breseq  version 0.33.1  revision 8505477f25b3 mutation predictions | marginal predictions | summary statistics | genome diff | command line log

Predicted mutations
evidence	position	mutation	freq	annotation	gene	description
RA	5,563	G→A	28.9%	intergenic (+33/+120)	yaaX → / ← yaaA	hypothetical protein/conserved hypothetical protein
RA	5,581	G→A	12.2%	intergenic (+51/+102)	yaaX → / ← yaaA	hypothetical protein/conserved hypothetical protein
RA	5,593	A→T	8.7%	intergenic (+63/+90)	yaaX → / ← yaaA	hypothetical protein/conserved hypothetical protein
RA	5,624	C→T	5.2%	intergenic (+94/+59)	yaaX → / ← yaaA	hypothetical protein/conserved hypothetical protein
RA	5,628	A→G	5.5%	intergenic (+98/+55)	yaaX → / ← yaaA	hypothetical protein/conserved hypothetical protein
RA	15,386	C→T	20.5%	intergenic (+88/+59)	dnaJ → / ← mokC	chaperone Hsp40, co‑chaperone with DnaK/regulatory protein for HokC, overlaps CDS of hokC
RA	34,427	C→T	25.0%	R364H (CGC→CAC)	caiC ←	predicted crotonobetaine CoA ligase:carnitine CoA ligase
RA	45,536	G→A	9.1%	S30S (TCG→TCA)	kefC →	potassium:proton antiporter
RA	63,049	T→C	7.8%	N137S (AAT→AGT)	polB ←	DNA polymerase II
RA	63,052	A→T	7.3%	V136D (GTT→GAT)	polB ←	DNA polymerase II
RA	63,055	A→T	7.3%	I135N (ATC→AAC)	polB ←	DNA polymerase II
RA	63,058	G→A	7.4%	T134I (ACT→ATT)	polB ←	DNA polymerase II
RA	65,975	C→T	16.8%	V242I (GTT→ATT)	leuB ←	3‑isopropylmalate dehydrogenase
RA	87,506	G→A	10.9%	L178L (TTG→TTA)	ddlB →	D‑Alanine:D‑alanine ligase
RA	132,188	A→G	8.7%	T161A (ACA→GCA) ‡	yadD →	predicted transposase
RA	132,189	C→T	8.7%	T161I (ACA→ATA) ‡	yadD →	predicted transposase
RA	132,193	G→T	10.4%	P162P (CCG→CCT)	yadD →	predicted transposase
RA	132,196	T→C	10.0%	D163D (GAT→GAC)	yadD →	predicted transposase
RA	132,199	C→T	10.3%	D164D (GAC→GAT)	yadD →	predicted transposase
RA	132,202	A→G	10.5%	E165E (GAA→GAG)	yadD →	predicted transposase
RA	132,220	G→T	12.3%	R171R (CGG→CGT)	yadD →	predicted transposase
RA	132,223	T→A	12.7%	I172I (ATT→ATA)	yadD →	predicted transposase
RA	132,226	G→T	11.3%	A173A (GCG→GCT)	yadD →	predicted transposase
RA	132,227	A→C	11.9%	I174L (ATT→CTT) ‡	yadD →	predicted transposase
RA	132,229	T→G	13.0%	I174M (ATT→ATG) ‡	yadD →	predicted transposase
RA	132,232	C→G	11.3%	L175L (CTC→CTG)	yadD →	predicted transposase
RA	132,238	A→G	11.8%	L177L (CTA→CTG)	yadD →	predicted transposase
RA	132,239	C→A	11.7%	L178M (CTG→ATG) ‡	yadD →	predicted transposase
RA	132,241	G→T	11.0%	L178L (CTG→CTT) ‡	yadD →	predicted transposase
RA	132,247	A→G	10.6%	K180K (AAA→AAG)	yadD →	predicted transposase
RA	138,390	A→G	7.9%	S593P (TCA→CCA)	htrE ←	predicted outer membrane usher protein
RA	189,184	G→T	11.6%	V227V (GTG→GTT)	ldcC →	lysine decarboxylase 2, constitutive
RA	189,194	G→T	12.6%	A231S (GCC→TCC) ‡	ldcC →	lysine decarboxylase 2, constitutive
RA	189,196	C→T	12.8%	A231A (GCC→GCT) ‡	ldcC →	lysine decarboxylase 2, constitutive
RA	189,199	G→T	12.1%	A232A (GCG→GCT)	ldcC →	lysine decarboxylase 2, constitutive
RA	189,203	T→G	10.4%	S234A (TCC→GCC) ‡	ldcC →	lysine decarboxylase 2, constitutive
RA	189,205	C→A	10.4%	S234S (TCC→TCA) ‡	ldcC →	lysine decarboxylase 2, constitutive
RA	189,211	T→C	11.9%	S236S (AGT→AGC)	ldcC →	lysine decarboxylase 2, constitutive
RA	189,214	G→C	8.9%	T237T (ACG→ACC)	ldcC →	lysine decarboxylase 2, constitutive
RA	189,215	C→A	9.3%	L238M (CTG→ATG) ‡	ldcC →	lysine decarboxylase 2, constitutive
RA	189,217	G→T	9.2%	L238L (CTG→CTT) ‡	ldcC →	lysine decarboxylase 2, constitutive
RA	189,218	T→C	9.2%	L239L (TTG→CTG)	ldcC →	lysine decarboxylase 2, constitutive
RA	189,223	C→T	9.7%	I240I (ATC→ATT)	ldcC →	lysine decarboxylase 2, constitutive
RA	189,229	C→T	9.2%	R242R (CGC→CGT)	ldcC →	lysine decarboxylase 2, constitutive
RA	189,453	G→T	10.3%	W317L (TGG→TTG) ‡	ldcC →	lysine decarboxylase 2, constitutive
RA	189,454	G→C	10.3%	W317C (TGG→TGC) ‡	ldcC →	lysine decarboxylase 2, constitutive
RA	189,460	A→G	10.2%	K319K (AAA→AAG)	ldcC →	lysine decarboxylase 2, constitutive
RA	189,463	G→A	10.7%	Q320Q (CAG→CAA)	ldcC →	lysine decarboxylase 2, constitutive
RA	189,466	G→A	10.6%	T321T (ACG→ACA)	ldcC →	lysine decarboxylase 2, constitutive
RA	189,475	C→G	11.5%	V324V (GTC→GTG)	ldcC →	lysine decarboxylase 2, constitutive
RA	189,476	C→A	11.2%	P325T (CCG→ACG) ‡	ldcC →	lysine decarboxylase 2, constitutive
RA	189,477	C→A	11.1%	P325Q (CCG→CAG) ‡	ldcC →	lysine decarboxylase 2, constitutive
RA	189,478	G→A	10.7%	P325P (CCG→CCA) ‡	ldcC →	lysine decarboxylase 2, constitutive
RA	189,481	G→C	10.8%	S326S (TCG→TCC)	ldcC →	lysine decarboxylase 2, constitutive
RA	189,484	T→C	11.8%	I327I (ATT→ATC)	ldcC →	lysine decarboxylase 2, constitutive
RA	189,490	C→T	14.2%	F329F (TTC→TTT)	ldcC →	lysine decarboxylase 2, constitutive
RA	189,493	T→C	14.1%	D330D (GAT→GAC)	ldcC →	lysine decarboxylase 2, constitutive
RA	189,496	T→C	14.1%	S331S (TCT→TCC)	ldcC →	lysine decarboxylase 2, constitutive
RA	189,499	C→G	14.1%	A332A (GCC→GCG)	ldcC →	lysine decarboxylase 2, constitutive
RA	189,508	G→T	8.8%	P335P (CCG→CCT)	ldcC →	lysine decarboxylase 2, constitutive
RA	189,580	C→T	9.4%	I359I (ATC→ATT)	ldcC →	lysine decarboxylase 2, constitutive
RA	189,582	T→A	9.6%	F360Y (TTC→TAC)	ldcC →	lysine decarboxylase 2, constitutive
RA	189,619	A→C	9.4%	L372F (TTA→TTC)	ldcC →	lysine decarboxylase 2, constitutive
RA	189,622	G→T	9.5%	S373S (TCG→TCT)	ldcC →	lysine decarboxylase 2, constitutive
RA	189,631	G→C	10.2%	S376S (TCG→TCC)	ldcC →	lysine decarboxylase 2, constitutive
RA	189,632	C→A	9.9%	L377M (CTG→ATG)	ldcC →	lysine decarboxylase 2, constitutive
RA	189,641	A→G	9.2%	I380V (ATT→GTT)	ldcC →	lysine decarboxylase 2, constitutive
RA	189,649	C→T	9.0%	G382G (GGC→GGT)	ldcC →	lysine decarboxylase 2, constitutive
RA	189,651:1	+C	9.4%	coding (1148/2142 nt)	ldcC →	lysine decarboxylase 2, constitutive
RA	189,655	Δ1 bp	9.3%	coding (1152/2142 nt)	ldcC →	lysine decarboxylase 2, constitutive
RA	189,656	G→A	9.0%	D385N (GAC→AAC)	ldcC →	lysine decarboxylase 2, constitutive
RA	189,664	G→A	10.4%	E387E (GAG→GAA)	ldcC →	lysine decarboxylase 2, constitutive
RA	189,665	G→A	10.0%	A388T (GCC→ACC)	ldcC →	lysine decarboxylase 2, constitutive
RA	190,065	G→A	30.5%	R521H (CGT→CAT)	ldcC →	lysine decarboxylase 2, constitutive
RA	190,069	G→C	34.3%	G522G (GGG→GGC)	ldcC →	lysine decarboxylase 2, constitutive
RA	190,075	A→T	47.5%	V524V (GTA→GTT)	ldcC →	lysine decarboxylase 2, constitutive
RA	190,078	A→T	47.5%	V525V (GTA→GTT)	ldcC →	lysine decarboxylase 2, constitutive
RA	190,090	C→T	41.7%	G529G (GGC→GGT)	ldcC →	lysine decarboxylase 2, constitutive
RA	190,093	T→G	40.0%	P530P (CCT→CCG)	ldcC →	lysine decarboxylase 2, constitutive
RA	190,108	T→C	40.4%	F535F (TTT→TTC)	ldcC →	lysine decarboxylase 2, constitutive
RA	190,111	C→G	39.6%	L536L (CTC→CTG)	ldcC →	lysine decarboxylase 2, constitutive
RA	190,114	T→C	40.4%	F537F (TTT→TTC)	ldcC →	lysine decarboxylase 2, constitutive
RA	190,117	T→C	37.2%	S538S (AGT→AGC)	ldcC →	lysine decarboxylase 2, constitutive
RA	190,120	T→C	34.8%	I539I (ATT→ATC)	ldcC →	lysine decarboxylase 2, constitutive
RA	190,123	C→T	37.2%	G540G (GGC→GGT)	ldcC →	lysine decarboxylase 2, constitutive
RA	190,132	A→G	25.6%	K543K (AAA→AAG)	ldcC →	lysine decarboxylase 2, constitutive
RA	204,511	C→T	100%	intergenic (+111/‑73)	alaV → / → rrlH	tRNA‑Ala/23S ribosomal RNA
RA	204,556	A→G	100%	intergenic (+156/‑28)	alaV → / → rrlH	tRNA‑Ala/23S ribosomal RNA
RA	214,925	A→C	73.1%	D12A (GAT→GCT)	dnaQ →	DNA polymerase III epsilon subunit
RA	214,931	A→C	72.7%	E14A (GAA→GCA)	dnaQ →	DNA polymerase III epsilon subunit
RA	217,941	A→T	11.3%	intergenic (‑33/‑73)	yafU ← / → yafF	predicted inner membrane protein/conserved hypothetical protein
RA	217,944	G→A	14.3%	intergenic (‑36/‑70)	yafU ← / → yafF	predicted inner membrane protein/conserved hypothetical protein
RA	217,947	G→A	11.8%	intergenic (‑39/‑67)	yafU ← / → yafF	predicted inner membrane protein/conserved hypothetical protein
RA	217,959	A→G	14.1%	intergenic (‑51/‑55)	yafU ← / → yafF	predicted inner membrane protein/conserved hypothetical protein
RA	217,968	C→T	14.7%	intergenic (‑60/‑46)	yafU ← / → yafF	predicted inner membrane protein/conserved hypothetical protein
RA	217,977	C→T	21.6%	intergenic (‑69/‑37)	yafU ← / → yafF	predicted inner membrane protein/conserved hypothetical protein
RA	217,996	A→T	64.7%	intergenic (‑88/‑18)	yafU ← / → yafF	predicted inner membrane protein/conserved hypothetical protein
RA	218,030	A→G	59.2%	Y6C (TAC→TGC)	yafF →	conserved hypothetical protein
RA	218,049	C→T	48.1%	N12N (AAC→AAT)	yafF →	conserved hypothetical protein
RA	218,052	A→C	14.8%	A13A (GCA→GCC)	yafF →	conserved hypothetical protein
RA	218,082	T→C	10.8%	I23I (ATT→ATC)	yafF →	conserved hypothetical protein
RA	218,097	G→A	15.0%	L28L (TTG→TTA)	yafF →	conserved hypothetical protein
RA	218,106	G→T	70.3%	E31D (GAG→GAT)	yafF →	conserved hypothetical protein
RA	218,157	C→T	15.9%	D48D (GAC→GAT)	yafF →	conserved hypothetical protein
RA	218,166	C→T	36.1%	Y51Y (TAC→TAT)	yafF →	conserved hypothetical protein
RA	218,169	G→C	15.2%	L52L (CTG→CTC)	yafF →	conserved hypothetical protein
RA	218,182	G→A	12.7%	A57T (GCG→ACG)	yafF →	conserved hypothetical protein
RA	219,996	C→T	32.8%	G711D (GGT→GAT)	fadE ←	acyl coenzyme A dehydrogenase
RA	222,988	T→G	32.9%	intergenic (+43/‑137)	lpcA → / → prfH	D‑sedoheptulose 7‑phosphate isomerase/predicted peptide chain release factor
RA	222,990	T→C	22.0%	intergenic (+45/‑135)	lpcA → / → prfH	D‑sedoheptulose 7‑phosphate isomerase/predicted peptide chain release factor
RA	222,997	T→A	35.9%	intergenic (+52/‑128)	lpcA → / → prfH	D‑sedoheptulose 7‑phosphate isomerase/predicted peptide chain release factor
RA	223,016	G→A	13.9%	intergenic (+71/‑109)	lpcA → / → prfH	D‑sedoheptulose 7‑phosphate isomerase/predicted peptide chain release factor
RA	223,018	C→A	26.1%	intergenic (+73/‑107)	lpcA → / → prfH	D‑sedoheptulose 7‑phosphate isomerase/predicted peptide chain release factor
RA	223,030	T→G	7.4%	intergenic (+85/‑95)	lpcA → / → prfH	D‑sedoheptulose 7‑phosphate isomerase/predicted peptide chain release factor
RA	223,627	T→A	51.9%	intergenic (+47/+10)	prfH → / ← pepD	predicted peptide chain release factor/aminoacyl‑histidine dipeptidase
RA	227,251	A→G	23.1%	K15K (AAA→AAG)	crl →	DNA‑binding transcriptional regulator
RA	228,508	T→G	8.0%	T65T (ACA→ACC)	phoE ←	outer membrane phosphoporin protein E
RA	228,520	G→A	7.7%	F61F (TTC→TTT)	phoE ←	outer membrane phosphoporin protein E
RA	228,526	A→C	8.5%	F59L (TTT→TTG) ‡	phoE ←	outer membrane phosphoporin protein E
RA	228,528	A→G	8.5%	F59L (TTT→CTT) ‡	phoE ←	outer membrane phosphoporin protein E
RA	228,532	G→C	8.4%	I57M (ATC→ATG) ‡	phoE ←	outer membrane phosphoporin protein E
RA	228,533	A→G	8.5%	I57T (ATC→ACC) ‡	phoE ←	outer membrane phosphoporin protein E
RA	228,534	T→C	8.5%	I57V (ATC→GTC) ‡	phoE ←	outer membrane phosphoporin protein E
RA	228,538	A→G	8.2%	S55S (AGT→AGC)	phoE ←	outer membrane phosphoporin protein E
RA	232,635	T→C	55.6%	N43D (AAC→GAC)	hemB ←	porphobilinogen synthase
RA	235,640	C→T	22.2%	intergenic (+1/‑257)	yaiA → / → aroM	hypothetical protein/conserved hypothetical protein
RA	246,374	C→T	17.2%	S6L (TCG→TTG)	phoR →	sensory histidine kinase in two‑component regulatory system with PhoB
RA	259,095	T→C	20.9%	Y8H (TAT→CAT)	yajD →	conserved hypothetical protein
RA	288,960	A→G	21.5%	Y535C (TAC→TGC)	lon →	DNA‑binding ATP‑dependent protease La
RA	294,191	A→G	12.2%	F531L (TTC→CTC)	ybaE ←	predicted transporter subunit
RA	299,010	G→A	11.4%	L557L (CTG→CTA)	mdlA →	fused predicted multidrug transporter subunits and ATP‑binding components of ABC superfamily
RA	307,588	C→T	15.0%	A45T (GCT→ACT)	ylaC ←	predicted inner membrane protein
RA	309,779	G→A	10.2%	R1032C (CGC→TGC)	acrB ←	multidrug efflux system protein
RA	309,780	G→A	10.2%	R1031R (CGC→CGT)	acrB ←	multidrug efflux system protein
RA	309,786	A→G	8.5%	V1029V (GTT→GTC) ‡	acrB ←	multidrug efflux system protein
RA	309,788	C→T	12.0%	V1029I (GTT→ATT) ‡	acrB ←	multidrug efflux system protein
RA	309,801	T→C	16.9%	V1024V (GTA→GTG)	acrB ←	multidrug efflux system protein
RA	309,807	A→T	23.2%	V1022V (GTT→GTA)	acrB ←	multidrug efflux system protein
RA	309,825	T→C	19.7%	V1016V (GTA→GTG) ‡	acrB ←	multidrug efflux system protein
RA	309,827	C→A	18.8%	V1016L (GTA→TTA) ‡	acrB ←	multidrug efflux system protein
RA	309,834	G→A	18.6%	T1013T (ACC→ACT) ‡	acrB ←	multidrug efflux system protein
RA	309,836	T→A	18.0%	T1013S (ACC→TCC) ‡	acrB ←	multidrug efflux system protein
RA	309,837	C→G	17.1%	V1012V (GTG→GTC)	acrB ←	multidrug efflux system protein
RA	309,843	C→T	10.2%	G1010G (GGG→GGA)	acrB ←	multidrug efflux system protein
RA	309,846	G→T	10.2%	G1009G (GGC→GGA)	acrB ←	multidrug efflux system protein
RA	309,855	A→C	11.4%	G1006G (GGT→GGG)	acrB ←	multidrug efflux system protein
RA	309,859	G→A	13.0%	T1005I (ACC→ATC)	acrB ←	multidrug efflux system protein
RA	309,864	T→C	11.7%	V1003V (GTA→GTG)	acrB ←	multidrug efflux system protein
RA	309,867	T→A	11.5%	A1002A (GCA→GCT)	acrB ←	multidrug efflux system protein
RA	310,779	C→G	10.1%	A698A (GCG→GCC)	acrB ←	multidrug efflux system protein
RA	310,785	A→G	9.4%	T696T (ACT→ACC)	acrB ←	multidrug efflux system protein
RA	310,788	C→T	9.5%	L695L (CTG→CTA)	acrB ←	multidrug efflux system protein
RA	310,791	T→G	10.0%	K694N (AAA→AAC) ‡	acrB ←	multidrug efflux system protein
RA	310,792	T→G	10.0%	K694T (AAA→ACA) ‡	acrB ←	multidrug efflux system protein
RA	310,793	T→C	10.0%	K694E (AAA→GAA) ‡	acrB ←	multidrug efflux system protein
RA	310,794	T→A	10.0%	E693D (GAA→GAT)	acrB ←	multidrug efflux system protein
RA	310,803	A→C	9.2%	L690L (CTT→CTG)	acrB ←	multidrug efflux system protein
RA	310,806	G→C	9.1%	G689G (GGC→GGG)	acrB ←	multidrug efflux system protein
RA	310,815	G→A	9.7%	D686D (GAC→GAT)	acrB ←	multidrug efflux system protein
RA	310,821	C→T	9.3%	L684L (CTG→CTA) ‡	acrB ←	multidrug efflux system protein
RA	310,823	G→A	9.5%	L684L (CTG→TTG) ‡	acrB ←	multidrug efflux system protein
RA	311,445	T→C	6.8%	S476S (TCA→TCG)	acrB ←	multidrug efflux system protein
RA	311,451	A→G	9.1%	I474I (ATT→ATC)	acrB ←	multidrug efflux system protein
RA	311,457	A→G	7.2%	I472I (ATT→ATC)	acrB ←	multidrug efflux system protein
RA	311,469	A→G	11.0%	R468R (CGT→CGC)	acrB ←	multidrug efflux system protein
RA	311,475	G→A	11.2%	I466I (ATC→ATT)	acrB ←	multidrug efflux system protein
RA	311,478	A→T	11.3%	A465A (GCT→GCA)	acrB ←	multidrug efflux system protein
RA	311,481	A→C	9.8%	G464G (GGT→GGG)	acrB ←	multidrug efflux system protein
RA	311,496	A→G	13.1%	F459F (TTT→TTC)	acrB ←	multidrug efflux system protein
RA	311,502	G→T	14.8%	A457A (GCC→GCA)	acrB ←	multidrug efflux system protein
RA	311,511	T→A	14.8%	V454V (GTA→GTT) ‡	acrB ←	multidrug efflux system protein
RA	311,513	C→T	15.0%	V454I (GTA→ATA) ‡	acrB ←	multidrug efflux system protein
RA	311,514	G→A	14.6%	F453F (TTC→TTT)	acrB ←	multidrug efflux system protein
RA	311,523	C→T	16.9%	S450S (TCG→TCA)	acrB ←	multidrug efflux system protein
RA	311,529	T→C	16.0%	V448V (GTA→GTG)	acrB ←	multidrug efflux system protein
RA	311,544	G→C	11.2%	V443V (GTC→GTG)	acrB ←	multidrug efflux system protein
RA	311,550	A→T	10.5%	A441A (GCT→GCA)	acrB ←	multidrug efflux system protein
RA	311,562	C→T	5.5%	Q437Q (CAG→CAA)	acrB ←	multidrug efflux system protein
RA	311,643	G→T	8.0%	I410I (ATC→ATA)	acrB ←	multidrug efflux system protein
RA	311,646	G→C	9.3%	A409A (GCC→GCG)	acrB ←	multidrug efflux system protein
RA	311,649	G→A	8.0%	D408D (GAC→GAT)	acrB ←	multidrug efflux system protein
RA	311,655	C→G	12.3%	V406V (GTG→GTC)	acrB ←	multidrug efflux system protein
RA	311,658	C→G	12.3%	L405F (TTG→TTC) ‡	acrB ←	multidrug efflux system protein
RA	311,660	A→G	13.1%	L405L (TTG→CTG) ‡	acrB ←	multidrug efflux system protein
RA	311,664	G→C	17.6%	G403G (GGC→GGG)	acrB ←	multidrug efflux system protein
RA	311,673	G→A	23.1%	L400L (CTC→CTT)	acrB ←	multidrug efflux system protein
RA	311,691	T→C	22.5%	T394T (ACA→ACG)	acrB ←	multidrug efflux system protein
RA	311,697	C→T	22.7%	T392T (ACG→ACA)	acrB ←	multidrug efflux system protein
RA	311,703	T→G	18.8%	I390I (ATA→ATC)	acrB ←	multidrug efflux system protein
RA	311,706	C→G	17.0%	S389S (TCG→TCC)	acrB ←	multidrug efflux system protein
RA	311,710	A→T	18.3%	F388Y (TTC→TAC)	acrB ←	multidrug efflux system protein
RA	311,712	G→A	16.6%	G387G (GGC→GGT)	acrB ←	multidrug efflux system protein
RA	311,718	G→A	9.3%	A385A (GCC→GCT)	acrB ←	multidrug efflux system protein
RA	311,724	A→G	9.0%	L383L (CTT→CTC)	acrB ←	multidrug efflux system protein
RA	311,760	G→C	8.4%	A371A (GCC→GCG)	acrB ←	multidrug efflux system protein
RA	311,769	C→G	11.9%	P368P (CCG→CCC)	acrB ←	multidrug efflux system protein
RA	311,772	A→G	12.4%	I367I (ATT→ATC)	acrB ←	multidrug efflux system protein
RA	311,777	A→G	12.6%	L366L (TTG→CTG)	acrB ←	multidrug efflux system protein
RA	311,781	C→T	14.8%	A364A (GCG→GCA)	acrB ←	multidrug efflux system protein
RA	311,784	G→T	14.8%	R363R (CGC→CGA)	acrB ←	multidrug efflux system protein
RA	311,787	G→C	14.8%	F362L (TTC→TTG) ‡	acrB ←	multidrug efflux system protein
RA	311,789	A→T	14.6%	F362I (TTC→ATC) ‡	acrB ←	multidrug efflux system protein
RA	311,790	G→A	14.3%	N361N (AAC→AAT)	acrB ←	multidrug efflux system protein
RA	311,798	G→A	17.5%	L359L (CTG→TTG)	acrB ←	multidrug efflux system protein
RA	311,811	A→C	19.7%	V354V (GTT→GTG)	acrB ←	multidrug efflux system protein
RA	311,823	G→C	11.3%	L350L (CTC→CTG)	acrB ←	multidrug efflux system protein
RA	311,826	G→C	8.4%	I349M (ATC→ATG)	acrB ←	multidrug efflux system protein
RA	311,829	G→A	7.9%	I348I (ATC→ATT)	acrB ←	multidrug efflux system protein
RA	311,832	C→G	7.4%	A347A (GCG→GCC)	acrB ←	multidrug efflux system protein
RA	311,840	C→A	11.3%	V345F (GTC→TTC)	acrB ←	multidrug efflux system protein
RA	311,850	A→T	12.6%	V341V (GTT→GTA)	acrB ←	multidrug efflux system protein
RA	311,868	G→A	9.7%	I335I (ATC→ATT) ‡	acrB ←	multidrug efflux system protein
RA	311,870	T→G	9.8%	I335L (ATC→CTC) ‡	acrB ←	multidrug efflux system protein
RA	311,871	T→C	9.7%	K334K (AAA→AAG) ‡	acrB ←	multidrug efflux system protein
RA	311,873	T→G	9.8%	K334Q (AAA→CAA) ‡	acrB ←	multidrug efflux system protein
RA	311,874	C→G	9.3%	V333V (GTG→GTC)	acrB ←	multidrug efflux system protein
RA	311,880	C→T	9.5%	P331P (CCG→CCA)	acrB ←	multidrug efflux system protein
RA	311,892	G→A	10.6%	Y327Y (TAC→TAT)	acrB ←	multidrug efflux system protein
RA	311,895	T→A	10.8%	P326P (CCA→CCT)	acrB ←	multidrug efflux system protein
RA	312,510	T→C	13.5%	E121E (GAA→GAG)	acrB ←	multidrug efflux system protein
RA	312,513	T→C	13.5%	Q120Q (CAA→CAG)	acrB ←	multidrug efflux system protein
RA	312,529	A→G	18.4%	M115T (ATG→ACG)	acrB ←	multidrug efflux system protein
RA	312,531	C→G	18.8%	A114A (GCG→GCC)	acrB ←	multidrug efflux system protein
RA	312,534	C→G	18.8%	L113L (CTG→CTC)	acrB ←	multidrug efflux system protein
RA	312,540	C→G	20.5%	L111L (CTG→CTC)	acrB ←	multidrug efflux system protein
RA	312,558	A→C	16.4%	V105V (GTT→GTG)	acrB ←	multidrug efflux system protein
RA	312,561	C→T	16.4%	Q104Q (CAG→CAA)	acrB ←	multidrug efflux system protein
RA	312,573	C→A	11.1%	A100A (GCG→GCT) ‡	acrB ←	multidrug efflux system protein
RA	312,575	C→G	11.3%	A100P (GCG→CCG) ‡	acrB ←	multidrug efflux system protein
RA	312,579	A→G	11.7%	T98T (ACT→ACC)	acrB ←	multidrug efflux system protein
RA	312,582	A→C	7.3%	G97G (GGT→GGG)	acrB ←	multidrug efflux system protein
RA	312,585	A→G	7.2%	S96S (TCT→TCC)	acrB ←	multidrug efflux system protein
RA	312,591	A→G	5.2%	F94F (TTT→TTC)	acrB ←	multidrug efflux system protein
RA	312,624	G→A	6.5%	D83D (GAC→GAT)	acrB ←	multidrug efflux system protein
RA	312,627	A→G	6.8%	S82S (AGT→AGC)	acrB ←	multidrug efflux system protein
RA	312,631	T→G	6.5%	N81T (AAC→ACC)	acrB ←	multidrug efflux system protein
RA	312,633	A→G	6.4%	S80S (TCT→TCC)	acrB ←	multidrug efflux system protein
RA	312,642	G→A	8.8%	Y77Y (TAC→TAT)	acrB ←	multidrug efflux system protein
RA	312,687	T→C	20.2%	T62T (ACA→ACG)	acrB ←	multidrug efflux system protein
RA	312,696	G→A	20.4%	D59D (GAC→GAT)	acrB ←	multidrug efflux system protein
RA	312,705	T→G	12.2%	T56T (ACA→ACC)	acrB ←	multidrug efflux system protein
RA	312,708	T→C	12.5%	K55K (AAA→AAG) ‡	acrB ←	multidrug efflux system protein
RA	312,710	T→G	12.5%	K55Q (AAA→CAA) ‡	acrB ←	multidrug efflux system protein
RA	313,227	G→A	12.0%	L288L (CTG→TTG)	acrA ←	multidrug efflux system
RA	313,228	C→A	12.0%	L287L (CTG→CTT)	acrA ←	multidrug efflux system
RA	313,231	A→C	11.9%	T286T (ACT→ACG)	acrA ←	multidrug efflux system
RA	313,234	G→A	11.5%	H285H (CAC→CAT)	acrA ←	multidrug efflux system
RA	313,237	A→T	10.7%	D284E (GAT→GAA) ‡	acrA ←	multidrug efflux system
RA	313,239	C→G	10.9%	D284H (GAT→CAT) ‡	acrA ←	multidrug efflux system
RA	313,246	C→A	10.4%	P281P (CCG→CCT)	acrA ←	multidrug efflux system
RA	313,254	T→C	10.0%	I279V (ATC→GTC)	acrA ←	multidrug efflux system
RA	313,258	G→A	9.2%	R277R (CGC→CGT)	acrA ←	multidrug efflux system
RA	313,267	G→T	8.4%	I274I (ATC→ATA)	acrA ←	multidrug efflux system
RA	313,270	A→G	7.1%	S273S (TCT→TCC)	acrA ←	multidrug efflux system
RA	313,456	C→A	9.3%	P211P (CCG→CCT)	acrA ←	multidrug efflux system
RA	313,462	A→G	8.1%	L209L (CTT→CTC)	acrA ←	multidrug efflux system
RA	313,465	T→C	7.0%	Q208Q (CAA→CAG)	acrA ←	multidrug efflux system
RA	313,471	C→G	7.4%	V206V (GTG→GTC)	acrA ←	multidrug efflux system
RA	313,474	G→A	7.5%	T205T (ACC→ACT)	acrA ←	multidrug efflux system
RA	313,477	T→C	7.9%	A204A (GCA→GCG)	acrA ←	multidrug efflux system
RA	313,768	A→G	6.1%	S107S (AGT→AGC)	acrA ←	multidrug efflux system
RA	313,774	G→A	6.4%	Y105Y (TAC→TAT)	acrA ←	multidrug efflux system
RA	313,777	T→A	6.4%	T104T (ACA→ACT) ‡	acrA ←	multidrug efflux system
RA	313,778	G→T	6.2%	T104K (ACA→AAA) ‡	acrA ←	multidrug efflux system
RA	313,780	C→T	6.2%	A103A (GCG→GCA)	acrA ←	multidrug efflux system
RA	313,795	A→G	7.6%	P98P (CCT→CCC)	acrA ←	multidrug efflux system
RA	313,801	A→G	8.6%	I96I (ATT→ATC)	acrA ←	multidrug efflux system
RA	327,386	C→T	59.4%	S288F (TCC→TTC)	hemH →	ferrochelatase
RA	337,128	G→T	20.8%	intergenic (+100/+216)	ybaQ → / ← copA	predicted DNA‑binding transcriptional regulator/copper transporter
RA	337,146	T→G	9.1%	intergenic (+118/+198)	ybaQ → / ← copA	predicted DNA‑binding transcriptional regulator/copper transporter
RA	337,149	A→T	9.0%	intergenic (+121/+195)	ybaQ → / ← copA	predicted DNA‑binding transcriptional regulator/copper transporter
RA	337,151	C→G	25.8%	intergenic (+123/+193)	ybaQ → / ← copA	predicted DNA‑binding transcriptional regulator/copper transporter
RA	337,157	C→A	16.6%	intergenic (+129/+187)	ybaQ → / ← copA	predicted DNA‑binding transcriptional regulator/copper transporter
RA	337,171	T→C	21.6%	intergenic (+143/+173)	ybaQ → / ← copA	predicted DNA‑binding transcriptional regulator/copper transporter
RA	349,124	C→T	47.5%	A474A (GCC→GCT)	gcl →	glyoxylate carboligase
RA	349,960	C→T	56.4%	P155L (CCC→CTC)	hyi →	hydroxypyruvate isomerase
RA	350,279	G→A	38.9%	intergenic (+6/‑94)	hyi → / → glxR	hydroxypyruvate isomerase/tartronate semialdehyde reductase, NADH‑dependent
RA	350,336	C→T	56.6%	intergenic (+63/‑37)	hyi → / → glxR	hydroxypyruvate isomerase/tartronate semialdehyde reductase, NADH‑dependent
RA	356,218	A→G	5.6%	V200A (GTA→GCA)	folD ←	bifunctional 5,10‑methylene‑tetrahydrofolate dehydrogenase and 5,10‑methylene‑tetrahydrofolate cyclohydrolase
RA	356,222	G→C	6.2%	H199D (CAC→GAC)	folD ←	bifunctional 5,10‑methylene‑tetrahydrofolate dehydrogenase and 5,10‑methylene‑tetrahydrofolate cyclohydrolase
RA	356,225	G→C	6.2%	H198D (CAT→GAT)	folD ←	bifunctional 5,10‑methylene‑tetrahydrofolate dehydrogenase and 5,10‑methylene‑tetrahydrofolate cyclohydrolase
RA	356,229	C→T	6.4%	L196L (CTG→CTA)	folD ←	bifunctional 5,10‑methylene‑tetrahydrofolate dehydrogenase and 5,10‑methylene‑tetrahydrofolate cyclohydrolase
RA	359,417	G→A	7.1%	G216S (GGT→AGT)	sfmD →	predicted outer membrane export usher protein
RA	359,423	T→A	7.2%	W218R (TGG→AGG)	sfmD →	predicted outer membrane export usher protein
RA	359,429	T→C	9.2%	Y220H (TAT→CAT)	sfmD →	predicted outer membrane export usher protein
RA	385,069	T→C	10.9%	F93F (TTT→TTC)	cstA →	carbon starvation protein
RA	385,072	G→C	11.6%	A94A (GCG→GCC)	cstA →	carbon starvation protein
RA	385,075	C→T	12.3%	A95A (GCC→GCT)	cstA →	carbon starvation protein
RA	385,078	T→C	12.3%	I96I (ATT→ATC)	cstA →	carbon starvation protein
RA	385,084	A→T	15.3%	G98G (GGA→GGT)	cstA →	carbon starvation protein
RA	385,087	A→T	16.7%	A99A (GCA→GCT)	cstA →	carbon starvation protein
RA	385,102	G→T	25.0%	G104G (GGG→GGT)	cstA →	carbon starvation protein
RA	385,108	A→T	29.1%	V106V (GTA→GTT)	cstA →	carbon starvation protein
RA	385,111	G→C	27.6%	L107L (CTG→CTC)	cstA →	carbon starvation protein
RA	385,114	G→C	26.1%	A108A (GCG→GCC)	cstA →	carbon starvation protein
RA	385,120	A→G	26.4%	Q110Q (CAA→CAG)	cstA →	carbon starvation protein
RA	385,135	G→T	18.7%	P115P (CCG→CCT)	cstA →	carbon starvation protein
RA	385,138	G→C	19.3%	G116G (GGG→GGC)	cstA →	carbon starvation protein
RA	385,140	T→C	17.9%	M117T (ATG→ACG)	cstA →	carbon starvation protein
RA	385,142	A→C	17.9%	I118L (ATC→CTC) ‡	cstA →	carbon starvation protein
RA	385,144	C→G	18.9%	I118M (ATC→ATG) ‡	cstA →	carbon starvation protein
RA	385,153	C→G	16.8%	L121L (CTC→CTG)	cstA →	carbon starvation protein
RA	385,156	T→G	14.3%	A122A (GCT→GCG)	cstA →	carbon starvation protein
RA	385,162	G→C	16.9%	V124V (GTG→GTC)	cstA →	carbon starvation protein
RA	385,165	T→G	15.4%	V125V (GTT→GTG)	cstA →	carbon starvation protein
RA	385,168	C→G	14.6%	L126L (CTC→CTG)	cstA →	carbon starvation protein
RA	385,202	G→A	13.9%	V138I (GTT→ATT) ‡	cstA →	carbon starvation protein
RA	385,204	T→C	13.9%	V138V (GTT→GTC) ‡	cstA →	carbon starvation protein
RA	385,207	T→C	9.8%	S139S (TCT→TCC)	cstA →	carbon starvation protein
RA	385,208	A→T	9.8%	T140S (ACG→TCG) ‡	cstA →	carbon starvation protein
RA	385,210	G→T	9.9%	T140T (ACG→ACT) ‡	cstA →	carbon starvation protein
RA	385,217	G→A	8.3%	D143N (GAC→AAC) ‡	cstA →	carbon starvation protein
RA	385,219	C→T	8.0%	D143D (GAC→GAT) ‡	cstA →	carbon starvation protein
RA	385,222	Δ1 bp	8.8%	coding (432/2106 nt)	cstA →	carbon starvation protein
RA	385,225:1	+A	8.9%	coding (435/2106 nt)	cstA →	carbon starvation protein
RA	385,228	G→T	10.7%	S146S (TCG→TCT)	cstA →	carbon starvation protein
RA	385,231	G→T	9.6%	L147L (CTG→CTT)	cstA →	carbon starvation protein
RA	385,238	C→A	8.4%	L150M (CTG→ATG)	cstA →	carbon starvation protein
RA	385,241	G→A	8.6%	V151I (GTC→ATC)	cstA →	carbon starvation protein
RA	385,411	G→T	13.7%	G207G (GGG→GGT)	cstA →	carbon starvation protein
RA	385,418	C→A	14.9%	L210M (CTG→ATG)	cstA →	carbon starvation protein
RA	385,425	A→T	15.7%	Y212F (TAT→TTT)	cstA →	carbon starvation protein
RA	385,427	C→A	16.0%	L213M (CTG→ATG) ‡	cstA →	carbon starvation protein
RA	385,429	G→T	16.0%	L213L (CTG→CTT) ‡	cstA →	carbon starvation protein
RA	385,442	A→G	16.7%	I218V (ATT→GTT) ‡	cstA →	carbon starvation protein
RA	385,444	T→G	17.2%	I218M (ATT→ATG) ‡	cstA →	carbon starvation protein
RA	385,447	C→T	16.0%	G219G (GGC→GGT)	cstA →	carbon starvation protein
RA	385,780	T→C	8.2%	F330F (TTT→TTC)	cstA →	carbon starvation protein
RA	385,798	C→T	20.6%	G336G (GGC→GGT)	cstA →	carbon starvation protein
RA	385,804	G→A	23.3%	V338V (GTG→GTA)	cstA →	carbon starvation protein
RA	385,816	T→C	20.3%	H342H (CAT→CAC)	cstA →	carbon starvation protein
RA	385,831	T→C	20.3%	S347S (TCT→TCC)	cstA →	carbon starvation protein
RA	385,834	G→T	17.6%	G348G (GGG→GGT)	cstA →	carbon starvation protein
RA	385,837	C→G	11.7%	T349T (ACC→ACG)	cstA →	carbon starvation protein
RA	385,843	G→A	11.1%	P351P (CCG→CCA)	cstA →	carbon starvation protein
RA	385,846	G→A	10.7%	K352K (AAG→AAA)	cstA →	carbon starvation protein
RA	385,847	A→C	10.6%	M353L (ATG→CTG)	cstA →	carbon starvation protein
RA	385,888	T→C	8.8%	G366G (GGT→GGC)	cstA →	carbon starvation protein
RA	385,890	G→C	9.8%	G367A (GGG→GCG) ‡	cstA →	carbon starvation protein
RA	385,891	G→A	9.8%	G367G (GGG→GGA) ‡	cstA →	carbon starvation protein
RA	385,895	T→C	9.3%	L369L (TTA→CTA) ‡	cstA →	carbon starvation protein
RA	385,897	A→G	9.8%	L369L (TTA→TTG) ‡	cstA →	carbon starvation protein
RA	385,903	A→G	9.8%	E371E (GAA→GAG)	cstA →	carbon starvation protein
RA	385,931	T→G	17.7%	S381A (TCC→GCC) ‡	cstA →	carbon starvation protein
RA	385,933	C→T	17.6%	S381S (TCC→TCT) ‡	cstA →	carbon starvation protein
RA	385,936	C→G	17.9%	A382A (GCC→GCG)	cstA →	carbon starvation protein
RA	385,938	G→C	17.6%	C383S (TGT→TCT) ‡	cstA →	carbon starvation protein
RA	385,939	T→C	17.4%	C383C (TGT→TGC) ‡	cstA →	carbon starvation protein
RA	385,948	T→A	10.8%	D386E (GAT→GAA)	cstA →	carbon starvation protein
RA	385,954	C→T	10.1%	G388G (GGC→GGT)	cstA →	carbon starvation protein
RA	385,955	G→C	10.0%	V389L (GTG→CTG) ‡	cstA →	carbon starvation protein
RA	385,957	G→T	9.9%	V389V (GTG→GTT) ‡	cstA →	carbon starvation protein
RA	385,960	T→C	10.0%	Y390Y (TAT→TAC)	cstA →	carbon starvation protein
RA	385,963	T→C	10.0%	F391F (TTT→TTC)	cstA →	carbon starvation protein
RA	385,966	C→G	9.7%	A392A (GCC→GCG)	cstA →	carbon starvation protein
RA	386,404	C→T	8.5%	V538V (GTC→GTT)	cstA →	carbon starvation protein
RA	386,420	A→G	8.2%	I544V (ATT→GTT)	cstA →	carbon starvation protein
RA	386,425	C→G	8.0%	N545K (AAC→AAG)	cstA →	carbon starvation protein
RA	386,427	C→G	8.3%	T546S (ACT→AGT) ‡	cstA →	carbon starvation protein
RA	386,428	T→C	7.9%	T546T (ACT→ACC) ‡	cstA →	carbon starvation protein
RA	386,443	T→C	7.1%	F551F (TTT→TTC)	cstA →	carbon starvation protein
RA	386,449	T→C	8.2%	I553I (ATT→ATC)	cstA →	carbon starvation protein
RA	386,450	G→T	8.1%	A554S (GCC→TCC)	cstA →	carbon starvation protein
RA	394,838	G→A	15.7%	P63P (CCG→CCA)	ahpF →	alkyl hydroperoxide reductase, F52a subunit, FAD/NAD(P)‑binding
RA	412,090	A→G	36.5%	V89A (GTG→GCG)	leuS ←	leucyl‑tRNA synthetase
RA	412,492	C→T	30.2%	intergenic (‑137/+152)	leuS ← / ← lnt	leucyl‑tRNA synthetase/apolipoprotein N‑acyltransferase
RA	412,564	A→C	41.1%	intergenic (‑209/+80)	leuS ← / ← lnt	leucyl‑tRNA synthetase/apolipoprotein N‑acyltransferase
RA	418,094	C→T	18.9%	A55T (GCT→ACT)	miaB ←	isopentenyl‑adenosine A37 tRNA methylthiolase
RA	423,971	T→C	21.7%	S309G (AGT→GGT)	nagC ←	DNA‑binding transcriptional dual regulator
RA	425,152	C→T	27.0%	D301N (GAT→AAT)	nagA ←	N‑acetylglucosamine‑6‑phosphate deacetylase
RA	434,040	C→T	20.4%	intergenic (‑93/+196)	fur ← / ← fldA	DNA‑binding transcriptional dual regulator/flavodoxin 1
RA	452,736	C→T	17.8%	A234V (GCA→GTA)	phr →	deoxyribodipyrimidine photolyase, FAD‑binding
RA	454,680	A→T	7.7%	R135R (CGT→CGA)	ybgH ←	predicted transporter
RA	454,683	C→A	7.4%	P134P (CCG→CCT) ‡	ybgH ←	predicted transporter
RA	454,684	G→T	7.5%	P134Q (CCG→CAG) ‡	ybgH ←	predicted transporter
RA	454,690	G→T	7.5%	T132N (ACC→AAC)	ybgH ←	predicted transporter
RA	454,692	T→C	7.7%	P131P (CCA→CCG) ‡	ybgH ←	predicted transporter
RA	454,693	G→T	7.7%	P131Q (CCA→CAA) ‡	ybgH ←	predicted transporter
RA	454,694	G→C	7.8%	P131A (CCA→GCA) ‡	ybgH ←	predicted transporter
RA	454,695	C→G	7.5%	E130D (GAG→GAC)	ybgH ←	predicted transporter
RA	454,698	A→G	7.3%	Y129Y (TAT→TAC)	ybgH ←	predicted transporter
RA	454,701	C→G	7.3%	L128L (CTG→CTC)	ybgH ←	predicted transporter
RA	454,710	G→A	6.7%	L125L (CTC→CTT)	ybgH ←	predicted transporter
RA	454,715	G→A	7.2%	L124L (CTG→TTG)	ybgH ←	predicted transporter
RA	454,989	C→G	16.2%	L32L (CTG→CTC)	ybgH ←	predicted transporter
RA	454,992	C→T	16.2%	L31L (CTG→CTA) ‡	ybgH ←	predicted transporter
RA	454,994	G→A	16.4%	L31L (CTG→TTG) ‡	ybgH ←	predicted transporter
RA	455,013	G→A	29.2%	S24S (AGC→AGT)	ybgH ←	predicted transporter
RA	455,016	A→G	31.4%	F23F (TTT→TTC)	ybgH ←	predicted transporter
RA	455,019	A→G	35.0%	Y22Y (TAT→TAC)	ybgH ←	predicted transporter
RA	455,022	T→C	33.3%	E21E (GAA→GAG)	ybgH ←	predicted transporter
RA	455,034	C→G	31.2%	L17L (CTG→CTC) ‡	ybgH ←	predicted transporter
RA	455,036	G→T	30.0%	L17M (CTG→ATG) ‡	ybgH ←	predicted transporter
RA	455,040	A→C	30.5%	V15V (GTT→GTG)	ybgH ←	predicted transporter
RA	455,045	C→T	25.0%	V14I (GTC→ATC)	ybgH ←	predicted transporter
RA	455,052	A→T	20.0%	I11I (ATT→ATA)	ybgH ←	predicted transporter
RA	455,055	A→C	19.5%	A10A (GCT→GCG)	ybgH ←	predicted transporter
RA	481,654	T→A	7.7%	L16Q (CTG→CAG)	tolQ →	membrane spanning protein in TolA‑TolQ‑TolR complex
RA	509,855	G→C	17.1%	intergenic (+80/‑103)	ybhI → / → ybhJ	predicted transporter/predicted hydratase
RA	551,606	G→A	15.0%	L640L (CTG→TTG)	ybiW ←	predicted pyruvate formate lyase
RA	574,465	G→A	36.3%	E432K (GAA→AAA)	ybjD →	conserved hypothetical protein with nucleoside triphosphate hydrolase domain
RA	608,004	G→A	7.1%	D750D (GAC→GAT)	pflB ←	pyruvate formate lyase I
RA	608,010	C→T	7.4%	Q748Q (CAG→CAA)	pflB ←	pyruvate formate lyase I
RA	608,019	T→A	7.3%	K745N (AAA→AAT) ‡	pflB ←	pyruvate formate lyase I
RA	608,020	T→C	7.3%	K745R (AAA→AGA) ‡	pflB ←	pyruvate formate lyase I
RA	608,021	T→G	7.4%	K745Q (AAA→CAA) ‡	pflB ←	pyruvate formate lyase I
RA	608,022	A→G	7.1%	T744T (ACT→ACC)	pflB ←	pyruvate formate lyase I
RA	608,028	C→T	7.9%	S742S (TCG→TCA) ‡	pflB ←	pyruvate formate lyase I
RA	608,030	A→C	8.1%	S742A (TCG→GCG) ‡	pflB ←	pyruvate formate lyase I
RA	608,037	A→G	8.5%	R739R (CGT→CGC)	pflB ←	pyruvate formate lyase I
RA	608,040	T→C	7.8%	V738V (GTA→GTG)	pflB ←	pyruvate formate lyase I
RA	608,043	T→G	8.1%	A737A (GCA→GCC)	pflB ←	pyruvate formate lyase I
RA	608,055	T→G	15.4%	V733V (GTA→GTC)	pflB ←	pyruvate formate lyase I
RA	608,064	G→T	17.8%	T730T (ACC→ACA)	pflB ←	pyruvate formate lyase I
RA	608,070	C→G	15.5%	Q728H (CAG→CAC) ‡	pflB ←	pyruvate formate lyase I
RA	608,072	G→T	16.0%	Q728K (CAG→AAG) ‡	pflB ←	pyruvate formate lyase I
RA	608,073	C→A	15.7%	P727P (CCG→CCT)	pflB ←	pyruvate formate lyase I
RA	608,090	T→G	16.4%	N722H (AAC→CAC)	pflB ←	pyruvate formate lyase I
RA	608,091	T→C	16.3%	E721E (GAA→GAG)	pflB ←	pyruvate formate lyase I
RA	608,094	C→G	15.0%	M720I (ATG→ATC)	pflB ←	pyruvate formate lyase I
RA	608,097	C→G	13.4%	A719A (GCG→GCC)	pflB ←	pyruvate formate lyase I
RA	608,100	G→A	13.5%	D718D (GAC→GAT)	pflB ←	pyruvate formate lyase I
RA	608,103	G→C	12.7%	L717L (CTC→CTG)	pflB ←	pyruvate formate lyase I
RA	608,115	A→C	16.0%	R713R (CGT→CGG)	pflB ←	pyruvate formate lyase I
RA	608,118	G→A	13.4%	N712N (AAC→AAT)	pflB ←	pyruvate formate lyase I
RA	608,124	C→T	12.3%	V710V (GTG→GTA)	pflB ←	pyruvate formate lyase I
RA	608,130	A→G	11.1%	V708V (GTT→GTC)	pflB ←	pyruvate formate lyase I
RA	608,136	C→G	13.5%	L706L (CTG→CTC)	pflB ←	pyruvate formate lyase I
RA	608,142	C→T	16.8%	Q704Q (CAG→CAA)	pflB ←	pyruvate formate lyase I
RA	608,148	A→G	17.4%	G702G (GGT→GGC)	pflB ←	pyruvate formate lyase I
RA	608,156	T→C	16.4%	I700V (ATC→GTC)	pflB ←	pyruvate formate lyase I
RA	608,157	G→A	16.4%	S699S (TCC→TCT) ‡	pflB ←	pyruvate formate lyase I
RA	608,158	G→T	16.3%	S699Y (TCC→TAC) ‡	pflB ←	pyruvate formate lyase I
RA	608,159	A→C	16.3%	S699A (TCC→GCC) ‡	pflB ←	pyruvate formate lyase I
RA	608,160	T→C	16.4%	A698A (GCA→GCG)	pflB ←	pyruvate formate lyase I
RA	608,175	G→A	13.9%	Y693Y (TAC→TAT)	pflB ←	pyruvate formate lyase I
RA	608,178	A→C	14.3%	G692G (GGT→GGG)	pflB ←	pyruvate formate lyase I
RA	608,186	T→G	12.4%	M690L (ATG→CTG)	pflB ←	pyruvate formate lyase I
RA	608,190	A→G	11.1%	G688G (GGT→GGC)	pflB ←	pyruvate formate lyase I
RA	608,193	A→G	11.6%	A687A (GCT→GCC) ‡	pflB ←	pyruvate formate lyase I
RA	608,194	G→A	12.6%	A687V (GCT→GTT) ‡	pflB ←	pyruvate formate lyase I
RA	608,196	C→A	11.5%	L686L (CTG→CTT)	pflB ←	pyruvate formate lyase I
RA	608,205	C→T	6.1%	K683K (AAG→AAA)	pflB ←	pyruvate formate lyase I
RA	608,274	A→G	8.0%	A660A (GCT→GCC)	pflB ←	pyruvate formate lyase I
RA	608,280	A→G	9.1%	A658A (GCT→GCC) ‡	pflB ←	pyruvate formate lyase I
RA	608,282	C→T	8.4%	A658T (GCT→ACT) ‡	pflB ←	pyruvate formate lyase I
RA	608,283	A→G	8.5%	F657F (TTT→TTC)	pflB ←	pyruvate formate lyase I
RA	608,295	A→C	11.9%	A653A (GCT→GCG)	pflB ←	pyruvate formate lyase I
RA	608,298	A→C	11.8%	V652V (GTT→GTG)	pflB ←	pyruvate formate lyase I
RA	608,301	G→C	12.3%	S651S (TCC→TCG)	pflB ←	pyruvate formate lyase I
RA	608,304	A→C	11.1%	T650T (ACT→ACG)	pflB ←	pyruvate formate lyase I
RA	608,309	G→A	11.6%	L649L (CTG→TTG)	pflB ←	pyruvate formate lyase I
RA	608,310	A→T	11.8%	S648S (TCT→TCA)	pflB ←	pyruvate formate lyase I
RA	608,316	T→C	7.7%	V646V (GTA→GTG)	pflB ←	pyruvate formate lyase I
RA	608,319	T→G	7.7%	A645A (GCA→GCC)	pflB ←	pyruvate formate lyase I
RA	608,328	C→G	6.2%	Q642H (CAG→CAC) ‡	pflB ←	pyruvate formate lyase I
RA	608,329	T→C	6.2%	Q642R (CAG→CGG) ‡	pflB ←	pyruvate formate lyase I
RA	608,340	G→A	9.2%	H638H (CAC→CAT)	pflB ←	pyruvate formate lyase I
RA	608,355	A→G	12.9%	G633G (GGT→GGC)	pflB ←	pyruvate formate lyase I
RA	608,361	T→C	11.4%	G631G (GGA→GGG) ‡	pflB ←	pyruvate formate lyase I
RA	608,362	C→G	12.1%	G631A (GGA→GCA) ‡	pflB ←	pyruvate formate lyase I
RA	608,370	C→T	15.8%	A628A (GCG→GCA) ‡	pflB ←	pyruvate formate lyase I
RA	608,372	C→T	15.8%	A628T (GCG→ACG) ‡	pflB ←	pyruvate formate lyase I
RA	608,373	G→T	15.7%	G627G (GGC→GGA)	pflB ←	pyruvate formate lyase I
RA	608,376	A→G	14.0%	A626A (GCT→GCC)	pflB ←	pyruvate formate lyase I
RA	608,379	A→G	14.7%	R625R (CGT→CGC)	pflB ←	pyruvate formate lyase I
RA	608,391	T→C	14.7%	P621P (CCA→CCG)	pflB ←	pyruvate formate lyase I
RA	608,394	G→C	15.9%	T620T (ACC→ACG)	pflB ←	pyruvate formate lyase I
RA	608,397	G→A	14.3%	N619N (AAC→AAT)	pflB ←	pyruvate formate lyase I
RA	608,403	C→G	13.0%	T617T (ACG→ACC)	pflB ←	pyruvate formate lyase I
RA	608,667	A→G	6.2%	G529G (GGT→GGC)	pflB ←	pyruvate formate lyase I
RA	608,676	A→G	6.8%	G526G (GGT→GGC)	pflB ←	pyruvate formate lyase I
RA	608,679	A→G	7.0%	C525C (TGT→TGC)	pflB ←	pyruvate formate lyase I
RA	608,682	C→T	6.9%	A524A (GCG→GCA)	pflB ←	pyruvate formate lyase I
RA	608,688	G→A	10.3%	T522T (ACC→ACT)	pflB ←	pyruvate formate lyase I
RA	608,693	Δ1 bp	10.3%	coding (1561/2283 nt)	pflB ←	pyruvate formate lyase I
RA	608,697:1	+G	10.1%	coding (1557/2283 nt)	pflB ←	pyruvate formate lyase I
RA	608,700	G→A	10.1%	D518D (GAC→GAT)	pflB ←	pyruvate formate lyase I
RA	608,706	G→A	12.5%	D516D (GAC→GAT)	pflB ←	pyruvate formate lyase I
RA	608,724	A→C	25.2%	S510S (TCT→TCG)	pflB ←	pyruvate formate lyase I
RA	608,727	G→A	25.2%	A509A (GCC→GCT)	pflB ←	pyruvate formate lyase I
RA	608,760	G→A	27.9%	I498I (ATC→ATT)	pflB ←	pyruvate formate lyase I
RA	608,766	G→A	28.2%	N496N (AAC→AAT)	pflB ←	pyruvate formate lyase I
RA	608,772	T→C	32.3%	A494A (GCA→GCG)	pflB ←	pyruvate formate lyase I
RA	608,775	A→G	32.3%	T493T (ACT→ACC) ‡	pflB ←	pyruvate formate lyase I
RA	608,776	G→C	32.3%	T493S (ACT→AGT) ‡	pflB ←	pyruvate formate lyase I
RA	608,787	T→C	21.9%	K489K (AAA→AAG) ‡	pflB ←	pyruvate formate lyase I
RA	608,788	T→A	21.8%	K489I (AAA→ATA) ‡	pflB ←	pyruvate formate lyase I
RA	608,789	T→C	21.9%	K489E (AAA→GAA) ‡	pflB ←	pyruvate formate lyase I
RA	608,790	A→C	24.5%	A488A (GCT→GCG)	pflB ←	pyruvate formate lyase I
RA	608,814	C→G	11.1%	M480I (ATG→ATC) ‡	pflB ←	pyruvate formate lyase I
RA	608,816	T→G	11.3%	M480L (ATG→CTG) ‡	pflB ←	pyruvate formate lyase I
RA	608,819	G→T	11.2%	R479S (CGC→AGC)	pflB ←	pyruvate formate lyase I
RA	608,820	C→G	11.3%	E478D (GAG→GAC)	pflB ←	pyruvate formate lyase I
RA	608,883	C→A	10.8%	M457I (ATG→ATT)	pflB ←	pyruvate formate lyase I
RA	608,886	T→C	11.2%	K456K (AAA→AAG)	pflB ←	pyruvate formate lyase I
RA	608,892	T→C	12.0%	K454K (AAA→AAG)	pflB ←	pyruvate formate lyase I
RA	608,895	T→C	12.0%	E453E (GAA→GAG)	pflB ←	pyruvate formate lyase I
RA	608,901	A→C	14.1%	V451V (GTT→GTG)	pflB ←	pyruvate formate lyase I
RA	608,904	G→C	11.9%	G450G (GGC→GGG)	pflB ←	pyruvate formate lyase I
RA	608,913	G→A	14.7%	I447I (ATC→ATT)	pflB ←	pyruvate formate lyase I
RA	608,922	C→G	16.0%	L444L (CTG→CTC)	pflB ←	pyruvate formate lyase I
RA	608,927	T→G	16.2%	M443L (ATG→CTG)	pflB ←	pyruvate formate lyase I
RA	608,928	G→C	16.6%	T442T (ACC→ACG)	pflB ←	pyruvate formate lyase I
RA	608,943	T→A	24.0%	A437A (GCA→GCT)	pflB ←	pyruvate formate lyase I
RA	608,946	A→G	20.2%	R436R (CGT→CGC)	pflB ←	pyruvate formate lyase I
RA	608,949	C→T	20.8%	A435A (GCG→GCA)	pflB ←	pyruvate formate lyase I
RA	608,955	G→A	25.2%	F433F (TTC→TTT)	pflB ←	pyruvate formate lyase I
RA	608,970	T→C	17.2%	K428K (AAA→AAG)	pflB ←	pyruvate formate lyase I
RA	608,978	C→T	15.3%	V426I (GTT→ATT)	pflB ←	pyruvate formate lyase I
RA	608,979	G→C	14.8%	I425M (ATC→ATG) ‡	pflB ←	pyruvate formate lyase I
RA	608,981	T→C	15.8%	I425V (ATC→GTC) ‡	pflB ←	pyruvate formate lyase I
RA	608,985	C→T	15.8%	P423P (CCG→CCA)	pflB ←	pyruvate formate lyase I
RA	608,991	T→G	15.0%	V421V (GTA→GTC)	pflB ←	pyruvate formate lyase I
RA	609,000	A→G	11.4%	A418A (GCT→GCC)	pflB ←	pyruvate formate lyase I
RA	609,006	A→C	7.3%	A416A (GCT→GCG)	pflB ←	pyruvate formate lyase I
RA	609,012	G→A	6.0%	D414D (GAC→GAT)	pflB ←	pyruvate formate lyase I
RA	609,015	A→G	5.4%	D413D (GAT→GAC)	pflB ←	pyruvate formate lyase I
RA	609,276	T→C	7.8%	E326E (GAA→GAG) ‡	pflB ←	pyruvate formate lyase I
RA	609,277	T→G	7.9%	E326A (GAA→GCA) ‡	pflB ←	pyruvate formate lyase I
RA	609,278	C→A	7.9%	E326* (GAA→TAA) ‡	pflB ←	pyruvate formate lyase I
RA	609,282	G→A	8.2%	Y324Y (TAC→TAT) ‡	pflB ←	pyruvate formate lyase I
RA	609,283	T→A	7.8%	Y324F (TAC→TTC) ‡	pflB ←	pyruvate formate lyase I
RA	609,291	A→T	7.7%	T321T (ACT→ACA)	pflB ←	pyruvate formate lyase I
RA	609,705	A→G	5.5%	R183R (CGT→CGC)	pflB ←	pyruvate formate lyase I
RA	609,708	G→A	5.5%	Y182Y (TAC→TAT)	pflB ←	pyruvate formate lyase I
RA	609,720	G→A	12.5%	I178I (ATC→ATT)	pflB ←	pyruvate formate lyase I
RA	609,723	A→G	14.9%	R177R (CGT→CGC)	pflB ←	pyruvate formate lyase I
RA	609,726	G→C	15.1%	G176G (GGC→GGG)	pflB ←	pyruvate formate lyase I
RA	609,738	T→G	22.0%	A172A (GCA→GCC) ‡	pflB ←	pyruvate formate lyase I
RA	609,739	G→C	19.9%	A172G (GCA→GGA) ‡	pflB ←	pyruvate formate lyase I
RA	609,747	C→T	21.2%	L169L (CTG→CTA) ‡	pflB ←	pyruvate formate lyase I
RA	609,749	G→A	21.2%	L169L (CTG→TTG) ‡	pflB ←	pyruvate formate lyase I
RA	609,759	A→C	20.8%	V165V (GTT→GTG)	pflB ←	pyruvate formate lyase I
RA	609,762	A→G	21.9%	G164G (GGT→GGC)	pflB ←	pyruvate formate lyase I
RA	609,777	A→G	22.1%	R159R (CGT→CGC)	pflB ←	pyruvate formate lyase I
RA	609,783	G→C	19.2%	I157M (ATC→ATG)	pflB ←	pyruvate formate lyase I
RA	609,786	G→A	17.6%	D156D (GAC→GAT)	pflB ←	pyruvate formate lyase I
RA	609,792	A→T	16.8%	T154T (ACT→ACA) ‡	pflB ←	pyruvate formate lyase I
RA	609,794	T→A	17.3%	T154S (ACT→TCT) ‡	pflB ←	pyruvate formate lyase I
RA	609,801	G→A	10.3%	D151D (GAC→GAT)	pflB ←	pyruvate formate lyase I
RA	609,804	G→A	9.2%	F150F (TTC→TTT)	pflB ←	pyruvate formate lyase I
RA	609,807	C→T	9.7%	V149V (GTG→GTA)	pflB ←	pyruvate formate lyase I
RA	630,073	C→T	32.4%	G10S (GGC→AGC)	ycbC ←	conserved inner membrane protein
RA	684,711	G→A	18.7%	D23N (GAC→AAC)	yccU →	predicted CoA‑binding protein with NAD(P)‑binding Rossmann‑fold domain
RA	705,295	A→G	50.7%	G32G (GGT→GGC)	ymcB ←	conserved hypothetical protein
RA	706,680	C→T	48.3%	R244K (AGG→AAG)	lpxL ←	lauryl‑acyl carrier protein (ACP)‑dependent acyltransferase
RA	720,216	T→C	32.0%	intergenic (+14/+221)	mviN → / ← rne	predicted inner membrane protein/fused ribonucleaseE endoribonuclease and scaffold for formation of degradosome
RA	741,873	T→C	12.2%	Y124Y (TAT→TAC)	ycfL →	hypothetical protein
RA	775,475	C→T	10.9%	H366H (CAC→CAT)	icd →	isocitrate dehydrogenase, specific for NADP+
RA	775,487	C→T	24.5%	T370T (ACC→ACT)	icd →	isocitrate dehydrogenase, specific for NADP+
RA	775,500	T→C	35.2%	L375L (TTA→CTA) ‡	icd →	isocitrate dehydrogenase, specific for NADP+
RA	775,502	A→G	35.2%	L375L (TTA→TTG) ‡	icd →	isocitrate dehydrogenase, specific for NADP+
RA	775,532	C→T	39.7%	N385N (AAC→AAT)	icd →	isocitrate dehydrogenase, specific for NADP+
RA	775,535	G→C	39.7%	A386A (GCG→GCC)	icd →	isocitrate dehydrogenase, specific for NADP+
RA	775,538	A→G	38.0%	K387K (AAA→AAG)	icd →	isocitrate dehydrogenase, specific for NADP+
RA	775,547	C→T	31.2%	T390T (ACC→ACT)	icd →	isocitrate dehydrogenase, specific for NADP+
RA	775,559	G→A	30.4%	E394E (GAG→GAA)	icd →	isocitrate dehydrogenase, specific for NADP+
RA	775,571	T→A	34.5%	D398E (GAT→GAA)	icd →	isocitrate dehydrogenase, specific for NADP+
RA	775,580	A→G	26.1%	K401K (AAA→AAG)	icd →	isocitrate dehydrogenase, specific for NADP+
RA	775,607	C→A	15.5%	D410E (GAC→GAA)	icd →	isocitrate dehydrogenase, specific for NADP+
RA	788,075	G→A	28.6%	P461S (CCA→TCA)	ycgB ←	conserved hypothetical protein
RA	805,245	T→C	9.7%	intergenic (+46/+54)	dhaR → / ← ycgV	predicted DNA‑binding transcriptional regulator, dihydroxyacetone/predicted adhesin
RA	805,466	T→C	9.1%	N901D (AAC→GAC)	ycgV ←	predicted adhesin
RA	806,555	C→T	12.7%	G538S (GGC→AGC)	ycgV ←	predicted adhesin
RA	820,928	T→A	5.7%	F184I (TTC→ATC)	kdsA →	3‑deoxy‑D‑manno‑octulosonate 8‑phosphate synthase
RA	821,445	T→C	38.5%	S7G (AGC→GGC)	ldrA ←	toxic polypeptide, small
RA	821,535	G→T	29.7%	intergenic (‑72/+382)	ldrA ← / ← ldrC	toxic polypeptide, small/toxic polypeptide, small
RA	821,537:1	+T	29.7%	intergenic (‑74/+380)	ldrA ← / ← ldrC	toxic polypeptide, small/toxic polypeptide, small
RA	821,576	T→G	41.9%	intergenic (‑113/+341)	ldrA ← / ← ldrC	toxic polypeptide, small/toxic polypeptide, small
RA	821,688	T→A	10.1%	intergenic (‑225/+229)	ldrA ← / ← ldrC	toxic polypeptide, small/toxic polypeptide, small
RA	821,728	A→G	17.6%	intergenic (‑265/+189)	ldrA ← / ← ldrC	toxic polypeptide, small/toxic polypeptide, small
RA	821,735	A→G	29.1%	intergenic (‑272/+182)	ldrA ← / ← ldrC	toxic polypeptide, small/toxic polypeptide, small
RA	821,744	C→T	33.3%	intergenic (‑281/+173)	ldrA ← / ← ldrC	toxic polypeptide, small/toxic polypeptide, small
RA	821,760	G→A	37.5%	intergenic (‑297/+157)	ldrA ← / ← ldrC	toxic polypeptide, small/toxic polypeptide, small
RA	821,766	G→A	41.3%	intergenic (‑303/+151)	ldrA ← / ← ldrC	toxic polypeptide, small/toxic polypeptide, small
RA	821,788	T→G	37.8%	intergenic (‑325/+129)	ldrA ← / ← ldrC	toxic polypeptide, small/toxic polypeptide, small
RA	821,826	A→T	38.6%	intergenic (‑363/+91)	ldrA ← / ← ldrC	toxic polypeptide, small/toxic polypeptide, small
RA	822,222	T→A	11.7%	intergenic (‑198/+206)	ldrC ← / ← chaA	toxic polypeptide, small/calcium/sodium:proton antiporter
RA	822,224	G→T	11.5%	intergenic (‑200/+204)	ldrC ← / ← chaA	toxic polypeptide, small/calcium/sodium:proton antiporter
RA	822,269	A→G	8.1%	intergenic (‑245/+159)	ldrC ← / ← chaA	toxic polypeptide, small/calcium/sodium:proton antiporter
RA	822,278	C→T	7.0%	intergenic (‑254/+150)	ldrC ← / ← chaA	toxic polypeptide, small/calcium/sodium:proton antiporter
RA	832,094	C→T	15.0%	D184D (GAC→GAT)	narG →	nitrate reductase 1, alpha subunit
RA	832,097	T→C	16.1%	R185R (CGT→CGC)	narG →	nitrate reductase 1, alpha subunit
RA	832,103	T→C	15.9%	A187A (GCT→GCC)	narG →	nitrate reductase 1, alpha subunit
RA	832,115	A→G	18.7%	P191P (CCA→CCG)	narG →	nitrate reductase 1, alpha subunit
RA	832,118	T→C	18.5%	I192I (ATT→ATC)	narG →	nitrate reductase 1, alpha subunit
RA	832,124	A→G	15.3%	A194A (GCA→GCG)	narG →	nitrate reductase 1, alpha subunit
RA	832,145	A→C	12.1%	A201A (GCA→GCC)	narG →	nitrate reductase 1, alpha subunit
RA	832,146	T→G	12.2%	S202A (TCG→GCG) ‡	narG →	nitrate reductase 1, alpha subunit
RA	832,148	G→C	12.3%	S202S (TCG→TCC) ‡	narG →	nitrate reductase 1, alpha subunit
RA	832,151	T→A	11.4%	G203G (GGT→GGA)	narG →	nitrate reductase 1, alpha subunit
RA	832,152	G→A	11.3%	A204T (GCA→ACA) ‡	narG →	nitrate reductase 1, alpha subunit
RA	832,154	A→G	10.7%	A204A (GCA→GCG) ‡	narG →	nitrate reductase 1, alpha subunit
RA	832,157	C→T	9.7%	R205R (CGC→CGT)	narG →	nitrate reductase 1, alpha subunit
RA	832,163	C→G	13.5%	L207L (CTC→CTG)	narG →	nitrate reductase 1, alpha subunit
RA	832,170	A→C	14.1%	I210L (ATT→CTT)	narG →	nitrate reductase 1, alpha subunit
RA	832,178	T→C	12.3%	G212G (GGT→GGC)	narG →	nitrate reductase 1, alpha subunit
RA	832,181	T→C	12.6%	T213T (ACT→ACC)	narG →	nitrate reductase 1, alpha subunit
RA	832,184	C→T	12.9%	C214C (TGC→TGT)	narG →	nitrate reductase 1, alpha subunit
RA	832,190	C→T	11.9%	S216S (AGC→AGT)	narG →	nitrate reductase 1, alpha subunit
RA	832,205	C→T	17.8%	Y221Y (TAC→TAT)	narG →	nitrate reductase 1, alpha subunit
RA	832,212	T→C	23.5%	L224L (TTG→CTG)	narG →	nitrate reductase 1, alpha subunit
RA	832,217	T→G	22.1%	P225P (CCT→CCG)	narG →	nitrate reductase 1, alpha subunit
RA	832,220	T→C	22.1%	P226P (CCT→CCC)	narG →	nitrate reductase 1, alpha subunit
RA	832,223	G→C	20.4%	A227A (GCG→GCC)	narG →	nitrate reductase 1, alpha subunit
RA	832,226	T→G	24.6%	S228S (TCT→TCG)	narG →	nitrate reductase 1, alpha subunit
RA	832,230	C→A	19.0%	Q230K (CAA→AAA) ‡	narG →	nitrate reductase 1, alpha subunit
RA	832,231	A→T	19.5%	Q230L (CAA→CTA) ‡	narG →	nitrate reductase 1, alpha subunit
RA	832,232	A→G	19.7%	Q230Q (CAA→CAG) ‡	narG →	nitrate reductase 1, alpha subunit
RA	832,250	T→C	18.9%	T236T (ACT→ACC)	narG →	nitrate reductase 1, alpha subunit
RA	832,268	T→C	27.3%	A242A (GCT→GCC)	narG →	nitrate reductase 1, alpha subunit
RA	832,277	C→T	24.7%	Y245Y (TAC→TAT)	narG →	nitrate reductase 1, alpha subunit
RA	832,307	A→T	38.8%	S255S (TCA→TCT)	narG →	nitrate reductase 1, alpha subunit
RA	832,313	G→A	37.2%	V257V (GTG→GTA)	narG →	nitrate reductase 1, alpha subunit
RA	832,322	G→A	32.2%	T260T (ACG→ACA)	narG →	nitrate reductase 1, alpha subunit
RA	832,328	C→G	23.9%	T262T (ACC→ACG)	narG →	nitrate reductase 1, alpha subunit
RA	832,334	T→C	21.4%	D264D (GAT→GAC)	narG →	nitrate reductase 1, alpha subunit
RA	832,337	T→C	20.3%	A265A (GCT→GCC)	narG →	nitrate reductase 1, alpha subunit
RA	832,349	T→C	7.2%	T269T (ACT→ACC)	narG →	nitrate reductase 1, alpha subunit
RA	832,355	G→A	6.9%	V271V (GTG→GTA)	narG →	nitrate reductase 1, alpha subunit
RA	832,358	T→C	6.7%	R272R (CGT→CGC)	narG →	nitrate reductase 1, alpha subunit
RA	832,413	C→T	9.2%	L291L (CTG→TTG)	narG →	nitrate reductase 1, alpha subunit
RA	832,421	T→C	12.2%	D293D (GAT→GAC)	narG →	nitrate reductase 1, alpha subunit
RA	832,423	T→A	12.2%	L294Q (CTG→CAG)	narG →	nitrate reductase 1, alpha subunit
RA	832,442	G→A	12.3%	Q300Q (CAG→CAA)	narG →	nitrate reductase 1, alpha subunit
RA	832,448	C→T	7.3%	T302T (ACC→ACT)	narG →	nitrate reductase 1, alpha subunit
RA	832,452	G→A	6.6%	A304T (GCG→ACG) ‡	narG →	nitrate reductase 1, alpha subunit
RA	832,453	C→G	6.6%	A304G (GCG→GGG) ‡	narG →	nitrate reductase 1, alpha subunit
RA	832,454	G→C	6.6%	A304A (GCG→GCC) ‡	narG →	nitrate reductase 1, alpha subunit
RA	832,457	A→C	6.6%	A305A (GCA→GCC)	narG →	nitrate reductase 1, alpha subunit
RA	832,458	A→C	6.6%	M306L (ATG→CTG)	narG →	nitrate reductase 1, alpha subunit
RA	832,464	C→A	7.2%	L308M (CTG→ATG)	narG →	nitrate reductase 1, alpha subunit
RA	832,469	G→A	6.8%	A309A (GCG→GCA)	narG →	nitrate reductase 1, alpha subunit
RA	832,712	T→G	8.7%	S390S (TCT→TCG)	narG →	nitrate reductase 1, alpha subunit
RA	833,144	C→T	8.6%	H534H (CAC→CAT)	narG →	nitrate reductase 1, alpha subunit
RA	833,147	T→G	10.1%	G535G (GGT→GGG)	narG →	nitrate reductase 1, alpha subunit
RA	833,150	T→C	7.9%	R536R (CGT→CGC)	narG →	nitrate reductase 1, alpha subunit
RA	833,163	G→C	13.3%	V541L (GTC→CTC)	narG →	nitrate reductase 1, alpha subunit
RA	833,168	T→C	13.3%	G542G (GGT→GGC)	narG →	nitrate reductase 1, alpha subunit
RA	833,171	G→A	10.9%	A543A (GCG→GCA)	narG →	nitrate reductase 1, alpha subunit
RA	833,174	G→T	10.8%	G544G (GGG→GGT)	narG →	nitrate reductase 1, alpha subunit
RA	833,175	C→G	10.5%	L545V (CTG→GTG) ‡	narG →	nitrate reductase 1, alpha subunit
RA	833,177	G→T	10.7%	L545L (CTG→CTT) ‡	narG →	nitrate reductase 1, alpha subunit
RA	833,195	C→G	10.5%	L551L (CTC→CTG)	narG →	nitrate reductase 1, alpha subunit
RA	833,198	T→C	10.8%	D552D (GAT→GAC)	narG →	nitrate reductase 1, alpha subunit
RA	833,207	T→C	10.4%	Y555Y (TAT→TAC)	narG →	nitrate reductase 1, alpha subunit
RA	833,231	T→C	7.4%	I563I (ATT→ATC)	narG →	nitrate reductase 1, alpha subunit
RA	833,240	C→T	9.1%	G566G (GGC→GGT)	narG →	nitrate reductase 1, alpha subunit
RA	833,249	T→G	16.2%	G569G (GGT→GGG)	narG →	nitrate reductase 1, alpha subunit
RA	833,252	G→A	14.3%	Q570Q (CAG→CAA)	narG →	nitrate reductase 1, alpha subunit
RA	833,258	G→T	15.8%	G572G (GGG→GGT)	narG →	nitrate reductase 1, alpha subunit
RA	833,270	G→A	14.6%	A576A (GCG→GCA)	narG →	nitrate reductase 1, alpha subunit
RA	833,279	A→C	15.4%	V579V (GTA→GTC)	narG →	nitrate reductase 1, alpha subunit
RA	833,282	T→C	15.0%	G580G (GGT→GGC)	narG →	nitrate reductase 1, alpha subunit
RA	833,843	T→C	6.8%	D767D (GAT→GAC)	narG →	nitrate reductase 1, alpha subunit
RA	833,847	G→C	8.9%	V769L (GTG→CTG)	narG →	nitrate reductase 1, alpha subunit
RA	833,852	T→G	6.1%	V770V (GTT→GTG)	narG →	nitrate reductase 1, alpha subunit
RA	833,858	G→C	7.6%	L772L (CTG→CTC)	narG →	nitrate reductase 1, alpha subunit
RA	833,867	T→C	13.4%	R775R (CGT→CGC)	narG →	nitrate reductase 1, alpha subunit
RA	833,868	C→A	13.4%	L776M (CTG→ATG)	narG →	nitrate reductase 1, alpha subunit
RA	833,873	G→C	15.1%	S777S (TCG→TCC)	narG →	nitrate reductase 1, alpha subunit
RA	833,876	C→T	12.5%	S778S (AGC→AGT)	narG →	nitrate reductase 1, alpha subunit
RA	833,882	T→C	14.3%	C780C (TGT→TGC)	narG →	nitrate reductase 1, alpha subunit
RA	833,885	C→G	14.3%	L781L (CTC→CTG)	narG →	nitrate reductase 1, alpha subunit
RA	833,887	A→T	14.4%	Y782F (TAT→TTT) ‡	narG →	nitrate reductase 1, alpha subunit
RA	833,888	T→C	15.1%	Y782Y (TAT→TAC) ‡	narG →	nitrate reductase 1, alpha subunit
RA	833,894	C→T	20.0%	D784D (GAC→GAT)	narG →	nitrate reductase 1, alpha subunit
RA	833,898	A→G	20.0%	I786V (ATT→GTT)	narG →	nitrate reductase 1, alpha subunit
RA	833,901	T→C	28.1%	L787L (TTG→CTG)	narG →	nitrate reductase 1, alpha subunit
RA	833,906	G→C	28.8%	P788P (CCG→CCC)	narG →	nitrate reductase 1, alpha subunit
RA	833,909	G→C	29.3%	T789T (ACG→ACC)	narG →	nitrate reductase 1, alpha subunit
RA	833,912	G→C	28.9%	A790A (GCG→GCC)	narG →	nitrate reductase 1, alpha subunit
RA	833,933	C→T	36.2%	D797D (GAC→GAT)	narG →	nitrate reductase 1, alpha subunit
RA	833,939	T→C	35.1%	N799N (AAT→AAC)	narG →	nitrate reductase 1, alpha subunit
RA	833,942	T→C	35.7%	T800T (ACT→ACC)	narG →	nitrate reductase 1, alpha subunit
RA	833,966	C→T	34.2%	H808H (CAC→CAT)	narG →	nitrate reductase 1, alpha subunit
RA	833,972	G→T	41.3%	L810L (CTG→CTT)	narG →	nitrate reductase 1, alpha subunit
RA	833,993	C→G	33.3%	A817A (GCC→GCG)	narG →	nitrate reductase 1, alpha subunit
RA	834,000	G→T	31.0%	A820S (GCG→TCG) ‡	narG →	nitrate reductase 1, alpha subunit
RA	834,002	G→A	30.4%	A820A (GCG→GCA) ‡	narG →	nitrate reductase 1, alpha subunit
RA	834,003	A→C	28.6%	K821Q (AAA→CAA) ‡	narG →	nitrate reductase 1, alpha subunit
RA	834,004	A→G	28.6%	K821R (AAA→AGA) ‡	narG →	nitrate reductase 1, alpha subunit
RA	834,005	A→C	28.6%	K821N (AAA→AAC) ‡	narG →	nitrate reductase 1, alpha subunit
RA	834,028	C→G	19.2%	A829G (GCC→GGC) ‡	narG →	nitrate reductase 1, alpha subunit
RA	834,029	C→T	19.2%	A829A (GCC→GCT) ‡	narG →	nitrate reductase 1, alpha subunit
RA	834,182	T→C	15.9%	G880G (GGT→GGC)	narG →	nitrate reductase 1, alpha subunit
RA	834,194	A→G	18.4%	P884P (CCA→CCG)	narG →	nitrate reductase 1, alpha subunit
RA	834,195	C→A	18.4%	H885N (CAC→AAC) ‡	narG →	nitrate reductase 1, alpha subunit
RA	834,197	C→T	18.4%	H885H (CAC→CAT) ‡	narG →	nitrate reductase 1, alpha subunit
RA	834,201	A→G	20.0%	M887V (ATG→GTG)	narG →	nitrate reductase 1, alpha subunit
RA	834,205	T→C	20.0%	V888A (GTC→GCC) ‡	narG →	nitrate reductase 1, alpha subunit
RA	834,206	C→G	20.1%	V888V (GTC→GTG) ‡	narG →	nitrate reductase 1, alpha subunit
RA	834,209	A→G	21.4%	V889V (GTA→GTG)	narG →	nitrate reductase 1, alpha subunit
RA	834,218	T→C	22.9%	D892D (GAT→GAC)	narG →	nitrate reductase 1, alpha subunit
RA	834,221	T→C	22.9%	Y893Y (TAT→TAC)	narG →	nitrate reductase 1, alpha subunit
RA	834,224	G→T	23.7%	P894P (CCG→CCT)	narG →	nitrate reductase 1, alpha subunit
RA	834,227	G→T	23.3%	A895A (GCG→GCT)	narG →	nitrate reductase 1, alpha subunit
RA	834,230	T→G	23.2%	T896T (ACT→ACG)	narG →	nitrate reductase 1, alpha subunit
RA	834,233	C→T	23.6%	Y897Y (TAC→TAT)	narG →	nitrate reductase 1, alpha subunit
RA	834,248	T→G	14.3%	S902S (TCT→TCG)	narG →	nitrate reductase 1, alpha subunit
RA	834,249	A→C	14.6%	I903L (ATC→CTC)	narG →	nitrate reductase 1, alpha subunit
RA	834,440	G→T	13.9%	Q966H (CAG→CAT)	narG →	nitrate reductase 1, alpha subunit
RA	834,443	A→T	13.5%	V967V (GTA→GTT)	narG →	nitrate reductase 1, alpha subunit
RA	834,446	C→A	12.9%	A968A (GCC→GCA)	narG →	nitrate reductase 1, alpha subunit
RA	834,449	G→C	12.7%	V969V (GTG→GTC)	narG →	nitrate reductase 1, alpha subunit
RA	834,482	T→G	17.1%	G980G (GGT→GGG)	narG →	nitrate reductase 1, alpha subunit
RA	834,485	T→C	17.4%	R981R (CGT→CGC)	narG →	nitrate reductase 1, alpha subunit
RA	834,488	C→A	17.3%	D982E (GAC→GAA)	narG →	nitrate reductase 1, alpha subunit
RA	834,494	G→C	21.7%	T984T (ACG→ACC)	narG →	nitrate reductase 1, alpha subunit
RA	834,507	A→C	35.3%	N989H (AAT→CAT) ‡	narG →	nitrate reductase 1, alpha subunit
RA	834,509	T→C	37.5%	N989N (AAT→AAC) ‡	narG →	nitrate reductase 1, alpha subunit
RA	834,515	A→G	42.9%	E991E (GAA→GAG)	narG →	nitrate reductase 1, alpha subunit
RA	834,527	C→T	45.9%	I995I (ATC→ATT)	narG →	nitrate reductase 1, alpha subunit
RA	834,533	C→T	43.1%	F997F (TTC→TTT)	narG →	nitrate reductase 1, alpha subunit
RA	834,548	A→G	34.5%	A1002A (GCA→GCG)	narG →	nitrate reductase 1, alpha subunit
RA	834,557	C→T	30.3%	R1005R (CGC→CGT)	narG →	nitrate reductase 1, alpha subunit
RA	834,575	G→C	27.0%	P1011P (CCG→CCC)	narG →	nitrate reductase 1, alpha subunit
RA	834,584	T→C	19.1%	S1014S (TCT→TCC)	narG →	nitrate reductase 1, alpha subunit
RA	834,594	G→A	21.7%	D1018N (GAT→AAT) ‡	narG →	nitrate reductase 1, alpha subunit
RA	834,595	A→G	21.0%	D1018G (GAT→GGT) ‡	narG →	nitrate reductase 1, alpha subunit
RA	834,596	T→C	22.0%	D1018D (GAT→GAC) ‡	narG →	nitrate reductase 1, alpha subunit
RA	834,599	A→T	23.9%	E1019D (GAA→GAT)	narG →	nitrate reductase 1, alpha subunit
RA	834,605	T→C	25.7%	V1021V (GTT→GTC)	narG →	nitrate reductase 1, alpha subunit
RA	834,608	T→C	26.1%	S1022S (TCT→TCC)	narG →	nitrate reductase 1, alpha subunit
RA	834,611	C→T	26.8%	Y1023Y (TAC→TAT)	narG →	nitrate reductase 1, alpha subunit
RA	834,617	C→G	27.5%	A1025A (GCC→GCG)	narG →	nitrate reductase 1, alpha subunit
RA	834,620	T→A	28.6%	G1026G (GGT→GGA)	narG →	nitrate reductase 1, alpha subunit
RA	834,635	C→T	20.5%	H1031H (CAC→CAT)	narG →	nitrate reductase 1, alpha subunit
RA	834,639	C→T	20.0%	L1033L (CTG→TTG) ‡	narG →	nitrate reductase 1, alpha subunit
RA	834,641	G→A	20.1%	L1033L (CTG→CTA) ‡	narG →	nitrate reductase 1, alpha subunit
RA	834,644	C→T	18.7%	I1034I (ATC→ATT)	narG →	nitrate reductase 1, alpha subunit
RA	834,647	A→G	19.0%	P1035P (CCA→CCG)	narG →	nitrate reductase 1, alpha subunit
RA	834,653	T→C	18.5%	R1037R (CGT→CGC)	narG →	nitrate reductase 1, alpha subunit
RA	834,659	C→G	20.8%	L1039L (CTC→CTG)	narG →	nitrate reductase 1, alpha subunit
RA	834,662	T→G	20.8%	S1040S (TCT→TCG)	narG →	nitrate reductase 1, alpha subunit
RA	834,665	T→A	18.6%	G1041G (GGT→GGA)	narG →	nitrate reductase 1, alpha subunit
RA	834,668	T→C	18.6%	R1042R (CGT→CGC)	narG →	nitrate reductase 1, alpha subunit
RA	834,674	A→G	16.4%	Q1044Q (CAA→CAG)	narG →	nitrate reductase 1, alpha subunit
RA	834,677	G→C	17.1%	L1045L (CTG→CTC)	narG →	nitrate reductase 1, alpha subunit
RA	834,689	C→T	17.6%	H1049H (CAC→CAT)	narG →	nitrate reductase 1, alpha subunit
RA	834,691	A→C	18.6%	Q1050P (CAG→CCG)	narG →	nitrate reductase 1, alpha subunit
RA	834,703	A→C	18.6%	D1054A (GAT→GCT)	narG →	nitrate reductase 1, alpha subunit
RA	834,707	C→T	19.7%	F1055F (TTC→TTT)	narG →	nitrate reductase 1, alpha subunit
RA	834,720	C→G	11.4%	L1060V (CTG→GTG)	narG →	nitrate reductase 1, alpha subunit
RA	834,724	T→C	10.4%	V1061A (GTT→GCT)	narG →	nitrate reductase 1, alpha subunit
RA	834,731	T→C	8.3%	R1063R (CGT→CGC)	narG →	nitrate reductase 1, alpha subunit
RA	834,737	G→T	10.3%	P1065P (CCG→CCT)	narG →	nitrate reductase 1, alpha subunit
RA	834,827	G→A	15.6%	K1095K (AAG→AAA)	narG →	nitrate reductase 1, alpha subunit
RA	834,833	T→C	16.0%	G1097G (GGT→GGC)	narG →	nitrate reductase 1, alpha subunit
RA	834,836	C→T	14.5%	I1098I (ATC→ATT)	narG →	nitrate reductase 1, alpha subunit
RA	834,842	C→A	14.4%	S1100S (TCC→TCA)	narG →	nitrate reductase 1, alpha subunit
RA	834,851	C→T	8.7%	S1103S (AGC→AGT)	narG →	nitrate reductase 1, alpha subunit
RA	834,854	C→A	7.3%	D1104E (GAC→GAA)	narG →	nitrate reductase 1, alpha subunit
RA	834,863	G→A	7.5%	L1107L (CTG→CTA)	narG →	nitrate reductase 1, alpha subunit
RA	834,971	T→C	7.4%	G1143G (GGT→GGC)	narG →	nitrate reductase 1, alpha subunit
RA	834,974	T→G	8.3%	A1144A (GCT→GCG)	narG →	nitrate reductase 1, alpha subunit
RA	834,986	T→C	12.8%	R1148R (CGT→CGC)	narG →	nitrate reductase 1, alpha subunit
RA	834,992	T→G	14.4%	V1150V (GTT→GTG)	narG →	nitrate reductase 1, alpha subunit
RA	835,001	G→A	15.6%	Q1153Q (CAG→CAA)	narG →	nitrate reductase 1, alpha subunit
RA	835,007	T→A	15.9%	V1155V (GTT→GTA)	narG →	nitrate reductase 1, alpha subunit
RA	835,011	G→C	16.7%	A1157P (GCA→CCA) ‡	narG →	nitrate reductase 1, alpha subunit
RA	835,013	A→G	16.5%	A1157A (GCA→GCG) ‡	narG →	nitrate reductase 1, alpha subunit
RA	835,016	G→C	16.6%	G1158G (GGG→GGC)	narG →	nitrate reductase 1, alpha subunit
RA	835,031	C→T	16.0%	Y1163Y (TAC→TAT)	narG →	nitrate reductase 1, alpha subunit
RA	835,037	G→C	10.3%	A1165A (GCG→GCC)	narG →	nitrate reductase 1, alpha subunit
RA	835,046	T→C	5.1%	R1168R (CGT→CGC)	narG →	nitrate reductase 1, alpha subunit
RA	835,178	T→C	18.5%	Y1212Y (TAT→TAC)	narG →	nitrate reductase 1, alpha subunit
RA	835,187	A→C	18.6%	V1215V (GTA→GTC)	narG →	nitrate reductase 1, alpha subunit
RA	835,190	T→A	19.1%	G1216G (GGT→GGA)	narG →	nitrate reductase 1, alpha subunit
RA	835,193	T→G	19.0%	S1217S (TCT→TCG)	narG →	nitrate reductase 1, alpha subunit
RA	835,208	T→C	15.3%	F1222F (TTT→TTC)	narG →	nitrate reductase 1, alpha subunit
RA	835,209	G→A	15.3%	V1223I (GTT→ATT) ‡	narG →	nitrate reductase 1, alpha subunit
RA	835,211	T→C	15.3%	V1223V (GTT→GTC) ‡	narG →	nitrate reductase 1, alpha subunit
RA	835,212	G→A	15.3%	V1224I (GTA→ATA) ‡	narG →	nitrate reductase 1, alpha subunit
RA	835,214	A→G	13.0%	V1224V (GTA→GTG) ‡	narG →	nitrate reductase 1, alpha subunit
RA	835,215	G→A	13.0%	V1225M (GTG→ATG) ‡	narG →	nitrate reductase 1, alpha subunit
RA	835,217	G→C	13.2%	V1225V (GTG→GTC) ‡	narG →	nitrate reductase 1, alpha subunit
RA	835,220	T→C	13.5%	R1226R (CGT→CGC)	narG →	nitrate reductase 1, alpha subunit
RA	835,233	A→G	22.0%	I1231V (ATT→GTT)	narG →	nitrate reductase 1, alpha subunit
RA	835,236	G→A	22.6%	D1232N (GAC→AAC)	narG →	nitrate reductase 1, alpha subunit
RA	835,242	T→C	13.9%	L1234L (TTA→CTA) ‡	narG →	nitrate reductase 1, alpha subunit
RA	835,244	A→G	14.1%	L1234L (TTA→TTG) ‡	narG →	nitrate reductase 1, alpha subunit
RA	835,249	G→A	13.4%	G1236D (GGC→GAC) ‡	narG →	nitrate reductase 1, alpha subunit
RA	835,250	C→T	12.9%	G1236G (GGC→GGT) ‡	narG →	nitrate reductase 1, alpha subunit
RA	835,256	C→T	12.6%	G1238G (GGC→GGT)	narG →	nitrate reductase 1, alpha subunit
RA	835,257	A→C	12.5%	N1239H (AAT→CAT) ‡	narG →	nitrate reductase 1, alpha subunit
RA	835,258	A→G	12.5%	N1239S (AAT→AGT) ‡	narG →	nitrate reductase 1, alpha subunit
RA	835,259	T→C	12.6%	N1239N (AAT→AAC) ‡	narG →	nitrate reductase 1, alpha subunit
RA	835,262	C→T	12.6%	D1240D (GAC→GAT)	narG →	nitrate reductase 1, alpha subunit
RA	835,275	Δ1 bp	18.7%	coding (3733/3744 nt)	narG →	nitrate reductase 1, alpha subunit
RA	835,278:1	+A	17.1%	coding (3736/3744 nt)	narG →	nitrate reductase 1, alpha subunit
RA	835,279	T→A	18.2%	V1246E (GTA→GAA)	narG →	nitrate reductase 1, alpha subunit
RA	835,291	T→C	26.8%	I3I (ATT→ATC)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,315	G→T	36.3%	L11L (CTG→CTT)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,318	T→C	37.5%	N12N (AAT→AAC)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,324	T→C	40.6%	D14D (GAT→GAC)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,327	G→A	39.4%	K15K (AAG→AAA)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,330	C→T	38.9%	C16C (TGC→TGT)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,342	C→T	39.2%	H20H (CAC→CAT)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,351	A→G	30.9%	S23S (TCA→TCG)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,354	T→G	29.6%	V24V (GTT→GTG)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,376	A→G	24.9%	S32G (AGC→GGC) ‡	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,378	C→G	25.2%	S32R (AGC→AGG) ‡	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,381	T→C	24.9%	R33R (CGT→CGC)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,388	G→A	21.3%	V36M (GTG→ATG)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,393	A→G	21.5%	E37E (GAA→GAG)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,396	T→C	21.5%	Y38Y (TAT→TAC)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,399	G→A	20.3%	A39A (GCG→GCA)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,405	C→T	18.3%	F41F (TTC→TTT)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,414	G→C	9.6%	V44V (GTG→GTC)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,768	C→G	12.7%	D162E (GAC→GAG)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,769	A→G	12.7%	N163D (AAC→GAC) ‡	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,770	A→C	12.8%	N163T (AAC→ACC) ‡	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,774	C→G	15.1%	I164M (ATC→ATG)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,777	G→A	13.3%	Q165Q (CAG→CAA)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,782	C→A	13.0%	A167E (GCG→GAG)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,789	T→C	14.3%	Y169Y (TAT→TAC)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,790	A→G	14.3%	S170G (AGC→GGC) ‡	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,792	C→G	12.3%	S170R (AGC→AGG) ‡	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,798	C→T	13.9%	F172F (TTC→TTT)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,819	T→C	19.6%	Y179Y (TAT→TAC)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,820	T→C	19.6%	L180L (TTG→CTG)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,846	G→C	20.9%	L188L (CTG→CTC)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,848:1	+T	21.3%	coding (566/1539 nt)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,852	G→A	21.6%	P190P (CCG→CCA)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,855	Δ1 bp	22.2%	coding (573/1539 nt)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,858	T→C	25.8%	C192C (TGT→TGC)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,873	G→A	28.8%	P197P (CCG→CCA)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,879	T→C	26.4%	G199G (GGT→GGC)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,882	G→T	25.3%	A200A (GCG→GCT)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,885	T→C	24.2%	I201I (ATT→ATC)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,891	G→A	22.0%	K203K (AAG→AAA)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,894	T→C	15.9%	R204R (CGT→CGC)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,903	T→C	12.5%	D207D (GAT→GAC)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,909	C→T	14.4%	I209I (ATC→ATT)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,912	C→G	14.6%	V210V (GTC→GTG)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,918	C→T	14.8%	I212I (ATC→ATT)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,921	C→T	15.0%	D213D (GAC→GAT)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,946	A→T	22.4%	M222L (ATG→TTG)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,954	C→A	24.2%	I224I (ATC→ATA)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,956	C→G	24.2%	T225S (ACT→AGT) ‡	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,957	T→C	24.2%	T225T (ACT→ACC) ‡	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,960	A→T	24.5%	G226G (GGA→GGT)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,963	C→T	27.6%	C227C (TGC→TGT)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,993	G→A	25.0%	K237K (AAG→AAA)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	835,999	T→C	22.8%	G239G (GGT→GGC)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	836,005	T→A	23.0%	S241S (TCT→TCA)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	836,008	G→A	17.2%	E242E (GAG→GAA)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	836,011	G→A	17.2%	K243K (AAG→AAA)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	836,047	G→A	14.5%	Q255Q (CAG→CAA)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	836,302	G→A	34.1%	A340A (GCG→GCA)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	836,305	G→A	33.3%	L341L (CTG→CTA)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	836,309	C→T	33.3%	L343L (CTG→TTG)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	836,314	T→C	32.0%	H344H (CAT→CAC)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	836,317	G→T	32.0%	P345P (CCG→CCT)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	836,323	T→C	29.6%	Y347Y (TAT→TAC)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	836,329	A→C	31.4%	T349T (ACA→ACC)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	836,350	G→T	21.9%	V356V (GTG→GTT)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	836,353	G→T	22.0%	P357P (CCG→CCT)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	836,356	T→G	22.1%	P358P (CCT→CCG)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	836,362	T→A	16.7%	S360S (TCT→TCA)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	836,443	A→G	23.9%	V387V (GTA→GTG)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	836,446	G→A	22.0%	Q388Q (CAG→CAA)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	836,452	G→C	25.0%	L390L (CTG→CTC)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	836,455	G→C	25.0%	A391A (GCG→GCC)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	836,459	C→A	27.6%	L393M (CTG→ATG)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	836,462	C→T	27.6%	L394L (CTG→TTG)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	836,466	C→G	24.9%	T395S (ACC→AGC) ‡	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	836,467	C→T	25.0%	T395T (ACC→ACT) ‡	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	836,473	T→C	24.5%	G397G (GGT→GGC)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	836,480	A→G	16.1%	K400E (AAA→GAA) ‡	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	836,481	A→G	16.1%	K400R (AAA→AGA) ‡	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	836,482	A→T	16.1%	K400N (AAA→AAT) ‡	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	836,494	C→G	8.0%	R404R (CGC→CGG)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	836,497	A→G	7.4%	A405A (GCA→GCG)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	836,612	T→C	22.2%	Y444H (TAC→CAC)	narH →	nitrate reductase 1, beta (Fe‑S) subunit
RA	837,036	A→G	11.5%	S73S (TCA→TCG)	narJ →	molybdenum‑cofactor‑assembly chaperone subunit (delta subunit) of nitrate reductase 1
RA	837,040	T→C	12.0%	L75L (TTG→CTG)	narJ →	molybdenum‑cofactor‑assembly chaperone subunit (delta subunit) of nitrate reductase 1
RA	837,048	T→C	17.6%	F77F (TTT→TTC)	narJ →	molybdenum‑cofactor‑assembly chaperone subunit (delta subunit) of nitrate reductase 1
RA	837,057	G→T	21.7%	V80V (GTG→GTT)	narJ →	molybdenum‑cofactor‑assembly chaperone subunit (delta subunit) of nitrate reductase 1
RA	837,060	C→T	20.0%	H81H (CAC→CAT)	narJ →	molybdenum‑cofactor‑assembly chaperone subunit (delta subunit) of nitrate reductase 1
RA	837,062	G→C	20.0%	G82A (GGC→GCC)	narJ →	molybdenum‑cofactor‑assembly chaperone subunit (delta subunit) of nitrate reductase 1
RA	837,066	A→G	23.4%	E83E (GAA→GAG)	narJ →	molybdenum‑cofactor‑assembly chaperone subunit (delta subunit) of nitrate reductase 1
RA	837,075	C→T	20.7%	D86D (GAC→GAT)	narJ →	molybdenum‑cofactor‑assembly chaperone subunit (delta subunit) of nitrate reductase 1
RA	837,087	G→A	20.4%	A90A (GCG→GCA)	narJ →	molybdenum‑cofactor‑assembly chaperone subunit (delta subunit) of nitrate reductase 1
RA	837,193	C→T	27.8%	Q126* (CAA→TAA)	narJ →	molybdenum‑cofactor‑assembly chaperone subunit (delta subunit) of nitrate reductase 1
RA	837,716	T→C	12.2%	F63F (TTT→TTC)	narI →	nitrate reductase 1, gamma (cytochrome b(NR)) subunit
RA	837,722	T→G	12.8%	G65G (GGT→GGG)	narI →	nitrate reductase 1, gamma (cytochrome b(NR)) subunit
RA	837,728	C→G	12.7%	F67L (TTC→TTG)	narI →	nitrate reductase 1, gamma (cytochrome b(NR)) subunit
RA	837,734	T→C	13.1%	G69G (GGT→GGC)	narI →	nitrate reductase 1, gamma (cytochrome b(NR)) subunit
RA	837,738	C→T	11.9%	L71L (CTG→TTG) ‡	narI →	nitrate reductase 1, gamma (cytochrome b(NR)) subunit
RA	837,740	G→A	11.6%	L71L (CTG→CTA) ‡	narI →	nitrate reductase 1, gamma (cytochrome b(NR)) subunit
RA	845,737	T→C	15.5%	Y178H (TAC→CAC)	tdk →	thymidine kinase/deoxyuridine kinase
RA	871,512	T→C	10.4%	I504T (ATT→ACT)	topA →	DNA topoisomerase I, omega subunit
RA	890,121	T→C	28.6%	intergenic (‑128/+240)	fabI ← / ← ycjD	enoyl‑[acyl‑carrier‑protein] reductase, NADH‑dependent/conserved hypothetical protein
RA	910,889	G→A	20.0%	K43K (AAG→AAA)	ycjV →	predicted sugar transporter subunit
RA	910,895	C→T	22.3%	T45T (ACC→ACT)	ycjV →	predicted sugar transporter subunit
RA	910,896	A→T	22.3%	T46S (ACC→TCC) ‡	ycjV →	predicted sugar transporter subunit
RA	910,897	C→T	22.8%	T46I (ACC→ATC) ‡	ycjV →	predicted sugar transporter subunit
RA	910,898	C→A	22.8%	T46T (ACC→ACA) ‡	ycjV →	predicted sugar transporter subunit
RA	910,923	G→A	31.3%	E55K (GAG→AAG) ‡	ycjV →	predicted sugar transporter subunit
RA	910,924	A→C	31.4%	E55A (GAG→GCG) ‡	ycjV →	predicted sugar transporter subunit
RA	910,930	G→C	27.0%	S57T (AGC→ACC)	ycjV →	predicted sugar transporter subunit
RA	910,932	G→A	27.0%	G58S (GGC→AGC)	ycjV →	predicted sugar transporter subunit
RA	910,940	T→C	22.5%	D60D (GAT→GAC)	ycjV →	predicted sugar transporter subunit
RA	910,946	G→C	14.8%	L62F (TTG→TTC)	ycjV →	predicted sugar transporter subunit
RA	910,951	A→G	6.7%	D64G (GAC→GGC) ‡	ycjV →	predicted sugar transporter subunit
RA	910,952	C→T	6.9%	D64D (GAC→GAT) ‡	ycjV →	predicted sugar transporter subunit
RA	910,954	G→A	6.7%	G65D (GGC→GAC) ‡	ycjV →	predicted sugar transporter subunit
RA	910,955	C→G	6.7%	G65G (GGC→GGG) ‡	ycjV →	predicted sugar transporter subunit
RA	917,592	A→G	31.2%	L311L (TTA→TTG)	tyrR →	DNA‑binding transcriptional dual regulator, tyrosine‑binding
RA	922,063	C→T	23.8%	R45* (CGA→TGA)	ycjZ →	predicted DNA‑binding transcriptional regulator
RA	943,008	A→G	8.4%	L45S (TTA→TCA)	ddpF ←	D‑Ala‑D‑Ala transporter subunit
RA	965,844	A→T	53.5%	V17D (GTT→GAT)	ydeM ←	conserved hypothetical protein
RA	974,990	A→T	54.6%	intergenic (+742/+250)	lsrB → / ← ydeH	AI2 transporter/conserved hypothetical protein
RA	975,257:1	+A	43.5%	coding (358/375 nt)	ydeH ←	conserved hypothetical protein
RA	980,208	A→G	39.7%	Y33H (TAT→CAT)	cspI ←	cold shock protein
RA	980,233	T→A	7.7%	K24N (AAA→AAT) ‡	cspI ←	cold shock protein
RA	980,235	T→C	10.9%	K24E (AAA→GAA) ‡	cspI ←	cold shock protein
RA	980,236	C→A	10.6%	P23P (CCG→CCT)	cspI ←	cold shock protein
RA	980,239	C→A	12.0%	T22T (ACG→ACT)	cspI ←	cold shock protein
RA	980,245	G→A	8.7%	F20F (TTC→TTT)	cspI ←	cold shock protein
RA	980,248	A→G	12.8%	G19G (GGT→GGC)	cspI ←	cold shock protein
RA	980,260	T→A	12.3%	E15D (GAA→GAT)	cspI ←	cold shock protein
RA	980,263	A→T	5.4%	P14P (CCT→CCA) ‡	cspI ←	cold shock protein
RA	980,265	G→C	18.2%	P14A (CCT→GCT) ‡	cspI ←	cold shock protein
RA	980,278	C→T	14.8%	V9V (GTG→GTA)	cspI ←	cold shock protein
RA	981,683	Δ1 bp	17.2%	coding (11/533 nt)	ydfQ ←	predicted lysozyme
RA	982,587	T→C	17.1%	S11S (TCT→TCC)	ydfA →	hypothetical protein
RA	982,595	A→G	18.8%	Y14C (TAC→TGC)	ydfA →	hypothetical protein
RA	982,605	T→C	22.3%	F17F (TTT→TTC)	ydfA →	hypothetical protein
RA	982,608	A→C	22.9%	P18P (CCA→CCC)	ydfA →	hypothetical protein
RA	982,617	C→T	27.5%	D21D (GAC→GAT)	ydfA →	hypothetical protein
RA	982,620	C→A	28.5%	G22G (GGC→GGA)	ydfA →	hypothetical protein
RA	982,629	C→T	29.6%	T25T (ACC→ACT)	ydfA →	hypothetical protein
RA	982,632	A→C	28.3%	A26A (GCA→GCC)	ydfA →	hypothetical protein
RA	982,656	G→A	23.0%	T34T (ACG→ACA)	ydfA →	hypothetical protein
RA	982,670	A→C	19.1%	N39T (AAT→ACT)	ydfA →	hypothetical protein
RA	983,505	T→C	16.3%	intergenic (+417/‑151)	ydfC → / → dicB	hypothetical protein/cell division inhibition protein
RA	983,519	G→A	14.9%	intergenic (+431/‑137)	ydfC → / → dicB	hypothetical protein/cell division inhibition protein
RA	983,528	C→T	14.6%	intergenic (+440/‑128)	ydfC → / → dicB	hypothetical protein/cell division inhibition protein
RA	1,008,267	C→T	21.4%	C340C (TGC→TGT)	ydgI →	predicted arginine/ornithine antiporter transporter
RA	1,009,234	G→A	15.1%	D190N (GAT→AAT)	folM →	dihydrofolate reductase isozyme
RA	1,014,482	A→G	21.4%	D529D (GAT→GAC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,488	C→G	25.8%	V527V (GTG→GTC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,491	A→C	26.7%	L526L (CTT→CTG)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,515	C→T	27.3%	V518V (GTG→GTA)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,521	A→G	27.3%	I516I (ATT→ATC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,533	G→A	25.0%	A512A (GCC→GCT)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,611	A→G	22.9%	G486G (GGT→GGC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,617	A→G	25.4%	S484S (AGT→AGC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,620	G→A	24.5%	G483G (GGC→GGT)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,623	A→G	24.6%	L482L (CTT→CTC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,644	T→A	44.9%	K475N (AAA→AAT) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,646	T→G	44.9%	K475Q (AAA→CAA) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,650	G→C	42.9%	A473A (GCC→GCG)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,653	A→G	41.2%	D472D (GAT→GAC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,656	C→G	37.2%	T471T (ACG→ACC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,659	C→A	38.7%	V470V (GTG→GTT)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,668	G→A	39.1%	S467S (AGC→AGT)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,677	G→A	29.6%	G464G (GGC→GGT)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,698	A→G	24.2%	S457S (AGT→AGC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,701	T→G	23.0%	G456G (GGA→GGC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,707	C→G	21.3%	Q454H (CAG→CAC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,710	C→G	20.5%	A453A (GCG→GCC) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,712	C→A	21.6%	A453S (GCG→TCG) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,719	T→C	20.7%	Q450Q (CAA→CAG) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,720	T→A	20.7%	Q450L (CAA→CTA) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,725	G→C	21.7%	V448V (GTC→GTG)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,728	A→G	20.7%	Y447Y (TAT→TAC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,731	A→G	18.6%	S446S (TCT→TCC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,734	A→G	13.6%	D445D (GAT→GAC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,764	A→T	22.2%	S435S (TCT→TCA)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,770	G→T	21.0%	S433S (TCC→TCA)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,773	G→T	20.5%	A432A (GCC→GCA) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,775	C→G	20.0%	A432P (GCC→CCC) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,782	T→G	20.0%	E429D (GAA→GAC) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,783	T→G	20.0%	E429A (GAA→GCA) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,785	C→A	19.5%	P428P (CCG→CCT)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,788	C→G	17.0%	T427T (ACG→ACC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,794	G→C	17.3%	A425A (GCC→GCG)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,812	A→G	12.3%	I419I (ATT→ATC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,818	A→G	10.7%	H417H (CAT→CAC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,839	C→A	10.6%	L410L (CTG→CTT)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,842	C→T	10.8%	G409G (GGG→GGA) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,843	C→T	12.1%	G409E (GGG→GAG) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,847	C→T	9.8%	E408K (GAA→AAA)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,852	T→G	10.3%	N406T (AAC→ACC) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,853	T→C	10.2%	N406D (AAC→GAC) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,854	A→G	10.8%	D405D (GAT→GAC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,857	C→A	12.1%	M404I (ATG→ATT)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,861	C→A	10.7%	R403L (CGG→CTG)	fumA ←	aerobic Class I fumarate hydratase
RA	1,014,872	T→C	6.3%	K399K (AAA→AAG)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,007	T→A	16.0%	G354G (GGA→GGT)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,010	C→G	15.7%	A353A (GCG→GCC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,013	T→C	15.1%	K352K (AAA→AAG) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,015	T→G	15.1%	K352Q (AAA→CAA) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,022	C→T	13.8%	E349E (GAG→GAA)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,027	C→G	12.1%	E348Q (GAA→CAA)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,028	C→T	12.0%	P347P (CCG→CCA)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,031	G→A	11.4%	I346I (ATC→ATT)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,034	A→G	12.7%	Y345Y (TAT→TAC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,037	T→C	13.4%	K344K (AAA→AAG) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,039	T→G	12.5%	K344Q (AAA→CAA) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,046	A→G	10.8%	N341N (AAT→AAC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,049	A→G	10.2%	H340H (CAT→CAC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,073	C→A	16.4%	G332G (GGG→GGT)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,076	C→T	16.4%	Q331Q (CAG→CAA) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,078	G→C	15.9%	Q331E (CAG→GAG) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,079	A→G	15.5%	R330R (CGT→CGC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,088	C→T	22.2%	K327K (AAG→AAA)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,097	G→A	21.9%	I324I (ATC→ATT)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,100	A→G	23.2%	N323N (AAT→AAC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,112	A→G	28.3%	S319S (TCT→TCC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,130	A→G	30.6%	G313G (GGT→GGC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,163	G→A	29.7%	R302R (CGC→CGT)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,166	A→G	29.1%	I301I (ATT→ATC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,169	C→A	26.9%	V300V (GTG→GTT)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,175	G→A	27.7%	I298I (ATC→ATT)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,184	A→C	27.9%	A295A (GCT→GCG)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,199	A→G	26.4%	G290G (GGT→GGC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,211	A→G	29.8%	G286G (GGT→GGC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,214	C→A	30.3%	L285L (CTG→CTT)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,220	A→G	23.6%	L283L (CTT→CTC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,223	A→T	17.0%	N282K (AAT→AAA)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,226	T→C	17.3%	Q281Q (CAA→CAG)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,229	C→G	10.9%	A280A (GCG→GCC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,232	T→C	9.5%	E279E (GAA→GAG)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,235	G→T	8.7%	I278I (ATC→ATA) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,236	A→T	8.8%	I278N (ATC→AAC) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,237	T→C	8.9%	I278V (ATC→GTC) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,243	A→G	10.9%	L276L (TTG→CTG)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,247	T→C	12.6%	K274K (AAA→AAG) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,249	T→G	12.7%	K274Q (AAA→CAA) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,256	T→C	12.3%	E271E (GAA→GAG) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,258	C→G	12.8%	E271Q (GAA→CAA) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,259	C→G	13.9%	V270V (GTG→GTC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,280	G→A	11.9%	H263H (CAC→CAT)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,283	C→T	11.6%	E262E (GAG→GAA)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,298	T→C	11.5%	P257P (CCA→CCG)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,451	C→G	16.6%	G206G (GGG→GGC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,454	C→G	16.7%	P205P (CCG→CCC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,457	C→A	14.7%	T204T (ACG→ACT)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,463	T→C	13.6%	L202L (TTA→TTG) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,465	A→G	13.2%	L202L (TTA→CTA) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,466	C→G	13.2%	A201A (GCG→GCC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,481	A→G	15.6%	Y196Y (TAT→TAC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,493	C→T	12.1%	K192K (AAG→AAA)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,499	T→G	10.0%	A190A (GCA→GCC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,502	C→A	11.0%	S189S (TCG→TCT)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,505	A→G	9.1%	G188G (GGT→GGC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,508	A→G	8.8%	G187G (GGT→GGC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,511	A→G	8.7%	G186G (GGT→GGC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,592	A→G	14.3%	N159N (AAT→AAC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,595	C→G	14.3%	V158V (GTG→GTC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,598	T→C	13.9%	E157E (GAA→GAG)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,604	A→G	16.6%	Y155Y (TAT→TAC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,610	A→G	18.2%	D153D (GAT→GAC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,618	G→C	20.9%	P151A (CCG→GCG)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,622	G→A	21.4%	N149N (AAC→AAT)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,625	T→C	23.2%	Q148Q (CAA→CAG)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,628	C→T	23.2%	S147S (TCG→TCA)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,631	G→A	24.4%	Y146Y (TAC→TAT)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,640	A→G	34.3%	N143N (AAT→AAC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,655	A→G	39.1%	T138T (ACT→ACC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,667	A→G	36.0%	G134G (GGT→GGC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,670	G→T	22.7%	R133R (CGC→CGA) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,671	C→T	22.7%	R133H (CGC→CAC) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,672	G→T	22.4%	R133S (CGC→AGC) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,675	C→A	21.7%	A132S (GCG→TCG)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,681	C→T	23.8%	A130T (GCG→ACG)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,682	C→T	23.8%	A129A (GCG→GCA) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,683	G→T	23.7%	A129E (GCG→GAG) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,694	A→G	18.4%	G125G (GGT→GGC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,697	A→G	21.4%	G124G (GGT→GGC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,706	T→C	14.3%	V121V (GTA→GTG)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,709	A→G	12.8%	R120R (CGT→CGC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,715	C→G	11.3%	G118G (GGG→GGC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,727	A→G	11.7%	V114V (GTT→GTC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,730	A→G	12.7%	I113I (ATT→ATC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,733	A→G	10.9%	I112I (ATT→ATC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,754	A→G	12.9%	C105C (TGT→TGC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,760	T→C	14.6%	P103P (CCA→CCG)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,766	A→C	16.4%	V101V (GTT→GTG)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,775	C→G	18.4%	A98A (GCG→GCC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,778	C→G	18.3%	A97A (GCG→GCC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,784	G→T	19.6%	D95E (GAC→GAA)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,793	A→T	18.2%	R92R (CGT→CGA) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,795	G→T	17.8%	R92S (CGT→AGT) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,796	C→T	17.8%	L91L (CTG→CTA) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,798	G→A	17.4%	L91L (CTG→TTG) ‡	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,814	A→G	21.0%	Y85Y (TAT→TAC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,817	T→C	20.3%	K84K (AAA→AAG)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,820	A→G	19.7%	D83D (GAT→GAC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,823	A→G	16.9%	N82N (AAT→AAC)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,835	C→T	14.3%	E78E (GAG→GAA)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,838	C→T	12.3%	P77P (CCG→CCA)	fumA ←	aerobic Class I fumarate hydratase
RA	1,015,841	G→A	10.6%	D76D (GAC→GAT)	fumA ←	aerobic Class I fumarate hydratase
RA	1,017,194	G→A	12.0%	A310T (GCA→ACA)	manA →	mannose‑6‑phosphate isomerase
RA	1,019,201	G→A	42.8%	intergenic (+150/+76)	ydgA → / ← uidC	conserved hypothetical protein/predicted outer membrane porin protein
RA	1,019,219:1	+C	17.2%	intergenic (+168/+58)	ydgA → / ← uidC	conserved hypothetical protein/predicted outer membrane porin protein
RA	1,026,302	C→A	10.8%	G190G (GGG→GGT)	malI ←	DNA‑binding transcriptional repressor
RA	1,032,910	T→C	25.4%	intergenic (+55/‑31)	ydgT → / → ydgK	predicted regulator/conserved inner membrane protein
RA	1,036,505	G→A	100%	A632A (GCG→GCA)	rsxC →	fused predicted 4Fe‑4S ferredoxin‑type protein
RA	1,041,581	G→A	18.7%	A374A (GCG→GCA)	ydgR →	predicted transporter
RA	1,045,790	C→T	20.0%	L99L (TTG→TTA)	ydhA ←	predicted lipoprotein
RA	1,050,725	T→C	25.4%	V305A (GTC→GCC)	ydhK →	conserved inner membrane protein
RA	1,071,158	A→G	28.8%	Y4C (TAT→TGT)	mdtK →	multidrug efflux system transporter
RA	1,080,002	G→A	14.1%	P507L (CCA→CTA)	ydhV ←	predicted oxidoreductase
RA	1,094,503	C→T	11.1%	G625D (GGC→GAC)	ydiJ ←	predicted FAD‑linked oxidoreductase
RA	1,102,502	T→C	7.1%	F42F (TTT→TTC)	aroD →	3‑dehydroquinate dehydratase
RA	1,143,545	A→T	5.5%	D663V (GAT→GTT)	katE →	hydroperoxidase HPII(III)
RA	1,179,532	T→C	43.5%	*328Q (TAA→CAA)	ansA →	cytoplasmic L‑asparaginase I
RA	1,191,074	A→C	55.8%	intergenic (+415/+485)	yeaJ → / ← rnd	predicted diguanylate cyclase/ribonuclease D
RA	1,191,560	T→C	68.4%	*116W (TGA→TGG)	rnd ←	ribonuclease D
RA	1,201,033	C→T	10.1%	T62T (ACC→ACT)	sdaA →	L‑serine deaminase I
RA	1,201,054	T→C	12.6%	G69G (GGT→GGC)	sdaA →	L‑serine deaminase I
RA	1,201,057	T→G	14.1%	L70L (CTT→CTG)	sdaA →	L‑serine deaminase I
RA	1,201,060	A→G	11.7%	A71A (GCA→GCG)	sdaA →	L‑serine deaminase I
RA	1,201,067	G→C	11.0%	E74Q (GAA→CAA) ‡	sdaA →	L‑serine deaminase I
RA	1,201,068	A→T	10.8%	E74V (GAA→GTA) ‡	sdaA →	L‑serine deaminase I
RA	1,201,069	A→G	10.8%	E74E (GAA→GAG) ‡	sdaA →	L‑serine deaminase I
RA	1,201,072	T→G	10.9%	P75P (CCT→CCG)	sdaA →	L‑serine deaminase I
RA	1,201,074	C→A	11.2%	A76D (GCC→GAC) ‡	sdaA →	L‑serine deaminase I
RA	1,201,075	C→T	11.2%	A76A (GCC→GCT) ‡	sdaA →	L‑serine deaminase I
RA	1,201,586	C→T	8.2%	L247L (CTG→TTG)	sdaA →	L‑serine deaminase I
RA	1,202,128	G→C	14.0%	T427T (ACG→ACC)	sdaA →	L‑serine deaminase I
RA	1,202,140	C→A	20.9%	T431T (ACC→ACA)	sdaA →	L‑serine deaminase I
RA	1,202,146	G→A	18.7%	K433K (AAG→AAA)	sdaA →	L‑serine deaminase I
RA	1,202,149	C→T	18.6%	D434D (GAC→GAT)	sdaA →	L‑serine deaminase I
RA	1,202,161	A→G	17.5%	K438K (AAA→AAG)	sdaA →	L‑serine deaminase I
RA	1,202,176	A→T	8.7%	S443S (TCA→TCT)	sdaA →	L‑serine deaminase I
RA	1,211,202	A→T	8.7%	V50V (GTT→GTA)	cspC ←	stress protein, member of the CspA‑family
RA	1,211,206	T→C	8.1%	N49S (AAC→AGC) ‡	cspC ←	stress protein, member of the CspA‑family
RA	1,211,207	T→G	8.0%	N49H (AAC→CAC) ‡	cspC ←	stress protein, member of the CspA‑family
RA	1,211,220	C→A	11.8%	L44L (CTG→CTT)	cspC ←	stress protein, member of the CspA‑family
RA	1,211,229	G→A	12.9%	F41F (TTC→TTT)	cspC ←	stress protein, member of the CspA‑family
RA	1,211,232	G→A	17.6%	G40G (GGC→GGT)	cspC ←	stress protein, member of the CspA‑family
RA	1,211,239	C→G	21.5%	G38A (GGT→GCT) ‡	cspC ←	stress protein, member of the CspA‑family
RA	1,211,240	C→T	23.8%	G38S (GGT→AGT) ‡	cspC ←	stress protein, member of the CspA‑family
RA	1,211,247	A→T	20.2%	A35A (GCT→GCA)	cspC ←	stress protein, member of the CspA‑family
RA	1,211,250	G→A	24.2%	S34S (TCC→TCT)	cspC ←	stress protein, member of the CspA‑family
RA	1,211,268	A→G	26.7%	D28D (GAT→GAC)	cspC ←	stress protein, member of the CspA‑family
RA	1,211,280	A→G	26.5%	D24D (GAT→GAC)	cspC ←	stress protein, member of the CspA‑family
RA	1,211,283	A→T	24.6%	A23A (GCT→GCA) ‡	cspC ←	stress protein, member of the CspA‑family
RA	1,211,284	G→T	27.0%	A23D (GCT→GAT) ‡	cspC ←	stress protein, member of the CspA‑family
RA	1,211,298	G→A	27.1%	G18G (GGC→GGT)	cspC ←	stress protein, member of the CspA‑family
RA	1,211,301	A→G	26.3%	F17F (TTT→TTC)	cspC ←	stress protein, member of the CspA‑family
RA	1,211,304	A→T	25.6%	G16G (GGT→GGA)	cspC ←	stress protein, member of the CspA‑family
RA	1,211,310	A→G	20.5%	S14S (TCT→TCC)	cspC ←	stress protein, member of the CspA‑family
RA	1,211,316	G→A	20.0%	N12N (AAC→AAT)	cspC ←	stress protein, member of the CspA‑family
RA	1,211,319	G→A	18.2%	F11F (TTC→TTT)	cspC ←	stress protein, member of the CspA‑family
RA	1,211,331	C→G	10.6%	Q7H (CAG→CAC) ‡	cspC ←	stress protein, member of the CspA‑family
RA	1,211,333	G→T	10.7%	Q7K (CAG→AAG) ‡	cspC ←	stress protein, member of the CspA‑family
RA	1,222,231	G→C	14.0%	G269A (GGT→GCT)	yebT →	conserved hypothetical protein
RA	1,250,792	A→C	54.1%	L167L (CTT→CTG)	ruvC ←	component of RuvABC resolvasome, endonuclease
RA	1,255,649	G→A	17.6%	A113A (GCG→GCA)	yecE →	conserved hypothetical protein
RA	1,258,382	A→T	19.4%	intergenic (+53/+112)	yecP → / ← torZ	predicted methyltransferase/trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,258,389	T→G	20.0%	intergenic (+60/+105)	yecP → / ← torZ	predicted methyltransferase/trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,258,404	C→T	11.3%	intergenic (+75/+90)	yecP → / ← torZ	predicted methyltransferase/trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,258,406	G→T	14.4%	intergenic (+77/+88)	yecP → / ← torZ	predicted methyltransferase/trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,258,410	Δ1 bp	11.3%	intergenic (+81/+84)	yecP → / ← torZ	predicted methyltransferase/trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,258,411	T→A	12.6%	intergenic (+82/+83)	yecP → / ← torZ	predicted methyltransferase/trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,258,414	G→T	12.1%	intergenic (+85/+80)	yecP → / ← torZ	predicted methyltransferase/trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,258,415	T→C	11.9%	intergenic (+86/+79)	yecP → / ← torZ	predicted methyltransferase/trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,258,429	A→G	9.5%	intergenic (+100/+65)	yecP → / ← torZ	predicted methyltransferase/trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,259,304	G→A	6.4%	N540N (AAC→AAT)	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,259,317	A→T	6.4%	F536Y (TTT→TAT)	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,259,319	T→G	6.7%	Q535H (CAA→CAC) ‡	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,259,320	T→C	6.6%	Q535R (CAA→CGA) ‡	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,259,322	C→T	6.7%	P534P (CCG→CCA)	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,259,325	A→C	7.1%	A533A (GCT→GCG) ‡	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,259,327	C→G	6.9%	A533P (GCT→CCT) ‡	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,259,328	A→C	7.3%	V532V (GTT→GTG)	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,259,331	A→C	6.9%	A531A (GCT→GCG) ‡	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,259,332	G→A	6.9%	A531V (GCT→GTT) ‡	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,259,334	C→T	6.9%	Q530Q (CAG→CAA)	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,259,349	A→C	18.9%	I525M (ATT→ATG) ‡	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,259,351	T→G	17.7%	I525L (ATT→CTT) ‡	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,259,358	G→A	17.8%	N522N (AAC→AAT)	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,259,361	G→A	16.5%	S521S (AGC→AGT)	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,259,379	C→G	13.3%	T515T (ACG→ACC)	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,259,382	C→G	12.7%	L514F (TTG→TTC) ‡	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,259,384	A→G	12.7%	L514L (TTG→CTG) ‡	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,259,385	G→A	12.6%	D513D (GAC→GAT)	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,259,391	G→A	12.0%	R511R (CGC→CGT)	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,259,400	C→A	10.4%	S508S (TCG→TCT)	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,259,799	T→C	12.5%	L375L (TTA→TTG)	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,259,805	C→T	16.4%	A373A (GCG→GCA)	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,259,808	C→T	16.4%	A372A (GCG→GCA)	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,259,817	C→G	19.2%	V369V (GTG→GTC)	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,259,820	C→G	20.0%	L368L (CTG→CTC) ‡	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,259,822	G→T	19.7%	L368M (CTG→ATG) ‡	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,259,838	T→C	22.2%	E362E (GAA→GAG)	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,259,845	T→A	20.8%	Y360F (TAT→TTT)	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,259,847	T→C	21.4%	Q359Q (CAA→CAG)	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,259,850	C→T	21.4%	Q358Q (CAG→CAA)	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,259,859	A→C	20.3%	I355M (ATT→ATG)	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,260,297	A→G	8.2%	V209V (GTT→GTC)	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,260,300	C→A	7.6%	Q208H (CAG→CAT) ‡	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,260,302	G→C	7.9%	Q208E (CAG→GAG) ‡	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,260,306	G→A	7.8%	N206N (AAC→AAT) ‡	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,260,308	T→G	8.6%	N206H (AAC→CAC) ‡	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,260,315	A→C	8.6%	I203M (ATT→ATG) ‡	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,260,317	T→C	8.9%	I203V (ATT→GTT) ‡	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,260,327	G→A	7.5%	S199S (TCC→TCT) ‡	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,260,329	A→T	7.5%	S199T (TCC→ACC) ‡	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,260,333	C→T	12.0%	Q197Q (CAG→CAA)	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,260,341	C→G	5.7%	E195Q (GAA→CAA)	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,260,348	C→T	14.3%	E192E (GAG→GAA)	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,260,351	T→C	14.0%	V191V (GTA→GTG) ‡	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,260,353	C→T	14.0%	V191I (GTA→ATA) ‡	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,260,354	A→C	13.8%	S190S (TCT→TCG)	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,260,363	C→T	14.3%	V187V (GTG→GTA)	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,260,366	A→G	14.0%	H186H (CAT→CAC) ‡	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,260,367	T→C	13.6%	H186R (CAT→CGT) ‡	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,260,374	T→G	13.0%	M184L (ATG→CTG)	torZ ←	trimethylamine N‑oxide reductase system III, catalytic subunit
RA	1,268,310	T→A	14.9%	I99F (ATC→TTC)	pgsA ←	phosphatidylglycerophosphate synthetase
RA	1,274,778	G→A	56.4%	S30N (AGC→AAC)	yodA →	conserved metal‑binding protein
RA	1,299,396	A→G	6.3%	intergenic (‑321/+169)	cobU ← / ← yeeX	bifunctional cobinamide kinase and cobinamide phosphate guanylyltransferase/conserved hypothetical protein
RA	1,299,400	A→G	6.9%	intergenic (‑325/+165)	cobU ← / ← yeeX	bifunctional cobinamide kinase and cobinamide phosphate guanylyltransferase/conserved hypothetical protein
RA	1,299,404	G→T	10.5%	intergenic (‑329/+161)	cobU ← / ← yeeX	bifunctional cobinamide kinase and cobinamide phosphate guanylyltransferase/conserved hypothetical protein
RA	1,299,417	A→G	13.8%	intergenic (‑342/+148)	cobU ← / ← yeeX	bifunctional cobinamide kinase and cobinamide phosphate guanylyltransferase/conserved hypothetical protein
RA	1,299,418	C→T	13.8%	intergenic (‑343/+147)	cobU ← / ← yeeX	bifunctional cobinamide kinase and cobinamide phosphate guanylyltransferase/conserved hypothetical protein
RA	1,299,421	G→A	13.8%	intergenic (‑346/+144)	cobU ← / ← yeeX	bifunctional cobinamide kinase and cobinamide phosphate guanylyltransferase/conserved hypothetical protein
RA	1,299,423	A→C	14.6%	intergenic (‑348/+142)	cobU ← / ← yeeX	bifunctional cobinamide kinase and cobinamide phosphate guanylyltransferase/conserved hypothetical protein
RA	1,299,439	A→G	13.9%	intergenic (‑364/+126)	cobU ← / ← yeeX	bifunctional cobinamide kinase and cobinamide phosphate guanylyltransferase/conserved hypothetical protein
RA	1,299,448	A→G	10.5%	intergenic (‑373/+117)	cobU ← / ← yeeX	bifunctional cobinamide kinase and cobinamide phosphate guanylyltransferase/conserved hypothetical protein
RA	1,299,487	G→A	30.8%	intergenic (‑412/+78)	cobU ← / ← yeeX	bifunctional cobinamide kinase and cobinamide phosphate guanylyltransferase/conserved hypothetical protein
RA	1,300,414	A→G	30.6%	I237I (ATT→ATC)	yeeA ←	conserved inner membrane protein
RA	1,304,455	T→C	13.4%	R389R (CGT→CGC)	sbcB →	exonuclease I
RA	1,309,899	G→A	53.3%	R31R (CGC→CGT)	yefM ←	antitoxin of the YoeB‑YefM toxin‑antitoxin system
RA	1,314,255	T→C	56.6%	H170H (CAT→CAC)	hisB →	fused histidinol‑phosphatase and imidazoleglycerol‑phosphate dehydratase
RA	1,321,783	G→A	52.3%	intergenic (‑237/+257)	gnd ← / ← galF	gluconate‑6‑phosphate dehydrogenase, decarboxylating/predicted subunit with GalU
RA	1,327,153	C→T	12.1%	intergenic (‑143/+133)	wcaK ← / ← wzxC	predicted pyruvyl transferase/colanic acid exporter
RA	1,327,159	G→A	14.2%	intergenic (‑149/+127)	wcaK ← / ← wzxC	predicted pyruvyl transferase/colanic acid exporter
RA	1,327,162	T→A	19.8%	intergenic (‑152/+124)	wcaK ← / ← wzxC	predicted pyruvyl transferase/colanic acid exporter
RA	1,327,163	T→C	20.0%	intergenic (‑153/+123)	wcaK ← / ← wzxC	predicted pyruvyl transferase/colanic acid exporter
RA	1,327,164	C→A	12.8%	intergenic (‑154/+122)	wcaK ← / ← wzxC	predicted pyruvyl transferase/colanic acid exporter
RA	1,327,166	G→C	13.1%	intergenic (‑156/+120)	wcaK ← / ← wzxC	predicted pyruvyl transferase/colanic acid exporter
RA	1,337,480	A→G	43.3%	S5S (AGT→AGC)	wcaF ←	predicted acyl transferase
RA	1,341,041	C→T	9.2%	A41T (GCG→ACG)	wcaB ←	predicted acyl transferase
RA	1,347,119	T→C	7.7%	G204G (GGT→GGC)	yegH →	fused predicted membrane proteins
RA	1,350,843	T→C	18.6%	intergenic (‑22/+70)	dcd ← / ← udk	2'‑deoxycytidine 5'‑triphosphate deaminase/uridine/cytidine kinase
RA	1,370,859	T→C	6.7%	intergenic (+116/‑14)	yohK → / → cdd	predicted inner membrane protein/cytidine/deoxycytidine deaminase
RA	1,374,127	T→C	18.0%	L356L (TTA→CTA)	yeiT →	predicted oxidoreductase
RA	1,390,615	A→G	57.0%	Q249Q (CAA→CAG)	nfo →	endonuclease IV with intrinsic 3'‑5' exonuclease activity
RA	1,395,087	T→C	10.4%	intergenic (‑160/‑208)	fruB ← / → setB	fused fructose‑specific PTS enzyme IIA component and HPr component/lactose/glucose efflux system
RA	1,395,393	G→T	11.2%	L33L (CTG→CTT)	setB →	lactose/glucose efflux system
RA	1,395,396	A→G	11.6%	Q34Q (CAA→CAG)	setB →	lactose/glucose efflux system
RA	1,395,399	C→T	11.7%	T35T (ACC→ACT)	setB →	lactose/glucose efflux system
RA	1,395,402	G→T	11.5%	P36P (CCG→CCT)	setB →	lactose/glucose efflux system
RA	1,395,405	A→C	13.1%	T37T (ACA→ACC)	setB →	lactose/glucose efflux system
RA	1,395,408	C→A	12.6%	L38L (CTC→CTA)	setB →	lactose/glucose efflux system
RA	1,395,660	T→A	10.3%	A122A (GCT→GCA)	setB →	lactose/glucose efflux system
RA	1,395,675	T→C	7.8%	F127F (TTT→TTC)	setB →	lactose/glucose efflux system
RA	1,395,681	T→C	7.7%	L129L (CTT→CTC)	setB →	lactose/glucose efflux system
RA	1,396,026	C→T	8.4%	I244I (ATC→ATT)	setB →	lactose/glucose efflux system
RA	1,396,027	A→G	8.5%	N245D (AAC→GAC) ‡	setB →	lactose/glucose efflux system
RA	1,396,029	C→T	8.6%	N245N (AAC→AAT) ‡	setB →	lactose/glucose efflux system
RA	1,396,041	T→A	9.8%	L249L (CTT→CTA)	setB →	lactose/glucose efflux system
RA	1,396,042	C→A	10.5%	P250T (CCC→ACC)	setB →	lactose/glucose efflux system
RA	1,396,047	G→T	11.5%	E251D (GAG→GAT)	setB →	lactose/glucose efflux system
RA	1,396,054	G→A	11.7%	A254T (GCC→ACC) ‡	setB →	lactose/glucose efflux system
RA	1,396,056	C→T	12.0%	A254A (GCC→GCT) ‡	setB →	lactose/glucose efflux system
RA	1,396,059	T→A	13.3%	G255G (GGT→GGA)	setB →	lactose/glucose efflux system
RA	1,396,061	T→A	15.0%	V256E (GTG→GAG) ‡	setB →	lactose/glucose efflux system
RA	1,396,062	G→A	16.3%	V256V (GTG→GTA) ‡	setB →	lactose/glucose efflux system
RA	1,396,068	G→T	20.6%	M258I (ATG→ATT)	setB →	lactose/glucose efflux system
RA	1,396,071	G→T	18.7%	G259G (GGG→GGT)	setB →	lactose/glucose efflux system
RA	1,408,246	T→C	8.9%	L172S (TTA→TCA)	yejF →	fused predicted oligopeptide transporter subunits and ATP‑binding components of ABC superfamily
RA	1,408,248	A→T	8.5%	T173S (ACG→TCG) ‡	yejF →	fused predicted oligopeptide transporter subunits and ATP‑binding components of ABC superfamily
RA	1,408,249	C→G	9.2%	T173R (ACG→AGG) ‡	yejF →	fused predicted oligopeptide transporter subunits and ATP‑binding components of ABC superfamily
RA	1,408,250	G→C	9.2%	T173T (ACG→ACC) ‡	yejF →	fused predicted oligopeptide transporter subunits and ATP‑binding components of ABC superfamily
RA	1,408,253	A→C	8.9%	R174R (CGA→CGC)	yejF →	fused predicted oligopeptide transporter subunits and ATP‑binding components of ABC superfamily
RA	1,408,258	A→C	9.1%	E176A (GAA→GCA) ‡	yejF →	fused predicted oligopeptide transporter subunits and ATP‑binding components of ABC superfamily
RA	1,408,259	A→G	9.8%	E176E (GAA→GAG) ‡	yejF →	fused predicted oligopeptide transporter subunits and ATP‑binding components of ABC superfamily
RA	1,408,260	T→G	9.6%	L177V (TTA→GTA) ‡	yejF →	fused predicted oligopeptide transporter subunits and ATP‑binding components of ABC superfamily
RA	1,408,262	A→G	9.6%	L177L (TTA→TTG) ‡	yejF →	fused predicted oligopeptide transporter subunits and ATP‑binding components of ABC superfamily
RA	1,408,263	T→C	9.6%	L178L (TTA→CTA) ‡	yejF →	fused predicted oligopeptide transporter subunits and ATP‑binding components of ABC superfamily
RA	1,408,265	A→G	10.2%	L178L (TTA→TTG) ‡	yejF →	fused predicted oligopeptide transporter subunits and ATP‑binding components of ABC superfamily
RA	1,408,277	A→G	10.2%	E182E (GAA→GAG)	yejF →	fused predicted oligopeptide transporter subunits and ATP‑binding components of ABC superfamily
RA	1,408,280	G→A	10.6%	P183P (CCG→CCA)	yejF →	fused predicted oligopeptide transporter subunits and ATP‑binding components of ABC superfamily
RA	1,417,571	A→T	10.0%	intergenic (+3/‑72)	yejM → / → proL	predicted hydrolase, inner membrane/tRNA‑Pro
RA	1,417,574	T→A	10.4%	intergenic (+6/‑69)	yejM → / → proL	predicted hydrolase, inner membrane/tRNA‑Pro
RA	1,417,577	A→T	8.6%	intergenic (+9/‑66)	yejM → / → proL	predicted hydrolase, inner membrane/tRNA‑Pro
RA	1,439,294	G→A	14.0%	D336D (GAC→GAT)	ompC ←	outer membrane porin protein C
RA	1,439,300	G→A	13.1%	Y334Y (TAC→TAT)	ompC ←	outer membrane porin protein C
RA	1,439,333	A→C	11.9%	A323A (GCT→GCG)	ompC ←	outer membrane porin protein C
RA	1,439,341	C→T	6.0%	V321I (GTT→ATT)	ompC ←	outer membrane porin protein C
RA	1,439,414	C→G	9.1%	L296L (CTG→CTC) ‡	ompC ←	outer membrane porin protein C
RA	1,439,416	G→T	10.4%	L296M (CTG→ATG) ‡	ompC ←	outer membrane porin protein C
RA	1,439,423	A→G	10.1%	R293R (CGT→CGC)	ompC ←	outer membrane porin protein C
RA	1,439,429	A→G	8.8%	G291G (GGT→GGC)	ompC ←	outer membrane porin protein C
RA	1,439,432	G→A	8.6%	F290F (TTC→TTT)	ompC ←	outer membrane porin protein C
RA	1,439,444	G→A	15.1%	Y286Y (TAC→TAT)	ompC ←	outer membrane porin protein C
RA	1,439,457	G→A	14.5%	A282V (GCT→GTT)	ompC ←	outer membrane porin protein C
RA	1,439,462	G→A	12.4%	F280F (TTC→TTT)	ompC ←	outer membrane porin protein C
RA	1,439,468	C→T	11.3%	Q278Q (CAG→CAA)	ompC ←	outer membrane porin protein C
RA	1,439,471	T→G	9.8%	A277A (GCA→GCC) ‡	ompC ←	outer membrane porin protein C
RA	1,439,473	C→T	7.6%	A277T (GCA→ACA) ‡	ompC ←	outer membrane porin protein C
RA	1,439,789	C→T	7.7%	Q171Q (CAG→CAA)	ompC ←	outer membrane porin protein C
RA	1,439,792	G→A	12.6%	Y170Y (TAC→TAT)	ompC ←	outer membrane porin protein C
RA	1,439,798	A→C	16.7%	V168V (GTT→GTG)	ompC ←	outer membrane porin protein C
RA	1,439,801	A→C	11.0%	A167A (GCT→GCG)	ompC ←	outer membrane porin protein C
RA	1,439,804	A→G	11.3%	F166F (TTT→TTC)	ompC ←	outer membrane porin protein C
RA	1,439,813	G→A	12.9%	G163G (GGC→GGT)	ompC ←	outer membrane porin protein C
RA	1,439,816	G→A	18.6%	D162D (GAC→GAT) ‡	ompC ←	outer membrane porin protein C
RA	1,439,818	C→T	12.6%	D162N (GAC→AAC) ‡	ompC ←	outer membrane porin protein C
RA	1,439,819	A→T	12.6%	V161V (GTT→GTA)	ompC ←	outer membrane porin protein C
RA	1,439,834	G→A	13.5%	D156D (GAC→GAT) ‡	ompC ←	outer membrane porin protein C
RA	1,439,835	T→C	8.0%	D156G (GAC→GGC) ‡	ompC ←	outer membrane porin protein C
RA	1,439,840	G→A	13.5%	N154N (AAC→AAT)	ompC ←	outer membrane porin protein C
RA	1,439,846	G→A	9.7%	Y152Y (TAC→TAT)	ompC ←	outer membrane porin protein C
RA	1,439,849	G→A	10.3%	T151T (ACC→ACT)	ompC ←	outer membrane porin protein C
RA	1,439,857	A→C	9.5%	F149V (TTC→GTC)	ompC ←	outer membrane porin protein C
RA	1,439,921	T→C	7.0%	V127V (GTA→GTG) ‡	ompC ←	outer membrane porin protein C
RA	1,439,923	C→T	7.0%	V127I (GTA→ATA) ‡	ompC ←	outer membrane porin protein C
RA	1,439,924	G→A	6.9%	D126D (GAC→GAT)	ompC ←	outer membrane porin protein C
RA	1,439,933	G→T	7.8%	S123S (TCC→TCA) ‡	ompC ←	outer membrane porin protein C
RA	1,439,935	A→C	7.5%	S123A (TCC→GCC) ‡	ompC ←	outer membrane porin protein C
RA	1,439,936	A→T	7.5%	T122T (ACT→ACA) ‡	ompC ←	outer membrane porin protein C
RA	1,439,937	G→T	7.4%	T122N (ACT→AAT) ‡	ompC ←	outer membrane porin protein C
RA	1,439,938	T→C	7.6%	T122A (ACT→GCT) ‡	ompC ←	outer membrane porin protein C
RA	1,439,948	A→T	7.9%	V118V (GTT→GTA)	ompC ←	outer membrane porin protein C
RA	1,439,951	A→G	7.7%	V117V (GTT→GTC)	ompC ←	outer membrane porin protein C
RA	1,439,954	G→A	6.8%	G116G (GGC→GGT)	ompC ←	outer membrane porin protein C
RA	1,439,969	G→A	7.4%	Y111Y (TAC→TAT)	ompC ←	outer membrane porin protein C
RA	1,440,224	G→A	8.8%	N26N (AAC→AAT)	ompC ←	outer membrane porin protein C
RA	1,440,227	G→A	9.0%	Y25Y (TAC→TAT)	ompC ←	outer membrane porin protein C
RA	1,440,236	A→G	7.9%	A22A (GCT→GCC)	ompC ←	outer membrane porin protein C
RA	1,440,239	A→T	7.9%	A21A (GCT→GCA)	ompC ←	outer membrane porin protein C
RA	1,440,242	G→A	7.7%	N20N (AAC→AAT) ‡	ompC ←	outer membrane porin protein C
RA	1,440,244	T→G	8.2%	N20H (AAC→CAC) ‡	ompC ←	outer membrane porin protein C
RA	1,467,882	Δ1 bp	20.8%	intergenic (+41/+87)	ubiG → / ← yfaL	bifunctional 3‑demethylubiquinone‑9 3‑methyltransferase and 2‑octaprenyl‑6‑hydroxy phenol methylase/adhesin
RA	1,467,905:1	+T	25.9%	intergenic (+64/+64)	ubiG → / ← yfaL	bifunctional 3‑demethylubiquinone‑9 3‑methyltransferase and 2‑octaprenyl‑6‑hydroxy phenol methylase/adhesin
RA	1,467,905:2	+C	25.9%	intergenic (+64/+64)	ubiG → / ← yfaL	bifunctional 3‑demethylubiquinone‑9 3‑methyltransferase and 2‑octaprenyl‑6‑hydroxy phenol methylase/adhesin
RA	1,467,905:3	+C	25.9%	intergenic (+64/+64)	ubiG → / ← yfaL	bifunctional 3‑demethylubiquinone‑9 3‑methyltransferase and 2‑octaprenyl‑6‑hydroxy phenol methylase/adhesin
RA	1,467,905:4	+C	25.9%	intergenic (+64/+64)	ubiG → / ← yfaL	bifunctional 3‑demethylubiquinone‑9 3‑methyltransferase and 2‑octaprenyl‑6‑hydroxy phenol methylase/adhesin
RA	1,467,908	T→A	24.9%	intergenic (+67/+61)	ubiG → / ← yfaL	bifunctional 3‑demethylubiquinone‑9 3‑methyltransferase and 2‑octaprenyl‑6‑hydroxy phenol methylase/adhesin
RA	1,467,910:2	+T	25.9%	intergenic (+69/+59)	ubiG → / ← yfaL	bifunctional 3‑demethylubiquinone‑9 3‑methyltransferase and 2‑octaprenyl‑6‑hydroxy phenol methylase/adhesin
RA	1,474,821	T→G	17.2%	intergenic (+119/‑115)	nrdA → / → nrdB	ribonucleoside diphosphate reductase 1, alpha subunit/ribonucleoside diphosphate reductase 1, beta subunit, ferritin‑like
RA	1,474,827	G→T	16.6%	intergenic (+125/‑109)	nrdA → / → nrdB	ribonucleoside diphosphate reductase 1, alpha subunit/ribonucleoside diphosphate reductase 1, beta subunit, ferritin‑like
RA	1,474,830	T→A	16.2%	intergenic (+128/‑106)	nrdA → / → nrdB	ribonucleoside diphosphate reductase 1, alpha subunit/ribonucleoside diphosphate reductase 1, beta subunit, ferritin‑like
RA	1,474,835	C→T	16.2%	intergenic (+133/‑101)	nrdA → / → nrdB	ribonucleoside diphosphate reductase 1, alpha subunit/ribonucleoside diphosphate reductase 1, beta subunit, ferritin‑like
RA	1,474,863	C→G	13.4%	intergenic (+161/‑73)	nrdA → / → nrdB	ribonucleoside diphosphate reductase 1, alpha subunit/ribonucleoside diphosphate reductase 1, beta subunit, ferritin‑like
RA	1,474,864	C→T	15.5%	intergenic (+162/‑72)	nrdA → / → nrdB	ribonucleoside diphosphate reductase 1, alpha subunit/ribonucleoside diphosphate reductase 1, beta subunit, ferritin‑like
RA	1,481,282	G→A	18.6%	A362T (GCT→ACT)	glpA →	sn‑glycerol‑3‑phosphate dehydrogenase (anaerobic), large subunit, FAD/NAD(P)‑binding
RA	1,484,894	T→C	54.1%	M316V (ATG→GTG)	menF ←	isochorismate synthase 2
RA	1,486,279	T→C	35.1%	T345A (ACA→GCA)	nuoN ←	NADH:ubiquinone oxidoreductase, membrane subunit N
RA	1,491,595	C→T	16.3%	P96P (CCG→CCA)	nuoJ ←	NADH:ubiquinone oxidoreductase, membrane subunit J
RA	1,502,353	G→A	39.2%	S92L (TCA→TTA)	lrhA ←	DNA‑binding transcriptional repressor
RA	1,502,847	A→T	52.3%	intergenic (‑220/‑700)	lrhA ← / → yfbQ	DNA‑binding transcriptional repressor/predicted aminotransferase
RA	1,513,018	T→C	21.4%	intergenic (+141/+291)	pta → / ← ubiX	phosphate acetyltransferase/3‑octaprenyl‑4‑hydroxybenzoate carboxy‑lyase
RA	1,557,415	A→G	56.7%	*128Q (TAG→CAG)	emrY ←	predicted multidrug efflux system
RA	1,563,207	C→T	6.6%	Q1072* (CAG→TAG)	evgS →	hybrid sensory histidine kinase in two‑component regulatory system with EvgA
RA	1,564,887	C→T	21.2%	intergenic (‑99/+193)	yfdE ← / ← glk	predicted CoA‑transferase, NAD(P)‑binding/glucokinase
RA	1,564,912	G→A	36.2%	intergenic (‑124/+168)	yfdE ← / ← glk	predicted CoA‑transferase, NAD(P)‑binding/glucokinase
RA	1,574,052	T→G	14.5%	noncoding (64/76 nt)	valU →	tRNA‑Val
RA	1,581,079	C→T	27.4%	G47S (GGT→AGT)	ypeB ←	hypothetical protein
RA	1,591,605	G→A	26.4%	intergenic (+64/+125)	yfeS → / ← cysM	conserved hypothetical protein/cysteine synthase B
RA	1,591,621	G→A	37.1%	intergenic (+80/+109)	yfeS → / ← cysM	conserved hypothetical protein/cysteine synthase B
RA	1,591,630	A→T	7.4%	intergenic (+89/+100)	yfeS → / ← cysM	conserved hypothetical protein/cysteine synthase B
RA	1,591,633	G→A	21.5%	intergenic (+92/+97)	yfeS → / ← cysM	conserved hypothetical protein/cysteine synthase B
RA	1,591,634	T→C	21.4%	intergenic (+93/+96)	yfeS → / ← cysM	conserved hypothetical protein/cysteine synthase B
RA	1,591,635	G→C	7.5%	intergenic (+94/+95)	yfeS → / ← cysM	conserved hypothetical protein/cysteine synthase B
RA	1,591,637	T→A	17.8%	intergenic (+96/+93)	yfeS → / ← cysM	conserved hypothetical protein/cysteine synthase B
RA	1,591,640	T→A	8.2%	intergenic (+99/+90)	yfeS → / ← cysM	conserved hypothetical protein/cysteine synthase B
RA	1,591,658	C→T	9.8%	intergenic (+117/+72)	yfeS → / ← cysM	conserved hypothetical protein/cysteine synthase B
RA	1,591,660	T→A	10.0%	intergenic (+119/+70)	yfeS → / ← cysM	conserved hypothetical protein/cysteine synthase B
RA	1,614,452	C→T	19.2%	intergenic (‑77/+140)	eutH ← / ← eutG	predicted inner membrane protein/predicted alcohol dehydrogenase in ethanolamine utilization
RA	1,614,453	G→C	19.2%	intergenic (‑78/+139)	eutH ← / ← eutG	predicted inner membrane protein/predicted alcohol dehydrogenase in ethanolamine utilization
RA	1,614,454	T→C	18.2%	intergenic (‑79/+138)	eutH ← / ← eutG	predicted inner membrane protein/predicted alcohol dehydrogenase in ethanolamine utilization
RA	1,614,455	A→T	18.2%	intergenic (‑80/+137)	eutH ← / ← eutG	predicted inner membrane protein/predicted alcohol dehydrogenase in ethanolamine utilization
RA	1,614,459	T→C	31.5%	intergenic (‑84/+133)	eutH ← / ← eutG	predicted inner membrane protein/predicted alcohol dehydrogenase in ethanolamine utilization
RA	1,614,466	G→A	35.2%	intergenic (‑91/+126)	eutH ← / ← eutG	predicted inner membrane protein/predicted alcohol dehydrogenase in ethanolamine utilization
RA	1,614,472	G→A	14.1%	intergenic (‑97/+120)	eutH ← / ← eutG	predicted inner membrane protein/predicted alcohol dehydrogenase in ethanolamine utilization
RA	1,614,480	C→T	21.4%	intergenic (‑105/+112)	eutH ← / ← eutG	predicted inner membrane protein/predicted alcohol dehydrogenase in ethanolamine utilization
RA	1,614,491	A→T	16.3%	intergenic (‑116/+101)	eutH ← / ← eutG	predicted inner membrane protein/predicted alcohol dehydrogenase in ethanolamine utilization
RA	1,614,492	T→C	32.6%	intergenic (‑117/+100)	eutH ← / ← eutG	predicted inner membrane protein/predicted alcohol dehydrogenase in ethanolamine utilization
RA	1,614,522	A→G	14.3%	intergenic (‑147/+70)	eutH ← / ← eutG	predicted inner membrane protein/predicted alcohol dehydrogenase in ethanolamine utilization
RA	1,622,247	A→C	9.3%	intergenic (‑174/+119)	ypfE ← / ← maeB	predicted carboxysome structural protein with predicted role in ethanol utilization/fused malic enzyme predicted oxidoreductase and predicted phosphotransacetylase
RA	1,631,410	T→C	22.2%	E128E (GAA→GAG)	aegA ←	fused predicted FeS binding subunit and predicted NAD/FAD‑binding subunit of oxidoreductase
RA	1,646,153	C→T	14.9%	intergenic (‑125/‑21)	dapA ← / → gcvR	dihydrodipicolinate synthase/DNA‑binding transcriptional repressor, regulatory protein accessory to GcvA
RA	1,666,180	T→A	9.1%	I193F (ATC→TTC)	guaB ←	IMP dehydrogenase
RA	1,666,716	A→G	12.8%	V14A (GTT→GCT)	guaB ←	IMP dehydrogenase
RA	1,712,236	C→T	24.0%	A1066T (GCT→ACT)	yphG ←	conserved hypothetical protein
RA	1,714,607	C→A	21.9%	L275L (CTG→CTT)	yphG ←	conserved hypothetical protein
RA	1,716,814	T→G	10.4%	intergenic (+72/+126)	yphH → / ← glyA	predicted DNA‑binding transcriptional regulator/serine hydroxymethyltransferase
RA	1,716,816	C→T	10.5%	intergenic (+74/+124)	yphH → / ← glyA	predicted DNA‑binding transcriptional regulator/serine hydroxymethyltransferase
RA	1,716,832	A→C	14.5%	intergenic (+90/+108)	yphH → / ← glyA	predicted DNA‑binding transcriptional regulator/serine hydroxymethyltransferase
RA	1,716,833	C→A	30.1%	intergenic (+91/+107)	yphH → / ← glyA	predicted DNA‑binding transcriptional regulator/serine hydroxymethyltransferase
RA	1,716,835	G→T	19.8%	intergenic (+93/+105)	yphH → / ← glyA	predicted DNA‑binding transcriptional regulator/serine hydroxymethyltransferase
RA	1,716,836	A→G	15.0%	intergenic (+94/+104)	yphH → / ← glyA	predicted DNA‑binding transcriptional regulator/serine hydroxymethyltransferase
RA	1,716,837	G→C	13.0%	intergenic (+95/+103)	yphH → / ← glyA	predicted DNA‑binding transcriptional regulator/serine hydroxymethyltransferase
RA	1,716,846	A→C	17.0%	intergenic (+104/+94)	yphH → / ← glyA	predicted DNA‑binding transcriptional regulator/serine hydroxymethyltransferase
RA	1,716,859	A→G	16.7%	intergenic (+117/+81)	yphH → / ← glyA	predicted DNA‑binding transcriptional regulator/serine hydroxymethyltransferase
RA	1,716,860	A→C	25.8%	intergenic (+118/+80)	yphH → / ← glyA	predicted DNA‑binding transcriptional regulator/serine hydroxymethyltransferase
RA	1,716,861	A→T	39.4%	intergenic (+119/+79)	yphH → / ← glyA	predicted DNA‑binding transcriptional regulator/serine hydroxymethyltransferase
RA	1,716,872	C→A	17.6%	intergenic (+130/+68)	yphH → / ← glyA	predicted DNA‑binding transcriptional regulator/serine hydroxymethyltransferase
RA	1,720,956	G→A	17.8%	H178H (CAC→CAT)	yfhA ←	predicted DNA‑binding response regulator in two‑component system
RA	1,729,738	C→T	17.5%	L372F (CTT→TTT)	yfhD →	predicted transglycosylase
RA	1,741,082	T→C	12.9%	K120R (AAA→AGA)	rseB ←	anti‑sigma factor
RA	1,746,998	G→A	12.5%	intergenic (+82/+127)	srmB → / ← yfiE	ATP‑dependent RNA helicase/predicted DNA‑binding transcriptional regulator
RA	1,747,003	T→C	12.8%	intergenic (+87/+122)	srmB → / ← yfiE	ATP‑dependent RNA helicase/predicted DNA‑binding transcriptional regulator
RA	1,753,067	G→A	27.9%	V143V (GTG→GTA)	yfiQ →	fused predicted acyl‑CoA synthetase NAD(P)‑binding subunit and ATP‑binding subunit
RA	1,763,556	T→C	20.9%	noncoding (288/1542 nt)	rrsG ←	16S ribosomal RNA
RA	1,763,636	A→G	30.0%	noncoding (208/1542 nt)	rrsG ←	16S ribosomal RNA
RA	1,789,035	T→C	28.9%	S58P (TCC→CCC)	ygaF →	hypothetical protein
RA	1,789,192	T→C	34.2%	V110A (GTG→GCG)	ygaF →	hypothetical protein
RA	1,804,090	G→A	73.5%	G52G (GGG→GGA)	mprA →	DNA‑binding transcriptional regulator
RA	1,823,325:1	+G	23.7%	intergenic (+62/+66)	norW → / ← hypF	NADH:flavorubredoxin oxidoreductase/carbamoyl phosphate phosphatase and maturation protein for [NiFe] hydrogenases
RA	1,823,331	G→T	19.3%	intergenic (+68/+60)	norW → / ← hypF	NADH:flavorubredoxin oxidoreductase/carbamoyl phosphate phosphatase and maturation protein for [NiFe] hydrogenases
RA	1,826,240	T→C	14.7%	E28E (GAA→GAG)	hydN ←	formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit
RA	1,826,243	C→A	13.8%	Q27H (CAG→CAT)	hydN ←	formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit
RA	1,826,249	A→C	16.7%	S25S (TCT→TCG)	hydN ←	formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit
RA	1,826,252	A→C	17.8%	V24V (GTT→GTG)	hydN ←	formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit
RA	1,826,255	C→T	17.4%	A23A (GCG→GCA) ‡	hydN ←	formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit
RA	1,826,256	G→A	35.7%	A23V (GCG→GTG) ‡	hydN ←	formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit
RA	1,826,261	C→A	20.6%	A21A (GCG→GCT)	hydN ←	formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit
RA	1,826,264	T→C	20.5%	V20V (GTA→GTG)	hydN ←	formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit
RA	1,826,285	A→G	17.0%	I13I (ATT→ATC)	hydN ←	formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit
RA	1,826,294	A→C	16.6%	S10R (AGT→AGG) ‡	hydN ←	formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit
RA	1,826,295	C→G	16.5%	S10T (AGT→ACT) ‡	hydN ←	formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit
RA	1,826,300	G→A	16.5%	D8D (GAC→GAT)	hydN ←	formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit
RA	1,826,303	A→C	14.5%	A7A (GCT→GCG)	hydN ←	formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit
RA	1,826,309	G→A	9.6%	I5I (ATC→ATT)	hydN ←	formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit
RA	1,834,068	G→A	22.2%	L56L (CTG→CTA)	ygbM →	conserved hypothetical protein
RA	1,837,444	G→A	8.2%	A325A (GCC→GCT)	nlpD ←	predicted outer membrane lipoprotein
RA	1,837,447	A→C	8.0%	S324R (AGT→AGG) ‡	nlpD ←	predicted outer membrane lipoprotein
RA	1,837,448	C→G	7.8%	S324T (AGT→ACT) ‡	nlpD ←	predicted outer membrane lipoprotein
RA	1,837,450	C→A	7.9%	L323L (CTG→CTT) ‡	nlpD ←	predicted outer membrane lipoprotein
RA	1,837,452	G→T	9.0%	L323M (CTG→ATG) ‡	nlpD ←	predicted outer membrane lipoprotein
RA	1,837,459	A→T	8.1%	D320E (GAT→GAA)	nlpD ←	predicted outer membrane lipoprotein
RA	1,837,463	T→C	7.8%	N319S (AAT→AGT)	nlpD ←	predicted outer membrane lipoprotein
RA	1,837,465	A→G	7.4%	H318H (CAT→CAC)	nlpD ←	predicted outer membrane lipoprotein
RA	1,837,471	G→A	6.6%	I316I (ATC→ATT)	nlpD ←	predicted outer membrane lipoprotein
RA	1,837,474	G→C	6.5%	I315M (ATC→ATG)	nlpD ←	predicted outer membrane lipoprotein
RA	1,837,477	A→G	6.3%	I314I (ATT→ATC)	nlpD ←	predicted outer membrane lipoprotein
RA	1,837,480	C→G	6.0%	L313L (CTG→CTC)	nlpD ←	predicted outer membrane lipoprotein
RA	1,864,319	C→T	9.3%	intergenic (+66/+82)	ygcP → / ← ygcQ	predicted anti‑terminator regulatory protein/predicted flavoprotein
RA	1,864,336	G→A	16.7%	intergenic (+83/+65)	ygcP → / ← ygcQ	predicted anti‑terminator regulatory protein/predicted flavoprotein
RA	1,864,337	A→C	14.1%	intergenic (+84/+64)	ygcP → / ← ygcQ	predicted anti‑terminator regulatory protein/predicted flavoprotein
RA	1,873,630	C→A	38.0%	intergenic (+774/+599)	ygcE → / ← ygcF	predicted kinase/conserved hypothetical protein
RA	1,889,569	A→G	9.1%	R220R (CGT→CGC)	gudX ←	predicted glucarate dehydratase
RA	1,892,019:1	+GC	100%	intergenic (‑437/+54)	gudP ← / ← ygdL	predicted D‑glucarate transporter/conserved hypothetical protein
RA	1,900,258	G→A	29.6%	A928V (GCT→GTT)	recB ←	exonuclease V (RecBCD complex), beta subunit
RA	1,914,596	T→G	11.7%	K292N (AAA→AAC)	ptsP ←	fused PEP‑protein phosphotransferase (enzyme I) of PTS system
RA	1,921,110	T→C	35.9%	S648G (AGC→GGC)	aas ←	fused 2‑acylglycerophospho‑ethanolamine acyl transferase and acyl‑acyl carrier protein synthetase
RA	1,932,763	G→A	65.4%	intergenic (‑134/+162)	yqeF ← / ← lysS	predicted acyltransferase/lysine tRNA synthetase, constitutive
RA	1,932,853	C→T	27.6%	intergenic (‑224/+72)	yqeF ← / ← lysS	predicted acyltransferase/lysine tRNA synthetase, constitutive
RA	1,932,952	C→G	10.0%	L497L (CTG→CTC)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,932,967	G→A	11.9%	I492I (ATC→ATT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,932,970	G→A	11.9%	T491T (ACC→ACT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,932,982	G→A	12.7%	T487T (ACC→ACT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,932,985	G→A	11.1%	F486F (TTC→TTT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,932,994	T→A	16.5%	V483V (GTA→GTT) ‡	lysS ←	lysine tRNA synthetase, constitutive
RA	1,932,996	C→T	15.8%	V483I (GTA→ATA) ‡	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,000	A→T	15.6%	R481R (CGT→CGA)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,015	T→A	14.0%	G476G (GGA→GGT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,024	T→A	13.6%	A473A (GCA→GCT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,027	T→G	13.6%	T472T (ACA→ACC)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,030	C→T	11.6%	P471P (CCG→CCA)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,036	T→C	10.3%	L469L (TTA→TTG) ‡	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,038	A→G	10.3%	L469L (TTA→CTA) ‡	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,039	G→A	10.2%	G468G (GGC→GGT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,044	G→A	12.4%	H467Y (CAT→TAT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,051	T→C	14.0%	A464A (GCA→GCG)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,054	G→A	14.4%	T463T (ACC→ACT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,057	G→C	14.0%	V462V (GTC→GTG)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,069	A→G	12.1%	D458D (GAT→GAC)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,072	G→A	12.2%	Y457Y (TAC→TAT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,081	C→G	17.9%	A454A (GCG→GCC)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,099	G→A	15.7%	D448D (GAC→GAT) ‡	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,100	T→G	16.7%	D448A (GAC→GCC) ‡	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,105	C→A	13.9%	A446A (GCG→GCT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,108	G→A	15.3%	A445A (GCC→GCT) ‡	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,109	G→T	13.5%	A445D (GCC→GAC) ‡	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,110	C→T	13.4%	A445T (GCC→ACC) ‡	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,117	A→T	16.3%	D442E (GAT→GAA)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,121	A→T	18.1%	L441Q (CTG→CAG)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,126	G→A	16.8%	R439R (CGC→CGT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,131	G→C	19.3%	Q438E (CAA→GAA)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,132	C→A	19.2%	A437A (GCG→GCT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,153	C→T	12.6%	L430L (CTG→CTA)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,165	G→A	13.0%	G426G (GGC→GGT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,168	G→A	12.2%	N425N (AAC→AAT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,189	A→G	12.0%	I418I (ATT→ATC)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,198	C→T	16.6%	E415E (GAG→GAA)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,204	G→A	18.6%	R413R (CGC→CGT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,210	T→G	22.1%	T411T (ACA→ACC)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,228	G→A	28.6%	D405D (GAC→GAT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,231	G→A	28.6%	N404N (AAC→AAT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,237	A→G	30.0%	R402R (CGT→CGC)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,240	C→T	31.6%	A401A (GCG→GCA)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,249	A→G	33.3%	S398S (TCT→TCC)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,252	A→C	33.3%	V397V (GTT→GTG)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,270	A→C	32.6%	T391T (ACT→ACG)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,276	G→A	34.1%	F389F (TTC→TTT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,282	C→T	33.7%	P387P (CCG→CCA)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,312	T→A	18.2%	E377D (GAA→GAT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,315	G→A	17.5%	F376F (TTC→TTT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,324	G→T	14.0%	T373T (ACC→ACA)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,327	A→G	10.2%	V372V (GTT→GTC)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,330	G→A	7.7%	I371I (ATC→ATT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,555	C→T	9.0%	S296S (TCG→TCA)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,558	T→C	9.4%	E295E (GAA→GAG)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,561	G→T	8.7%	T294T (ACC→ACA)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,567	C→T	11.9%	E292E (GAG→GAA)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,570	G→A	13.0%	I291I (ATC→ATT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,575	G→A	14.3%	L290L (CTG→TTG)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,579	T→G	14.9%	K288N (AAA→AAC) ‡	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,581	T→G	14.8%	K288Q (AAA→CAA) ‡	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,588	T→C	14.7%	A285A (GCA→GCG)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,591	G→A	14.3%	Y284Y (TAC→TAT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,594	A→C	14.4%	A283A (GCT→GCG)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,615	G→T	12.9%	T276T (ACC→ACA)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,624	T→A	13.3%	P273P (CCA→CCT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,627	G→A	14.3%	N272N (AAC→AAT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,633	A→G	14.3%	R270R (CGT→CGC)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,636	T→A	14.5%	V269V (GTA→GTT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,639	G→A	14.7%	S268S (TCC→TCT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,651	G→A	21.4%	N264N (AAC→AAT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,681	A→C	23.6%	R254R (CGT→CGG)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,684	C→T	20.7%	E253E (GAG→GAA)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,687	G→A	16.2%	F252F (TTC→TTT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,690	G→A	16.4%	G251G (GGC→GGT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,693	A→G	17.4%	G250G (GGT→GGC)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,696	A→T	17.4%	V249V (GTT→GTA)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,699	C→A	16.6%	V248V (GTG→GTT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,708	C→T	12.0%	K245K (AAG→AAA)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,711	G→C	12.7%	L244L (CTC→CTG)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,714	G→A	12.2%	Y243Y (TAC→TAT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,720	T→C	11.3%	E241E (GAA→GAG)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,738	G→A	10.8%	Y235Y (TAC→TAT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,744	G→A	9.2%	D233D (GAC→GAT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,756	C→A	7.5%	A229A (GCG→GCT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,759	G→A	7.4%	N228N (AAC→AAT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,765	G→A	10.0%	H226H (CAC→CAT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,771	G→A	9.8%	I224I (ATC→ATT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,780	A→G	12.9%	R221R (CGT→CGC)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,783	C→A	11.8%	A220A (GCG→GCT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,788	C→A	11.8%	A219S (GCT→TCT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,789	G→T	12.7%	A218A (GCC→GCA)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,792	A→C	13.0%	G217G (GGT→GGG)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,795	G→A	12.3%	G216G (GGC→GGT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,798	A→T	12.5%	P215P (CCT→CCA)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,801	G→A	13.2%	I214I (ATC→ATT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,804	C→T	12.3%	V213V (GTG→GTA)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,819	C→G	12.5%	T208T (ACG→ACC)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,825	A→T	10.5%	V206V (GTT→GTA)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,936	C→T	14.0%	Q169Q (CAG→CAA)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,945	G→A	17.4%	R166R (CGC→CGT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,948	C→G	17.4%	A165A (GCG→GCC) ‡	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,949	G→A	17.4%	A165V (GCG→GTG) ‡	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,965	A→G	23.2%	L160L (TTG→CTG)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,966	G→A	22.8%	G159G (GGC→GGT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,969	G→A	22.8%	H158H (CAC→CAT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,981	C→T	22.9%	P154P (CCG→CCA)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,984	C→T	18.8%	L153L (CTG→CTA) ‡	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,986	G→A	19.1%	L153L (CTG→TTG) ‡	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,987	C→A	18.0%	P152P (CCG→CCT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,933,993	C→T	14.6%	L150L (CTG→CTA)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,002	G→A	9.9%	T147T (ACC→ACT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,011	A→G	8.3%	R144R (CGT→CGC)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,016	A→G	6.1%	L143L (TTG→CTG)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,023	G→A	5.0%	C140C (TGC→TGT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,161	G→A	10.4%	R94R (CGC→CGT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,164	A→G	9.7%	G93G (GGT→GGC)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,167	G→A	9.9%	G92G (GGC→GGT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,170	A→G	10.0%	V91V (GTT→GTC)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,173	G→A	9.5%	D90D (GAC→GAT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,181	G→A	11.7%	L88L (CTG→TTG)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,182	G→C	11.7%	T87T (ACC→ACG)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,185	A→T	11.9%	V86V (GTT→GTA)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,188	G→A	11.2%	F85F (TTC→TTT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,191	A→G	13.4%	S84S (TCT→TCC)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,194	C→G	13.2%	A83A (GCG→GCC)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,200	A→C	15.5%	G81G (GGT→GGG)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,206	A→G	21.5%	I79I (ATT→ATC)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,224	G→T	19.9%	R73R (CGC→CGA)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,236	G→C	16.7%	A69A (GCC→GCG) ‡	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,238	C→A	19.4%	A69S (GCC→TCC) ‡	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,266	T→C	10.4%	E59E (GAA→GAG) ‡	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,268	C→G	10.4%	E59Q (GAA→CAA) ‡	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,272	C→A	7.0%	E57D (GAG→GAT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,275	T→C	6.6%	K56K (AAA→AAG)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,278	G→C	6.0%	G55G (GGC→GGG) ‡	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,279	C→G	6.1%	G55A (GGC→GCC) ‡	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,281	G→A	6.1%	D54D (GAC→GAT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,284	G→A	6.3%	F53F (TTC→TTT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,287	T→C	6.6%	E52E (GAA→GAG)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,291	G→T	8.7%	A51E (GCA→GAA)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,299	T→C	8.3%	Q48Q (CAA→CAG)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,314	A→G	8.5%	D43D (GAT→GAC)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,320	A→G	7.8%	R41R (CGT→CGC)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,934,323	G→A	5.9%	F40F (TTC→TTT)	lysS ←	lysine tRNA synthetase, constitutive
RA	1,941,697	T→C	13.9%	intergenic (+136/+60)	ygfZ → / ← yqfA	predicted folate‑dependent regulatory protein/predicted oxidoreductase, inner membrane subunit
RA	1,941,698	G→A	12.3%	intergenic (+137/+59)	ygfZ → / ← yqfA	predicted folate‑dependent regulatory protein/predicted oxidoreductase, inner membrane subunit
RA	1,941,702	T→G	29.2%	intergenic (+141/+55)	ygfZ → / ← yqfA	predicted folate‑dependent regulatory protein/predicted oxidoreductase, inner membrane subunit
RA	1,941,704	C→A	25.9%	intergenic (+143/+53)	ygfZ → / ← yqfA	predicted folate‑dependent regulatory protein/predicted oxidoreductase, inner membrane subunit
RA	1,941,723	G→A	7.2%	intergenic (+162/+34)	ygfZ → / ← yqfA	predicted folate‑dependent regulatory protein/predicted oxidoreductase, inner membrane subunit
RA	1,941,724	G→A	7.9%	intergenic (+163/+33)	ygfZ → / ← yqfA	predicted folate‑dependent regulatory protein/predicted oxidoreductase, inner membrane subunit
RA	1,960,125	G→A	12.0%	intergenic (‑55/+160)	fbaA ← / ← pgk	fructose‑bisphosphate aldolase, class II/phosphoglycerate kinase
RA	1,960,131	T→A	14.7%	intergenic (‑61/+154)	fbaA ← / ← pgk	fructose‑bisphosphate aldolase, class II/phosphoglycerate kinase
RA	1,960,141	C→T	13.0%	intergenic (‑71/+144)	fbaA ← / ← pgk	fructose‑bisphosphate aldolase, class II/phosphoglycerate kinase
RA	1,963,700	C→T	8.0%	A108T (GCC→ACC)	yggD ←	predicted DNA‑binding transcriptional regulator
RA	1,985,434	A→G	8.9%	intergenic (+37/+118)	yggW → / ← yggM	predicted oxidoreductase/conserved hypothetical protein
RA	1,985,438	G→T	8.5%	intergenic (+41/+114)	yggW → / ← yggM	predicted oxidoreductase/conserved hypothetical protein
RA	1,990,234	A→G	50.0%	L76L (TTA→TTG)	mutY →	adenine DNA glycosylase
RA	2,006,920	C→G	8.5%	S2T (AGT→ACT)  E327D (GAG→GAC)	hybB ← hybA ←	predicted hydrogenase 2 cytochrome b type component hydrogenase 2 4Fe‑4S ferredoxin‑type component
RA	2,008,716	T→C	5.8%	K102K (AAA→AAG)	hybO ←	hydrogenase 2, small subunit
RA	2,013,459	G→T	16.6%	intergenic (+153/+119)	yghA → / ← exbD	predicted glutathionylspermidine synthase, with NAD(P)‑binding Rossmann‑fold domain/membrane spanning protein in TonB‑ExbB‑ExbD complex
RA	2,013,460	A→G	16.9%	intergenic (+154/+118)	yghA → / ← exbD	predicted glutathionylspermidine synthase, with NAD(P)‑binding Rossmann‑fold domain/membrane spanning protein in TonB‑ExbB‑ExbD complex
RA	2,013,461	G→T	12.3%	intergenic (+155/+117)	yghA → / ← exbD	predicted glutathionylspermidine synthase, with NAD(P)‑binding Rossmann‑fold domain/membrane spanning protein in TonB‑ExbB‑ExbD complex
RA	2,013,466	Δ1 bp	18.1%	intergenic (+160/+112)	yghA → / ← exbD	predicted glutathionylspermidine synthase, with NAD(P)‑binding Rossmann‑fold domain/membrane spanning protein in TonB‑ExbB‑ExbD complex
RA	2,013,468	A→T	14.3%	intergenic (+162/+110)	yghA → / ← exbD	predicted glutathionylspermidine synthase, with NAD(P)‑binding Rossmann‑fold domain/membrane spanning protein in TonB‑ExbB‑ExbD complex
RA	2,013,480	T→G	17.1%	intergenic (+174/+98)	yghA → / ← exbD	predicted glutathionylspermidine synthase, with NAD(P)‑binding Rossmann‑fold domain/membrane spanning protein in TonB‑ExbB‑ExbD complex
RA	2,026,414	G→A	28.2%	intergenic (‑173/+61)	plsC ← / ← parC	1‑acyl‑sn‑glycerol‑3‑phosphate acyltransferase/DNA topoisomerase IV, subunit A
RA	2,035,931	C→T	10.7%	F21F (TTC→TTT)	ygiC →	hypothetical protein
RA	2,040,713	C→T	35.5%	D40D (GAC→GAT)	yqiH →	predicted periplasmic pilin chaperone
RA	2,040,951	T→A	38.3%	*120K (TAA→AAA)	yqiH →	predicted periplasmic pilin chaperone
RA	2,041,438	G→A	46.5%	D32N (GAT→AAT)	yqiI →	conserved hypothetical protein
RA	2,045,818	C→T	10.4%	intergenic (+580/+215)	yqiK → / ← rfaE	conserved hypothetical protein/fused heptose 7‑phosphate kinase and heptose 1‑phosphate adenyltransferase
RA	2,045,825	A→G	8.9%	intergenic (+587/+208)	yqiK → / ← rfaE	conserved hypothetical protein/fused heptose 7‑phosphate kinase and heptose 1‑phosphate adenyltransferase
RA	2,045,830:1	+A	8.9%	intergenic (+592/+203)	yqiK → / ← rfaE	conserved hypothetical protein/fused heptose 7‑phosphate kinase and heptose 1‑phosphate adenyltransferase
RA	2,045,835	C→T	7.3%	intergenic (+597/+198)	yqiK → / ← rfaE	conserved hypothetical protein/fused heptose 7‑phosphate kinase and heptose 1‑phosphate adenyltransferase
RA	2,045,838	G→T	8.4%	intergenic (+600/+195)	yqiK → / ← rfaE	conserved hypothetical protein/fused heptose 7‑phosphate kinase and heptose 1‑phosphate adenyltransferase
RA	2,045,839	T→A	12.0%	intergenic (+601/+194)	yqiK → / ← rfaE	conserved hypothetical protein/fused heptose 7‑phosphate kinase and heptose 1‑phosphate adenyltransferase
RA	2,045,864	T→A	6.6%	intergenic (+626/+169)	yqiK → / ← rfaE	conserved hypothetical protein/fused heptose 7‑phosphate kinase and heptose 1‑phosphate adenyltransferase
RA	2,050,271	A→G	11.6%	L28L (CTT→CTC)	glnE ←	fused deadenylyltransferase and adenylyltransferase for glutamine synthetase
RA	2,057,586	C→T	18.3%	D137D (GAC→GAT)	ttdA →	L‑tartrate dehydratase, alpha subunit
RA	2,065,625	C→T	11.7%	intergenic (+24/+55)	rpoD → / ← ygjF	RNA polymerase, sigma 70 (sigma D) factor/G/U mismatch‑specific DNA glycosylase
RA	2,068,647	T→C	10.5%	E381E (GAA→GAG)	aer ←	fused signal transducer for aerotaxis sensory component and methyl accepting chemotaxis component
RA	2,068,650	G→T	10.6%	G380G (GGC→GGA)	aer ←	fused signal transducer for aerotaxis sensory component and methyl accepting chemotaxis component
RA	2,068,656	A→G	10.7%	R378R (CGT→CGC)	aer ←	fused signal transducer for aerotaxis sensory component and methyl accepting chemotaxis component
RA	2,068,659	C→A	12.4%	A377A (GCG→GCT)	aer ←	fused signal transducer for aerotaxis sensory component and methyl accepting chemotaxis component
RA	2,068,671	C→T	12.0%	A373A (GCG→GCA)	aer ←	fused signal transducer for aerotaxis sensory component and methyl accepting chemotaxis component
RA	2,072,881	C→A	16.3%	P235T (CCG→ACG)	ebgR →	DNA‑binding transcriptional repressor
RA	2,076,873	C→T	21.3%	H147Y (CAT→TAT)	ebgC →	cryptic beta‑D‑galactosidase, beta subunit
RA	2,080,563	G→A	6.6%	Q86Q (CAG→CAA)	exuT →	hexuronate transporter
RA	2,087,666	C→T	50.0%	T54I (ACC→ATC)	yhaH →	predicted inner membrane protein
RA	2,089,817	C→T	16.6%	V99V (GTC→GTT)	yhaK →	predicted pirin‑related protein
RA	2,093,664	A→G	6.2%	N396N (AAT→AAC)	tdcG ←	L‑serine dehydratase 3
RA	2,093,670	T→C	10.7%	E394E (GAA→GAG)	tdcG ←	L‑serine dehydratase 3
RA	2,093,673	A→G	11.4%	I393I (ATT→ATC)	tdcG ←	L‑serine dehydratase 3
RA	2,093,679	C→T	10.1%	P391P (CCG→CCA)	tdcG ←	L‑serine dehydratase 3
RA	2,093,682	G→C	10.2%	I390M (ATC→ATG) ‡	tdcG ←	L‑serine dehydratase 3
RA	2,093,684	T→C	10.1%	I390V (ATC→GTC) ‡	tdcG ←	L‑serine dehydratase 3
RA	2,093,685	T→C	10.2%	Q389Q (CAA→CAG)	tdcG ←	L‑serine dehydratase 3
RA	2,093,700	A→G	14.8%	V384V (GTT→GTC)	tdcG ←	L‑serine dehydratase 3
RA	2,093,706	A→G	17.0%	D382D (GAT→GAC)	tdcG ←	L‑serine dehydratase 3
RA	2,093,709	G→A	18.6%	C381C (TGC→TGT)	tdcG ←	L‑serine dehydratase 3
RA	2,093,712	G→C	19.0%	T380T (ACC→ACG)	tdcG ←	L‑serine dehydratase 3
RA	2,093,718	C→A	19.2%	G378G (GGG→GGT)	tdcG ←	L‑serine dehydratase 3
RA	2,093,721	A→G	20.0%	L377L (CTT→CTC)	tdcG ←	L‑serine dehydratase 3
RA	2,093,727	A→G	20.0%	H375H (CAT→CAC)	tdcG ←	L‑serine dehydratase 3
RA	2,093,736	C→G	16.4%	A372A (GCG→GCC)	tdcG ←	L‑serine dehydratase 3
RA	2,093,751	A→G	15.7%	N367N (AAT→AAC) ‡	tdcG ←	L‑serine dehydratase 3
RA	2,093,752	T→A	16.3%	N367I (AAT→ATT) ‡	tdcG ←	L‑serine dehydratase 3
RA	2,093,757	T→C	16.9%	V365V (GTA→GTG)	tdcG ←	L‑serine dehydratase 3
RA	2,093,769	A→G	10.9%	S361S (AGT→AGC)	tdcG ←	L‑serine dehydratase 3
RA	2,093,772	G→T	12.7%	G360G (GGC→GGA)	tdcG ←	L‑serine dehydratase 3
RA	2,093,964	T→A	10.1%	V296V (GTA→GTT)	tdcG ←	L‑serine dehydratase 3
RA	2,093,973	A→G	19.0%	I293I (ATT→ATC)	tdcG ←	L‑serine dehydratase 3
RA	2,093,979	G→C	18.7%	G291G (GGC→GGG)	tdcG ←	L‑serine dehydratase 3
RA	2,094,000	T→C	21.0%	A284A (GCA→GCG)	tdcG ←	L‑serine dehydratase 3
RA	2,094,003	C→A	21.7%	T283T (ACG→ACT)	tdcG ←	L‑serine dehydratase 3
RA	2,094,006	T→C	21.1%	V282V (GTA→GTG)	tdcG ←	L‑serine dehydratase 3
RA	2,094,015	C→A	18.2%	G279G (GGG→GGT)	tdcG ←	L‑serine dehydratase 3
RA	2,094,024	T→A	16.7%	A276A (GCA→GCT)	tdcG ←	L‑serine dehydratase 3
RA	2,094,789	C→T	7.6%	G21G (GGG→GGA)	tdcG ←	L‑serine dehydratase 3
RA	2,094,810	G→A	9.1%	P14P (CCC→CCT)	tdcG ←	L‑serine dehydratase 3
RA	2,094,813	A→G	8.6%	G13G (GGT→GGC)	tdcG ←	L‑serine dehydratase 3
RA	2,094,819	C→G	8.1%	G11G (GGG→GGC)	tdcG ←	L‑serine dehydratase 3
RA	2,094,822	A→G	7.3%	I10I (ATT→ATC)	tdcG ←	L‑serine dehydratase 3
RA	2,111,795	T→C	11.3%	C147R (TGC→CGC)	agaI →	galactosamine‑6‑phosphate isomerase
RA	2,130,584	A→G	9.4%	I107I (ATT→ATC)	mtr ←	tryptophan transporter of high affinity
RA	2,130,596	G→A	9.1%	T103T (ACC→ACT)	mtr ←	tryptophan transporter of high affinity
RA	2,130,599	C→G	8.6%	L102L (CTG→CTC)	mtr ←	tryptophan transporter of high affinity
RA	2,130,611	C→A	11.6%	V98V (GTG→GTT)	mtr ←	tryptophan transporter of high affinity
RA	2,130,614	A→G	11.4%	F97F (TTT→TTC)	mtr ←	tryptophan transporter of high affinity
RA	2,130,622	T→C	12.6%	I95V (ATT→GTT)	mtr ←	tryptophan transporter of high affinity
RA	2,130,625	A→T	12.2%	S94T (TCC→ACC)	mtr ←	tryptophan transporter of high affinity
RA	2,130,629	G→A	9.8%	G92G (GGC→GGT)	mtr ←	tryptophan transporter of high affinity
RA	2,130,633	T→C	10.5%	N91S (AAC→AGC)	mtr ←	tryptophan transporter of high affinity
RA	2,130,637	C→T	8.5%	V90I (GTC→ATC)	mtr ←	tryptophan transporter of high affinity
RA	2,130,638	C→A	8.4%	V89V (GTG→GTT) ‡	mtr ←	tryptophan transporter of high affinity
RA	2,130,640	C→T	8.5%	V89M (GTG→ATG) ‡	mtr ←	tryptophan transporter of high affinity
RA	2,130,648	C→G	7.1%	G86A (GGC→GCC) ‡	mtr ←	tryptophan transporter of high affinity
RA	2,130,649	C→T	7.1%	G86S (GGC→AGC) ‡	mtr ←	tryptophan transporter of high affinity
RA	2,130,650	T→G	7.2%	K85N (AAA→AAC)	mtr ←	tryptophan transporter of high affinity
RA	2,130,653	G→A	7.0%	G84G (GGC→GGT)	mtr ←	tryptophan transporter of high affinity
RA	2,130,656	C→G	7.0%	L83L (CTG→CTC) ‡	mtr ←	tryptophan transporter of high affinity
RA	2,130,658	G→T	6.4%	L83M (CTG→ATG) ‡	mtr ←	tryptophan transporter of high affinity
RA	2,130,659	C→T	6.6%	L82L (TTG→TTA)	mtr ←	tryptophan transporter of high affinity
RA	2,131,666	G→A	19.3%	L428L (CTG→TTG)	deaD ←	ATP‑dependent RNA helicase
JC	2,133,767	(TCGTTA)2→1	36.0%	coding (246‑251/891 nt)	nlpI ←	conserved hypothetical protein
RA	2,155,567	A→T	16.3%	intergenic (+78/+108)	dacB → / ← obgE	D‑alanyl‑D‑alanine carboxypeptidase/GTPase involved in cell partioning and DNA repair
RA	2,155,591	T→A	9.7%	intergenic (+102/+84)	dacB → / ← obgE	D‑alanyl‑D‑alanine carboxypeptidase/GTPase involved in cell partioning and DNA repair
RA	2,155,592	C→T	9.1%	intergenic (+103/+83)	dacB → / ← obgE	D‑alanyl‑D‑alanine carboxypeptidase/GTPase involved in cell partioning and DNA repair
RA	2,155,605	C→T	7.7%	intergenic (+116/+70)	dacB → / ← obgE	D‑alanyl‑D‑alanine carboxypeptidase/GTPase involved in cell partioning and DNA repair
RA	2,155,607	T→A	7.6%	intergenic (+118/+68)	dacB → / ← obgE	D‑alanyl‑D‑alanine carboxypeptidase/GTPase involved in cell partioning and DNA repair
RA	2,155,617:1	+A	7.1%	intergenic (+128/+58)	dacB → / ← obgE	D‑alanyl‑D‑alanine carboxypeptidase/GTPase involved in cell partioning and DNA repair
RA	2,155,618	T→A	6.9%	intergenic (+129/+57)	dacB → / ← obgE	D‑alanyl‑D‑alanine carboxypeptidase/GTPase involved in cell partioning and DNA repair
RA	2,220,170	C→T	6.3%	intergenic (+430/‑548)	yhdH → / → accB	predicted oxidoreductase, Zn‑dependent and NAD(P)‑binding/acetyl CoA carboxylase, BCCP subunit
RA	2,220,174	G→A	6.1%	intergenic (+434/‑544)	yhdH → / → accB	predicted oxidoreductase, Zn‑dependent and NAD(P)‑binding/acetyl CoA carboxylase, BCCP subunit
RA	2,220,179	G→T	7.9%	intergenic (+439/‑539)	yhdH → / → accB	predicted oxidoreductase, Zn‑dependent and NAD(P)‑binding/acetyl CoA carboxylase, BCCP subunit
RA	2,220,199	C→T	15.8%	intergenic (+459/‑519)	yhdH → / → accB	predicted oxidoreductase, Zn‑dependent and NAD(P)‑binding/acetyl CoA carboxylase, BCCP subunit
RA	2,220,205	A→C	15.1%	intergenic (+465/‑513)	yhdH → / → accB	predicted oxidoreductase, Zn‑dependent and NAD(P)‑binding/acetyl CoA carboxylase, BCCP subunit
RA	2,220,206	T→C	14.7%	intergenic (+466/‑512)	yhdH → / → accB	predicted oxidoreductase, Zn‑dependent and NAD(P)‑binding/acetyl CoA carboxylase, BCCP subunit
RA	2,220,208	C→A	15.5%	intergenic (+468/‑510)	yhdH → / → accB	predicted oxidoreductase, Zn‑dependent and NAD(P)‑binding/acetyl CoA carboxylase, BCCP subunit
RA	2,220,209	C→A	15.4%	intergenic (+469/‑509)	yhdH → / → accB	predicted oxidoreductase, Zn‑dependent and NAD(P)‑binding/acetyl CoA carboxylase, BCCP subunit
RA	2,220,218	T→C	16.1%	intergenic (+478/‑500)	yhdH → / → accB	predicted oxidoreductase, Zn‑dependent and NAD(P)‑binding/acetyl CoA carboxylase, BCCP subunit
RA	2,220,226	T→C	11.8%	intergenic (+486/‑492)	yhdH → / → accB	predicted oxidoreductase, Zn‑dependent and NAD(P)‑binding/acetyl CoA carboxylase, BCCP subunit
RA	2,220,238	C→T	9.4%	intergenic (+498/‑480)	yhdH → / → accB	predicted oxidoreductase, Zn‑dependent and NAD(P)‑binding/acetyl CoA carboxylase, BCCP subunit
RA	2,225,948	G→C	35.4%	V129V (GTG→GTC)	dusB →	tRNA‑dihydrouridine synthase B
RA	2,236,063	G→A	7.3%	V403V (GTG→GTA)	purH →	fused IMP cyclohydrolase and phosphoribosylaminoimidazolecarboxamide formyltransferase
RA	2,245,573	T→C	17.0%	intergenic (‑89/‑6)	nudC ← / → rsd	NADH pyrophosphatase/stationary phase protein, binds sigma 70 RNA polymerase subunit
RA	2,264,627	T→C	12.5%	K6K (AAA→AAG)	nusG ←	transcription termination factor
RA	2,264,986	T→C	17.5%	E15G (GAA→GGA)	secE ←	preprotein translocase membrane subunit
RA	2,280,720	G→A	30.3%	R201* (CGA→TGA)	fabR ←	DNA‑binding transcriptional repressor
RA	2,292,617	A→G	51.7%	intergenic (+168/‑253)	fsaB → / → gldA	fructose‑6‑phosphate aldolase 2/glycerol dehydrogenase, NAD
RA	2,294,050	A→C	26.0%	intergenic (+77/‑198)	gldA → / → yijF	glycerol dehydrogenase, NAD/conserved hypothetical protein
RA	2,294,089	C→A	19.2%	intergenic (+116/‑159)	gldA → / → yijF	glycerol dehydrogenase, NAD/conserved hypothetical protein
RA	2,297,298	T→C	18.3%	E258G (GAA→GGA)	katG ←	catalase/hydroperoxidase HPI(I)
RA	2,303,886	G→A	10.4%	intergenic (+59/‑125)	metJ → / → yiiX	DNA‑binding transcriptional repressor, S‑adenosylmethionine‑binding/predicted peptidoglycan peptidase
RA	2,303,887	T→G	10.4%	intergenic (+60/‑124)	metJ → / → yiiX	DNA‑binding transcriptional repressor, S‑adenosylmethionine‑binding/predicted peptidoglycan peptidase
RA	2,303,888	C→G	10.4%	intergenic (+61/‑123)	metJ → / → yiiX	DNA‑binding transcriptional repressor, S‑adenosylmethionine‑binding/predicted peptidoglycan peptidase
RA	2,303,892:1	+C	11.4%	intergenic (+65/‑119)	metJ → / → yiiX	DNA‑binding transcriptional repressor, S‑adenosylmethionine‑binding/predicted peptidoglycan peptidase
RA	2,303,893:1	+G	10.6%	intergenic (+66/‑118)	metJ → / → yiiX	DNA‑binding transcriptional repressor, S‑adenosylmethionine‑binding/predicted peptidoglycan peptidase
RA	2,303,898	T→C	12.2%	intergenic (+71/‑113)	metJ → / → yiiX	DNA‑binding transcriptional repressor, S‑adenosylmethionine‑binding/predicted peptidoglycan peptidase
RA	2,303,904	G→A	11.5%	intergenic (+77/‑107)	metJ → / → yiiX	DNA‑binding transcriptional repressor, S‑adenosylmethionine‑binding/predicted peptidoglycan peptidase
RA	2,303,907	T→A	13.2%	intergenic (+80/‑104)	metJ → / → yiiX	DNA‑binding transcriptional repressor, S‑adenosylmethionine‑binding/predicted peptidoglycan peptidase
RA	2,303,913	C→T	13.8%	intergenic (+86/‑98)	metJ → / → yiiX	DNA‑binding transcriptional repressor, S‑adenosylmethionine‑binding/predicted peptidoglycan peptidase
RA	2,303,925	C→A	14.2%	intergenic (+98/‑86)	metJ → / → yiiX	DNA‑binding transcriptional repressor, S‑adenosylmethionine‑binding/predicted peptidoglycan peptidase
RA	2,311,509	T→C	15.1%	intergenic (+20/‑47)	hslU → / → menA	molecular chaperone and ATPase component of HslUV protease/1,4‑dihydroxy‑2‑naphthoate octaprenyltransferase
RA	2,316,796	G→A	28.0%	L157L (CTG→CTA)	glpX →	fructose 1,6‑bisphosphatase II
RA	2,329,107	T→C	19.6%	intergenic (‑24/+125)	yiiM ← / ← kdgT	conserved hypothetical protein/2‑keto‑3‑deoxy‑D‑gluconate transporter
RA	2,331,252	A→C	61.1%	intergenic (‑157/+273)	sodA ← / ← fdhD	superoxide dismutase, Mn/formate dehydrogenase formation protein
RA	2,334,140	A→G	17.4%	K530R (AAG→AGG)	fdoG →	formate dehydrogenase‑O, large subunit
RA	2,346,508	G→A	18.9%	P21S (CCA→TCA)	hemN ←	coproporphyrinogen III oxidase, SAM and NAD(P)H dependent, oxygen‑independent
RA	2,359,867	G→A	43.2%	noncoding (1228/2905 nt)	rrlA ←	23S ribosomal RNA
RA	2,359,876	C→T	41.1%	noncoding (1219/2905 nt)	rrlA ←	23S ribosomal RNA
RA	2,371,040	T→C	8.3%	intergenic (+36/+345)	fadA → / ← fre	3‑ketoacyl‑CoA thiolase/flavin reductase
RA	2,371,046	G→A	8.9%	intergenic (+42/+339)	fadA → / ← fre	3‑ketoacyl‑CoA thiolase/flavin reductase
RA	2,371,048	T→A	9.1%	intergenic (+44/+337)	fadA → / ← fre	3‑ketoacyl‑CoA thiolase/flavin reductase
RA	2,371,056	C→G	9.2%	intergenic (+52/+329)	fadA → / ← fre	3‑ketoacyl‑CoA thiolase/flavin reductase
RA	2,371,634	C→T	12.8%	E151E (GAG→GAA)	fre ←	flavin reductase
RA	2,376,834	G→A	10.6%	V518V (GTC→GTT)	ubiB ←	2‑octaprenylphenol hydroxylase
RA	2,401,662	T→C	8.5%	K222R (AAA→AGA)	xerC ←	site‑specific tyrosine recombinase
RA	2,419,194	C→T	9.1%	E273E (GAG→GAA)	wzyE ←	predicted Wzy protein involved in ECA polysaccharide chain elongation
RA	2,421,757	C→T	17.8%	M193I (ATG→ATA)	wzxE ←	O‑antigen translocase
RA	2,425,537	G→A	12.8%	T185T (ACC→ACT)	rffG ←	dTDP‑glucose 4,6‑dehydratase
RA	2,425,789	G→A	6.4%	N101N (AAC→AAT)	rffG ←	dTDP‑glucose 4,6‑dehydratase
RA	2,425,804	C→T	7.0%	A96A (GCG→GCA)	rffG ←	dTDP‑glucose 4,6‑dehydratase
RA	2,425,807	T→C	7.0%	A95A (GCA→GCG)	rffG ←	dTDP‑glucose 4,6‑dehydratase
RA	2,425,810	C→A	7.6%	P94P (CCG→CCT)	rffG ←	dTDP‑glucose 4,6‑dehydratase
RA	2,425,816	G→T	6.0%	D92E (GAC→GAA) ‡	rffG ←	dTDP‑glucose 4,6‑dehydratase
RA	2,425,817	T→G	6.1%	D92A (GAC→GCC) ‡	rffG ←	dTDP‑glucose 4,6‑dehydratase
RA	2,425,818	C→T	6.1%	D92N (GAC→AAC) ‡	rffG ←	dTDP‑glucose 4,6‑dehydratase
RA	2,425,822	A→T	5.9%	S90S (TCT→TCA)	rffG ←	dTDP‑glucose 4,6‑dehydratase
RA	2,429,480	C→T	16.0%	G35S (GGC→AGC)	wzzE ←	Entobacterial Common Antigen (ECA) polysaccharide chain length modulation protein
RA	2,430,365	T→C	45.2%	I111M (ATA→ATG)	rfe ←	UDP‑GlcNAc:undecaprenylphosphate GlcNAc‑1‑phosphate transferase
RA	2,432,788	C→T	15.1%	G22E (GGG→GAG)	trxA ←	thioredoxin 1
RA	2,477,458	T→C	21.3%	V168V (GTT→GTC)	pstA →	phosphate transporter subunit
RA	2,477,887	A→G	21.4%	intergenic (+42/‑141)	pstA → / → pstB	phosphate transporter subunit/phosphate transporter subunit
RA	2,492,284	C→T	12.9%	L361L (CTG→TTG)	gyrB →	DNA gyrase, subunit B
RA	2,493,652	A→C	13.5%	intergenic (+34/‑341)	gyrB → / → ibpA	DNA gyrase, subunit B/heat shock chaperone
RA	2,493,675	C→T	22.9%	intergenic (+57/‑318)	gyrB → / → ibpA	DNA gyrase, subunit B/heat shock chaperone
RA	2,493,676	T→C	24.6%	intergenic (+58/‑317)	gyrB → / → ibpA	DNA gyrase, subunit B/heat shock chaperone
RA	2,493,694	T→G	20.4%	intergenic (+76/‑299)	gyrB → / → ibpA	DNA gyrase, subunit B/heat shock chaperone
RA	2,493,697	T→C	19.3%	intergenic (+79/‑296)	gyrB → / → ibpA	DNA gyrase, subunit B/heat shock chaperone
RA	2,493,839	A→C	42.0%	intergenic (+221/‑154)	gyrB → / → ibpA	DNA gyrase, subunit B/heat shock chaperone
RA	2,494,512	A→G	7.4%	intergenic (+106/‑6)	ibpA → / → ibpB	heat shock chaperone/heat shock chaperone
RA	2,507,530	G→A	13.1%	P198P (CCG→CCA)	yicI →	predicted alpha‑glucosidase
RA	2,547,976	T→C	24.6%	V62A (GTT→GCT)	htrL →	hypothetical protein
RA	2,549,665	G→A	18.7%	G248R (GGG→AGG)	kbl →	glycine C‑acetyltransferase
RA	2,562,540	G→T	7.9%	L513M (CTG→ATG)	lldP ←	L‑lactate permease
RA	2,562,544	T→C	8.4%	V511V (GTA→GTG) ‡	lldP ←	L‑lactate permease
RA	2,562,545	A→G	8.6%	V511A (GTA→GCA) ‡	lldP ←	L‑lactate permease
RA	2,562,546	C→T	9.7%	V511I (GTA→ATA) ‡	lldP ←	L‑lactate permease
RA	2,562,550	C→G	9.8%	A509A (GCG→GCC)	lldP ←	L‑lactate permease
RA	2,562,553	A→G	10.6%	C508C (TGT→TGC)	lldP ←	L‑lactate permease
RA	2,562,559	G→C	11.1%	I506M (ATC→ATG) ‡	lldP ←	L‑lactate permease
RA	2,562,561	T→C	11.1%	I506V (ATC→GTC) ‡	lldP ←	L‑lactate permease
RA	2,562,562	A→G	11.1%	A505A (GCT→GCC)	lldP ←	L‑lactate permease
RA	2,562,589	A→G	9.5%	G496G (GGT→GGC)	lldP ←	L‑lactate permease
RA	2,562,691	T→G	12.5%	S462S (TCA→TCC)	lldP ←	L‑lactate permease
RA	2,562,697	A→G	13.6%	D460D (GAT→GAC)	lldP ←	L‑lactate permease
RA	2,562,703	C→G	9.5%	G458G (GGG→GGC)	lldP ←	L‑lactate permease
RA	2,562,709	C→A	9.3%	L456L (CTG→CTT)	lldP ←	L‑lactate permease
RA	2,562,718	C→G	10.2%	G453G (GGG→GGC)	lldP ←	L‑lactate permease
RA	2,562,733	G→A	8.5%	F448F (TTC→TTT)	lldP ←	L‑lactate permease
RA	2,569,784	T→C	11.7%	I18I (ATT→ATC)	yibI →	predicted inner membrane protein
RA	2,569,787	T→C	11.7%	F19F (TTT→TTC)	yibI →	predicted inner membrane protein
RA	2,569,793	A→G	11.0%	G21G (GGA→GGG)	yibI →	predicted inner membrane protein
RA	2,569,799	C→T	10.5%	I23I (ATC→ATT)	yibI →	predicted inner membrane protein
RA	2,569,800	G→A	9.8%	A24T (GCG→ACG) ‡	yibI →	predicted inner membrane protein
RA	2,569,801	C→T	9.9%	A24V (GCG→GTG) ‡	yibI →	predicted inner membrane protein
RA	2,569,802	G→T	9.8%	A24A (GCG→GCT) ‡	yibI →	predicted inner membrane protein
RA	2,569,803	A→T	9.6%	I25L (ATA→TTA)	yibI →	predicted inner membrane protein
RA	2,569,811	C→T	9.7%	D27D (GAC→GAT)	yibI →	predicted inner membrane protein
RA	2,569,814	C→T	9.3%	I28I (ATC→ATT)	yibI →	predicted inner membrane protein
RA	2,569,817	T→C	8.9%	P29P (CCT→CCC)	yibI →	predicted inner membrane protein
RA	2,569,820	T→C	8.4%	Y30Y (TAT→TAC)	yibI →	predicted inner membrane protein
RA	2,569,847	C→T	13.6%	P39P (CCC→CCT)	yibI →	predicted inner membrane protein
RA	2,569,859	T→C	18.8%	A43A (GCT→GCC)	yibI →	predicted inner membrane protein
RA	2,569,866	A→G	18.3%	T46A (ACG→GCG) ‡	yibI →	predicted inner membrane protein
RA	2,569,867	C→T	19.5%	T46M (ACG→ATG) ‡	yibI →	predicted inner membrane protein
RA	2,569,868	G→T	19.4%	T46T (ACG→ACT) ‡	yibI →	predicted inner membrane protein
RA	2,569,871	G→T	19.3%	A47A (GCG→GCT)	yibI →	predicted inner membrane protein
RA	2,569,874	C→T	17.4%	G48G (GGC→GGT)	yibI →	predicted inner membrane protein
RA	2,569,883	C→T	23.1%	S51S (AGC→AGT)	yibI →	predicted inner membrane protein
RA	2,569,892	T→G	18.7%	T54T (ACT→ACG)	yibI →	predicted inner membrane protein
RA	2,569,893	C→T	18.7%	L55L (CTG→TTG) ‡	yibI →	predicted inner membrane protein
RA	2,569,895	G→A	17.2%	L55L (CTG→CTA) ‡	yibI →	predicted inner membrane protein
RA	2,569,922	C→T	12.3%	I64I (ATC→ATT)	yibI →	predicted inner membrane protein
RA	2,569,928	G→C	10.0%	A66A (GCG→GCC)	yibI →	predicted inner membrane protein
RA	2,569,934	C→T	9.7%	L68L (CTC→CTT)	yibI →	predicted inner membrane protein
RA	2,570,755	T→G	7.9%	T220T (ACT→ACG)	yibH →	hypothetical protein
RA	2,570,756	G→A	7.9%	V221I (GTC→ATC) ‡	yibH →	hypothetical protein
RA	2,570,758	C→A	8.6%	V221V (GTC→GTA) ‡	yibH →	hypothetical protein
RA	2,570,759	A→G	8.1%	I222V (ATT→GTT) ‡	yibH →	hypothetical protein
RA	2,570,761	T→G	8.4%	I222M (ATT→ATG) ‡	yibH →	hypothetical protein
RA	2,570,764	C→T	8.2%	R223R (CGC→CGT)	yibH →	hypothetical protein
RA	2,570,774	A→G	6.8%	N227D (AAT→GAT)	yibH →	hypothetical protein
RA	2,570,779	C→T	6.6%	G228G (GGC→GGT)	yibH →	hypothetical protein
RA	2,570,782	C→T	6.0%	Y229Y (TAC→TAT)	yibH →	hypothetical protein
RA	2,570,785	T→G	6.0%	V230V (GTT→GTG)	yibH →	hypothetical protein
RA	2,570,788	T→C	5.9%	T231T (ACT→ACC)	yibH →	hypothetical protein
RA	2,570,800	C→T	8.7%	I235I (ATC→ATT)	yibH →	hypothetical protein
RA	2,570,803	C→T	6.6%	R236R (CGC→CGT)	yibH →	hypothetical protein
RA	2,570,806	A→G	6.2%	P237P (CCA→CCG)	yibH →	hypothetical protein
RA	2,570,812	A→C	6.7%	T239T (ACA→ACC)	yibH →	hypothetical protein
RA	2,570,833	G→A	8.4%	L246L (CTG→CTA)	yibH →	hypothetical protein
RA	2,570,848	C→G	7.4%	V251V (GTC→GTG)	yibH →	hypothetical protein
RA	2,570,851	C→T	7.6%	F252F (TTC→TTT)	yibH →	hypothetical protein
RA	2,570,854	C→A	7.9%	I253I (ATC→ATA)	yibH →	hypothetical protein
RA	2,571,121	C→T	7.7%	G342G (GGC→GGT)	yibH →	hypothetical protein
RA	2,571,124	C→T	7.8%	I343I (ATC→ATT)	yibH →	hypothetical protein
RA	2,571,148	C→T	13.9%	S351S (TCC→TCT)	yibH →	hypothetical protein
RA	2,571,151	C→T	13.9%	D352D (GAC→GAT)	yibH →	hypothetical protein
RA	2,571,166	T→C	18.9%	V357V (GTT→GTC)	yibH →	hypothetical protein
RA	2,571,178	G→C	18.1%	R361R (CGG→CGC)	yibH →	hypothetical protein
RA	2,571,187	G→A	16.6%	L364L (CTG→CTA)	yibH →	hypothetical protein
RA	2,571,188	C→T	16.6%	L365L (CTA→TTA)	yibH →	hypothetical protein
RA	2,571,191	A→C	16.2%	R366R (AGA→CGA) ‡	yibH →	hypothetical protein
RA	2,571,193	A→C	17.4%	R366S (AGA→AGC) ‡	yibH →	hypothetical protein
RA	2,571,206	A→G	12.3%	M371V (ATG→GTG)	yibH →	hypothetical protein
RA	2,571,214	T→C	10.8%	Y373Y (TAT→TAC)	yibH →	hypothetical protein
RA	2,571,225	A→T	16.4%	D377V (GAT→GTT)	yibH →	hypothetical protein
RA	2,571,326	T→C	15.5%	intergenic (+94/‑1685)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,571,329	T→G	17.2%	intergenic (+97/‑1682)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,571,330	T→C	17.2%	intergenic (+98/‑1681)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,571,338	T→G	20.7%	intergenic (+106/‑1673)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,571,344:1	+A	16.9%	intergenic (+112/‑1667)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,571,345	T→G	17.0%	intergenic (+113/‑1666)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,571,350	G→A	19.6%	intergenic (+118/‑1661)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,571,351	A→G	19.2%	intergenic (+119/‑1660)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,571,352	G→C	21.2%	intergenic (+120/‑1659)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,571,357	C→A	21.2%	intergenic (+125/‑1654)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,571,371	T→C	26.7%	intergenic (+139/‑1640)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,571,384	T→A	14.3%	intergenic (+152/‑1627)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,571,398	G→C	9.3%	intergenic (+166/‑1613)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,572,487	A→G	35.6%	intergenic (+1255/‑524)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,572,705	C→T	32.8%	intergenic (+1473/‑306)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,572,707	T→C	32.9%	intergenic (+1475/‑304)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,572,708	A→C	31.5%	intergenic (+1476/‑303)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,572,711	T→C	18.6%	intergenic (+1479/‑300)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,572,713	C→T	27.6%	intergenic (+1481/‑298)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,572,727	G→T	25.7%	intergenic (+1495/‑284)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,572,736	T→A	25.0%	intergenic (+1504/‑275)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,572,751	T→A	14.6%	intergenic (+1519/‑260)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,572,752	G→A	9.8%	intergenic (+1520/‑259)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,572,756	T→A	9.7%	intergenic (+1524/‑255)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,572,758	A→C	9.7%	intergenic (+1526/‑253)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,572,759	A→G	9.7%	intergenic (+1527/‑252)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,572,761	G→A	8.5%	intergenic (+1529/‑250)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,572,762	T→G	9.4%	intergenic (+1530/‑249)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,572,768	A→G	8.1%	intergenic (+1536/‑243)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,572,770	A→G	8.1%	intergenic (+1538/‑241)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,572,772	T→C	8.1%	intergenic (+1540/‑239)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,572,773	A→G	8.1%	intergenic (+1541/‑238)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,572,941	G→A	49.0%	intergenic (+1709/‑70)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,572,989	T→C	34.7%	intergenic (+1757/‑22)	yibH → / → ysaB	hypothetical protein/hypothetical protein
RA	2,573,339	T→C	28.8%	intergenic (+29/‑66)	ysaB → / → glyQ	hypothetical protein/glycine tRNA synthetase, alpha subunit
RA	2,584,304	A→G	7.5%	H991H (CAT→CAC) ‡	mdtF ←	multidrug transporter, RpoS‑dependent
RA	2,584,306	G→T	8.4%	H991N (CAT→AAT) ‡	mdtF ←	multidrug transporter, RpoS‑dependent
RA	2,584,314	A→G	11.7%	V988A (GTT→GCT)	mdtF ←	multidrug transporter, RpoS‑dependent
RA	2,584,316	C→T	11.6%	L987L (CTG→CTA)	mdtF ←	multidrug transporter, RpoS‑dependent
RA	2,584,322	C→T	13.6%	L985L (CTG→CTA) ‡	mdtF ←	multidrug transporter, RpoS‑dependent
RA	2,584,324	G→A	13.6%	L985L (CTG→TTG) ‡	mdtF ←	multidrug transporter, RpoS‑dependent
RA	2,584,325	C→T	13.6%	V984V (GTG→GTA)	mdtF ←	multidrug transporter, RpoS‑dependent
RA	2,584,343	C→G	13.8%	L978L (CTG→CTC)	mdtF ←	multidrug transporter, RpoS‑dependent
RA	2,584,361	T→A	10.8%	P972P (CCA→CCT)	mdtF ←	multidrug transporter, RpoS‑dependent
RA	2,586,002	T→G	6.3%	L425L (CTA→CTC)	mdtF ←	multidrug transporter, RpoS‑dependent
RA	2,586,011	T→C	8.6%	E422E (GAA→GAG)	mdtF ←	multidrug transporter, RpoS‑dependent
RA	2,586,015	G→A	8.0%	A421V (GCG→GTG) ‡	mdtF ←	multidrug transporter, RpoS‑dependent
RA	2,586,016	C→T	8.0%	A421T (GCG→ACG) ‡	mdtF ←	multidrug transporter, RpoS‑dependent
RA	2,586,017	A→C	8.2%	I420M (ATT→ATG)	mdtF ←	multidrug transporter, RpoS‑dependent
RA	2,586,020	G→C	7.5%	V419V (GTC→GTG)	mdtF ←	multidrug transporter, RpoS‑dependent
RA	2,586,023	A→G	7.7%	R418R (CGT→CGC)	mdtF ←	multidrug transporter, RpoS‑dependent
RA	2,586,047	G→T	13.1%	I410I (ATC→ATA)	mdtF ←	multidrug transporter, RpoS‑dependent
RA	2,586,050	G→C	13.7%	A409A (GCC→GCG)	mdtF ←	multidrug transporter, RpoS‑dependent
RA	2,586,053	G→A	13.7%	D408D (GAC→GAT)	mdtF ←	multidrug transporter, RpoS‑dependent
RA	2,586,059	C→G	13.3%	V406V (GTG→GTC)	mdtF ←	multidrug transporter, RpoS‑dependent
RA	2,586,062	C→G	13.3%	L405L (CTG→CTC)	mdtF ←	multidrug transporter, RpoS‑dependent
RA	2,586,065	T→C	10.6%	L404L (TTA→TTG) ‡	mdtF ←	multidrug transporter, RpoS‑dependent
RA	2,586,067	A→G	11.1%	L404L (TTA→CTA) ‡	mdtF ←	multidrug transporter, RpoS‑dependent
RA	2,586,071	T→G	10.2%	I402I (ATA→ATC)	mdtF ←	multidrug transporter, RpoS‑dependent
RA	2,586,074	C→G	9.2%	A401A (GCG→GCC)	mdtF ←	multidrug transporter, RpoS‑dependent
RA	2,586,077	C→A	9.7%	L400L (CTG→CTT)	mdtF ←	multidrug transporter, RpoS‑dependent
RA	2,587,282	T→C	10.9%	intergenic (‑6/+19)	mdtF ← / ← mdtE	multidrug transporter, RpoS‑dependent/multidrug resistance efflux transporter
RA	2,592,859	T→A	6.0%	N50I (AAT→ATT)	yhiF ←	predicted DNA‑binding ranscriptional regulator
RA	2,592,861	C→G	5.1%	M49I (ATG→ATC) ‡	yhiF ←	predicted DNA‑binding ranscriptional regulator
RA	2,592,863	T→A	5.2%	M49L (ATG→TTG) ‡	yhiF ←	predicted DNA‑binding ranscriptional regulator
RA	2,595,215	T→G	12.9%	T27T (ACA→ACC) ‡	arsC ←	arsenate reductase
RA	2,595,216	G→T	12.9%	T27K (ACA→AAA) ‡	arsC ←	arsenate reductase
RA	2,595,222	C→T	14.0%	S25N (AGC→AAC)	arsC ←	arsenate reductase
RA	2,595,227	G→A	12.5%	R23R (CGC→CGT) ‡	arsC ←	arsenate reductase
RA	2,595,228	C→T	12.5%	R23H (CGC→CAC) ‡	arsC ←	arsenate reductase
RA	2,595,230	G→A	12.3%	I22I (ATC→ATT) ‡	arsC ←	arsenate reductase
RA	2,595,232	T→G	12.5%	I22L (ATC→CTC) ‡	arsC ←	arsenate reductase
RA	2,595,245	A→G	21.8%	N17N (AAT→AAC)	arsC ←	arsenate reductase
RA	2,595,248	A→G	23.2%	R16R (CGT→CGC)	arsC ←	arsenate reductase
RA	2,595,251	C→T	23.9%	S15S (TCG→TCA)	arsC ←	arsenate reductase
RA	2,595,254	C→G	22.3%	T14T (ACG→ACC)	arsC ←	arsenate reductase
RA	2,595,260	G→A	24.5%	C12C (TGC→TGT)	arsC ←	arsenate reductase
RA	2,595,278	A→G	29.4%	I6I (ATT→ATC)	arsC ←	arsenate reductase
RA	2,595,306	C→A	33.3%	intergenic (‑11/+2)	arsC ← / ← arsB	arsenate reductase/arsenite/antimonite transporter
RA	2,595,319	A→C	28.4%	F427V (TTC→GTC)	arsB ←	arsenite/antimonite transporter
RA	2,595,326	A→C	26.7%	R424R (CGT→CGG)	arsB ←	arsenite/antimonite transporter
RA	2,595,329	T→C	25.0%	L423L (CTA→CTG) ‡	arsB ←	arsenite/antimonite transporter
RA	2,595,330	A→C	24.4%	L423R (CTA→CGA) ‡	arsB ←	arsenite/antimonite transporter
RA	2,595,331	G→A	25.0%	L423L (CTA→TTA) ‡	arsB ←	arsenite/antimonite transporter
RA	2,595,341	A→G	21.7%	A419A (GCT→GCC)	arsB ←	arsenite/antimonite transporter
RA	2,595,347	C→A	21.6%	T417T (ACG→ACT)	arsB ←	arsenite/antimonite transporter
RA	2,595,350	C→G	20.5%	V416V (GTG→GTC)	arsB ←	arsenite/antimonite transporter
RA	2,595,362	A→C	18.9%	P412P (CCT→CCG)	arsB ←	arsenite/antimonite transporter
RA	2,595,367	G→C	18.7%	L411V (CTG→GTG)	arsB ←	arsenite/antimonite transporter
RA	2,595,368	G→A	18.6%	T410T (ACC→ACT)	arsB ←	arsenite/antimonite transporter
RA	2,595,376	T→C	19.3%	I408V (ATC→GTC)	arsB ←	arsenite/antimonite transporter
RA	2,595,380	C→G	20.5%	G406G (GGG→GGC)	arsB ←	arsenite/antimonite transporter
RA	2,595,383	T→G	19.3%	T405T (ACA→ACC)	arsB ←	arsenite/antimonite transporter
RA	2,595,404	G→A	21.5%	S398S (AGC→AGT) ‡	arsB ←	arsenite/antimonite transporter
RA	2,595,405	C→G	21.8%	S398T (AGC→ACC) ‡	arsB ←	arsenite/antimonite transporter
RA	2,595,410	A→T	19.7%	T396T (ACT→ACA)	arsB ←	arsenite/antimonite transporter
RA	2,595,425	C→G	9.9%	S391S (TCG→TCC) ‡	arsB ←	arsenite/antimonite transporter
RA	2,595,427	A→C	9.7%	S391A (TCG→GCG) ‡	arsB ←	arsenite/antimonite transporter
RA	2,595,431	T→C	9.9%	V389V (GTA→GTG)	arsB ←	arsenite/antimonite transporter
RA	2,595,434	G→A	10.0%	H388H (CAC→CAT)	arsB ←	arsenite/antimonite transporter
RA	2,595,443	G→C	8.3%	L385L (CTC→CTG)	arsB ←	arsenite/antimonite transporter
RA	2,595,446	T→C	7.7%	L384L (CTA→CTG)	arsB ←	arsenite/antimonite transporter
RA	2,595,449	C→A	7.6%	T383T (ACG→ACT)	arsB ←	arsenite/antimonite transporter
RA	2,595,452	A→T	7.7%	A382A (GCT→GCA)	arsB ←	arsenite/antimonite transporter
RA	2,595,458	G→A	7.4%	S380S (AGC→AGT)	arsB ←	arsenite/antimonite transporter
RA	2,595,461	A→G	6.2%	G379G (GGT→GGC)	arsB ←	arsenite/antimonite transporter
RA	2,595,467	T→C	10.4%	P377P (CCA→CCG)	arsB ←	arsenite/antimonite transporter
RA	2,595,473	A→G	14.4%	I375I (ATT→ATC)	arsB ←	arsenite/antimonite transporter
RA	2,595,482	T→G	22.6%	G372G (GGA→GGC)	arsB ←	arsenite/antimonite transporter
RA	2,595,485	C→T	21.5%	L371L (TTG→TTA)	arsB ←	arsenite/antimonite transporter
RA	2,595,491	G→A	25.0%	C369C (TGC→TGT)	arsB ←	arsenite/antimonite transporter
RA	2,595,514	C→T	24.6%	V362I (GTT→ATT)	arsB ←	arsenite/antimonite transporter
RA	2,595,518	C→T	25.2%	A360A (GCG→GCA)	arsB ←	arsenite/antimonite transporter
RA	2,595,521	T→C	23.2%	E359E (GAA→GAG)	arsB ←	arsenite/antimonite transporter
RA	2,595,529	T→C	21.6%	I357V (ATC→GTC)	arsB ←	arsenite/antimonite transporter
RA	2,595,530	A→G	21.8%	V356V (GTT→GTC)	arsB ←	arsenite/antimonite transporter
RA	2,595,538	A→T	16.5%	S354T (TCT→ACT)	arsB ←	arsenite/antimonite transporter
RA	2,595,539	T→C	15.8%	A353A (GCA→GCG)	arsB ←	arsenite/antimonite transporter
RA	2,595,545	G→A	16.5%	S351S (AGC→AGT)	arsB ←	arsenite/antimonite transporter
RA	2,595,548	G→C	16.5%	G350G (GGC→GGG)	arsB ←	arsenite/antimonite transporter
RA	2,595,551	A→G	16.3%	D349D (GAT→GAC)	arsB ←	arsenite/antimonite transporter
RA	2,595,557	G→C	18.1%	S347S (TCC→TCG)	arsB ←	arsenite/antimonite transporter
RA	2,595,562	A→G	15.0%	L346L (TTG→CTG)	arsB ←	arsenite/antimonite transporter
RA	2,595,566	G→A	16.0%	G344G (GGC→GGT)	arsB ←	arsenite/antimonite transporter
RA	2,595,571	C→T	16.0%	V343I (GTT→ATT)	arsB ←	arsenite/antimonite transporter
RA	2,595,575	T→C	18.7%	V341V (GTA→GTG)	arsB ←	arsenite/antimonite transporter
RA	2,595,590	G→A	9.8%	N336N (AAC→AAT)	arsB ←	arsenite/antimonite transporter
RA	2,595,596	A→C	22.2%	I334M (ATT→ATG) ‡	arsB ←	arsenite/antimonite transporter
RA	2,595,598	T→C	22.2%	I334V (ATT→GTT) ‡	arsB ←	arsenite/antimonite transporter
RA	2,595,599	A→T	25.5%	S333S (TCT→TCA)	arsB ←	arsenite/antimonite transporter
RA	2,595,602	A→T	21.0%	S332S (TCT→TCA)	arsB ←	arsenite/antimonite transporter
RA	2,595,608	G→A	17.0%	F330F (TTC→TTT)	arsB ←	arsenite/antimonite transporter
RA	2,595,611	G→T	17.0%	A329A (GCC→GCA)	arsB ←	arsenite/antimonite transporter
RA	2,595,695	T→G	7.4%	L301F (TTA→TTC)	arsB ←	arsenite/antimonite transporter
RA	2,595,698	T→C	7.1%	G300G (GGA→GGG)	arsB ←	arsenite/antimonite transporter
RA	2,595,701	G→T	7.5%	A299A (GCC→GCA)	arsB ←	arsenite/antimonite transporter
RA	2,595,719	A→G	10.8%	V293V (GTT→GTC)	arsB ←	arsenite/antimonite transporter
RA	2,595,725	C→G	12.5%	L291L (CTG→CTC) ‡	arsB ←	arsenite/antimonite transporter
RA	2,595,727	G→T	11.6%	L291M (CTG→ATG) ‡	arsB ←	arsenite/antimonite transporter
RA	2,595,728	A→G	11.9%	Y290Y (TAT→TAC)	arsB ←	arsenite/antimonite transporter
RA	2,595,737	G→C	14.9%	L287L (CTC→CTG)	arsB ←	arsenite/antimonite transporter
RA	2,595,740	C→T	15.1%	S286S (TCG→TCA)	arsB ←	arsenite/antimonite transporter
RA	2,595,746	G→A	15.5%	I284I (ATC→ATT)	arsB ←	arsenite/antimonite transporter
RA	2,595,749	G→A	14.5%	V283V (GTC→GTT)	arsB ←	arsenite/antimonite transporter
RA	2,595,752	A→G	14.6%	I282I (ATT→ATC)	arsB ←	arsenite/antimonite transporter
RA	2,595,761	G→T	11.0%	P279P (CCC→CCA)	arsB ←	arsenite/antimonite transporter
RA	2,595,764	G→C	11.1%	A278A (GCC→GCG)	arsB ←	arsenite/antimonite transporter
RA	2,595,782	A→T	9.0%	G272G (GGT→GGA)	arsB ←	arsenite/antimonite transporter
RA	2,595,785	C→G	9.1%	T271T (ACG→ACC)	arsB ←	arsenite/antimonite transporter
RA	2,595,788	A→G	8.3%	N270N (AAT→AAC)	arsB ←	arsenite/antimonite transporter
RA	2,595,791	A→G	8.0%	I269I (ATT→ATC)	arsB ←	arsenite/antimonite transporter
RA	2,595,796	C→A	6.7%	A268S (GCG→TCG)	arsB ←	arsenite/antimonite transporter
RA	2,596,103	A→C	9.0%	A165A (GCT→GCG)	arsB ←	arsenite/antimonite transporter
RA	2,596,106	G→C	9.2%	S164S (TCC→TCG)	arsB ←	arsenite/antimonite transporter
RA	2,596,109	A→G	9.6%	V163V (GTT→GTC)	arsB ←	arsenite/antimonite transporter
RA	2,596,127	G→A	26.8%	S157S (TCC→TCT)	arsB ←	arsenite/antimonite transporter
RA	2,596,130	G→A	26.5%	V156V (GTC→GTT)	arsB ←	arsenite/antimonite transporter
RA	2,596,136	A→G	28.3%	L154L (CTT→CTC)	arsB ←	arsenite/antimonite transporter
RA	2,596,151	G→C	28.8%	T149T (ACC→ACG)	arsB ←	arsenite/antimonite transporter
RA	2,596,157	G→T	28.8%	A147A (GCC→GCA)	arsB ←	arsenite/antimonite transporter
RA	2,596,163	G→A	18.5%	F145F (TTC→TTT)	arsB ←	arsenite/antimonite transporter
RA	2,596,169	G→T	19.2%	A143A (GCC→GCA)	arsB ←	arsenite/antimonite transporter
RA	2,596,172	C→A	18.6%	A142A (GCG→GCT)	arsB ←	arsenite/antimonite transporter
RA	2,596,178	C→G	14.5%	V140V (GTG→GTC)	arsB ←	arsenite/antimonite transporter
RA	2,596,181	G→A	10.7%	F139F (TTC→TTT)	arsB ←	arsenite/antimonite transporter
RA	2,596,184	C→G	10.3%	A138A (GCG→GCC)	arsB ←	arsenite/antimonite transporter
RA	2,603,818	A→G	24.1%	Y285H (TAC→CAC)	yhiP ←	predicted transporter
RA	2,605,504	A→G	23.9%	intergenic (‑83/‑308)	uspA ← / → yhiO	universal stress global response regulator/predicted universal stress (ethanol tolerance) protein B
RA	2,608,096	T→C	21.0%	intergenic (‑206/+104)	pitA ← / ← nikR	phosphate transporter, low‑affinity/DNA‑binding transcriptional regulator, Ni‑binding
RA	2,608,105:1	+C	20.6%	intergenic (‑215/+95)	pitA ← / ← nikR	phosphate transporter, low‑affinity/DNA‑binding transcriptional regulator, Ni‑binding
RA	2,636,243	G→A	10.2%	intergenic (+63/‑35)	ugpB → / → ugpA	glycerol‑3‑phosphate transporter subunit/glycerol‑3‑phosphate transporter subunit
RA	2,645,155	A→G	13.4%	E374E (GAA→GAG)	gntU →	gluconate transporter, low affinity GNT 1 system
RA	2,663,990	G→A	17.6%	G325E (GGG→GAG)	rtcB →	conserved hypothetical protein
RA	2,673,919	C→A	22.7%	G207C (GGT→TGT)	gntT ←	gluconate transporter, high‑affinity GNT I system
RA	2,675,295	G→A	24.3%	L60L (CTG→TTG)	gntY ←	predicted gluconate transport associated protein
RA	2,677,365	T→A	7.8%	M189L (ATG→TTG)	yhgA ←	predicted transposase
RA	2,677,369	G→A	7.7%	D187D (GAC→GAT)	yhgA ←	predicted transposase
RA	2,677,375	T→C	7.8%	Q185Q (CAA→CAG)	yhgA ←	predicted transposase
RA	2,677,390	T→C	13.0%	Q180Q (CAA→CAG)	yhgA ←	predicted transposase
RA	2,695,039	C→T	16.4%	F31F (TTC→TTT)	nudE →	ADP‑ribose diphosphatase
RA	2,704,553	G→A	9.8%	R255H (CGC→CAC)	damX →	hypothetical protein
RA	2,705,682	A→T	8.1%	D167V (GAT→GTT)	dam →	DNA adenine methylase
RA	2,708,913	G→A	49.4%	E54E (GAG→GAA)	yhfZ →	conserved hypothetical protein
RA	2,747,793	T→C	14.7%	I103T (ATC→ACC)	rplO →	50S ribosomal subunit protein L15
RA	2,749,714	A→T	6.1%	D54V (GAC→GTC)	rpsM →	30S ribosomal subunit protein S13
RA	2,749,720	T→A	5.1%	L56Q (CTG→CAG)	rpsM →	30S ribosomal subunit protein S13
RA	2,754,270	A→G	16.4%	V413A (GTG→GCG)	trkA ←	NAD‑binding component of TrK potassium transporter
RA	2,772,254	C→T	15.5%	P527S (CCA→TCA)	aceB →	malate synthase A
RA	2,790,638	C→T	13.2%	intergenic (+33/‑742)	pgi → / → ubiC	glucosephosphate isomerase/chorismate pyruvate lyase
RA	2,790,674	G→T	24.3%	intergenic (+69/‑706)	pgi → / → ubiC	glucosephosphate isomerase/chorismate pyruvate lyase
RA	2,790,849	C→T	44.7%	intergenic (+244/‑531)	pgi → / → ubiC	glucosephosphate isomerase/chorismate pyruvate lyase
RA	2,816,309	T→C	22.0%	intergenic (‑52/‑34)	soxS ← / → soxR	DNA‑binding transcriptional dual regulator/DNA‑binding transcriptional dual regulator, Fe‑S center for redox‑sensing
RA	2,823,628	G→A	57.4%	intergenic (+373/+585)	nrfG → / ← pheU	heme lyase (NrfEFG) for insertion of heme into c552, subunit NrfG/tRNA‑Phe
RA	2,823,871	A→G	38.6%	intergenic (+616/+342)	nrfG → / ← pheU	heme lyase (NrfEFG) for insertion of heme into c552, subunit NrfG/tRNA‑Phe
RA	2,870,827	G→A	8.5%	intergenic (+70/‑110)	rnr → / → rlmB	exoribonuclease R, RNase R/23S rRNA (Gm2251)‑methyltransferase
RA	2,870,831	A→G	8.7%	intergenic (+74/‑106)	rnr → / → rlmB	exoribonuclease R, RNase R/23S rRNA (Gm2251)‑methyltransferase
RA	2,870,832	C→T	8.0%	intergenic (+75/‑105)	rnr → / → rlmB	exoribonuclease R, RNase R/23S rRNA (Gm2251)‑methyltransferase
RA	2,870,833	G→A	8.3%	intergenic (+76/‑104)	rnr → / → rlmB	exoribonuclease R, RNase R/23S rRNA (Gm2251)‑methyltransferase
RA	2,870,836	T→A	9.1%	intergenic (+79/‑101)	rnr → / → rlmB	exoribonuclease R, RNase R/23S rRNA (Gm2251)‑methyltransferase
RA	2,870,847	Δ1 bp	8.0%	intergenic (+90/‑90)	rnr → / → rlmB	exoribonuclease R, RNase R/23S rRNA (Gm2251)‑methyltransferase
RA	2,870,848	C→G	8.0%	intergenic (+91/‑89)	rnr → / → rlmB	exoribonuclease R, RNase R/23S rRNA (Gm2251)‑methyltransferase
RA	2,870,850	T→A	7.8%	intergenic (+93/‑87)	rnr → / → rlmB	exoribonuclease R, RNase R/23S rRNA (Gm2251)‑methyltransferase
RA	2,870,855	A→G	10.0%	intergenic (+98/‑82)	rnr → / → rlmB	exoribonuclease R, RNase R/23S rRNA (Gm2251)‑methyltransferase
RA	2,870,865	A→T	8.6%	intergenic (+108/‑72)	rnr → / → rlmB	exoribonuclease R, RNase R/23S rRNA (Gm2251)‑methyltransferase
RA	2,886,319	G→A	11.3%	G191S (GGT→AGT)	ytfI →	hypothetical protein
RA	2,891,414	C→A	54.4%	P23P (CCC→CCA)	ytfQ →	predicted sugar transporter subunit
RA	2,892,325	T→C	18.2%	intergenic (+23/‑117)	ytfQ → / → ytfR	predicted sugar transporter subunit/predicted sugar transporter subunit
RA	2,892,345	C→T	38.7%	intergenic (+43/‑97)	ytfQ → / → ytfR	predicted sugar transporter subunit/predicted sugar transporter subunit
RA	2,892,346	T→C	11.6%	intergenic (+44/‑96)	ytfQ → / → ytfR	predicted sugar transporter subunit/predicted sugar transporter subunit
RA	2,892,348	G→A	33.3%	intergenic (+46/‑94)	ytfQ → / → ytfR	predicted sugar transporter subunit/predicted sugar transporter subunit
RA	2,913,962	G→A	11.7%	intergenic (‑45/+236)	pyrL ← / ← yjgH	pyrBI operon leader peptide/predicted mRNA endoribonuclease
RA	2,918,721	T→C	12.5%	K325K (AAA→AAG)	argI ←	ornithine carbamoyltransferase 1
RA	2,918,724	G→A	11.8%	I324I (ATC→ATT)	argI ←	ornithine carbamoyltransferase 1
RA	2,918,727	A→C	12.5%	T323T (ACT→ACG)	argI ←	ornithine carbamoyltransferase 1
RA	2,918,736	A→C	15.5%	R320R (CGT→CGG)	argI ←	ornithine carbamoyltransferase 1
RA	2,918,751	A→G	17.1%	D315D (GAT→GAC)	argI ←	ornithine carbamoyltransferase 1
RA	2,918,754	A→G	14.3%	F314F (TTT→TTC)	argI ←	ornithine carbamoyltransferase 1
RA	2,918,757	A→C	14.3%	V313V (GTT→GTG)	argI ←	ornithine carbamoyltransferase 1
RA	2,918,760	A→G	12.6%	I312I (ATT→ATC)	argI ←	ornithine carbamoyltransferase 1
RA	2,918,766	G→C	8.8%	A310A (GCC→GCG)	argI ←	ornithine carbamoyltransferase 1
RA	2,918,769	G→C	8.8%	A309A (GCC→GCG)	argI ←	ornithine carbamoyltransferase 1
RA	2,918,772	A→C	7.9%	S308S (TCT→TCG)	argI ←	ornithine carbamoyltransferase 1
RA	2,918,775	T→C	7.8%	E307E (GAA→GAG)	argI ←	ornithine carbamoyltransferase 1
RA	2,918,778	G→A	6.3%	F306F (TTC→TTT)	argI ←	ornithine carbamoyltransferase 1
RA	2,918,781	G→C	6.3%	V305V (GTC→GTG)	argI ←	ornithine carbamoyltransferase 1
RA	2,918,787	A→G	6.7%	D303D (GAT→GAC)	argI ←	ornithine carbamoyltransferase 1
RA	2,918,790	A→C	6.8%	T302T (ACT→ACG)	argI ←	ornithine carbamoyltransferase 1
RA	2,918,793	G→C	6.4%	V301V (GTC→GTG)	argI ←	ornithine carbamoyltransferase 1
RA	2,918,796	T→C	5.1%	E300E (GAA→GAG)	argI ←	ornithine carbamoyltransferase 1
RA	2,918,948	A→G	10.0%	L250L (TTG→CTG)	argI ←	ornithine carbamoyltransferase 1
RA	2,918,949	T→C	10.0%	A249A (GCA→GCG)	argI ←	ornithine carbamoyltransferase 1
RA	2,918,958	T→C	13.5%	E246E (GAA→GAG)	argI ←	ornithine carbamoyltransferase 1
RA	2,918,961	C→T	13.5%	A245A (GCG→GCA)	argI ←	ornithine carbamoyltransferase 1
RA	2,918,967	T→C	14.1%	K243K (AAA→AAG)	argI ←	ornithine carbamoyltransferase 1
RA	2,918,976	T→G	14.6%	A240A (GCA→GCC)	argI ←	ornithine carbamoyltransferase 1
RA	2,918,979	T→C	14.8%	E239E (GAA→GAG)	argI ←	ornithine carbamoyltransferase 1
RA	2,918,982	C→G	15.3%	G238G (GGG→GGC)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,000	A→G	13.6%	D232D (GAT→GAC)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,018	A→C	11.5%	A226A (GCT→GCG)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,021	A→G	11.2%	G225G (GGT→GGC)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,024	T→C	9.5%	E224E (GAA→GAG) ‡	argI ←	ornithine carbamoyltransferase 1
RA	2,919,026	C→T	9.5%	E224K (GAA→AAA) ‡	argI ←	ornithine carbamoyltransferase 1
RA	2,919,030	T→G	7.3%	G222G (GGA→GGC)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,033	C→T	7.5%	K221K (AAG→AAA) ‡	argI ←	ornithine carbamoyltransferase 1
RA	2,919,034	T→G	7.4%	K221T (AAG→ACG) ‡	argI ←	ornithine carbamoyltransferase 1
RA	2,919,035	T→C	7.4%	K221E (AAG→GAG) ‡	argI ←	ornithine carbamoyltransferase 1
RA	2,919,039	G→C	7.7%	V219V (GTC→GTG)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,042	A→G	7.3%	D218D (GAT→GAC)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,048	A→C	7.5%	T216T (ACT→ACG)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,054	C→A	7.0%	T214T (ACG→ACT)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,153	A→C	9.7%	G181G (GGT→GGG)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,159	A→C	10.0%	L179L (CTT→CTG)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,168	A→C	10.1%	A176A (GCT→GCG)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,174	G→C	10.1%	L174L (CTC→CTG)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,183	A→G	15.6%	N171N (AAT→AAC)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,198	A→G	20.3%	R166R (CGT→CGC)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,204	G→A	23.5%	D164D (GAC→GAT)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,207	A→G	25.0%	G163G (GGT→GGC)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,210	T→C	23.7%	A162A (GCA→GCG)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,213	A→G	23.0%	Y161Y (TAT→TAC)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,228	T→C	20.8%	E156E (GAA→GAG)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,234	G→A	21.6%	F154F (TTC→TTT)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,240	T→C	23.1%	K152K (AAA→AAG)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,246	G→C	22.6%	P150P (CCC→CCG)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,251	A→G	20.7%	L149L (TTG→CTG)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,252	A→G	21.0%	H148H (CAT→CAC)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,267	G→C	13.9%	L143L (CTC→CTG) ‡	argI ←	ornithine carbamoyltransferase 1
RA	2,919,269	G→T	14.2%	L143I (CTC→ATC) ‡	argI ←	ornithine carbamoyltransferase 1
RA	2,919,270	A→C	14.2%	L142L (CTT→CTG)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,273	A→G	14.3%	D141D (GAT→GAC)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,288	C→G	8.9%	T136T (ACG→ACC)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,291	G→C	8.7%	P135P (CCC→CCG)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,294	A→G	8.8%	H134H (CAT→CAC)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,399	G→C	7.8%	R99R (CGC→CGG)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,402	A→C	7.9%	G98G (GGT→GGG)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,405	A→G	7.8%	L97L (CTT→CTC)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,408	C→A	6.3%	V96V (GTG→GTT)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,411	G→C	5.8%	R95R (CGC→CGG)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,423	T→C	8.9%	K91K (AAA→AAG)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,429	C→T	10.4%	S89S (TCG→TCA)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,441	A→C	12.8%	G85G (GGT→GGG)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,459	T→C	16.3%	P79P (CCA→CCG)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,462	G→C	14.5%	G78G (GGC→GGG)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,465	G→T	14.5%	L77L (CTC→CTA) ‡	argI ←	ornithine carbamoyltransferase 1
RA	2,919,467	G→A	14.6%	L77F (CTC→TTC) ‡	argI ←	ornithine carbamoyltransferase 1
RA	2,919,471	A→G	14.6%	T75T (ACT→ACC)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,480	A→C	16.5%	A72A (GCT→GCG)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,483	A→G	16.8%	G71G (GGT→GGC)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,493	T→A	22.0%	Y68F (TAT→TTT)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,516	T→A	30.3%	R60R (CGA→CGT)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,564	A→G	21.2%	T44T (ACT→ACC)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,567	G→A	19.8%	L43L (CTC→CTT)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,570	T→C	13.7%	K42K (AAA→AAG)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,573	G→C	14.3%	A41A (GCC→GCG) ‡	argI ←	ornithine carbamoyltransferase 1
RA	2,919,574	G→T	14.0%	A41D (GCC→GAC) ‡	argI ←	ornithine carbamoyltransferase 1
RA	2,919,575	C→G	17.6%	A41P (GCC→CCC) ‡	argI ←	ornithine carbamoyltransferase 1
RA	2,919,577	T→A	17.6%	E40V (GAA→GTA)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,582	T→C	17.6%	K38K (AAA→AAG)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,585	A→G	15.4%	G37G (GGT→GGC)	argI ←	ornithine carbamoyltransferase 1
RA	2,919,588	G→A	14.6%	S36S (AGC→AGT) ‡	argI ←	ornithine carbamoyltransferase 1
RA	2,919,589	C→T	14.4%	S36N (AGC→AAC) ‡	argI ←	ornithine carbamoyltransferase 1
RA	2,924,237	G→A	18.6%	P329S (CCT→TCT)	valS ←	valyl‑tRNA synthetase
RA	2,931,105	G→A	19.4%	L115L (CTG→TTG)	yjgR ←	predicted ATPase
RA	2,933,019	G→A	28.9%	G297G (GGC→GGT)	idnT ←	L‑idonate and D‑gluconate transporter
RA	2,936,917	T→C	18.2%	K226R (AAA→AGA)	yjgB ←	predicted alcohol dehydrogenase, Zn‑dependent and NAD(P)‑binding
RA	2,946,407	G→A	57.1%	intergenic (‑121/+121)	fecI ← / ← dnaC	RNA polymerase, sigma 19 factor/DNA biosynthesis protein
RA	2,947,541	G→A	15.0%	F89F (TTC→TTT)	dnaT ←	DNA biosynthesis protein
RA	2,952,864	G→A	22.5%	intergenic (‑173/+95)	leuQ ← / ← rsmC	tRNA‑Leu/16S RNA m2G1207 methylase
RA	2,952,884	G→A	12.9%	intergenic (‑193/+75)	leuQ ← / ← rsmC	tRNA‑Leu/16S RNA m2G1207 methylase
RA	2,960,632	Δ1 bp	8.2%	intergenic (+82/+338)	yjjV → / ← yjjW	predicted DNase/predicted pyruvate formate lyase activating enzyme
RA	2,960,726	T→G	9.6%	intergenic (+176/+244)	yjjV → / ← yjjW	predicted DNase/predicted pyruvate formate lyase activating enzyme
RA	2,960,735	G→C	9.2%	intergenic (+185/+235)	yjjV → / ← yjjW	predicted DNase/predicted pyruvate formate lyase activating enzyme
RA	2,960,737	C→G	8.2%	intergenic (+187/+233)	yjjV → / ← yjjW	predicted DNase/predicted pyruvate formate lyase activating enzyme
RA	2,960,739	Δ1 bp	10.6%	intergenic (+189/+231)	yjjV → / ← yjjW	predicted DNase/predicted pyruvate formate lyase activating enzyme
RA	2,960,746	A→C	11.1%	intergenic (+196/+224)	yjjV → / ← yjjW	predicted DNase/predicted pyruvate formate lyase activating enzyme
RA	2,970,436	C→T	25.4%	*215* (TGA→TAA)	ytjB ←	conserved hypothetical protein

Unassigned missing coverage evidence
			seq id	start	end	size	←reads	reads→	gene	description
*	*	÷	minE	251983	252041	59	13 [11]	[12] 13	malZ	maltodextrin glucosidase
*	*	÷	minE	1231136	1231173	38	13 [12]	[12] 13	ptrB	protease II

Unassigned new junction evidence
		seq id	position	reads (cov)	reads (cov)	score	skew	freq	annotation	gene	product
*	?	minE	= 5600	46 (0.890)	15 (0.380) +ACGCTGCGATTT	8/78	NT	29.4%	intergenic (+70/+83)	yaaX/yaaA	hypothetical protein/conserved hypothetical protein
	?	minE	2636227 =	48 (0.930)					intergenic (+47/‑51)	ugpB/ugpA	glycerol‑3‑phosphate transporter subunit/glycerol‑3‑phosphate transporter subunit
*	?	minE	= 5671	48 (0.930)	18 (0.380)	10/94	NT	35.9%	intergenic (+141/+12)	yaaX/yaaA	hypothetical protein/conserved hypothetical protein
	?	minE	2094909 =	20 (0.420)					intergenic (‑58/+394)	tdcG/rnpB	L‑serine dehydratase 3/RNase P
*	?	minE	15385 =	37 (0.710)	10 (0.200)	9/100	NT	29.7%	intergenic (+87/+60)	dnaJ/mokC	chaperone Hsp40, co‑chaperone with DnaK/regulatory protein for HokC, overlaps CDS of hokC
	?	minE	= 1570889	11 (0.220)					intergenic (+26/+210)	nupC/alaX	nucleoside (except guanosine) transporter/tRNA‑Ala
*	?	minE	= 18241	57 (1.100)	25 (0.480)	21/102	NT	37.6%	intergenic (+80/+252)	nhaR/rpsT	DNA‑binding transcriptional activator/30S ribosomal subunit protein S20
	?	minE	1502766 =	26 (0.500)					intergenic (‑139/‑781)	lrhA/yfbQ	DNA‑binding transcriptional repressor/predicted aminotransferase
*	?	minE	75112 =	54 (1.040)	4 (0.090)	3/84	NT	7.4%	coding (279/942 nt)	mraW	S‑adenosyl‑dependent methyltransferase activity on membrane‑located substrates
	?	minE	75141 =	55 (1.290)					coding (308/942 nt)	mraW	S‑adenosyl‑dependent methyltransferase activity on membrane‑located substrates
*	?	minE	95427 =	70 (1.350)	4 (0.090)	3/92	NT	6.4%	coding (2409/2706 nt)	secA	preprotein translocase subunit, ATPase that targets protein precursors to the SecYE core translocon
	?	minE	95453 =	53 (1.130)					coding (2435/2706 nt)	secA	preprotein translocase subunit, ATPase that targets protein precursors to the SecYE core translocon
*	?	minE	126195 =	45 (0.870)	3 (0.060)	3/96	NT	7.1%	coding (25/537 nt)	hpt	hypoxanthine phosphoribosyltransferase
	?	minE	126212 =	36 (0.740)					coding (42/537 nt)	hpt	hypoxanthine phosphoribosyltransferase
*	?	minE	134415 =	41 (0.790)	4 (0.100)	3/76	NT	13.7%	intergenic (‑74/+40)	panB/yadC	3‑methyl‑2‑oxobutanoate hydroxymethyltransferase/predicted fimbrial‑like adhesin protein
	?	minE	134452 =	20 (0.520)					intergenic (‑111/+3)	panB/yadC	3‑methyl‑2‑oxobutanoate hydroxymethyltransferase/predicted fimbrial‑like adhesin protein
*	?	minE	= 138525	65 (1.250)	4 (0.090)	3/92	NT	6.8%	coding (1642/2598 nt)	htrE	predicted outer membrane usher protein
	?	minE	= 138536	51 (1.090)					coding (1631/2598 nt)	htrE	predicted outer membrane usher protein
*	?	minE	139150 =	50 (0.960)	5 (0.100)	3/102	NT	8.3%	coding (1017/2598 nt)	htrE	predicted outer membrane usher protein
	?	minE	139171 =	61 (1.180)					coding (996/2598 nt)	htrE	predicted outer membrane usher protein
*	?	minE	= 174251	54 (1.040)	4 (0.080)	3/96	NT	7.9%	coding (524/762 nt)	ispU	undecaprenyl pyrophosphate synthase
	?	minE	= 174268	42 (0.860)					coding (541/762 nt)	ispU	undecaprenyl pyrophosphate synthase
*	?	minE	= 188896	68 (1.310)	19 (0.520) +GAACAGGGTCGCTAA	10/72	NT	32.5%	coding (393/2142 nt)	ldcC	lysine decarboxylase 2, constitutive
	?	minE	= 924830	44 (0.850)					coding (516/589 nt)	yncA	predicted acyltransferase with acyl‑CoA N‑acyltransferase domain
*	?	minE	202882 =	NA (NA)	7 (0.140)	3/100	NT	NA	noncoding (287/1542 nt)	rrsH	16S ribosomal RNA
	?	minE	202909 =	NA (NA)					noncoding (314/1542 nt)	rrsH	16S ribosomal RNA
*	?	minE	= 202915	NA (NA)	3 (0.060)	3/92	NT	NA	noncoding (320/1542 nt)	rrsH	16S ribosomal RNA
	?	minE	= 202927	NA (NA)					noncoding (332/1542 nt)	rrsH	16S ribosomal RNA
*	?	minE	= 203199	NA (NA)	4 (0.090)	4/88	NT	NA	noncoding (604/1542 nt)	rrsH	16S ribosomal RNA
	?	minE	= 203228	NA (NA)					noncoding (633/1542 nt)	rrsH	16S ribosomal RNA
*	?	minE	= 203909	NA (NA)	5 (0.110)	5/88	NT	NA	noncoding (1314/1542 nt)	rrsH	16S ribosomal RNA
	?	minE	= 203917	NA (NA)					noncoding (1322/1542 nt)	rrsH	16S ribosomal RNA
*	?	minE	= 203945	NA (NA)	7 (0.140)	4/100	NT	NA	noncoding (1350/1542 nt)	rrsH	16S ribosomal RNA
	?	minE	= 203966	NA (NA)					noncoding (1371/1542 nt)	rrsH	16S ribosomal RNA
*	?	minE	203947 =	NA (NA)	5 (0.110)	4/92	NT	NA	noncoding (1352/1542 nt)	rrsH	16S ribosomal RNA
	?	minE	203966 =	NA (NA)					noncoding (1371/1542 nt)	rrsH	16S ribosomal RNA
*	?	minE	204033 =	NA (NA)	4 (0.080)	4/94	NT	NA	noncoding (1438/1542 nt)	rrsH	16S ribosomal RNA
	?	minE	204063 =	NA (NA)					noncoding (1468/1542 nt)	rrsH	16S ribosomal RNA
*	?	minE	204714 =	NA (NA)	4 (0.090)	3/88	NT	NA	noncoding (131/2904 nt)	rrlH	23S ribosomal RNA
	?	minE	204732 =	NA (NA)					noncoding (149/2904 nt)	rrlH	23S ribosomal RNA
*	?	minE	= 204740	NA (NA)	9 (0.210)	7/86	NT	NA	noncoding (157/2904 nt)	rrlH	23S ribosomal RNA
	?	minE	= 204751	NA (NA)					noncoding (168/2904 nt)	rrlH	23S ribosomal RNA
*	?	minE	= 205114	NA (NA)	7 (0.150)	5/94	NT	NA	noncoding (531/2904 nt)	rrlH	23S ribosomal RNA
	?	minE	= 205125	NA (NA)					noncoding (542/2904 nt)	rrlH	23S ribosomal RNA
*	?	minE	= 205178	NA (NA)	11 (0.240)	4/92	NT	NA	noncoding (595/2904 nt)	rrlH	23S ribosomal RNA
	?	minE	= 205194	NA (NA)					noncoding (611/2904 nt)	rrlH	23S ribosomal RNA
*	?	minE	205529 =	NA (NA)	5 (0.100)	3/94	NT	NA	noncoding (946/2904 nt)	rrlH	23S ribosomal RNA
	?	minE	205555 =	NA (NA)					noncoding (972/2904 nt)	rrlH	23S ribosomal RNA
*	?	minE	205640 =	NA (NA)	7 (0.140)	3/96	NT	NA	noncoding (1057/2904 nt)	rrlH	23S ribosomal RNA
	?	minE	205665 =	NA (NA)					noncoding (1082/2904 nt)	rrlH	23S ribosomal RNA
*	?	minE	= 206767	NA (NA)	6 (0.120)	4/98	NT	NA	noncoding (2184/2904 nt)	rrlH	23S ribosomal RNA
	?	minE	= 206784	NA (NA)					noncoding (2201/2904 nt)	rrlH	23S ribosomal RNA
*	?	minE	= 206886	NA (NA)	3 (0.060)	3/92	NT	NA	noncoding (2303/2904 nt)	rrlH	23S ribosomal RNA
	?	minE	= 206895	NA (NA)					noncoding (2312/2904 nt)	rrlH	23S ribosomal RNA
*	?	minE	208968 =	48 (0.930)	7 (0.150)	3/90	NT	15.0%	coding (738/915 nt)	yafC	predicted DNA‑binding transcriptional regulator
	?	minE	208993 =	37 (0.810)					coding (713/915 nt)	yafC	predicted DNA‑binding transcriptional regulator
*	?	minE	= 215622	39 (0.750)	57 (2.340) +27 bp	37/48	NT	71.2%	coding (732/732 nt)	dnaQ	DNA polymerase III epsilon subunit
	?	minE	2705182 =	59 (1.140)					intergenic (+106/‑1)	damX/dam	hypothetical protein/DNA adenine methylase
*	?	minE	222160 =	61 (1.180)	5 (0.110)	3/92	NT	8.5%	intergenic (‑33/‑207)	fadE/lpcA	acyl coenzyme A dehydrogenase/D‑sedoheptulose 7‑phosphate isomerase
	?	minE	222187 =	52 (1.110)					intergenic (‑60/‑180)	fadE/lpcA	acyl coenzyme A dehydrogenase/D‑sedoheptulose 7‑phosphate isomerase
*	?	minE	= 223037	49 (0.950)	20 (0.560) +TAGCACTGCCACGTAT	10/70	NT	42.8%	intergenic (+92/‑88)	lpcA/prfH	D‑sedoheptulose 7‑phosphate isomerase/predicted peptide chain release factor
	?	minE	1019195 =	29 (0.560)					intergenic (+144/+82)	ydgA/uidC	conserved hypothetical protein/predicted outer membrane porin protein
*	?	minE	298441 =	35 (0.680)	3 (0.070) +AACCACC	3/88	NT	10.4%	coding (1102/1773 nt)	mdlA	fused predicted multidrug transporter subunits and ATP‑binding components of ABC superfamily
	?	minE	706827 =	25 (0.480)					coding (584/921 nt)	lpxL	lauryl‑acyl carrier protein (ACP)‑dependent acyltransferase
*	?	minE	= 299536	56 (1.080)	5 (0.100)	3/94	NT	8.8%	coding (432/1782 nt)	mdlB	fused predicted multidrug transporter subunits and ATP binding components of ABC superfamily
	?	minE	= 299550	52 (1.090)					coding (446/1782 nt)	mdlB	fused predicted multidrug transporter subunits and ATP binding components of ABC superfamily
*	?	minE	299638 =	46 (0.890)	6 (0.130)	4/90	NT	11.6%	coding (534/1782 nt)	mdlB	fused predicted multidrug transporter subunits and ATP binding components of ABC superfamily
	?	minE	299664 =	51 (1.120)					coding (560/1782 nt)	mdlB	fused predicted multidrug transporter subunits and ATP binding components of ABC superfamily
*	?	minE	= 350570	42 (0.810)	19 (0.430) +CACGCCGC	9/86	NT	33.4%	intergenic (+167/+32)	glxR/purK	tartronate semialdehyde reductase, NADH‑dependent/N5‑carboxyaminoimidazole ribonucleotide synthase
	?	minE	1941687 =	48 (0.930)					intergenic (+126/+70)	ygfZ/yqfA	predicted folate‑dependent regulatory protein/predicted oxidoreductase, inner membrane subunit
*	?	minE	= 370029	64 (1.240)	3 (0.070) +TTAATG	3/90	NT	5.5%	coding (976/3882 nt)	entF	enterobactin synthase multienzyme complex component, ATP‑dependent
	?	minE	= 555160	53 (1.020)					coding (602/663 nt)	fsaA	fructose‑6‑phosphate aldolase 1
*	?	minE	= 391534	40 (0.770)	4 (0.090)	3/88	NT	9.4%	intergenic (‑68/+79)	ybdN/ybdO	conserved hypothetical protein/predicted DNA‑binding transcriptional regulator
	?	minE	= 391543	43 (0.960)					intergenic (‑77/+70)	ybdN/ybdO	conserved hypothetical protein/predicted DNA‑binding transcriptional regulator
*	?	minE	397368 =	62 (1.200)	4 (0.080)	3/96	NT	6.9%	coding (421/966 nt)	lipA	lipoate synthase
	?	minE	397397 =	50 (1.030)					coding (392/966 nt)	lipA	lipoate synthase
*	?	minE	436259 =	61 (1.180)	110 (2.300)	55/94	NT	70.5%	intergenic (‑156/‑29)	ybfF/seqA	conserved hypothetical protein/regulatory protein for replication initiation
	?	minE	= 2706018	36 (0.750)					coding (836/837 nt)	dam	DNA adenine methylase
*	?	minE	= 436833	60 (1.160)	149 (2.880)	63/102	NT	74.3%	coding (546/546 nt)	seqA	regulatory protein for replication initiation
	?	minE	1803907 =	43 (0.830)					intergenic (+63/‑28)	ygaH/mprA	predicted inner membrane protein/DNA‑binding transcriptional regulator
*	?	minE	464953 =	42 (0.810)	8 (0.250) +AAGTTCAGCGATCTACATTA	6/62	NT	24.3%	intergenic (+93/‑208)	sdhB/sucA	succinate dehydrogenase, FeS subunit/2‑oxoglutarate decarboxylase, thiamin‑requiring
	?	minE	= 2870826	40 (0.770)					intergenic (+69/‑111)	rnr/rlmB	exoribonuclease R, RNase R/23S rRNA (Gm2251)‑methyltransferase
*	?	minE	= 494276	55 (1.060)	3 (0.070)	3/90	NT	5.4%	coding (1017/1041 nt)	galM	galactose‑1‑epimerase
	?	minE	= 494284	57 (1.250)					coding (1009/1041 nt)	galM	galactose‑1‑epimerase
*	?	minE	= 507574	79 (1.520)	5 (0.110)	3/92	NT	6.3%	coding (361/1053 nt)	ybhH	conserved hypothetical protein
	?	minE	= 507593	77 (1.650)					coding (380/1053 nt)	ybhH	conserved hypothetical protein
*	?	minE	= 558469	19 (0.370)	12 (0.240) +GT	7/98	NT	29.7%	intergenic (+19/‑285)	iaaA/cmr	L‑asparaginase/multidrug efflux system protein
	?	minE	1659293 =	40 (0.770)					coding (1493/1542 nt)	ppx	exopolyphosphatase
*	?	minE	= 605476	32 (0.620)	3 (0.060)	3/92	NT	8.0%	coding (792/909 nt)	ycaN	predicted DNA‑binding transcriptional regulator
	?	minE	= 605486	40 (0.860)					coding (782/909 nt)	ycaN	predicted DNA‑binding transcriptional regulator
*	?	minE	= 631469	26 (0.500)	4 (0.090)	3/90	NT	13.1%	coding (452/1323 nt)	mukF	Involved in chromosome partioning, Ca2+ binding protein
	?	minE	= 631495	30 (0.660)					coding (478/1323 nt)	mukF	Involved in chromosome partioning, Ca2+ binding protein
*	?	minE	= 761080	37 (0.710)	3 (0.060)	3/94	NT	7.5%	coding (1005/1047 nt)	potD	polyamine transporter subunit
	?	minE	= 761099	40 (0.840)					coding (986/1047 nt)	potD	polyamine transporter subunit
*	?	minE	764598 =	57 (1.100)	3 (0.060)	3/94	NT	5.8%	coding (252/1137 nt)	potA	polyamine transporter subunit
	?	minE	764619 =	45 (0.940)					coding (231/1137 nt)	potA	polyamine transporter subunit
*	?	minE	= 815014	40 (0.770)	3 (0.070)	3/88	NT	7.5%	coding (78/852 nt)	ispE	4‑diphosphocytidyl‑2‑C‑methylerythritol kinase
	?	minE	= 815027	40 (0.890)					coding (65/852 nt)	ispE	4‑diphosphocytidyl‑2‑C‑methylerythritol kinase
*	?	minE	815317 =	52 (1.000)	3 (0.060)	3/94	NT	5.9%	coding (398/624 nt)	lolB	chaperone for lipoproteins
	?	minE	815343 =	48 (1.010)					coding (372/624 nt)	lolB	chaperone for lipoproteins
*	?	minE	= 855033	41 (0.790)	3 (0.070)	3/86	NT	8.0%	intergenic (‑44/+337)	yciG/trpA	hypothetical protein/tryptophan synthase, alpha subunit
	?	minE	= 855042	34 (0.780)					intergenic (‑53/+328)	yciG/trpA	hypothetical protein/tryptophan synthase, alpha subunit
*	?	minE	865596 =	7 (0.140)	5 (0.100)	3/100	NT	17.6%	intergenic (+1/‑210)	yciQ/rluB	predicted inner membrane protein/23S rRNA pseudouridylate synthase
	?	minE	865626 =	40 (0.790)					intergenic (+31/‑180)	yciQ/rluB	predicted inner membrane protein/23S rRNA pseudouridylate synthase
*	?	minE	886884 =	32 (0.620)	4 (0.090)	3/92	NT	11.1%	coding (983/1935 nt)	rnb	ribonuclease II
	?	minE	886912 =	35 (0.750)					coding (955/1935 nt)	rnb	ribonuclease II
*	?	minE	901743 =	54 (1.040)	3 (0.070)	3/88	NT	6.6%	coding (1588/1680 nt)	ycjM	predicted glucosyltransferase
	?	minE	901773 =	38 (0.850)					coding (1618/1680 nt)	ycjM	predicted glucosyltransferase
*	?	minE	919665 =	37 (0.710)	3 (0.060)	3/94	NT	7.0%	coding (796/966 nt)	ycjG	L‑Ala‑D/L‑Glu epimerase
	?	minE	919715 =	46 (0.960)					coding (846/966 nt)	ycjG	L‑Ala‑D/L‑Glu epimerase
*	?	minE	957613 =	51 (0.980)	3 (0.070)	3/90	NT	7.0%	coding (2693/2796 nt)	pqqL	predicted peptidase
	?	minE	957637 =	35 (0.770)					coding (2669/2796 nt)	pqqL	predicted peptidase
*	?	minE	979119 =	56 (1.080)	3 (0.060)	3/94	NT	6.2%	coding (26/2046 nt)	dcp	dipeptidyl carboxypeptidase II
	?	minE	979139 =	39 (0.820)					coding (6/2046 nt)	dcp	dipeptidyl carboxypeptidase II
*	?	minE	= 984524	41 (0.790)	3 (0.070)	3/86	NT	6.7%	coding (625/711 nt)	ynfC	hypothetical protein
	?	minE	= 984538	49 (1.120)					coding (611/711 nt)	ynfC	hypothetical protein
*	?	minE	998811 =	43 (0.830)	3 (0.060)	3/94	NT	8.0%	intergenic (+168/‑256)	ynfM/asr	predicted transporter/acid shock‑inducible periplasmic protein
	?	minE	998856 =	29 (0.610)					intergenic (+213/‑211)	ynfM/asr	predicted transporter/acid shock‑inducible periplasmic protein
*	?	minE	1039924 =	45 (0.870)	3 (0.060)	3/92	NT	6.5%	intergenic (+75/‑536)	nth/ydgR	DNA glycosylase and apyrimidinic (AP) lyase/predicted transporter
	?	minE	1039951 =	46 (0.980)					intergenic (+102/‑509)	nth/ydgR	DNA glycosylase and apyrimidinic (AP) lyase/predicted transporter
*	?	minE	1098680 =	42 (0.810)	4 (0.090)	3/92	NT	9.5%	intergenic (+18/‑82)	ydiL/ydiM	conserved hypothetical protein/predicted transporter
	?	minE	1098700 =	38 (0.810)					intergenic (+38/‑62)	ydiL/ydiM	conserved hypothetical protein/predicted transporter
*	?	minE	= 1168581	61 (1.180)	4 (0.080)	3/96	NT	7.2%	coding (514/621 nt)	ynjF	predicted phosphatidyl transferase, inner membrane protein
	?	minE	= 1168598	46 (0.940)					coding (497/621 nt)	ynjF	predicted phosphatidyl transferase, inner membrane protein
*	?	minE	= 1216891	54 (1.040)	3 (0.070)	3/90	NT	5.2%	coding (1842/2049 nt)	prc	carboxy‑terminal protease for penicillin‑binding protein 3
	?	minE	= 1216912	61 (1.330)					coding (1821/2049 nt)	prc	carboxy‑terminal protease for penicillin‑binding protein 3
*	?	minE	1249724 =	52 (1.000)	3 (0.060)	3/96	NT	6.3%	coding (169/612 nt)	ruvA	component of RuvABC resolvasome, regulatory subunit
	?	minE	1249756 =	41 (0.840)					coding (137/612 nt)	ruvA	component of RuvABC resolvasome, regulatory subunit
*	?	minE	1258762 =	57 (1.100)	4 (0.090) +CAACGT	3/90	NT	8.0%	coding (2162/2430 nt)	torZ	trimethylamine N‑oxide reductase system III, catalytic subunit
	?	minE	= 1519712	47 (0.910)					coding (282/660 nt)	dedA	conserved inner membrane protein
*	?	minE	1262029 =	29 (0.560)	4 (0.090)	3/92	NT	13.5%	coding (20/1101 nt)	torY	TMAO reductase III (TorYZ), cytochrome c‑type subunit
	?	minE	1262049 =	25 (0.530)					intergenic (‑1/+387)	torY/cutC	TMAO reductase III (TorYZ), cytochrome c‑type subunit/copper homeostasis protein
*	?	minE	= 1262440	37 (0.710)	5 (0.110)	3/88	NT	13.3%	coding (743/747 nt)	cutC	copper homeostasis protein
	?	minE	= 1262456	33 (0.740)					coding (727/747 nt)	cutC	copper homeostasis protein
*	?	minE	= 1280403	42 (0.810)	6 (0.130)	3/88	NT	12.5%	coding (2182/7104 nt)	yeeJ	adhesin
	?	minE	= 1280416	48 (1.070)					coding (2195/7104 nt)	yeeJ	adhesin
*	?	minE	1298934 =	52 (1.000)	6 (0.130)	4/88	NT	11.1%	coding (142/546 nt)	cobU	bifunctional cobinamide kinase and cobinamide phosphate guanylyltransferase
	?	minE	1298968 =	51 (1.140)					coding (108/546 nt)	cobU	bifunctional cobinamide kinase and cobinamide phosphate guanylyltransferase
*	?	minE	1310343 =	66 (1.270)	3 (0.070)	3/86	NT	6.1%	intergenic (+19/‑127)	hisL/hisG	his operon leader peptide/ATP phosphoribosyltransferase
	?	minE	1310367 =	36 (0.820)					intergenic (+43/‑103)	hisL/hisG	his operon leader peptide/ATP phosphoribosyltransferase
*	?	minE	1396187 =	42 (0.810)	4 (0.090)	3/90	NT	10.4%	coding (893/1182 nt)	setB	lactose/glucose efflux system
	?	minE	1396206 =	32 (0.700)					coding (912/1182 nt)	setB	lactose/glucose efflux system
*	?	minE	= 1408364	56 (1.080)	3 (0.070)	3/90	NT	5.3%	coding (633/1590 nt)	yejF	fused predicted oligopeptide transporter subunits and ATP‑binding components of ABC superfamily
	?	minE	= 1408381	57 (1.250)					coding (650/1590 nt)	yejF	fused predicted oligopeptide transporter subunits and ATP‑binding components of ABC superfamily
*	?	minE	1435980 =	60 (1.160)	5 (0.130) +TGTGGTGGTGGC	4/78	NT	8.1%	coding (188/1644 nt)	yojI	fused predicted multidrug transport subunits and membrane component and ATP‑binding component of ABC superfamily
	?	minE	= 2059288	88 (1.700)					coding (552/1464 nt)	ygjE	predicted tartrate:succinate antiporter
*	?	minE	= 1443728	62 (1.200)	4 (0.090)	3/92	NT	5.8%	intergenic (+16/‑1)	rcsD/rcsB	phosphotransfer intermediate protein in two‑component regulatory system with RcsBC/DNA‑binding response regulator in two‑component regulatory system with RcsC and YojN
	?	minE	= 1443743	74 (1.580)					coding (15/651 nt)	rcsB	DNA‑binding response regulator in two‑component regulatory system with RcsC and YojN
*	?	minE	= 1444537	28 (0.540)	10 (0.380) +25 bp	10/52	NT	46.6%	intergenic (+158/+42)	rcsB/rcsC	DNA‑binding response regulator in two‑component regulatory system with RcsC and YojN/hybrid sensory kinase in two‑component regulatory system with RcsB and YojN
	?	minE	2477862 =	17 (0.330)					intergenic (+17/‑166)	pstA/pstB	phosphate transporter subunit/phosphate transporter subunit
*	?	minE	= 1456504	46 (0.890)	5 (0.110)	3/90	NT	11.8%	coding (846/1650 nt)	yfaQ	hypothetical protein
	?	minE	= 1456521	34 (0.740)					coding (829/1650 nt)	yfaQ	hypothetical protein
*	?	minE	= 1476009	68 (1.310)	6 (0.130)	3/92	NT	8.5%	coding (1074/1131 nt)	nrdB	ribonucleoside diphosphate reductase 1, beta subunit, ferritin‑like
	?	minE	= 1476015	68 (1.450)					coding (1080/1131 nt)	nrdB	ribonucleoside diphosphate reductase 1, beta subunit, ferritin‑like
*	?	minE	= 1501264	66 (1.270)	3 (0.070)	3/90	NT	5.7%	intergenic (‑206/+425)	nuoA/lrhA	NADH:ubiquinone oxidoreductase, membrane subunit A/DNA‑binding transcriptional repressor
	?	minE	= 1501324	41 (0.900)					intergenic (‑266/+365)	nuoA/lrhA	NADH:ubiquinone oxidoreductase, membrane subunit A/DNA‑binding transcriptional repressor
*	?	minE	= 1545919	46 (0.890)	6 (0.130)	5/92	NT	12.2%	coding (268/285 nt)	yfcZ	conserved hypothetical protein
	?	minE	= 1545933	45 (0.960)					coding (254/285 nt)	yfcZ	conserved hypothetical protein
*	?	minE	1583045 =	35 (0.680)	6 (0.130)	3/88	NT	15.0%	coding (190/2016 nt)	ligA	DNA ligase, NAD(+)‑dependent
	?	minE	1583066 =	38 (0.850)					coding (169/2016 nt)	ligA	DNA ligase, NAD(+)‑dependent
*	?	minE	1591595 =	33 (0.640)	49 (1.100) +ACATCAA	17/88	NT	56.9%	intergenic (+54/+135)	yfeS/cysM	conserved hypothetical protein/cysteine synthase B
	?	minE	1864319 =	53 (1.020)					intergenic (+66/+82)	ygcP/ygcQ	predicted anti‑terminator regulatory protein/predicted flavoprotein
*	?	minE	= 1675930	89 (1.720)	6 (0.130)	3/88	NT	7.5%	coding (1040/1155 nt)	yfgB	hypothetical protein
	?	minE	= 1675947	71 (1.590)					coding (1023/1155 nt)	yfgB	hypothetical protein
*	?	minE	= 1687685	34 (0.660)	33 (0.830) +GATTCTTGCGCC	18/78	NT	52.2%	intergenic (‑66/+76)	sseB/pepB	rhodanase‑like enzyme, sulfur transfer from thiosulfate/aminopeptidase B
	?	minE	2892324 =	45 (0.870)					intergenic (+22/‑118)	ytfQ/ytfR	predicted sugar transporter subunit/predicted sugar transporter subunit
*	?	minE	1735927 =	50 (0.960)	3 (0.060)	3/96	NT	6.4%	coding (146/906 nt)	era	membrane‑associated, 16S rRNA‑binding GTPase
	?	minE	1735964 =	40 (0.820)					coding (109/906 nt)	era	membrane‑associated, 16S rRNA‑binding GTPase
*	?	minE	1761923 =	50 (0.960)	6 (0.130)	3/90	NT	12.6%	intergenic (‑53/+132)	rrlG/gltW	23S ribosomal RNA/tRNA‑Glu
	?	minE	1761941 =	39 (0.850)					intergenic (‑71/+114)	rrlG/gltW	23S ribosomal RNA/tRNA‑Glu
*	?	minE	= 1766900	54 (1.040)	3 (0.060)	3/96	NT	5.5%	intergenic (‑41/+89)	clpB/yfiH	protein disaggregation chaperone/conserved hypothetical protein
	?	minE	= 1766917	52 (1.070)					intergenic (‑58/+72)	clpB/yfiH	protein disaggregation chaperone/conserved hypothetical protein
*	?	minE	1837010 =	67 (1.290)	5 (0.110)	3/90	NT	8.1%	coding (90/876 nt)	rpoS	RNA polymerase, sigma S (sigma 38) factor
	?	minE	1837032 =	55 (1.200)					coding (68/876 nt)	rpoS	RNA polymerase, sigma S (sigma 38) factor
*	?	minE	1869856 =	43 (0.830)	5 (0.110)	4/90	NT	11.0%	intergenic (‑101/‑218)	ygcW/yqcE	predicted deoxygluconate dehydrogenase/predicted transporter
	?	minE	1869880 =	43 (0.940)					intergenic (‑125/‑194)	ygcW/yqcE	predicted deoxygluconate dehydrogenase/predicted transporter
*	?	minE	1916933 =	60 (1.160)	5 (0.100)	3/98	NT	9.4%	coding (235/690 nt)	mutH	methyl‑directed mismatch repair protein
	?	minE	1916957 =	39 (0.780)					coding (259/690 nt)	mutH	methyl‑directed mismatch repair protein
*	?	minE	1958332 =	36 (0.690)	3 (0.070)	3/88	NT	7.7%	coding (262/660 nt)	rpiA	ribosephosphate isomerase, constitutive
	?	minE	1958358 =	41 (0.920)					coding (236/660 nt)	rpiA	ribosephosphate isomerase, constitutive
*	?	minE	1985422 =	52 (1.000)	8 (0.220) +TACGCCGCATCCGGC	4/72	NT	16.3%	intergenic (+25/+130)	yggW/yggM	predicted oxidoreductase/conserved hypothetical protein
	?	minE	2901792 =	64 (1.240)					intergenic (‑44/+114)	nrdG/nrdD	anaerobic ribonucleotide reductase activating protein/anaerobic ribonucleoside‑triphosphate reductase
*	?	minE	2000859 =	104 (2.010)	6 (0.120)	4/96	NT	6.9%	coding (424/1860 nt)	gss	fused glutathionylspermidine amidase and glutathionylspermidine synthetase
	?	minE	2000891 =	65 (1.330)					coding (392/1860 nt)	gss	fused glutathionylspermidine amidase and glutathionylspermidine synthetase
*	?	minE	= 2051691	56 (1.080)	4 (0.090)	3/90	NT	6.9%	intergenic (‑13/‑229)	ygiF/htrG	predicted adenylate cyclase/predicted signal transduction protein
	?	minE	= 2051703	59 (1.290)					intergenic (‑25/‑217)	ygiF/htrG	predicted adenylate cyclase/predicted signal transduction protein
*	?	minE	= 2083973	78 (1.510)	5 (0.110)	3/92	NT	6.7%	coding (333/384 nt)	yqjB	conserved hypothetical protein
	?	minE	= 2083985	69 (1.480)					coding (345/384 nt)	yqjB	conserved hypothetical protein
*	?	minE	2140433 =	60 (1.160)	3 (0.060)	3/94	NT	6.0%	coding (675/2673 nt)	infB	fused protein chain initiation factor 2, IF2
	?	minE	2140452 =	38 (0.800)					coding (656/2673 nt)	infB	fused protein chain initiation factor 2, IF2
*	?	minE	= 2168181	44 (0.850)	3 (0.060)	3/94	NT	6.2%	coding (253/576 nt)	yrbK	conserved hypothetical protein
	?	minE	= 2168207	51 (1.070)					coding (279/576 nt)	yrbK	conserved hypothetical protein
*	?	minE	= 2232336	NA (NA)	4 (0.080)	3/94	NT	NA	noncoding (9/2904 nt)	rrlD	23S ribosomal RNA
	?	minE	= 2232398	NA (NA)					intergenic (‑54/+140)	rrlD/gltV	23S ribosomal RNA/tRNA‑Glu
*	?	minE	2254588 =	75 (1.450)	4 (0.080)	3/96	NT	5.7%	coding (2450/4224 nt)	rpoC	RNA polymerase, beta prime subunit
	?	minE	2254616 =	62 (1.270)					coding (2422/4224 nt)	rpoC	RNA polymerase, beta prime subunit
*	?	minE	2261783 =	46 (0.890)	3 (0.060)	3/96	NT	6.2%	coding (45/366 nt)	rplL	50S ribosomal subunit protein L7/L12
	?	minE	2261805 =	48 (0.980)					coding (23/366 nt)	rplL	50S ribosomal subunit protein L7/L12
*	?	minE	2270768 =	NA (NA)	5 (0.110)	3/90	NT	44.7%	intergenic (‑18/+75)	rrfB/rrlB	5S ribosomal RNA/23S ribosomal RNA
	?	minE	2358126 =	7 (0.140)					intergenic (‑30/+64)	rrfA/rrlA	5S ribosomal RNA/23S ribosomal RNA
*	?	minE	2275478 =	NA (NA)	4 (0.090)	3/90	NT	100%	noncoding (251/1542 nt)	rrsB	16S ribosomal RNA
	?	minE	2362809 =	0 (0.000)					noncoding (274/1542 nt)	rrsA	16S ribosomal RNA
*	?	minE	= 2277681	32 (0.620)	3 (0.060)	3/96	NT	7.6%	coding (1068/1845 nt)	btuB	vitamin B12/cobalamin outer membrane transporter
	?	minE	= 2277705	43 (0.880)					coding (1044/1845 nt)	btuB	vitamin B12/cobalamin outer membrane transporter
*	?	minE	= 2327114	40 (0.770)	4 (0.090)	3/92	NT	9.7%	coding (185/1374 nt)	cpxA	sensory histidine kinase in two‑component regulatory system with CpxR
	?	minE	= 2327131	38 (0.810)					coding (202/1374 nt)	cpxA	sensory histidine kinase in two‑component regulatory system with CpxR
*	?	minE	= 2377004	47 (0.910)	5 (0.110)	4/88	NT	10.7%	coding (1384/1641 nt)	ubiB	2‑octaprenylphenol hydroxylase
	?	minE	= 2377016	43 (0.960)					coding (1372/1641 nt)	ubiB	2‑octaprenylphenol hydroxylase
*	?	minE	2388519 =	55 (1.060)	3 (0.060)	3/92	NT	6.5%	coding (925/1023 nt)	pldB	lysophospholipase L(2)
	?	minE	2388544 =	37 (0.790)					coding (900/1023 nt)	pldB	lysophospholipase L(2)
*	?	minE	2395347 =	40 (0.770)	4 (0.090)	4/86	NT	11.0%	intergenic (+22/‑73)	rarD/yigG	predicted chloramphenical resistance permease/predicted inner membrane protein
	?	minE	2395381 =	31 (0.710)					intergenic (+56/‑39)	rarD/yigG	predicted chloramphenical resistance permease/predicted inner membrane protein
*	?	minE	2403490 =	77 (1.490)	5 (0.100)	3/96	NT	6.4%	coding (362/825 nt)	dapF	diaminopimelate epimerase
	?	minE	2403514 =	75 (1.540)					coding (338/825 nt)	dapF	diaminopimelate epimerase
*	?	minE	2409481 =	65 (1.250)	4 (0.080)	3/96	NT	7.0%	coding (697/741 nt)	hemD	uroporphyrinogen III synthase
	?	minE	2409516 =	45 (0.920)					coding (732/741 nt)	hemD	uroporphyrinogen III synthase
*	?	minE	= 2455285	NA (NA)	6 (0.130)	3/92	NT	NA	noncoding (1524/1542 nt)	rrsC	16S ribosomal RNA
	?	minE	2764774 =	NA (NA)					noncoding (1512/1542 nt)	rrsE	16S ribosomal RNA
*	?	minE	= 2526517	63 (1.220)	5 (0.100)	3/94	NT	7.7%	coding (465/597 nt)	ttk	division inhibitor
	?	minE	= 2526530	62 (1.300)					coding (452/597 nt)	ttk	division inhibitor
*	?	minE	= 2540138	70 (1.350)	4 (0.090)	3/90	NT	6.0%	coding (663/1017 nt)	rfaJ	UDP‑D‑glucose:(galactosyl)lipopolysaccharide glucosyltransferase
	?	minE	= 2540152	63 (1.380)					coding (677/1017 nt)	rfaJ	UDP‑D‑glucose:(galactosyl)lipopolysaccharide glucosyltransferase
*	?	minE	2540259 =	55 (1.060)	16 (0.350) +GGTGTT	9/90	NT	31.7%	coding (784/1017 nt)	rfaJ	UDP‑D‑glucose:(galactosyl)lipopolysaccharide glucosyltransferase
	?	minE	2791155 =	23 (0.440)					intergenic (+550/‑225)	pgi/ubiC	glucosephosphate isomerase/chorismate pyruvate lyase
*	?	minE	= 2543276	57 (1.100)	6 (0.130)	6/94	NT	10.9%	coding (1252/1260 nt)	rfaL	O‑antigen ligase
	?	minE	= 2543288	46 (0.960)					coding (1240/1260 nt)	rfaL	O‑antigen ligase
*	?	minE	2547200 =	62 (1.200)	3 (0.060)	3/92	NT	5.4%	coding (289/933 nt)	rfaD	ADP‑L‑glycero‑D‑mannoheptose‑6‑epimerase, NAD(P)‑binding
	?	minE	2547230 =	50 (1.070)					coding (259/933 nt)	rfaD	ADP‑L‑glycero‑D‑mannoheptose‑6‑epimerase, NAD(P)‑binding
*	?	minE	= 2593949	46 (0.890)	3 (0.060)	3/100	NT	5.6%	intergenic (‑220/+921)	slp/arsC	outer membrane lipoprotein/arsenate reductase
	?	minE	= 2593974	57 (1.120)					intergenic (‑245/+896)	slp/arsC	outer membrane lipoprotein/arsenate reductase
*	?	minE	2621754 =	60 (1.160)	3 (0.060)	3/96	NT	5.2%	coding (176/360 nt)	yhhM	conserved hypothetical protein
	?	minE	2621780 =	52 (1.070)					coding (202/360 nt)	yhhM	conserved hypothetical protein
*	?	minE	2626177 =	48 (0.930)	3 (0.080)	3/78	NT	9.6%	intergenic (+16/‑229)	ftsX/rpoH	predicted transporter subunit/RNA polymerase, sigma 32 (sigma H) factor
	?	minE	2626214 =	20 (0.500)					intergenic (+53/‑192)	ftsX/rpoH	predicted transporter subunit/RNA polymerase, sigma 32 (sigma H) factor
*	?	minE	= 2633288	47 (0.910)	8 (0.170)	3/92	NT	15.6%	coding (306/768 nt)	livG	leucine/isoleucine/valine transporter subunit
	?	minE	= 2633300	44 (0.940)					coding (318/768 nt)	livG	leucine/isoleucine/valine transporter subunit
*	?	minE	2733620 =	82 (1.580)	4 (0.080)	3/94	NT	5.3%	coding (215/288 nt)	yheL	predicted intracellular sulfur oxidation protein
	?	minE	2733654 =	68 (1.420)					coding (249/288 nt)	yheL	predicted intracellular sulfur oxidation protein
*	?	minE	= 2736896	51 (0.980)	5 (0.110)	3/86	NT	9.6%	coding (2040/2115 nt)	fusA	protein chain elongation factor EF‑G
	?	minE	= 2736913	51 (1.170)					coding (2057/2115 nt)	fusA	protein chain elongation factor EF‑G
*	?	minE	2776814 =	44 (0.850)	4 (0.090)	4/86	NT	11.7%	coding (872/2187 nt)	arpA	regulator of acetyl CoA synthetase
	?	minE	2776838 =	23 (0.530)					coding (848/2187 nt)	arpA	regulator of acetyl CoA synthetase
*	?	minE	= 2816610	57 (1.100)	5 (0.110)	4/90	NT	7.9%	coding (268/441 nt)	soxR	DNA‑binding transcriptional dual regulator, Fe‑S center for redox‑sensing
	?	minE	= 2816621	67 (1.470)					coding (279/441 nt)	soxR	DNA‑binding transcriptional dual regulator, Fe‑S center for redox‑sensing
*	?	minE	= 2825932	85 (1.640)	5 (0.110)	5/92	NT	6.7%	coding (773/1698 nt)	dipZ	fused thiol:disulfide interchange protein
	?	minE	= 2825965	62 (1.330)					coding (740/1698 nt)	dipZ	fused thiol:disulfide interchange protein
*	?	minE	= 2828976	69 (1.330)	4 (0.080)	3/96	NT	5.9%	coding (1014/1437 nt)	aspA	aspartate ammonia‑lyase
	?	minE	= 2829001	63 (1.290)					coding (989/1437 nt)	aspA	aspartate ammonia‑lyase
*	?	minE	= 2835791	42 (0.810)	3 (0.070)	3/86	NT	7.1%	coding (106/870 nt)	yjeJ	hypothetical protein
	?	minE	= 2835797	43 (0.980)					coding (100/870 nt)	yjeJ	hypothetical protein
*	?	minE	= 2843507	62 (1.200)	4 (0.090)	3/88	NT	6.2%	coding (474/1809 nt)	frdA	fumarate reductase (anaerobic) catalytic and NAD/flavoprotein subunit
	?	minE	= 2843526	67 (1.500)					coding (455/1809 nt)	frdA	fumarate reductase (anaerobic) catalytic and NAD/flavoprotein subunit
*	?	minE	2903481 =	76 (1.470)	6 (0.130)	3/94	NT	7.8%	coding (564/2139 nt)	nrdD	anaerobic ribonucleoside‑triphosphate reductase
	?	minE	2903505 =	72 (1.510)					coding (540/2139 nt)	nrdD	anaerobic ribonucleoside‑triphosphate reductase
*	?	minE	= 2908679	53 (1.020)	4 (0.090)	3/90	NT	7.1%	intergenic (‑49/‑330)	treR/mgtA	DNA‑binding transcriptional repressor/magnesium transporter
	?	minE	= 2908693	58 (1.270)					intergenic (‑63/‑316)	treR/mgtA	DNA‑binding transcriptional repressor/magnesium transporter
*	?	minE	2918569 =	51 (0.980)	3 (0.070)	3/90	NT	7.1%	coding (1749/1815 nt)	yjgL	hypothetical protein
	?	minE	2918613 =	34 (0.740)					coding (1793/1815 nt)	yjgL	hypothetical protein
*	?	minE	2957605 =	57 (1.100)	3 (0.060)	3/94	NT	5.5%	intergenic (+312/‑81)	prfC/osmY	peptide chain release factor RF‑3/periplasmic protein
	?	minE	2957623 =	51 (1.070)					intergenic (+330/‑63)	prfC/osmY	peptide chain release factor RF‑3/periplasmic protein
*	?	minE	= 2962065	42 (0.810)	4 (0.080)	3/96	NT	8.5%	coding (1291/1551 nt)	yjjI	conserved hypothetical protein
	?	minE	= 2962083	47 (0.960)					coding (1273/1551 nt)	yjjI	conserved hypothetical protein
*	?	minE	= 2971259	52 (1.000)	4 (0.090)	3/92	NT	6.7%	coding (75/969 nt)	serB	3‑phosphoserine phosphatase
	?	minE	= 2971281	65 (1.390)					coding (97/969 nt)	serB	3‑phosphoserine phosphatase
*	?	minE	2975691 =	49 (0.950)	3 (0.070)	3/88	NT	7.4%	coding (1122/1668 nt)	yjjK	fused predicted transporter subunits and ATP‑binding components of ABC superfamily
	?	minE	2975721 =	33 (0.740)					coding (1092/1668 nt)	yjjK	fused predicted transporter subunits and ATP‑binding components of ABC superfamily