC | pseudogene, GAP dehydrogenase; glyceraldehyde‑3‑phosphate dehydrogenase (second fragment) | |||||
| * | ? | NC_000913 | 1570641 = | 107 (0.570) | 6 (0.040) +ATAACGTTGTAAA |
5/212 | NT | 9.5% | intergenic (‑152/+4) | gadC/gadB | glutamate:gamma‑aminobutyric acid antiporter/glutamate decarboxylase B, PLP‑dependent |
| ? | NC_000913 | 3666120 = | 22 (0.120) | intergenic (‑310/+60) | gadX/gadA | acid resistance regulon transcriptional activator; autoactivator/glutamate decarboxylase A, PLP‑dependent | |||||
| * | ? | NC_000913 | = 1629411 | 37 (0.200) | 4 (0.020) | 4/226 | NT | 10.1% | coding (197/204 nt) | ydfZ | selenoprotein, function unknown |
| ? | NC_000913 | = 1629426 | 36 (0.200) | intergenic (+8/+27) | ydfZ/ydfI | selenoprotein, function unknown/putative NAD‑dependent D‑mannonate oxidoreductase | |||||
| * | ? | NC_000913 | 1657831 = | 131 (0.700) | 8 (0.040) | 8/230 | NT | 5.9% | coding (267/306 nt) | ynfD | DUF1161 family periplasmic protein |
| ? | NC_000913 | 1657858 = | NA (NA) | coding (294/306 nt) | ynfD | DUF1161 family periplasmic protein | |||||
| * | ? | NC_000913 | 1697230 = | 145 (0.780) | 7 (0.040) | 6/214 | NT | 5.9% | intergenic (‑178/+43) | uidR/hdhA | transcriptional repressor/7‑alpha‑hydroxysteroid dehydrogenase, NAD‑dependent |
| ? | NC_000913 | 1697261 = | 93 (0.550) | intergenic (‑209/+12) | uidR/hdhA | transcriptional repressor/7‑alpha‑hydroxysteroid dehydrogenase, NAD‑dependent | |||||
| * | ? | NC_000913 | 1713804 = | 201 (1.080) | 12 (0.070) | 12/232 | NT | 5.9% | coding (1036/1503 nt) | dtpA | dipeptide and tripeptide permease A |
| ? | NC_000913 | 1713842 = | 185 (1.020) | coding (1074/1503 nt) | dtpA | dipeptide and tripeptide permease A | |||||
| * | ? | NC_000913 | 1787626 = | 146 (0.780) | 8 (0.040) | 8/228 | NT | 5.9% | coding (182/834 nt) | ppsR | PEP synthase kinase and PEP synthase pyrophosphorylase |
| ? | NC_000913 | 1787651 = | 115 (0.640) | coding (207/834 nt) | ppsR | PEP synthase kinase and PEP synthase pyrophosphorylase | |||||
| * | ? | NC_000913 | 1846862 = | 96 (0.510) | 5 (0.030) | 4/224 | NT | 5.0% | coding (99/1962 nt) | topB | DNA topoisomerase III |
| ? | NC_000913 | 1846899 = | 98 (0.560) | coding (62/1962 nt) | topB | DNA topoisomerase III | |||||
| * | ? | NC_000913 | = 1937563 | 88 (0.470) | 8 (0.050) | 4/218 | NT | 8.2% | intergenic (+42/‑86) | yebK/pykA | putative DNA‑binding transcriptional regulator/pyruvate kinase II |
| ? | NC_000913 | = 1937592 | 99 (0.580) | intergenic (+71/‑57) | yebK/pykA | putative DNA‑binding transcriptional regulator/pyruvate kinase II | |||||
| * | ? | NC_000913 | 2065691 = | 155 (0.830) | 12 (0.070) | 7/222 | NT | 7.8% | coding (74/546 nt) | cobU | cobinamide kinase and cobinamide phosphate guanylyltransferase |
| ? | NC_000913 | 2065730 = | 138 (0.790) | coding (35/546 nt) | cobU | cobinamide kinase and cobinamide phosphate guanylyltransferase | |||||
| * | ? | NC_000913 | 2204447 = | 44 (0.240) | 9 (0.050) | 9/216 | NT | 20.0% | intergenic (+158/‑149) | yehK/yehL | uncharacterized protein/putative hexameric AAA+ MoxR family ATPase |
| ? | NC_000913 | 2204492 = | 32 (0.190) | intergenic (+203/‑104) | yehK/yehL | uncharacterized protein/putative hexameric AAA+ MoxR family ATPase | |||||
| * | ? | NC_000913 | = 2232735 | NA (NA) | 5 (0.030) | 6/226 | NT | NA | intergenic (+7/‑143) | cdd/sanA | cytidine/deoxycytidine deaminase/DUF218 superfamily vancomycin high temperature exclusion protein |
| ? | NC_000913 | = 2232765 | NA (NA) | noncoding (30/34 nt) | REP155 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP155 (repetitive extragenic palindromic) element; contains 1 REP sequences | |||||
| * | ? | NC_000913 | = 2268748 | 113 (0.610) | 16 (0.090) | 12/226 | NT | 13.1% | coding (920/987 nt) | yeiR | Zn‑stimulated GTPase involved in zinc homeostasis; mutants are cadmium and EDTA sensitive; Zn(2+) binding protein |
| ? | NC_000913 | = 2268760 | 105 (0.590) | coding (932/987 nt) | yeiR | Zn‑stimulated GTPase involved in zinc homeostasis; mutants are cadmium and EDTA sensitive; Zn(2+) binding protein | |||||
| * | ? | NC_000913 | 2304471 = | 61 (0.330) | 12 (0.070) | 6/224 | NT | 22.4% | noncoding (55/655 nt) | REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences | REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences |
| ? | NC_000913 | 2304955 = | 26 (0.150) | noncoding (539/655 nt) | REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences | REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences | |||||
| * | ? | NC_000913 | = 2304536 | 68 (0.360) | 9 (0.050) | 7/232 | NT | 18.5% | noncoding (120/655 nt) | REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences | REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences |
| ? | NC_000913 | = 2304673 | 13 (0.070) | noncoding (257/655 nt) | REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences | REP161 (repetitive extragenic palindromic) element; contains 12 REP sequences | |||||
| * | ? | NC_000913 | 2326950 = | 157 (0.840) | 10 (0.060) | 7/230 | NT | 6.2% | coding (842/1185 nt) | atoB | acetyl‑CoA acetyltransferase |
| ? | NC_000913 | 2326969 = | 151 (0.840) | coding (861/1185 nt) | atoB | acetyl‑CoA acetyltransferase | |||||
| * | ? | NC_000913 | 2430981 = | 65 (0.350) | 5 (0.030) | 5/224 | NT | 7.9% | noncoding (53/84 nt) | REP169 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP169 (repetitive extragenic palindromic) element; contains 2 REP sequences |
| ? | NC_000913 | 2431013 = | 55 (0.310) | intergenic (‑250/+9) | cvpA/dedD | colicin V production protein/membrane‑anchored periplasmic protein involved in septation | |||||
| * | ? | NC_000913 | = 2516411 | 191 (1.020) | 16 (0.090) | 8/230 | NT | 7.9% | coding (1422/2190 nt) | yfeA | putative diguanylate cyclase |
| ? | NC_000913 | = 2516437 | 186 (1.030) | coding (1396/2190 nt) | yfeA | putative diguanylate cyclase | |||||
| * | ? | NC_000913 | = 2533705 | 106 (0.570) | 9 (0.050) | 6/222 | NT | 8.0% | intergenic (+325/‑59) | cysK/ptsH | cysteine synthase A, O‑acetylserine sulfhydrolase A subunit/phosphohistidinoprotein‑hexose phosphotransferase component of PTS system (Hpr) |
| ? | NC_000913 | = 2533719 | 108 (0.620) | intergenic (+339/‑45) | cysK/ptsH | cysteine synthase A, O‑acetylserine sulfhydrolase A subunit/phosphohistidinoprotein‑hexose phosphotransferase component of PTS system (Hpr) | |||||
| * | ? | NC_000913 | 2568185 = | NA (NA) | 10 (0.060) +ACCCGCTACACACCCCGCAG |
3/198 | NT | NA | noncoding (47/183 nt) | REP178 (repetitive extragenic palindromic) element; contains 4 REP sequences | REP178 (repetitive extragenic palindromic) element; contains 4 REP sequences |
| ? | NC_000913 | = 3217522 | NA (NA) | noncoding (89/89 nt) | REP229 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP229 (repetitive extragenic palindromic) element; contains 2 REP sequences | |||||
| * | ? | NC_000913 | 2617968 = | NA (NA) | 4 (0.020) | 4/224 | NT | NA | noncoding (1/37 nt) | REP182 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP182 (repetitive extragenic palindromic) element; contains 1 REP sequences |
| ? | NC_000913 | 2618001 = | NA (NA) | noncoding (34/37 nt) | REP182 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP182 (repetitive extragenic palindromic) element; contains 1 REP sequences | |||||
| * | ? | NC_000913 | = 2708671 | 206 (1.100) | 16 (0.090) | 12/224 | NT | 7.6% | coding (84/957 nt) | rseB | anti‑sigma E factor, binds RseA |
| ? | NC_000913 | = 2708691 | 195 (1.110) | coding (64/957 nt) | rseB | anti‑sigma E factor, binds RseA | |||||
| * | ? | NC_000913 | 2727891 = | NA (NA) | 49 (0.280) | 22/226 | NT | NA | noncoding (1294/2904 nt) | rrlG | 23S ribosomal RNA of rrnG operon |
| ? | NC_000913 | 2727910 = | NA (NA) | noncoding (1275/2904 nt) | rrlG | 23S ribosomal RNA of rrnG operon | |||||
| * | ? | NC_000913 | 2728214 = | NA (NA) | 43 (0.240) | 21/230 | NT | NA | noncoding (971/2904 nt) | rrlG | 23S ribosomal RNA of rrnG operon |
| ? | NC_000913 | 2728240 = | NA (NA) | noncoding (945/2904 nt) | rrlG | 23S ribosomal RNA of rrnG operon | |||||
| * | ? | NC_000913 | 2730003 = | NA (NA) | 12 (0.070) | 9/224 | NT | NA | noncoding (1155/1542 nt) | rrsG | 16S ribosomal RNA of rrnG operon |
| ? | NC_000913 | 2730041 = | NA (NA) | noncoding (1117/1542 nt) | rrsG | 16S ribosomal RNA of rrnG operon | |||||
| * | ? | NC_000913 | 2755402 = | 118 (0.630) | 8 (0.040) | 5/230 | NT | 6.6% | intergenic (+24/‑757) | smpB/intA | tmRNA‑binding trans‑translation protein/CP4‑57 prophage; integrase |
| ? | NC_000913 | 2755442 = | 113 (0.630) | intergenic (+64/‑717) | smpB/intA | tmRNA‑binding trans‑translation protein/CP4‑57 prophage; integrase | |||||
| * | ? | NC_000913 | 2800357 = | 155 (0.830) | 8 (0.040) | 6/228 | NT | 5.3% | coding (212/330 nt) | ygaM | putative membrane‑anchored DUF883 family ribosome‑binding protein |
| ? | NC_000913 | 2800380 = | 140 (0.780) | coding (235/330 nt) | ygaM | putative membrane‑anchored DUF883 family ribosome‑binding protein | |||||
| * | ? | NC_000913 | = 2813016 | 131 (0.700) | 7 (0.040) | 5/224 | NT | 5.3% | coding (401/1539 nt) | emrB | multidrug efflux system protein |
| ? | NC_000913 | = 2813031 | 128 (0.730) | coding (416/1539 nt) | emrB | multidrug efflux system protein | |||||
| * | ? | NC_000913 | 2818349 = | 106 (0.570) | 7 (0.040) | 4/222 | NT | 6.5% | intergenic (‑75/+124) | argY/argV | tRNA‑Arg/tRNA‑Arg |
| ? | NC_000913 | 2818411 = | 102 (0.590) | intergenic (‑137/+62) | argY/argV | tRNA‑Arg/tRNA‑Arg | |||||
| * | ? | NC_000913 | 2818492 = | 172 (0.920) | 15 (0.080) | 8/226 | NT | 8.1% | noncoding (58/77 nt) | argV | tRNA‑Arg |
| ? | NC_000913 | 2818515 = | 176 (0.990) | noncoding (35/77 nt) | argV | tRNA‑Arg | |||||
| * | ? | NC_000913 | 2822046 = | 145 (0.780) | 7 (0.040) | 5/226 | NT | 5.0% | intergenic (‑35/+93) | alaS/recX | alanyl‑tRNA synthetase/regulatory protein for RecA |
| ? | NC_000913 | 2822080 = | 126 (0.710) | intergenic (‑69/+59) | alaS/recX | alanyl‑tRNA synthetase/regulatory protein for RecA | |||||
| * | ? | NC_000913 | 2828783 = | 144 (0.770) | 7 (0.040) | 5/230 | NT | 5.1% | coding (163/360 nt) | srlM | sorbitol=responsive srl operon transcriptional activator |
| ? | NC_000913 | 2828822 = | 120 (0.670) | coding (202/360 nt) | srlM | sorbitol=responsive srl operon transcriptional activator | |||||
| * | ? | NC_000913 | 2884559 = | 138 (0.740) | 14 (0.080) | 12/228 | NT | 9.6% | coding (2661/2667 nt) | ygcB | Cascade complex anti‑viral R‑loop helicase‑annealase Cas3 |
| ? | NC_000913 | 2884597 = | 131 (0.730) | coding (2623/2667 nt) | ygcB | Cascade complex anti‑viral R‑loop helicase‑annealase Cas3 | |||||
| * | ? | NC_000913 | 2909114 = | 170 (0.910) | 12 (0.070) | 10/230 | NT | 6.6% | coding (553/1638 nt) | pyrG | CTP synthetase |
| ? | NC_000913 | 2909151 = | 177 (0.980) | coding (516/1638 nt) | pyrG | CTP synthetase | |||||
| * | ? | NC_000913 | = 2981914 | 204 (1.090) | 13 (0.070) | 8/226 | NT | 5.9% | coding (269/1419 nt) | araE | arabinose transporter |
| ? | NC_000913 | = 2981935 | 221 (1.250) | coding (248/1419 nt) | araE | arabinose transporter | |||||
| * | ? | NC_000913 | 3037860 = | 86 (0.460) | 6 (0.040) | 6/216 | NT | 6.6% | coding (247/1734 nt) | recJ | ssDNA exonuclease, 5' ‑‑> 3'‑specific |
| ? | NC_000913 | 3037943 = | 93 (0.550) | coding (164/1734 nt) | recJ | ssDNA exonuclease, 5' ‑‑> 3'‑specific | |||||
| * | ? | NC_000913 | 3056789 = | 254 (1.360) | 21 (0.120) | 14/222 | NT | 8.0% | coding (549/549 nt) | fau | 5‑formyltetrahydrofolate cyclo‑ligase family protein |
| ? | NC_000913 | 3056813 = | 244 (1.400) | intergenic (+24/‑36) | fau/sibC | 5‑formyltetrahydrofolate cyclo‑ligase family protein/sRNA antisense regulator of toxic IbsC protein | |||||
| * | ? | NC_000913 | = 3097480 | 112 (0.600) | 6 (0.030) | 5/230 | NT | 5.4% | coding (214/1137 nt) | yggW | HemN family putative oxidoreductase |
| ? | NC_000913 | = 3097545 | 103 (0.570) | coding (279/1137 nt) | yggW | HemN family putative oxidoreductase | |||||
| * | ? | NC_000913 | = 3101756 | NA (NA) | 11 (0.060) | 8/224 | NT | NA | noncoding (61/79 nt) | REP218 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP218 (repetitive extragenic palindromic) element; contains 2 REP sequences |
| ? | NC_000913 | 3774243 = | NA (NA) | noncoding (8/99 nt) | RIP271 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | RIP271 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | |||||
| * | ? | NC_000913 | 3123440 = | 110 (0.590) | 7 (0.040) | 6/228 | NT | 6.7% | coding (366/2172 nt) | glcB | malate synthase G |
| ? | NC_000913 | 3123495 = | 89 (0.500) | coding (311/2172 nt) | glcB | malate synthase G | |||||
| * | ? | NC_000913 | = 3150670 | 98 (0.560) | 12 (0.070) | 10/224 | NT | 10.9% | noncoding (117/255 nt) | RIP222 (repetitive extragenic palindromic) element; contains 5 REP sequences and 2 IHF sites | RIP222 (repetitive extragenic palindromic) element; contains 5 REP sequences and 2 IHF sites |
| ? | NC_000913 | 3774236 = | NA (NA) | noncoding (1/99 nt) | RIP271 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | RIP271 (repetitive extragenic palindromic) element; contains 2 REP sequences and 1 IHF site | |||||
| * | ? | NC_000913 | = 3161672 | 203 (1.090) | 12 (0.070) | 9/232 | NT | 5.9% | coding (998/1413 nt) | ftsP | septal ring component that protects the divisome from stress; multicopy suppressor of ftsI(Ts) |
| ? | NC_000913 | = 3161700 | 183 (1.010) | coding (970/1413 nt) | ftsP | septal ring component that protects the divisome from stress; multicopy suppressor of ftsI(Ts) | |||||
| * | ? | NC_000913 | = 3194547 | 128 (0.690) | 16 (0.090) | 11/226 | NT | 11.7% | intergenic (+22/+176) | yqiK/sibD | PHB family membrane protein, function unknown/sRNA antisense regulator of toxic IbsD protein |
| ? | NC_000913 | = 3194562 | 120 (0.680) | intergenic (+37/+161) | yqiK/sibD | PHB family membrane protein, function unknown/sRNA antisense regulator of toxic IbsD protein | |||||
| * | ? | NC_000913 | = 3194924 | 135 (0.720) | 11 (0.060) | 9/228 | NT | 7.8% | intergenic (‑59/+175) | sibD/sibE | sRNA antisense regulator of toxic IbsD protein/sRNA antisense regulator of toxic IbsE protein |
| ? | NC_000913 | = 3194939 | 129 (0.720) | intergenic (‑74/+160) | sibD/sibE | sRNA antisense regulator of toxic IbsD protein/sRNA antisense regulator of toxic IbsE protein | |||||
| * | ? | NC_000913 | = 3385763 | 120 (0.640) | 8 (0.050) | 5/224 | NT | 6.5% | coding (226/264 nt) | yhcN | cadmium and peroxide resistance protein, stress‑induced |
| ? | NC_000913 | = 3385776 | 117 (0.670) | coding (239/264 nt) | yhcN | cadmium and peroxide resistance protein, stress‑induced | |||||
| * | ? | NC_000913 | 3411592 = | 122 (0.650) | 6 (0.040) | 6/216 | NT | 6.3% | intergenic (+25/‑61) | fis/yhdJ | global DNA‑binding transcriptional dual regulator/DNA adenine methyltransferase, SAM‑dependent |
| ? | NC_000913 | 3411628 = | 68 (0.400) | intergenic (+61/‑25) | fis/yhdJ | global DNA‑binding transcriptional dual regulator/DNA adenine methyltransferase, SAM‑dependent | |||||
| * | ? | NC_000913 | = 3416769 | 171 (0.920) | 13 (0.070) | 9/228 | NT | 7.3% | coding (1737/3105 nt) | acrF | multidrug efflux system protein |
| ? | NC_000913 | = 3416782 | 165 (0.920) | coding (1750/3105 nt) | acrF | multidrug efflux system protein | |||||
| * | ? | NC_000913 | = 3470960 | NA (NA) | 6 (0.030) | 4/226 | NT | NA | coding (370/1185 nt) | tufA | translation elongation factor EF‑Tu 1 |
| ? | NC_000913 | = 3470998 | NA (NA) | coding (332/1185 nt) | tufA | translation elongation factor EF‑Tu 1 | |||||
| * | ? | NC_000913 | 3620131 = | NA (NA) | 4 (0.020) | 4/232 | NT | 100% | coding (940/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor |
| ? | NC_000913 | 3620147 = | 0 (0.000) | coding (956/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor | |||||
| * | ? | NC_000913 | = 3620220 | NA (NA) | 10 (0.060) | 9/226 | NT | 100% | coding (1029/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor |
| ? | NC_000913 | = 3620255 | 0 (0.000) | coding (1064/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor | |||||
| * | ? | NC_000913 | = 3620350 | NA (NA) | 14 (0.080) | 8/226 | NT | 100% | coding (1159/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor |
| ? | NC_000913 | = 3620425 | 0 (0.000) | coding (1234/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor | |||||
| * | ? | NC_000913 | 3620357 = | NA (NA) | 4 (0.020) | 4/226 | NT | 100% | coding (1166/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor |
| ? | NC_000913 | 3620420 = | 0 (0.000) | coding (1229/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor | |||||
| * | ? | NC_000913 | = 3620363 | NA (NA) | 4 (0.020) | 4/228 | NT | 100% | coding (1172/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor |
| ? | NC_000913 | = 3620412 | 0 (0.000) | coding (1221/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor | |||||
| * | ? | NC_000913 | 3620569 = | NA (NA) | 23 (0.130) | 14/226 | NT | 100% | coding (1378/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor |
| ? | NC_000913 | 3620582 = | 0 (0.000) | coding (1391/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor | |||||
| * | ? | NC_000913 | 3621455 = | NA (NA) | 5 (0.030) | 5/230 | NT | 100% | coding (2264/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor |
| ? | NC_000913 | 3621474 = | 0 (0.000) | coding (2283/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor | |||||
| * | ? | NC_000913 | = 3621712 | NA (NA) | 4 (0.020) | 4/230 | NT | NA | coding (2521/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor |
| ? | NC_000913 | = 3621776 | NA (NA) | coding (2585/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor | |||||
| * | ? | NC_000913 | 3622466 = | NA (NA) | 15 (0.080) | 8/230 | NT | 16.4% | coding (3275/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor |
| ? | NC_000913 | 3622497 = | 79 (0.420) | coding (3306/4236 nt) | rhsB | Rhs protein with DUF4329 family putative toxin domain; putative neighboring cell growth inhibitor | |||||
| * | ? | NC_000913 | = 3655587 | 174 (0.930) | 10 (0.050) | 10/232 | NT | 5.2% | coding (316/648 nt) | yhiD | putative Mg(2+) transport ATPase, inner membrane protein |
| ? | NC_000913 | = 3655609 | 192 (1.060) | coding (294/648 nt) | yhiD | putative Mg(2+) transport ATPase, inner membrane protein | |||||
| * | ? | NC_000913 | = 3666134 | 23 (0.120) | 7 (0.040) | 6/208 | NT | 19.2% | intergenic (‑324/+46) | gadX/gadA | acid resistance regulon transcriptional activator; autoactivator/glutamate decarboxylase A, PLP‑dependent |
| ? | NC_000913 | = 3666147 | 39 (0.240) | intergenic (‑337/+33) | gadX/gadA | acid resistance regulon transcriptional activator; autoactivator/glutamate decarboxylase A, PLP‑dependent | |||||
| * | ? | NC_000913 | 3712860 = | 189 (1.010) | 216 (1.160) | 123/238 | NT | 56.8% | coding (75/699 nt) | yhjY | autotransporter beta‑domain protein |
| ? | NC_000913 | = 3873341 | 139 (0.740) | coding (272/618 nt) | dgoA | 2‑oxo‑3‑deoxygalactonate 6‑phosphate aldolase | |||||
| * | ? | NC_000913 | 3717215 = | 381 (2.040) | 18 (0.110) | 11/214 | NT | 5.5% | intergenic (+9/‑95) | yiaD/ghrB | multicopy suppressor of bamB; outer membrane lipoprotein/glyoxylate/hydroxypyruvate reductase B |
| ? | NC_000913 | 3717245 = | 276 (1.650) | intergenic (+39/‑65) | yiaD/ghrB | multicopy suppressor of bamB; outer membrane lipoprotein/glyoxylate/hydroxypyruvate reductase B | |||||
| * | ? | NC_000913 | 3718298 = | 298 (1.600) | 36 (0.210) | 24/222 | NT | 12.2% | intergenic (+14/+36) | ghrB/yiaF | glyoxylate/hydroxypyruvate reductase B/barrier effect co‑colonization resistance factor; DUF3053 family lipoprotein |
| ? | NC_000913 | 3718334 = | 240 (1.380) | coding (711/711 nt) | yiaF | barrier effect co‑colonization resistance factor; DUF3053 family lipoprotein | |||||
| * | ? | NC_000913 | 3726887 = | 269 (1.440) | 22 (0.130) | 11/216 | NT | 8.7% | intergenic (+5/+37) | wecH/yiaA | O‑acetyltransferase for enterobacterial common antigen (ECA)/YiaAB family inner membrane protein, tandem domains |
| ? | NC_000913 | 3726917 = | 218 (1.290) | intergenic (+35/+7) | wecH/yiaA | O‑acetyltransferase for enterobacterial common antigen (ECA)/YiaAB family inner membrane protein, tandem domains | |||||
| * | ? | NC_000913 | 3736232 = | 369 (2.070) | 22 (0.120) | 13/228 | NT | 5.6% | noncoding (79/171 nt) | REP268 (repetitive extragenic palindromic) element; contains 4 REP sequences | REP268 (repetitive extragenic palindromic) element; contains 4 REP sequences |
| ? | NC_000913 | = 4484414 | NA (NA) | noncoding (82/84 nt) | REP342 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP342 (repetitive extragenic palindromic) element; contains 2 REP sequences | |||||
| * | ? | NC_000913 | 3774340 = | 320 (1.710) | 19 (0.110) | 14/222 | NT | 6.5% | intergenic (+146/‑84) | mtlA/mtlD | mannitol‑specific PTS enzyme: IIA, IIB and IIC components/mannitol‑1‑phosphate dehydrogenase, NAD‑dependent |
| ? | NC_000913 | 3774360 = | 248 (1.430) | intergenic (+166/‑64) | mtlA/mtlD | mannitol‑specific PTS enzyme: IIA, IIB and IIC components/mannitol‑1‑phosphate dehydrogenase, NAD‑dependent | |||||
| * | ? | NC_000913 | = 3795026 | 399 (2.140) | 25 (0.140) | 19/222 | NT | 6.3% | coding (98/1047 nt) | waaF | ADP‑heptose:LPS heptosyltransferase II |
| ? | NC_000913 | = 3795059 | 378 (2.170) | coding (131/1047 nt) | waaF | ADP‑heptose:LPS heptosyltransferase II | |||||
| * | ? | NC_000913 | = 3858205 | 297 (1.590) | 22 (0.130) | 13/212 | NT | 7.3% | coding (200/1494 nt) | yidJ | sulfatase/phosphatase superfamily protein |
| ? | NC_000913 | = 3858228 | 298 (1.790) | coding (177/1494 nt) | yidJ | sulfatase/phosphatase superfamily protein | |||||
| * | ? | NC_000913 | 3884850 = | 191 (1.020) | 13 (0.070) | 10/226 | NT | 6.6% | coding (358/360 nt) coding (35/258 nt) |
rnpA yidD |
protein C5 component of RNase P membrane protein insertion efficiency factor, UPF0161 family inner membrane protein |
| ? | NC_000913 | 3884875 = | 188 (1.060) | coding (60/258 nt) | yidD | membrane protein insertion efficiency factor, UPF0161 family inner membrane protein | |||||
| * | ? | NC_000913 | 3908479 = | 154 (0.830) | 9 (0.050) | 8/232 | NT | 5.4% | intergenic (‑113/+70) | pstB/pstA | phosphate ABC transporter ATPase/phosphate ABC transporter permease |
| ? | NC_000913 | 3908506 = | 168 (0.920) | intergenic (‑140/+43) | pstB/pstA | phosphate ABC transporter ATPase/phosphate ABC transporter permease | |||||
| * | ? | NC_000913 | = 3908685 | 277 (1.480) | 32 (0.180) | 15/228 | NT | 10.6% | coding (755/891 nt) | pstA | phosphate ABC transporter permease |
| ? | NC_000913 | = 3908700 | 277 (1.550) | coding (740/891 nt) | pstA | phosphate ABC transporter permease | |||||
| * | ? | NC_000913 | 3920303 = | 127 (0.680) | 10 (0.060) | 9/228 | NT | 7.6% | coding (101/534 nt) | atpH | F1 sector of membrane‑bound ATP synthase, delta subunit |
| ? | NC_000913 | 3920328 = | 122 (0.680) | coding (76/534 nt) | atpH | F1 sector of membrane‑bound ATP synthase, delta subunit | |||||
| * | ? | NC_000913 | = 3938307 | 138 (0.740) | 11 (0.060) | 11/222 | NT | 7.6% | coding (81/993 nt) | rbsR | transcriptional repressor of ribose metabolism |
| ? | NC_000913 | = 3938313 | 139 (0.800) | coding (87/993 nt) | rbsR | transcriptional repressor of ribose metabolism | |||||
| * | ? | NC_000913 | = 3944991 | NA (NA) | 11 (0.060) | 6/226 | NT | 6.7% | noncoding (1288/2904 nt) | rrlC | 23S ribosomal RNA of rrnC operon |
| ? | NC_000913 | = 4038798 | 162 (0.870) | noncoding (1280/2905 nt) | rrlA | 23S ribosomal RNA of rrnA operon | |||||
| * | ? | NC_000913 | = 3962703 | NA (NA) | 6 (0.030) | 4/226 | NT | NA | noncoding (4/36 nt) | REP286 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP286 (repetitive extragenic palindromic) element; contains 1 REP sequences |
| ? | NC_000913 | = 3962735 | NA (NA) | noncoding (36/36 nt) | REP286 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP286 (repetitive extragenic palindromic) element; contains 1 REP sequences | |||||
| * | ? | NC_000913 | = 3999519 | 234 (1.250) | 13 (0.070) | 11/224 | NT | 5.2% | coding (1537/2163 nt) | uvrD | DNA‑dependent ATPase I and helicase II |
| ? | NC_000913 | = 3999532 | 258 (1.470) | coding (1550/2163 nt) | uvrD | DNA‑dependent ATPase I and helicase II | |||||
| * | ? | NC_000913 | = 4040481 | NA (NA) | 106 (0.600) | 19/226 | NT | 64.7% | intergenic (+58/‑36) | rrlA/rrfA | 23S ribosomal RNA of rrnA operon/5S ribosomal RNA of rrnA operon |
| ? | NC_000913 | = 4040505 | 61 (0.330) | intergenic (+82/‑12) | rrlA/rrfA | 23S ribosomal RNA of rrnA operon/5S ribosomal RNA of rrnA operon | |||||
| * | ? | NC_000913 | = 4040683 | 12 (0.060) | 43 (0.230) | 15/234 | NT | 65.8% | intergenic (+47/+223) | rrfA/mobB | 5S ribosomal RNA of rrnA operon/molybdopterin‑guanine dinucleotide biosynthesis protein B |
| ? | NC_000913 | = 4213162 | 33 (0.180) | intergenic (+3/‑72) | rrfE/yjaA | 5S ribosomal RNA of rrnE operon/stress‑induced protein | |||||
| * | ? | NC_000913 | = 4051977 | 173 (0.930) | 10 (0.060) | 8/226 | NT | 5.5% | intergenic (+121/‑68) | yihI/hemN | activator of Der GTPase/coproporphyrinogen III oxidase, SAM and NAD(P)H dependent, oxygen‑independent |
| ? | NC_000913 | = 4051999 | 179 (1.010) | intergenic (+143/‑46) | yihI/hemN | activator of Der GTPase/coproporphyrinogen III oxidase, SAM and NAD(P)H dependent, oxygen‑independent | |||||
| * | ? | NC_000913 | = 4080099 | NA (NA) | 7 (0.040) | 6/224 | NT | NA | noncoding (80/98 nt) | REP297 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP297 (repetitive extragenic palindromic) element; contains 2 REP sequences |
| ? | NC_000913 | = 4080110 | NA (NA) | noncoding (91/98 nt) | REP297 (repetitive extragenic palindromic) element; contains 2 REP sequences | REP297 (repetitive extragenic palindromic) element; contains 2 REP sequences | |||||
| * | ? | NC_000913 | = 4153357 | 113 (0.610) | 6 (0.030) | 5/224 | NT | 5.4% | noncoding (11/346 nt) | REP309 (repetitive extragenic palindromic) element; contains 6 REP sequences | REP309 (repetitive extragenic palindromic) element; contains 6 REP sequences |
| ? | NC_000913 | = 4153375 | 105 (0.600) | noncoding (29/346 nt) | REP309 (repetitive extragenic palindromic) element; contains 6 REP sequences | REP309 (repetitive extragenic palindromic) element; contains 6 REP sequences | |||||
| * | ? | NC_000913 | = 4168341 | 40 (0.210) | 14 (0.080) | 11/218 | NT | 34.3% | intergenic (+141/‑31) | rrsB/gltT | 16S ribosomal RNA of rrnB operon/tRNA‑Glu |
| ? | NC_000913 | = 4168363 | 17 (0.100) | intergenic (+163/‑9) | rrsB/gltT | 16S ribosomal RNA of rrnB operon/tRNA‑Glu | |||||
| * | ? | NC_000913 | 4196527 = | 190 (1.020) | 12 (0.070) | 8/232 | NT | 5.9% | coding (282/477 nt) | rsd | stationary phase protein, binds sigma 70 RNA polymerase subunit |
| ? | NC_000913 | 4196561 = | 198 (1.090) | coding (248/477 nt) | rsd | stationary phase protein, binds sigma 70 RNA polymerase subunit | |||||
| * | ? | NC_000913 | 4233833 = | 79 (0.420) | 6 (0.040) | 6/218 | NT | 9.1% | coding (76/1650 nt) | pgi | glucosephosphate isomerase |
| ? | NC_000913 | 4233869 = | 48 (0.280) | coding (112/1650 nt) | pgi | glucosephosphate isomerase | |||||
| * | ? | NC_000913 | 4239740 = | 189 (1.010) | 11 (0.070) | 10/216 | NT | 6.2% | intergenic (+10/+37) | yjbH/yjbT | DUF940 family extracellular polysaccharide protein/putative periplasmic protein |
| ? | NC_000913 | 4239772 = | 159 (0.940) | intergenic (+42/+5) | yjbH/yjbT | DUF940 family extracellular polysaccharide protein/putative periplasmic protein | |||||
| * | ? | NC_000913 | 4281812 = | 256 (1.370) | 19 (0.110) | 14/218 | NT | 7.8% | coding (1264/1293 nt) | yjcF | pentapeptide repeats protein |
| ? | NC_000913 | 4281841 = | 214 (1.250) | coding (1235/1293 nt) | yjcF | pentapeptide repeats protein | |||||
| * | ? | NC_000913 | 4321620 = | 147 (0.790) | 8 (0.050) | 6/224 | NT | 5.3% | coding (77/453 nt) | phnG | ribophosphonate triphosphate synthase subunit |
| ? | NC_000913 | 4321659 = | 146 (0.830) | coding (38/453 nt) | phnG | ribophosphonate triphosphate synthase subunit | |||||
| * | ? | NC_000913 | = 4332094 | NA (NA) | 20 (0.120) | 13/218 | NT | 10.3% | intergenic (+90/‑22) | proP/pmrR | proline/glycine betaine transporter/putative membrane‑bound BasS regulator |
| ? | NC_000913 | = 4332102 | 174 (1.020) | intergenic (+98/‑14) | proP/pmrR | proline/glycine betaine transporter/putative membrane‑bound BasS regulator | |||||
| * | ? | NC_000913 | 4341778 = | 64 (0.340) | 6 (0.040) | 5/202 | NT | 8.3% | intergenic (‑150/‑133) | melR/melA | melibiose operon transcriptional regulator; autoregulator/alpha‑galactosidase, NAD(P)‑binding |
| ? | NC_000913 | 4341834 = | 79 (0.500) | intergenic (‑206/‑77) | melR/melA | melibiose operon transcriptional regulator; autoregulator/alpha‑galactosidase, NAD(P)‑binding | |||||
| * | ? | NC_000913 | = 4341795 | 68 (0.360) | 8 (0.050) | 7/202 | NT | 10.5% | intergenic (‑167/‑116) | melR/melA | melibiose operon transcriptional regulator; autoregulator/alpha‑galactosidase, NAD(P)‑binding |
| ? | NC_000913 | = 4341815 | 79 (0.500) | intergenic (‑187/‑96) | melR/melA | melibiose operon transcriptional regulator; autoregulator/alpha‑galactosidase, NAD(P)‑binding | |||||
| * | ? | NC_000913 | 4389302 = | 185 (0.990) | 9 (0.050) | 8/228 | NT | 5.1% | coding (69/3324 nt) | mscM | mechanosensitive channel protein, miniconductance |
| ? | NC_000913 | 4389328 = | 155 (0.870) | coding (43/3324 nt) | mscM | mechanosensitive channel protein, miniconductance | |||||
| * | ? | NC_000913 | 4412327 = | 121 (0.650) | 13 (0.070) | 11/226 | NT | 9.9% | coding (349/399 nt) | yjfL | UPF0719 family inner membrane protein |
| ? | NC_000913 | 4412348 = | 122 (0.690) | coding (370/399 nt) | yjfL | UPF0719 family inner membrane protein | |||||
| * | ? | NC_000913 | = 4417460 | 262 (1.400) | 17 (0.100) | 14/224 | NT | 6.3% | coding (509/750 nt) | yjfP | acyl CoA esterase |
| ? | NC_000913 | = 4417479 | 263 (1.500) | coding (528/750 nt) | yjfP | acyl CoA esterase | |||||
| * | ? | NC_000913 | = 4534139 | 258 (1.380) | 14 (0.080) | 12/218 | NT | 5.4% | intergenic (‑86/+291) | yjhX/yjhZ | UPF0386 family protein/pseudogene, rimK paralog, C‑terminal fragment |
| ? | NC_000913 | = 4534160 | 251 (1.470) | intergenic (‑107/+270) | yjhX/yjhZ | UPF0386 family protein/pseudogene, rimK paralog, C‑terminal fragment | |||||
| * | ? | NC_000913 | = 4549784 | NA (NA) | 8 (0.050) | 6/226 | NT | NA | noncoding (2/36 nt) | REP345 (repetitive extragenic palindromic) element; contains 1 REP sequences | REP345 (repetitive extragenic palindromic) element; contains 1 REP sequences |
| ? | NC_000913 | = 4549822 | NA (NA) | intergenic (+112/+131) | fimH/gntP | minor component of type 1 fimbriae/fructuronate transporter | |||||