breseq  version 0.33.1  revision 8505477f25b3 mutation predictions | marginal predictions | summary statistics | genome diff | command line log

Predicted mutations
evidence	position	mutation	freq	annotation	gene	description
RA	1,699	G→T	5.7%	P41Q (CCG→CAG)	parA ←	chromosome partition protein
RA	1,706	G→C	7.2%	L39V (CTC→GTC)	parA ←	chromosome partition protein
RA	1,707	G→C	8.3%	D38E (GAC→GAG)	parA ←	chromosome partition protein
RA	12,688	A→T	6.0%	Q156L (CAG→CTG)	recF →	DNA replication/repair protein
RA	12,696	C→T	5.8%	L159L (CTG→TTG)	recF →	DNA replication/repair protein
RA	21,472	C→T	7.0%	D425D (GAC→GAT)	PP_0016 →	hypothetical protein
RA	26,844	A→T	8.1%	intergenic (+40/+145)	PP_0021 → / ← PP_0022	hypothetical protein/hypothetical protein
RA	40,952	T→C	6.4%	W162R (TGG→CGG)	oprP →	porin P
RA	42,123	C→T	5.9%	R23C (CGC→TGC)	PP_0039 →	hypothetical protein
RA	54,899	T→C	6.6%	*225Q (TAG→CAG)	czcR‑II →	response regulator
RA	58,435	G→C	5.7%	intergenic (‑346/+342)	PP_5424 ← / ← PP_0050	hypothetical protein/hypothetical protein
RA	58,437	T→A	5.6%	intergenic (‑348/+340)	PP_5424 ← / ← PP_0050	hypothetical protein/hypothetical protein
RA	58,439	G→C	5.4%	intergenic (‑350/+338)	PP_5424 ← / ← PP_0050	hypothetical protein/hypothetical protein
RA	79,895	C→A	5.5%	P217Q (CCG→CAG)	PP_0069 →	rossmann fold nucleotide‑binding protein
RA	85,066	T→C	9.8%	intergenic (+44/+86)	aroE → / ← PP_0075	shikimate 5‑dehydrogenase/choline sulfate transporter
RA	85,074	A→G	9.8%	intergenic (+52/+78)	aroE → / ← PP_0075	shikimate 5‑dehydrogenase/choline sulfate transporter
RA	85,077	T→G	9.5%	intergenic (+55/+75)	aroE → / ← PP_0075	shikimate 5‑dehydrogenase/choline sulfate transporter
RA	85,078:1	+T	10.2%	intergenic (+56/+74)	aroE → / ← PP_0075	shikimate 5‑dehydrogenase/choline sulfate transporter
RA	85,081	T→G	11.8%	intergenic (+59/+71)	aroE → / ← PP_0075	shikimate 5‑dehydrogenase/choline sulfate transporter
RA	85,088	C→A	9.9%	intergenic (+66/+64)	aroE → / ← PP_0075	shikimate 5‑dehydrogenase/choline sulfate transporter
RA	85,091	Δ1 bp	10.0%	intergenic (+69/+61)	aroE → / ← PP_0075	shikimate 5‑dehydrogenase/choline sulfate transporter
RA	85,093	C→A	11.1%	intergenic (+71/+59)	aroE → / ← PP_0075	shikimate 5‑dehydrogenase/choline sulfate transporter
RA	85,096	C→T	10.5%	intergenic (+74/+56)	aroE → / ← PP_0075	shikimate 5‑dehydrogenase/choline sulfate transporter
RA	85,104	G→A	11.9%	intergenic (+82/+48)	aroE → / ← PP_0075	shikimate 5‑dehydrogenase/choline sulfate transporter
RA	86,240	G→T	5.2%	L160M (CTG→ATG)	PP_0075 ←	choline sulfate transporter
RA	86,245	A→C	5.2%	M158R (ATG→AGG)	PP_0075 ←	choline sulfate transporter
RA	92,184	G→T	7.8%	L66M (CTG→ATG)	trpA ←	tryptophan synthase subunit alpha
RA	92,186	T→C	7.9%	Q65R (CAG→CGG) ‡	trpA ←	tryptophan synthase subunit alpha
RA	92,187	G→A	8.0%	Q65* (CAG→TAG) ‡	trpA ←	tryptophan synthase subunit alpha
RA	92,189	A→C	8.1%	I64S (ATC→AGC)	trpA ←	tryptophan synthase subunit alpha
RA	92,443	G→A	6.4%	S384L (TCG→TTG)	trpB ←	tryptophan synthase subunit beta
RA	122,215	C→G	5.6%	intergenic (+25/+36)	katE → / ← PP_0116	hydroperoxidase/putative lipoprotein
RA	122,222	A→C	5.7%	intergenic (+32/+29)	katE → / ← PP_0116	hydroperoxidase/putative lipoprotein
RA	122,223	T→A	5.1%	intergenic (+33/+28)	katE → / ← PP_0116	hydroperoxidase/putative lipoprotein
RA	122,224	G→T	5.1%	intergenic (+34/+27)	katE → / ← PP_0116	hydroperoxidase/putative lipoprotein
RA	127,121	C→G	6.7%	intergenic (‑31/+39)	thrB ← / ← PP_0122	homoserine kinase/hypothetical protein
RA	127,122	C→G	7.6%	intergenic (‑32/+38)	thrB ← / ← PP_0122	homoserine kinase/hypothetical protein
RA	127,123	G→C	7.9%	intergenic (‑33/+37)	thrB ← / ← PP_0122	homoserine kinase/hypothetical protein
RA	133,296	C→G	5.8%	P25R (CCG→CGG)	PP_0128 →	hypothetical protein
RA	138,949	G→A	11.2%	R519W (CGG→TGG)	kinB ←	alginate biosynthesis sensor protein KinB
RA	138,950	T→G	11.4%	R518S (AGA→AGC) ‡	kinB ←	alginate biosynthesis sensor protein KinB
RA	138,951	C→A	10.9%	R518I (AGA→ATA) ‡	kinB ←	alginate biosynthesis sensor protein KinB
RA	138,952	T→C	11.2%	R518G (AGA→GGA) ‡	kinB ←	alginate biosynthesis sensor protein KinB
RA	158,997	G→T	6.1%	Y464* (TAC→TAA)	PP_0149 ←	hypothetical protein
RA	159,000	G→C	6.0%	G463G (GGC→GGG) ‡	PP_0149 ←	hypothetical protein
RA	159,001	C→G	6.0%	G463A (GGC→GCC) ‡	PP_0149 ←	hypothetical protein
RA	159,004	A→T	6.0%	L462Q (CTG→CAG)	PP_0149 ←	hypothetical protein
RA	159,007	C→G	6.1%	R461P (CGC→CCC) ‡	PP_0149 ←	hypothetical protein
RA	159,008	G→C	6.1%	R461G (CGC→GGC) ‡	PP_0149 ←	hypothetical protein
RA	159,011	A→C	6.0%	L460V (TTA→GTA)	PP_0149 ←	hypothetical protein
RA	186,766	T→C	6.2%	T51A (ACC→GCC)	PP_0163 ←	transcriptional regulator
RA	195,559	C→A	36.2%	T355T (ACC→ACA)	PP_0168 →	putative surface adhesion protein
RA	195,628	C→T	10.4%	D378D (GAC→GAT)	PP_0168 →	putative surface adhesion protein
RA	195,629	A→G	10.4%	T379A (ACC→GCC)	PP_0168 →	putative surface adhesion protein
RA	195,634	C→T	46.2%	T380T (ACC→ACT)	PP_0168 →	putative surface adhesion protein
RA	195,724	A→G	7.3%	V410V (GTA→GTG)	PP_0168 →	putative surface adhesion protein
RA	196,306	T→C	17.8%	N604N (AAT→AAC)	PP_0168 →	putative surface adhesion protein
RA	196,327	A→C	18.9%	T611T (ACA→ACC)	PP_0168 →	putative surface adhesion protein
RA	196,351	C→G	20.2%	T619T (ACC→ACG)	PP_0168 →	putative surface adhesion protein
RA	196,372	A→G	10.5%	K626K (AAA→AAG)	PP_0168 →	putative surface adhesion protein
RA	196,390	T→C	23.7%	D632D (GAT→GAC)	PP_0168 →	putative surface adhesion protein
RA	196,795	G→C	7.8%	T767T (ACG→ACC)	PP_0168 →	putative surface adhesion protein
RA	196,879	G→A	19.5%	V795V (GTG→GTA)	PP_0168 →	putative surface adhesion protein
RA	197,032	C→T	5.5%	T846T (ACC→ACT)	PP_0168 →	putative surface adhesion protein
RA	197,089	T→C	11.1%	N865N (AAT→AAC)	PP_0168 →	putative surface adhesion protein
RA	197,179	A→G	5.2%	V895V (GTA→GTG)	PP_0168 →	putative surface adhesion protein
RA	197,185	C→T	5.4%	T897T (ACC→ACT)	PP_0168 →	putative surface adhesion protein
RA	197,551	C→G	6.1%	T1019T (ACC→ACG)	PP_0168 →	putative surface adhesion protein
RA	197,572	G→A	13.5%	K1026K (AAG→AAA)	PP_0168 →	putative surface adhesion protein
RA	197,590	T→C	16.4%	D1032D (GAT→GAC)	PP_0168 →	putative surface adhesion protein
RA	197,632	T→C	10.7%	T1046T (ACT→ACC)	PP_0168 →	putative surface adhesion protein
RA	197,695	G→C	10.8%	T1067T (ACG→ACC)	PP_0168 →	putative surface adhesion protein
RA	201,385	T→C	6.6%	N2297N (AAT→AAC)	PP_0168 →	putative surface adhesion protein
RA	205,651	C→G	7.6%	V3719V (GTC→GTG)	PP_0168 →	putative surface adhesion protein
RA	205,663	C→T	8.0%	G3723G (GGC→GGT)	PP_0168 →	putative surface adhesion protein
RA	213,220	G→C	7.8%	V6242V (GTG→GTC)	PP_0168 →	putative surface adhesion protein
RA	220,562	C→G	6.7%	intergenic (+19/‑109)	PP_0168 → / → PP_5431	putative surface adhesion protein/hypothetical protein
RA	220,563	A→T	7.8%	intergenic (+20/‑108)	PP_0168 → / → PP_5431	putative surface adhesion protein/hypothetical protein
RA	233,832	A→T	13.9%	intergenic (+20/+43)	PP_0180 → / ← PP_0181	cytochrome c family protein/hypothetical protein
RA	233,833	C→G	13.1%	intergenic (+21/+42)	PP_0180 → / ← PP_0181	cytochrome c family protein/hypothetical protein
RA	233,834	A→T	13.1%	intergenic (+22/+41)	PP_0180 → / ← PP_0181	cytochrome c family protein/hypothetical protein
RA	239,052	C→T	5.5%	P45S (CCA→TCA) ‡	hemD →	uroporphyrinogen‑III synthase
RA	239,053	C→T	5.7%	P45L (CCA→CTA) ‡	hemD →	uroporphyrinogen‑III synthase
RA	239,060	G→A	5.2%	R47R (CGG→CGA)	hemD →	uroporphyrinogen‑III synthase
RA	239,062	T→A	5.3%	L48Q (CTG→CAG)	hemD →	uroporphyrinogen‑III synthase
RA	239,064	T→C	5.2%	S49P (TCG→CCG)	hemD →	uroporphyrinogen‑III synthase
RA	262,940	G→C	6.9%	intergenic (+175/‑310)	PP_0211 → / → gabD‑I	hypothetical protein/succinate‑semialdehyde dehydrogenase
RA	262,942	A→C	6.8%	intergenic (+177/‑308)	PP_0211 → / → gabD‑I	hypothetical protein/succinate‑semialdehyde dehydrogenase
RA	262,944	C→G	6.6%	intergenic (+179/‑306)	PP_0211 → / → gabD‑I	hypothetical protein/succinate‑semialdehyde dehydrogenase
RA	262,946	G→T	6.8%	intergenic (+181/‑304)	PP_0211 → / → gabD‑I	hypothetical protein/succinate‑semialdehyde dehydrogenase
RA	262,948	G→C	7.8%	intergenic (+183/‑302)	PP_0211 → / → gabD‑I	hypothetical protein/succinate‑semialdehyde dehydrogenase
RA	268,744	T→A	7.6%	intergenic (‑75/+25)	PP_0216 ← / ← desA	sensory box/GGDEF family protein/delta‑9 fatty acid desaturase
RA	268,746	G→C	7.1%	intergenic (‑77/+23)	PP_0216 ← / ← desA	sensory box/GGDEF family protein/delta‑9 fatty acid desaturase
RA	271,316	A→G	5.5%	H406R (CAC→CGC)	PP_0218 →	sensory box protein
RA	278,742:1	+A	100%	intergenic (‑237/+77)	PP_0224 ← / ← sctC	DszC family monooxygenase/sulfur compound ABC transporter ATP‑binding protein
RA	284,586	T→A	17.7%	intergenic (+33/+30)	betT‑II → / ← atsK	choline/carnitine/betaine transporter/alpha‑ketoglutarate‑dependent sulfonate dioxygenase
RA	284,587	T→A	17.7%	intergenic (+34/+29)	betT‑II → / ← atsK	choline/carnitine/betaine transporter/alpha‑ketoglutarate‑dependent sulfonate dioxygenase
RA	288,015	G→C	5.1%	Y31* (TAC→TAG) ‡	tauA ←	taurine ABC transporter substrate‑binding protein
RA	288,016	T→C	5.2%	Y31C (TAC→TGC) ‡	tauA ←	taurine ABC transporter substrate‑binding protein
RA	307,865:1	+C	100%	intergenic (+880/‑989)	hslO → / → PP_0254	molecular chaperone HslO/hypothetical protein
RA	308,738	C→T	7.1%	intergenic (+1753/‑116)	hslO → / → PP_0254	molecular chaperone HslO/hypothetical protein
RA	308,739	A→G	6.8%	intergenic (+1754/‑115)	hslO → / → PP_0254	molecular chaperone HslO/hypothetical protein
RA	313,965	C→G	7.4%	V192V (GTG→GTC) ‡	yrfG ←	purine nucleotidase
RA	313,966	A→T	6.6%	V192E (GTG→GAG) ‡	yrfG ←	purine nucleotidase
RA	313,967	C→G	7.2%	V192L (GTG→CTG) ‡	yrfG ←	purine nucleotidase
RA	317,012	C→T	6.4%	A307T (GCA→ACA)	dctD‑I ←	C4‑dicarboxylate transport transcriptional regulator
RA	322,133	G→A	14.6%	intergenic (+420/+38)	aguA → / ← PP_0267	agmatine deiminase/ferric siderophore receptor
RA	322,140	T→C	10.7%	intergenic (+427/+31)	aguA → / ← PP_0267	agmatine deiminase/ferric siderophore receptor
RA	326,065	C→A	8.3%	*556Y (TAG→TAT)	PP_0269 ←	glutamate synthase large subunit
RA	326,068	T→G	7.4%	A555A (GCA→GCC)	PP_0269 ←	glutamate synthase large subunit
RA	328,510	A→G	6.6%	L247P (CTG→CCG)	PP_0270 ←	sensor histidine kinase
RA	335,433	C→T	13.1%	intergenic (‑38/+166)	PP_0277 ← / ← PP_5437	hypothetical protein/hypothetical protein
RA	335,434	A→T	12.8%	intergenic (‑39/+165)	PP_0277 ← / ← PP_5437	hypothetical protein/hypothetical protein
RA	335,435	A→G	12.8%	intergenic (‑40/+164)	PP_0277 ← / ← PP_5437	hypothetical protein/hypothetical protein
RA	336,124:1	+T	100%	coding (209/237 nt)	PP_0278 →	hypothetical protein
RA	337,809	A→G	16.7%	intergenic (‑59/+70)	PP_0279 ← / ← PP_0280	hypothetical protein/amino acid ABC transporter permease
RA	337,816:1	+A	15.0%	intergenic (‑66/+63)	PP_0279 ← / ← PP_0280	hypothetical protein/amino acid ABC transporter permease
RA	337,819	A→C	15.0%	intergenic (‑69/+60)	PP_0279 ← / ← PP_0280	hypothetical protein/amino acid ABC transporter permease
RA	337,822	C→G	14.3%	intergenic (‑72/+57)	PP_0279 ← / ← PP_0280	hypothetical protein/amino acid ABC transporter permease
RA	337,825	G→T	13.3%	intergenic (‑75/+54)	PP_0279 ← / ← PP_0280	hypothetical protein/amino acid ABC transporter permease
RA	337,827	Δ1 bp	12.8%	intergenic (‑77/+52)	PP_0279 ← / ← PP_0280	hypothetical protein/amino acid ABC transporter permease
RA	337,836	C→T	13.6%	intergenic (‑86/+43)	PP_0279 ← / ← PP_0280	hypothetical protein/amino acid ABC transporter permease
RA	344,032	A→G	7.2%	intergenic (+121/+68)	PP_5440 → / ← PP_t72	hypothetical protein/tRNA‑Phe
RA	344,041	Δ1 bp	6.8%	intergenic (+130/+59)	PP_5440 → / ← PP_t72	hypothetical protein/tRNA‑Phe
RA	344,045:1	+T	6.7%	intergenic (+134/+55)	PP_5440 → / ← PP_t72	hypothetical protein/tRNA‑Phe
RA	346,118	G→A	6.2%	N576N (AAC→AAT) ‡	PP_0287 ←	hypothetical protein
RA	346,119	T→A	6.1%	N576I (AAC→ATC) ‡	PP_0287 ←	hypothetical protein
RA	346,120	T→C	6.2%	N576D (AAC→GAC) ‡	PP_0287 ←	hypothetical protein
RA	353,067	A→G	100%	intergenic (+34/+84)	hisF → / ← cbcV	imidazole glycerol phosphate synthase subunit HisF/choline/betaine/carnitine ABC transporter ATP binding protein
RA	373,407	C→G	5.0%	L217V (CTG→GTG)	dgcB →	dimethylglycine dehydrogenase subunit
RA	384,498	G→A	5.4%	A326T (GCA→ACA)	PP_0320 →	methyl‑accepting chemotaxis transducer
RA	387,791	T→G	7.0%	S311A (TCC→GCC) ‡	glyA‑I →	serine hydroxymethyltransferase
RA	387,792	C→T	6.9%	S311F (TCC→TTC) ‡	glyA‑I →	serine hydroxymethyltransferase
RA	387,798	G→C	7.1%	G313A (GGC→GCC)	glyA‑I →	serine hydroxymethyltransferase
RA	387,804	A→G	7.1%	D315G (GAC→GGC) ‡	glyA‑I →	serine hydroxymethyltransferase
RA	387,805	C→A	7.8%	D315E (GAC→GAA) ‡	glyA‑I →	serine hydroxymethyltransferase
RA	421,154	Δ1 bp	5.3%	intergenic (+11/+7)	PP_0347 → / ← PP_0348	hypothetical protein/hypothetical protein
RA	421,161	T→A	5.6%	*929C (TGA→TGT)	PP_0348 ←	hypothetical protein
RA	421,165	T→C	5.5%	H928R (CAC→CGC)	PP_0348 ←	hypothetical protein
RA	421,167:1	+A	5.7%	coding (2781/2787 nt)	PP_0348 ←	hypothetical protein
RA	431,343	A→G	5.1%	I324T (ATC→ACC)	PP_0354 ←	CBS domain‑containing protein
RA	431,362	C→T	5.9%	V318I (GTT→ATT)	PP_0354 ←	CBS domain‑containing protein
RA	432,993	A→T	9.2%	intergenic (+18/+29)	PP_0355 → / ← glcB	two‑component system response regulator/malate synthase G
RA	432,994	A→T	9.2%	intergenic (+19/+28)	PP_0355 → / ← glcB	two‑component system response regulator/malate synthase G
RA	432,995	A→T	9.2%	intergenic (+20/+27)	PP_0355 → / ← glcB	two‑component system response regulator/malate synthase G
RA	436,580	G→C	5.4%	H236Q (CAC→CAG)	PP_0358 ←	membrane protein
RA	461,030	C→G	5.1%	V479L (GTG→CTG)	pqqF ←	coenzyme PQQ synthesis protein F
RA	471,066	T→C	10.2%	intergenic (‑110/+18)	PP_0386 ← / ← rpoD	sensory box protein/RNA polymerase sigma 70 factor
RA	471,067	G→A	9.9%	intergenic (‑111/+17)	PP_0386 ← / ← rpoD	sensory box protein/RNA polymerase sigma 70 factor
RA	474,163	G→C	5.7%	A274A (GCC→GCG)	dnaG ←	DNA primase
RA	483,095	C→T	6.6%	Q448Q (CAG→CAA)	yeaG ←	protein kinase
RA	487,825	G→C	5.6%	R159R (CGC→CGG)	pdxA ←	4‑hydroxythreonine‑4‑phosphate dehydrogenase
RA	487,829	A→G	5.4%	L158P (CTG→CCG)	pdxA ←	4‑hydroxythreonine‑4‑phosphate dehydrogenase
RA	487,831	G→C	5.3%	G157G (GGC→GGG) ‡	pdxA ←	4‑hydroxythreonine‑4‑phosphate dehydrogenase
RA	487,833	C→T	5.6%	G157S (GGC→AGC) ‡	pdxA ←	4‑hydroxythreonine‑4‑phosphate dehydrogenase
RA	487,837	G→C	5.4%	T155T (ACC→ACG)	pdxA ←	4‑hydroxythreonine‑4‑phosphate dehydrogenase
RA	499,203	A→G	100%	intergenic (+47/‑249)	uhpA → / → PP_0411	two‑component system response regulator UhpA/polyamine ABC transporter ATP‑binding protein
RA	503,831	A→T	6.8%	intergenic (+34/‑117)	PP_0414 → / → rpe	polyamine ABC transporter permease/ribulose‑5‑phosphate 3‑epimerase
RA	503,832	A→T	6.8%	intergenic (+35/‑116)	PP_0414 → / → rpe	polyamine ABC transporter permease/ribulose‑5‑phosphate 3‑epimerase
RA	503,837:1	+C	5.6%	intergenic (+40/‑111)	PP_0414 → / → rpe	polyamine ABC transporter permease/ribulose‑5‑phosphate 3‑epimerase
RA	532,676	G→T	7.0%	intergenic (+19/‑60)	PP_t03 → / → tufA	tRNA‑Thr/elongation factor Tu‑A
RA	532,677	A→T	7.2%	intergenic (+20/‑59)	PP_t03 → / → tufA	tRNA‑Thr/elongation factor Tu‑A
RA	532,678	A→T	7.6%	intergenic (+21/‑58)	PP_t03 → / → tufA	tRNA‑Thr/elongation factor Tu‑A
RA	532,679	A→C	7.6%	intergenic (+22/‑57)	PP_t03 → / → tufA	tRNA‑Thr/elongation factor Tu‑A
RA	539,941	T→G	6.9%	R773R (CGT→CGG)	rpoB →	DNA‑directed RNA polymerase subunit beta
RA	539,942	C→A	6.7%	P774T (CCG→ACG)	rpoB →	DNA‑directed RNA polymerase subunit beta
RA	541,437	A→G	6.9%	Q1272R (CAG→CGG)	rpoB →	DNA‑directed RNA polymerase subunit beta
RA	541,440	C→T	6.4%	P1273L (CCG→CTG)	rpoB →	DNA‑directed RNA polymerase subunit beta
RA	550,549	C→G	7.2%	intergenic (+30/‑112)	tufB → / → rpsJ	elongation factor Tu‑B/30S ribosomal protein S10
RA	557,332	Δ1 bp	7.4%	intergenic (+75/‑134)	rpsN → / → rpsH	30S ribosomal protein S14/30S ribosomal protein S8
RA	557,336:1	+A	7.7%	intergenic (+79/‑130)	rpsN → / → rpsH	30S ribosomal protein S14/30S ribosomal protein S8
RA	564,377:1	+A	5.5%	intergenic (+29/‑144)	rplQ → / → katA	50S ribosomal protein L17/catalase
RA	564,382	Δ1 bp	5.3%	intergenic (+34/‑139)	rplQ → / → katA	50S ribosomal protein L17/catalase
RA	591,079	G→A	8.3%	R109H (CGC→CAC)	PP_0501 →	NAD‑dependent epimerase/dehydratase family protein
RA	591,082	T→C	8.4%	V110A (GTG→GCG)	PP_0501 →	NAD‑dependent epimerase/dehydratase family protein
RA	604,470	C→G	5.4%	P101R (CCA→CGA)	nusB →	transcription antitermination protein
RA	616,452	G→T	8.1%	noncoding (70/142 nt)	PP_mr11 ←	FMN regulatory region
RA	625,062	C→T	6.9%	intergenic (‑156/+27)	PP_0537 ← / ← ppa	transcriptional regulator/inorganic pyrophosphatase
RA	625,063	A→T	6.7%	intergenic (‑157/+26)	PP_0537 ← / ← ppa	transcriptional regulator/inorganic pyrophosphatase
RA	625,064	A→T	6.8%	intergenic (‑158/+25)	PP_0537 ← / ← ppa	transcriptional regulator/inorganic pyrophosphatase
RA	625,065	A→G	6.8%	intergenic (‑159/+24)	PP_0537 ← / ← ppa	transcriptional regulator/inorganic pyrophosphatase
RA	628,160	A→T	5.9%	I212N (ATT→AAT)	eutC ←	ethanolamine ammonia‑lyase subunit beta
RA	635,840	G→T	7.3%	E22* (GAA→TAA) ‡	mpl →	UDP‑N‑acetylmuramate:L‑alanyl‑gamma‑D‑glutamyl‑ meso‑diaminopimelate ligase
RA	635,841	A→T	6.4%	E22V (GAA→GTA) ‡	mpl →	UDP‑N‑acetylmuramate:L‑alanyl‑gamma‑D‑glutamyl‑ meso‑diaminopimelate ligase
RA	644,546	C→G	11.1%	E157D (GAG→GAC)	acoA ←	acetoin:2,6‑dichlorophenolindophenol oxidoreductase subunit alpha
RA	648,287	A→C	11.5%	intergenic (+56/+35)	acoR → / ← accC	acetoin catabolism regulatory protein/acetyl‑CoA carboxylase biotin carboxylase subunit
RA	650,231	C→T	5.5%	intergenic (‑75/+25)	accB ← / ← aroQ‑I	acetyl‑CoA carboxylase biotin carboxyl carrier subunit/type II 3‑dehydroquinate dehydratase
RA	655,060	G→A	6.1%	A428V (GCC→GTC)	PP_0563 ←	two‑component system response regulator
RA	655,067	T→C	6.0%	T426A (ACC→GCC)	PP_0563 ←	two‑component system response regulator
RA	668,263	G→T	10.2%	F87L (TTC→TTA) ‡	PP_0571 ←	membrane protein
RA	668,264	A→C	11.3%	F87C (TTC→TGC) ‡	PP_0571 ←	membrane protein
RA	679,882	G→T	5.6%	G257C (GGT→TGT)	PP_0582 →	thiolase family protein
RA	679,889	C→A	5.4%	S259Y (TCC→TAC)	PP_0582 →	thiolase family protein
RA	697,203	T→C	7.8%	intergenic (+130/‑621)	mmsA‑I → / → PP_16SD	methylmalonate‑semialdehyde dehydrogenase/16S ribosomal RNA
RA	697,214	T→C	7.7%	intergenic (+141/‑610)	mmsA‑I → / → PP_16SD	methylmalonate‑semialdehyde dehydrogenase/16S ribosomal RNA
RA	697,225	C→G	9.6%	intergenic (+152/‑599)	mmsA‑I → / → PP_16SD	methylmalonate‑semialdehyde dehydrogenase/16S ribosomal RNA
RA	697,228	C→G	9.0%	intergenic (+155/‑596)	mmsA‑I → / → PP_16SD	methylmalonate‑semialdehyde dehydrogenase/16S ribosomal RNA
RA	697,481	G→A	7.4%	intergenic (+408/‑343)	mmsA‑I → / → PP_16SD	methylmalonate‑semialdehyde dehydrogenase/16S ribosomal RNA
RA	699,722	A→G	38.3%	intergenic (+115/‑129)	PP_t06 → / → PP_23SD	tRNA‑Ala/23S ribosomal RNA
RA	707,055	C→T	8.4%	intergenic (+231/+15)	PP_0599 → / ← rpsT	paraquat‑inducible protein B/30S ribosomal protein S20
RA	715,009:1	+T	6.8%	intergenic (+75/+2)	ispH → / ← PP_0607	4‑hydroxy‑3‑methylbut‑2‑enyl diphosphate reductase/type IV pili biogenesis protein FimT
RA	715,016	Δ1 bp	6.7%	coding (478/483 nt)	PP_0607 ←	type IV pili biogenesis protein FimT
RA	733,645	A→T	10.8%	intergenic (+19/‑28)	PP_t09 → / → PP_t10	tRNA‑Lys/tRNA‑Pro
RA	733,646	A→T	10.9%	intergenic (+20/‑27)	PP_t09 → / → PP_t10	tRNA‑Lys/tRNA‑Pro
RA	733,647	A→T	10.5%	intergenic (+21/‑26)	PP_t09 → / → PP_t10	tRNA‑Lys/tRNA‑Pro
RA	743,266	G→A	33.3%	R456Q (CGG→CAG)	PP_0635 →	group II intron‑encoding maturase
RA	743,269	T→C	33.2%	L457P (CTC→CCC)	PP_0635 →	group II intron‑encoding maturase
RA	743,272	G→A	30.8%	G458E (GGG→GAG)	PP_0635 →	group II intron‑encoding maturase
RA	743,275	T→C	30.8%	L459P (CTG→CCG)	PP_0635 →	group II intron‑encoding maturase
RA	743,439	T→G	5.3%	intergenic (+118/+156)	PP_0635 → / ← PP_0636	group II intron‑encoding maturase/cold shock DNA‑binding domain‑containing protein
RA	743,440	T→A	5.3%	intergenic (+119/+155)	PP_0635 → / ← PP_0636	group II intron‑encoding maturase/cold shock DNA‑binding domain‑containing protein
RA	743,441	C→A	5.5%	intergenic (+120/+154)	PP_0635 → / ← PP_0636	group II intron‑encoding maturase/cold shock DNA‑binding domain‑containing protein
RA	772,178	T→C	10.8%	intergenic (+39/‑160)	PP_0663 → / → PP_0664	AsnC family transcriptional regulator/homoserine dehydrogenase
RA	772,179	T→G	11.8%	intergenic (+40/‑159)	PP_0663 → / → PP_0664	AsnC family transcriptional regulator/homoserine dehydrogenase
RA	772,182	C→A	11.6%	intergenic (+43/‑156)	PP_0663 → / → PP_0664	AsnC family transcriptional regulator/homoserine dehydrogenase
RA	772,183	G→A	11.6%	intergenic (+44/‑155)	PP_0663 → / → PP_0664	AsnC family transcriptional regulator/homoserine dehydrogenase
RA	780,556	A→C	5.2%	intergenic (‑86/+36)	PP_0670 ← / ← glyA‑II	bile acid/Na+ symporter family transporter/serine hydroxymethyltransferase
RA	780,558	T→A	5.5%	intergenic (‑88/+34)	PP_0670 ← / ← glyA‑II	bile acid/Na+ symporter family transporter/serine hydroxymethyltransferase
RA	780,560	G→T	7.8%	intergenic (‑90/+32)	PP_0670 ← / ← glyA‑II	bile acid/Na+ symporter family transporter/serine hydroxymethyltransferase
RA	797,982	T→G	10.3%	intergenic (+40/‑46)	PP_0683 → / → fklB‑I	hypothetical protein/FKBP‑type peptidyl‑prolyl cis‑trans isomerase
RA	797,983	T→A	10.4%	intergenic (+41/‑45)	PP_0683 → / → fklB‑I	hypothetical protein/FKBP‑type peptidyl‑prolyl cis‑trans isomerase
RA	797,986	T→A	10.4%	intergenic (+44/‑42)	PP_0683 → / → fklB‑I	hypothetical protein/FKBP‑type peptidyl‑prolyl cis‑trans isomerase
RA	797,987	C→A	10.7%	intergenic (+45/‑41)	PP_0683 → / → fklB‑I	hypothetical protein/FKBP‑type peptidyl‑prolyl cis‑trans isomerase
RA	798,662	C→A	7.3%	intergenic (+17/+10)	fklB‑I → / ← PP_0685	FKBP‑type peptidyl‑prolyl cis‑trans isomerase/hypothetical protein
RA	801,355	A→G	5.2%	intergenic (+28/‑161)	rpmA → / → obg	50S ribosomal protein L27/GTPase Obg
RA	801,356	T→C	5.2%	intergenic (+29/‑160)	rpmA → / → obg	50S ribosomal protein L27/GTPase Obg
RA	801,357	G→A	5.3%	intergenic (+30/‑159)	rpmA → / → obg	50S ribosomal protein L27/GTPase Obg
RA	801,358	C→T	5.4%	intergenic (+31/‑158)	rpmA → / → obg	50S ribosomal protein L27/GTPase Obg
RA	802,770	T→C	7.9%	intergenic (+28/‑58)	obg → / → proB	GTPase Obg/glutamate 5‑kinase
RA	802,771	C→A	8.0%	intergenic (+29/‑57)	obg → / → proB	GTPase Obg/glutamate 5‑kinase
RA	802,772	T→G	8.0%	intergenic (+30/‑56)	obg → / → proB	GTPase Obg/glutamate 5‑kinase
RA	802,773	G→A	7.9%	intergenic (+31/‑55)	obg → / → proB	GTPase Obg/glutamate 5‑kinase
RA	809,094	A→C	5.4%	R88R (CGT→CGG)	PP_0695 ←	hypothetical protein
RA	812,048	T→C	6.2%	Q68Q (CAA→CAG)	PP_0698 ←	LysR family transcriptional regulator
RA	863,898	T→A	8.5%	intergenic (+15/+21)	hemH → / ← uraA	ferrochelatase/uracil permease
RA	863,899	T→A	8.5%	intergenic (+16/+20)	hemH → / ← uraA	ferrochelatase/uracil permease
RA	863,900	T→A	8.5%	intergenic (+17/+19)	hemH → / ← uraA	ferrochelatase/uracil permease
RA	866,724	C→T	6.6%	A59A (GCC→GCT)	PP_0748 →	hypothetical protein
RA	866,725	G→A	6.6%	D60N (GAC→AAC) ‡	PP_0748 →	hypothetical protein
RA	866,726	A→T	6.6%	D60V (GAC→GTC) ‡	PP_0748 →	hypothetical protein
RA	866,732	C→T	6.4%	A62V (GCT→GTT)	PP_0748 →	hypothetical protein
RA	866,734	G→T	6.2%	E63* (GAA→TAA) ‡	PP_0748 →	hypothetical protein
RA	866,735	A→C	5.8%	E63A (GAA→GCA) ‡	PP_0748 →	hypothetical protein
RA	866,737	A→G	6.0%	T64A (ACC→GCC)	PP_0748 →	hypothetical protein
RA	866,743	A→T	6.7%	I66L (ATA→TTA) ‡	PP_0748 →	hypothetical protein
RA	866,744	T→C	6.4%	I66T (ATA→ACA) ‡	PP_0748 →	hypothetical protein
RA	866,745	A→G	6.3%	I66M (ATA→ATG) ‡	PP_0748 →	hypothetical protein
RA	873,425	T→C	8.2%	L20P (CTT→CCT)	PP_5457 →	hypothetical protein
RA	874,538	C→T	9.7%	V39V (GTC→GTT)	PP_0759 →	hypothetical protein
RA	874,539	G→C	9.9%	E40Q (GAA→CAA) ‡	PP_0759 →	hypothetical protein
RA	874,540	A→G	9.7%	E40G (GAA→GGA) ‡	PP_0759 →	hypothetical protein
RA	875,283	A→C	6.9%	intergenic (+22/+24)	PP_0759 → / ← PP_0760	hypothetical protein/membrane protein
RA	875,284	T→A	6.5%	intergenic (+23/+23)	PP_0759 → / ← PP_0760	hypothetical protein/membrane protein
RA	875,285	G→T	6.8%	intergenic (+24/+22)	PP_0759 → / ← PP_0760	hypothetical protein/membrane protein
RA	875,954	A→G	9.7%	intergenic (‑63/+24)	PP_0760 ← / ← PP_mr65	membrane protein/YybP‑YkoY
RA	875,956	G→C	9.8%	intergenic (‑65/+22)	PP_0760 ← / ← PP_mr65	membrane protein/YybP‑YkoY
RA	875,960	G→A	9.8%	intergenic (‑69/+18)	PP_0760 ← / ← PP_mr65	membrane protein/YybP‑YkoY
RA	889,441	A→C	10.0%	intergenic (+178/‑16)	PP_0769 → / → PP_0770	sensor histidine kinase/PemI‑like protein
RA	889,444	T→A	9.8%	intergenic (+181/‑13)	PP_0769 → / → PP_0770	sensor histidine kinase/PemI‑like protein
RA	889,445	T→A	9.8%	intergenic (+182/‑12)	PP_0769 → / → PP_0770	sensor histidine kinase/PemI‑like protein
RA	889,448	G→T	9.8%	intergenic (+185/‑9)	PP_0769 → / → PP_0770	sensor histidine kinase/PemI‑like protein
RA	900,289	T→A	6.1%	L133L (CTT→CTA)	PP_0784 →	hypothetical protein
RA	914,624	Δ1 bp	7.0%	coding (1335/1743 nt)	fruA →	PTS fructose transporter subunit IIBC
RA	925,901	C→T	7.1%	W242* (TGG→TAG) ‡	PP_0805 ←	outer membrane efflux protein
RA	925,902	A→G	7.1%	W242R (TGG→CGG) ‡	PP_0805 ←	outer membrane efflux protein
RA	927,770	A→C	5.1%	L5951R (CTG→CGG) ‡	PP_0806 ←	surface adhesion protein
RA	927,771	G→T	5.3%	L5951M (CTG→ATG) ‡	PP_0806 ←	surface adhesion protein
RA	932,428	A→G	5.7%	G4398G (GGT→GGC)	PP_0806 ←	surface adhesion protein
RA	932,432	T→C	6.2%	D4397G (GAC→GGC)	PP_0806 ←	surface adhesion protein
RA	932,435	G→A	6.4%	A4396V (GCC→GTC)	PP_0806 ←	surface adhesion protein
RA	932,439	C→T	6.5%	A4395T (GCC→ACC)	PP_0806 ←	surface adhesion protein
RA	932,444	G→T	5.5%	T4393K (ACA→AAA)	PP_0806 ←	surface adhesion protein
RA	941,990	G→A	5.2%	P1211L (CCC→CTC)	PP_0806 ←	surface adhesion protein
RA	943,611	C→G	5.1%	G671R (GGG→CGG)	PP_0806 ←	surface adhesion protein
RA	955,149	A→G	20.6%	intergenic (+103/‑210)	cyoE → / → alaC	protoheme IX farnesyltransferase/aminotransferase
RA	955,151	G→A	20.6%	intergenic (+105/‑208)	cyoE → / → alaC	protoheme IX farnesyltransferase/aminotransferase
RA	955,152	T→A	20.6%	intergenic (+106/‑207)	cyoE → / → alaC	protoheme IX farnesyltransferase/aminotransferase
RA	955,153	T→C	20.6%	intergenic (+107/‑206)	cyoE → / → alaC	protoheme IX farnesyltransferase/aminotransferase
RA	955,155	C→T	23.3%	intergenic (+109/‑204)	cyoE → / → alaC	protoheme IX farnesyltransferase/aminotransferase
RA	961,720	A→T	5.8%	L232Q (CTG→CAG)	selD ←	selenide, water dikinase
RA	971,677	C→T	7.1%	intergenic (+32/‑32)	yajC → / → secD	protein translocase subunit YajC/protein translocase subunit SecD
RA	971,678	A→T	6.8%	intergenic (+33/‑31)	yajC → / → secD	protein translocase subunit YajC/protein translocase subunit SecD
RA	971,679	A→G	6.8%	intergenic (+34/‑30)	yajC → / → secD	protein translocase subunit YajC/protein translocase subunit SecD
RA	983,581	T→A	7.9%	intergenic (+39/‑50)	iscX → / → ndk	cysteine desulfurase activity regulator/nucleoside diphosphate kinase
RA	983,584	A→T	8.0%	intergenic (+42/‑47)	iscX → / → ndk	cysteine desulfurase activity regulator/nucleoside diphosphate kinase
RA	983,587	T→A	8.2%	intergenic (+45/‑44)	iscX → / → ndk	cysteine desulfurase activity regulator/nucleoside diphosphate kinase
RA	1,013,228	A→T	22.2%	intergenic (+56/+75)	prfC → / ← potF‑I	peptide chain release factor 3/putrescine‑binding protein
RA	1,013,234	C→A	19.4%	intergenic (+62/+69)	prfC → / ← potF‑I	peptide chain release factor 3/putrescine‑binding protein
RA	1,013,235	A→T	18.4%	intergenic (+63/+68)	prfC → / ← potF‑I	peptide chain release factor 3/putrescine‑binding protein
RA	1,013,241	G→C	18.5%	intergenic (+69/+62)	prfC → / ← potF‑I	peptide chain release factor 3/putrescine‑binding protein
RA	1,013,242	G→C	18.8%	intergenic (+70/+61)	prfC → / ← potF‑I	peptide chain release factor 3/putrescine‑binding protein
RA	1,013,248	A→T	21.9%	intergenic (+76/+55)	prfC → / ← potF‑I	peptide chain release factor 3/putrescine‑binding protein
RA	1,013,249	T→G	25.0%	intergenic (+77/+54)	prfC → / ← potF‑I	peptide chain release factor 3/putrescine‑binding protein
RA	1,013,255	A→T	23.5%	intergenic (+83/+48)	prfC → / ← potF‑I	peptide chain release factor 3/putrescine‑binding protein
RA	1,013,286	C→T	9.5%	intergenic (+114/+17)	prfC → / ← potF‑I	peptide chain release factor 3/putrescine‑binding protein
RA	1,013,757	T→A	5.9%	Y209F (TAC→TTC)	potF‑I ←	putrescine‑binding protein
RA	1,013,761	G→T	5.4%	P208T (CCT→ACT)	potF‑I ←	putrescine‑binding protein
RA	1,013,762	C→G	6.0%	R207R (CGG→CGC)	potF‑I ←	putrescine‑binding protein
RA	1,013,765	C→G	6.0%	V206V (GTG→GTC) ‡	potF‑I ←	putrescine‑binding protein
RA	1,013,766	A→C	6.0%	V206G (GTG→GGG) ‡	potF‑I ←	putrescine‑binding protein
RA	1,017,834	C→T	8.3%	G10S (GGT→AGT)	PP_5461 ←	hypothetical protein
RA	1,017,836	A→T	8.3%	L9* (TTA→TAA) ‡	PP_5461 ←	hypothetical protein
RA	1,017,837	A→T	8.3%	L9I (TTA→ATA) ‡	PP_5461 ←	hypothetical protein
RA	1,017,839	A→G	8.3%	L8P (CTT→CCT)	PP_5461 ←	hypothetical protein
RA	1,034,960	T→C	5.3%	L333L (TTG→CTG)	PP_0892 →	phospholipase family protein
RA	1,034,963	A→T	5.3%	T334S (ACA→TCA)	PP_0892 →	phospholipase family protein
RA	1,034,966	G→A	5.5%	A335T (GCG→ACG)	PP_0892 →	phospholipase family protein
RA	1,041,198	G→T	5.4%	A46D (GCT→GAT)	PP_0900 ←	PAP2 family protein
RA	1,046,227	C→G	7.2%	M717I (ATG→ATC)	PP_0906 ←	RND family multidrug transporter
RA	1,046,230	C→G	7.6%	S716S (TCG→TCC)	PP_0906 ←	RND family multidrug transporter
RA	1,047,736	G→A	6.0%	S214S (TCC→TCT)	PP_0906 ←	RND family multidrug transporter
RA	1,054,462	A→C	8.8%	M1G (GTG→GGG) †‡	PP_0912 ←	hypothetical protein
RA	1,054,463	C→T	8.8%	M1M (GTG→ATG) †‡	PP_0912 ←	hypothetical protein
RA	1,054,464	A→T	8.8%	intergenic (‑1/+36)	PP_0912 ← / ← PP_0913	hypothetical protein/hypothetical protein
RA	1,054,465	A→G	8.9%	intergenic (‑2/+35)	PP_0912 ← / ← PP_0913	hypothetical protein/hypothetical protein
RA	1,054,466	G→T	9.7%	intergenic (‑3/+34)	PP_0912 ← / ← PP_0913	hypothetical protein/hypothetical protein
RA	1,060,961	A→G	6.4%	E56G (GAG→GGG)	PP_0918 →	3‑beta hydroxysteroid dehydrogenase/isomerase family protein
RA	1,066,335	T→C	7.2%	S89G (AGC→GGC)	PP_0924 ←	hypothetical protein
RA	1,066,338	T→C	7.2%	S88G (AGC→GGC)	PP_0924 ←	hypothetical protein
RA	1,066,339	G→A	7.3%	A87A (GCC→GCT)	PP_0924 ←	hypothetical protein
RA	1,066,342	G→A	7.2%	A86A (GCC→GCT)	PP_0924 ←	hypothetical protein
RA	1,069,781	A→G	7.0%	S315G (AGC→GGC)	aroP‑I →	aromatic amino acid transport protein
RA	1,070,246:1	+GA	100%	intergenic (+46/+96)	aroP‑I → / ← PP_0928	aromatic amino acid transport protein/K+‑dependent Na+/Ca+ exchanger‑like protein
RA	1,070,260	G→C	61.6%	intergenic (+60/+82)	aroP‑I → / ← PP_0928	aromatic amino acid transport protein/K+‑dependent Na+/Ca+ exchanger‑like protein
RA	1,070,263	G→C	55.2%	intergenic (+63/+79)	aroP‑I → / ← PP_0928	aromatic amino acid transport protein/K+‑dependent Na+/Ca+ exchanger‑like protein
RA	1,075,486	C→G	6.6%	I68M (ATC→ATG)	mreB →	cell wall structural actin‑like protein MreB
RA	1,075,487	C→G	6.6%	R69G (CGT→GGT)	mreB →	cell wall structural actin‑like protein MreB
RA	1,075,492	C→G	6.4%	T70T (ACC→ACG)	mreB →	cell wall structural actin‑like protein MreB
RA	1,075,493	C→G	6.3%	H71D (CAT→GAT)	mreB →	cell wall structural actin‑like protein MreB
RA	1,088,661	T→G	6.2%	intergenic (+157/‑97)	pmbA → / → PP_0943	regulatory protease/hypothetical protein
RA	1,088,662	C→A	6.3%	intergenic (+158/‑96)	pmbA → / → PP_0943	regulatory protease/hypothetical protein
RA	1,093,922	A→T	5.8%	L82Q (CTG→CAG)	ptsN ←	phosphotransferase system subunit IIA
RA	1,094,117	Δ1 bp	6.5%	coding (50/465 nt)	ptsN ←	phosphotransferase system subunit IIA
RA	1,094,123	A→C	7.7%	V15G (GTG→GGG)	ptsN ←	phosphotransferase system subunit IIA
RA	1,094,125	G→T	7.3%	L14L (CTC→CTA) ‡	ptsN ←	phosphotransferase system subunit IIA
RA	1,094,126	A→C	6.5%	L14R (CTC→CGC) ‡	ptsN ←	phosphotransferase system subunit IIA
RA	1,094,128	G→T	6.7%	S13S (TCC→TCA)	ptsN ←	phosphotransferase system subunit IIA
RA	1,094,133:1	+T	6.3%	coding (34/465 nt)	ptsN ←	phosphotransferase system subunit IIA
RA	1,105,119	C→T	6.6%	A174V (GCC→GTC) ‡	hisG →	ATP phosphoribosyltransferase
RA	1,105,120	C→G	6.1%	A174A (GCC→GCG) ‡	hisG →	ATP phosphoribosyltransferase
RA	1,105,121	A→G	6.6%	T175A (ACG→GCG)	hisG →	ATP phosphoribosyltransferase
RA	1,115,625	A→T	6.7%	L736* (TTG→TAG) ‡	valS ←	valine‑‑tRNA ligase
RA	1,115,626	A→T	6.6%	L736M (TTG→ATG) ‡	valS ←	valine‑‑tRNA ligase
RA	1,120,469	T→A	6.4%	intergenic (‑211/‑91)	pepA ← / → PP_0982	cytosol aminopeptidase/YjgP/YjgQ family permease
RA	1,120,470	T→A	6.4%	intergenic (‑212/‑90)	pepA ← / → PP_0982	cytosol aminopeptidase/YjgP/YjgQ family permease
RA	1,120,471	T→A	6.4%	intergenic (‑213/‑89)	pepA ← / → PP_0982	cytosol aminopeptidase/YjgP/YjgQ family permease
RA	1,126,645:1	+C	100%	intergenic (‑99/+50)	tdcG‑II ← / ← gcvP‑I	L‑serine dehydratase/glycine dehydrogenase
RA	1,145,433	C→T	12.5%	intergenic (‑100/+41)	hemO ← / ← PP_1006	heme oxygenase/heme receptor
RA	1,145,440	G→A	10.6%	intergenic (‑107/+34)	hemO ← / ← PP_1006	heme oxygenase/heme receptor
RA	1,145,441	T→C	10.6%	intergenic (‑108/+33)	hemO ← / ← PP_1006	heme oxygenase/heme receptor
RA	1,145,448	A→G	10.0%	intergenic (‑115/+26)	hemO ← / ← PP_1006	heme oxygenase/heme receptor
RA	1,184,585	G→C	40.5%	intergenic (‑201/‑211)	mltF ← / → purL	membrane‑bound lytic murein transglycosylase F/phosphoribosylformylglycinamidine synthase
RA	1,184,588	G→C	44.0%	intergenic (‑204/‑208)	mltF ← / → purL	membrane‑bound lytic murein transglycosylase F/phosphoribosylformylglycinamidine synthase
RA	1,184,605	C→T	17.9%	intergenic (‑221/‑191)	mltF ← / → purL	membrane‑bound lytic murein transglycosylase F/phosphoribosylformylglycinamidine synthase
RA	1,184,612	A→T	11.1%	intergenic (‑228/‑184)	mltF ← / → purL	membrane‑bound lytic murein transglycosylase F/phosphoribosylformylglycinamidine synthase
RA	1,189,035	A→G	8.8%	intergenic (+25/+17)	PP_1038 → / ← tatC‑I	hypothetical protein/Sec‑independent protein translocase protein
RA	1,189,036	C→T	8.4%	intergenic (+26/+16)	PP_1038 → / ← tatC‑I	hypothetical protein/Sec‑independent protein translocase protein
RA	1,189,494	T→G	6.7%	E107A (GAA→GCA) ‡	tatC‑I ←	Sec‑independent protein translocase protein
RA	1,189,495	C→A	5.8%	E107* (GAA→TAA) ‡	tatC‑I ←	Sec‑independent protein translocase protein
RA	1,201,597	A→T	6.0%	P135P (CCA→CCT)  M1M (ATG→TTG) †	xcpV → xcpW →	type II secretion pathway protein XcpV type II secretion pathway protein XcpW
RA	1,202,857	G→T	6.2%	R229L (CGG→CTG)	xcpY →	type II secretion pathway protein XcpY
RA	1,210,827	T→A	17.6%	intergenic (+17/+20)	ytnA → / ← PP_1060	amino acid permease YtnA/glutamate synthase large subunit
RA	1,210,828	T→A	12.1%	intergenic (+18/+19)	ytnA → / ← PP_1060	amino acid permease YtnA/glutamate synthase large subunit
RA	1,210,829	T→A	12.1%	intergenic (+19/+18)	ytnA → / ← PP_1060	amino acid permease YtnA/glutamate synthase large subunit
RA	1,212,380	T→A	7.5%	E29D (GAA→GAT)	PP_1060 ←	glutamate synthase large subunit
RA	1,212,520	C→T	100%	intergenic (‑54/+134)	PP_1060 ← / ← PP_1061	glutamate synthase large subunit/ATP‑dependent DNA helicase
RA	1,215,084	G→T	7.2%	Y625* (TAC→TAA) ‡	PP_1061 ←	ATP‑dependent DNA helicase
RA	1,215,086	A→G	7.0%	Y625H (TAC→CAC) ‡	PP_1061 ←	ATP‑dependent DNA helicase
RA	1,215,087	G→C	9.1%	D624E (GAC→GAG)	PP_1061 ←	ATP‑dependent DNA helicase
RA	1,215,092	G→C	8.3%	L623V (CTC→GTC)	PP_1061 ←	ATP‑dependent DNA helicase
RA	1,215,093	C→T	7.2%	L622L (TTG→TTA) ‡	PP_1061 ←	ATP‑dependent DNA helicase
RA	1,215,095	A→C	7.2%	L622V (TTG→GTG) ‡	PP_1061 ←	ATP‑dependent DNA helicase
RA	1,224,630	C→T	7.9%	W16* (TGG→TGA) ‡	gltK ←	glutamate/aspartate ABC transporter permease
RA	1,224,631	C→G	7.9%	W16S (TGG→TCG) ‡	gltK ←	glutamate/aspartate ABC transporter permease
RA	1,224,632	A→G	7.3%	W16R (TGG→CGG) ‡	gltK ←	glutamate/aspartate ABC transporter permease
RA	1,226,127	C→A	5.1%	G122C (GGC→TGC)	gltI ←	glutamate/aspartate ABC transporter substrate‑binding protein
RA	1,226,707	T→A	10.7%	intergenic (‑217/‑114)	gltI ← / → PP_1072	glutamate/aspartate ABC transporter substrate‑binding protein/leucine‑rich repeat‑containing protein
RA	1,226,710	T→A	10.2%	intergenic (‑220/‑111)	gltI ← / → PP_1072	glutamate/aspartate ABC transporter substrate‑binding protein/leucine‑rich repeat‑containing protein
RA	1,230,583	G→T	7.0%	V1255F (GTC→TTC)	PP_1072 →	leucine‑rich repeat‑containing protein
RA	1,235,928	G→T	6.2%	R87R (CGC→CGA)	glpF ←	aquaglyceroporin
RA	1,242,983	G→A	8.3%	intergenic (‑99/‑126)	PP_1083 ← / → tsaA	(2Fe‑2S)‑binding protein/peroxiredoxin
RA	1,244,368	A→G	11.4%	G39G (GGT→GGC) ‡	rnt ←	ribonuclease T
RA	1,244,369	C→G	11.4%	G39A (GGT→GCT) ‡	rnt ←	ribonuclease T
RA	1,244,370	C→T	11.3%	G39S (GGT→AGT) ‡	rnt ←	ribonuclease T
RA	1,269,389	C→G	6.0%	D15H (GAT→CAT)	PP_1109 ←	GntR family transcriptional regulator
RA	1,275,084	G→C	13.7%	intergenic (‑281/+31)	PP_5462 ← / ← PP_5463	hypothetical protein/hypothetical protein
RA	1,275,087	G→C	15.2%	intergenic (‑284/+28)	PP_5462 ← / ← PP_5463	hypothetical protein/hypothetical protein
RA	1,287,868	C→G	5.9%	T417T (ACC→ACG)	PP_1125 →	putative Helicase
RA	1,293,255	T→G	5.1%	A286A (GCT→GCG)	PP_1128 →	OmpA family protein
RA	1,293,264	C→A	5.1%	A289A (GCC→GCA)	PP_1128 →	OmpA family protein
RA	1,294,413	C→T	8.8%	R11Q (CGG→CAG)	PP_1130 ←	hypothetical protein
RA	1,294,415	G→C	9.5%	C10W (TGC→TGG) ‡	PP_1130 ←	hypothetical protein
RA	1,294,417	A→G	8.4%	C10R (TGC→CGC) ‡	PP_1130 ←	hypothetical protein
RA	1,311,322	C→G	5.8%	A71P (GCA→CCA)	PP_1144 ←	membrane protein
RA	1,313,631	G→C	6.3%	A342A (GCC→GCG)	rapA ←	RNA polymerase‑associated protein RapA
RA	1,313,636	G→C	5.3%	R341G (CGC→GGC)	rapA ←	RNA polymerase‑associated protein RapA
RA	1,320,300	T→A	9.4%	T811S (ACA→TCA)	PP_1154 ←	sensory box protein
RA	1,320,303	C→G	9.5%	V810L (GTG→CTG)	PP_1154 ←	sensory box protein
RA	1,320,306	T→A	10.7%	T809S (ACA→TCA)	PP_1154 ←	sensory box protein
RA	1,327,121	C→T	56.2%	intergenic (+97/‑196)	PP_16SE → / → PP_23SE	16S ribosomal RNA/23S ribosomal RNA
RA	1,342,251	C→T	11.5%	intergenic (‑35/+20)	PP_1166 ← / ← PP_1167	DMT superfamily permease/TRAP dicarboxylate transporter subunit DctM
RA	1,342,252	A→T	11.1%	intergenic (‑36/+19)	PP_1166 ← / ← PP_1167	DMT superfamily permease/TRAP dicarboxylate transporter subunit DctM
RA	1,342,253	A→G	11.3%	intergenic (‑37/+18)	PP_1166 ← / ← PP_1167	DMT superfamily permease/TRAP dicarboxylate transporter subunit DctM
RA	1,352,288	C→T	6.2%	E24K (GAA→AAA)	PP_1178 ←	hypothetical protein
RA	1,352,293	G→T	6.1%	S22* (TCG→TAG) ‡	PP_1178 ←	hypothetical protein
RA	1,352,294	A→C	7.0%	S22A (TCG→GCG) ‡	PP_1178 ←	hypothetical protein
RA	1,352,299	A→G	6.2%	F20S (TTC→TCC)	PP_1178 ←	hypothetical protein
RA	1,376,322	G→C	6.4%	intergenic (+31/+18)	kup → / ← PP_1201	potassium transport system protein Kup/hypothetical protein
RA	1,376,323	A→T	6.4%	intergenic (+32/+17)	kup → / ← PP_1201	potassium transport system protein Kup/hypothetical protein
RA	1,383,254	A→T	13.0%	L16Q (CTG→CAG)	PP_1204 ←	lipoprotein
RA	1,384,157	T→G	14.3%	I292L (ATT→CTT)	proS ←	proline‑‑tRNA ligase
RA	1,384,159	A→T	14.3%	L291Q (CTG→CAG)	proS ←	proline‑‑tRNA ligase
RA	1,384,161	C→A	13.4%	K290N (AAG→AAT)	proS ←	proline‑‑tRNA ligase
RA	1,397,101	G→C	6.4%	V17L (GTC→CTC)	tolA →	colicin S4/filamentous phage transport protein
RA	1,399,148	Δ1 bp	6.6%	coding (981/1302 nt)	tolB →	Tol biopolymer transport system protein
RA	1,400,872	C→A	5.6%	intergenic (+35/‑134)	ybgF → / → queE	TolQRA transport system periplasmic protein/7‑carboxy‑7‑deazaguanine synthase
RA	1,400,874	A→T	7.0%	intergenic (+37/‑132)	ybgF → / → queE	TolQRA transport system periplasmic protein/7‑carboxy‑7‑deazaguanine synthase
RA	1,400,876	T→G	6.3%	intergenic (+39/‑130)	ybgF → / → queE	TolQRA transport system periplasmic protein/7‑carboxy‑7‑deazaguanine synthase
RA	1,401,650	T→C	6.5%	R215R (CGT→CGC)	queE →	7‑carboxy‑7‑deazaguanine synthase
RA	1,403,590	G→A	17.8%	intergenic (‑56/+25)	PP_1227 ← / ← PP_1228	membrane protein/methyl‑accepting chemotaxis transducer
RA	1,416,862	G→A	5.7%	R37Q (CGG→CAG)	PP_1239 →	metallo‑beta‑lactamase family protein
RA	1,416,868	T→A	5.7%	L39Q (CTG→CAG)	PP_1239 →	metallo‑beta‑lactamase family protein
RA	1,419,548:1	+C	100%	intergenic (‑37/+99)	PP_1242 ← / ← PP_1244	hypothetical protein/hypothetical protein
RA	1,435,815	A→T	6.4%	L50Q (CTG→CAG)	PP_1256 ←	alpha‑ketoglutarate semialdehyde dehydrogenase
RA	1,435,822	A→T	8.1%	C48S (TGC→AGC)	PP_1256 ←	alpha‑ketoglutarate semialdehyde dehydrogenase
RA	1,450,049	G→A	7.6%	R7C (CGC→TGC)	PP_1268 ←	HtrA suppressor protein SohA
RA	1,450,925	C→T	15.0%	R37W (CGG→TGG)	PP_1270 →	LysR family transcriptional regulator
RA	1,453,671	C→T	7.1%	A102V (GCG→GTG)	PP_1272 →	multidrug MFS transporter membrane fusion protein
RA	1,457,917	T→G	8.6%	V92V (GTT→GTG)	PP_1276 →	hypothetical protein
RA	1,457,918	C→A	7.3%	H93N (CAC→AAC)	PP_1276 →	hypothetical protein
RA	1,472,713	C→G	6.0%	S38S (TCG→TCC)	alg8 ←	glycosyltransferase Alg8
RA	1,481,515	T→C	6.2%	S75G (AGC→GGC)	rhlB ←	ATP‑dependent RNA helicase RhlB
RA	1,483,879	C→A	7.3%	intergenic (+24/‑44)	yhdW → / → yhdX	amino acid ABC transporter‑binding protein YhdW/amino acid ABC transporter permease
RA	1,489,370	A→G	8.3%	intergenic (+169/‑34)	ybgI → / → cysD	metal‑binding hydrolase/oxidase/sulfate adenylyltransferase subunit 2
RA	1,494,903	C→T	6.9%	intergenic (‑33/+62)	PP_1306 ← / ← PP_1307	Pyocin S‑type killer domain‑containing protein/AsnC family transcriptional regulator
RA	1,495,650	G→A	6.4%	A27T (GCC→ACC)	mdeA →	methionine gamma‑lyase
RA	1,495,653	C→A	5.9%	L28M (CTG→ATG) ‡	mdeA →	methionine gamma‑lyase
RA	1,495,654	T→G	6.1%	L28R (CTG→CGG) ‡	mdeA →	methionine gamma‑lyase
RA	1,495,657	T→C	6.6%	V29A (GTG→GCG)	mdeA →	methionine gamma‑lyase
RA	1,496,815	T→G	7.9%	intergenic (+47/+25)	mdeA → / ← PP_1309	methionine gamma‑lyase/hypothetical protein
RA	1,496,816	T→C	7.8%	intergenic (+48/+24)	mdeA → / ← PP_1309	methionine gamma‑lyase/hypothetical protein
RA	1,496,817	G→A	7.7%	intergenic (+49/+23)	mdeA → / ← PP_1309	methionine gamma‑lyase/hypothetical protein
RA	1,496,818	C→A	9.0%	intergenic (+50/+22)	mdeA → / ← PP_1309	methionine gamma‑lyase/hypothetical protein
RA	1,499,480	2 bp→AC	100%	intergenic (+57/‑106)	trpS → / → zapE	tryptophan‑‑tRNA ligase/nucleoside triphosphate hydrolase domain‑containing protein
RA	1,499,498	1 bp→CG	100%	intergenic (+75/‑89)	trpS → / → zapE	tryptophan‑‑tRNA ligase/nucleoside triphosphate hydrolase domain‑containing protein
RA	1,499,506:1	+C	100%	intergenic (+83/‑81)	trpS → / → zapE	tryptophan‑‑tRNA ligase/nucleoside triphosphate hydrolase domain‑containing protein
RA	1,504,067	T→A	9.2%	intergenic (+34/‑229)	rpsI → / → petA	30S ribosomal protein S9/ubiquinol‑cytochrome c reductase iron‑sulfur subunit
RA	1,504,068	T→A	9.1%	intergenic (+35/‑228)	rpsI → / → petA	30S ribosomal protein S9/ubiquinol‑cytochrome c reductase iron‑sulfur subunit
RA	1,505,538	G→T	8.7%	G217V (GGC→GTC)	petB →	cytochrome b
RA	1,505,544	A→C	5.4%	D219A (GAC→GCC)	petB →	cytochrome b
RA	1,517,281	C→A	8.2%	A157A (GCC→GCA)	murE →	UDP‑N‑acetylmuramoyl‑L‑alanyl‑D‑glutamate‑‑2, 6‑diaminopimelate ligase
RA	1,517,282	G→C	10.1%	V158L (GTG→CTG) ‡	murE →	UDP‑N‑acetylmuramoyl‑L‑alanyl‑D‑glutamate‑‑2, 6‑diaminopimelate ligase
RA	1,517,283	T→G	8.8%	V158G (GTG→GGG) ‡	murE →	UDP‑N‑acetylmuramoyl‑L‑alanyl‑D‑glutamate‑‑2, 6‑diaminopimelate ligase
RA	1,521,246	T→G	8.7%	F168C (TTC→TGC) ‡	murD →	UDP‑N‑acetylmuramoylalanine‑‑D‑glutamate ligase
RA	1,521,247	C→G	8.7%	F168L (TTC→TTG) ‡	murD →	UDP‑N‑acetylmuramoylalanine‑‑D‑glutamate ligase
RA	1,521,248	C→A	8.7%	Q169K (CAG→AAG)	murD →	UDP‑N‑acetylmuramoylalanine‑‑D‑glutamate ligase
RA	1,521,990	C→T	7.2%	A416V (GCC→GTC)	murD →	UDP‑N‑acetylmuramoylalanine‑‑D‑glutamate ligase
RA	1,533,185	C→G	5.1%	T399S (ACC→AGC) ‡	secA →	protein translocase subunit SecA
RA	1,533,186	C→T	5.1%	T399T (ACC→ACT) ‡	secA →	protein translocase subunit SecA
RA	1,544,489	C→A	25.0%	intergenic (+48/+66)	mdfA → / ← ampG	multidrug MFS transporter/muropeptide permease AmpG
RA	1,544,492	G→C	22.8%	intergenic (+51/+63)	mdfA → / ← ampG	multidrug MFS transporter/muropeptide permease AmpG
RA	1,544,494	C→G	31.3%	intergenic (+53/+61)	mdfA → / ← ampG	multidrug MFS transporter/muropeptide permease AmpG
RA	1,544,499	C→G	31.2%	intergenic (+58/+56)	mdfA → / ← ampG	multidrug MFS transporter/muropeptide permease AmpG
RA	1,544,501	G→C	31.3%	intergenic (+60/+54)	mdfA → / ← ampG	multidrug MFS transporter/muropeptide permease AmpG
RA	1,544,504	T→G	27.8%	intergenic (+63/+51)	mdfA → / ← ampG	multidrug MFS transporter/muropeptide permease AmpG
RA	1,549,895	A→T	9.4%	I99F (ATC→TTC)	groL →	chaperonin GroEL
RA	1,549,900	C→T	9.4%	V100V (GTC→GTT)	groL →	chaperonin GroEL
RA	1,549,901	A→G	9.4%	N101D (AAC→GAC)	groL →	chaperonin GroEL
RA	1,549,906	A→T	9.6%	E102D (GAA→GAT)	groL →	chaperonin GroEL
RA	1,555,388	A→C	15.6%	intergenic (+26/+48)	sbcB → / ← PP_1366	exodeoxyribonuclease I/transcriptional regulator MvaT
RA	1,555,389	T→A	15.9%	intergenic (+27/+47)	sbcB → / ← PP_1366	exodeoxyribonuclease I/transcriptional regulator MvaT
RA	1,555,390	G→T	16.0%	intergenic (+28/+46)	sbcB → / ← PP_1366	exodeoxyribonuclease I/transcriptional regulator MvaT
RA	1,561,513	T→A	5.3%	N193I (AAC→ATC) ‡	pctA ←	methyl‑accepting chemotaxis protein PctA
RA	1,561,514	T→C	5.2%	N193D (AAC→GAC) ‡	pctA ←	methyl‑accepting chemotaxis protein PctA
RA	1,567,267	T→C	7.0%	intergenic (+71/‑250)	pcaR → / → pcaK	pca regulon transcriptional regulator/4‑hydroxybenzoate transporter
RA	1,572,248	T→C	5.6%	L124L (TTG→CTG) ‡	pcaB →	3‑carboxy‑cis,cis‑muconate cycloisomerase
RA	1,572,249	T→A	5.6%	L124* (TTG→TAG) ‡	pcaB →	3‑carboxy‑cis,cis‑muconate cycloisomerase
RA	1,572,889	C→A	7.6%	A337A (GCC→GCA)	pcaB →	3‑carboxy‑cis,cis‑muconate cycloisomerase
RA	1,572,890	C→G	7.2%	L338V (CTG→GTG) ‡	pcaB →	3‑carboxy‑cis,cis‑muconate cycloisomerase
RA	1,572,891	T→G	7.5%	L338R (CTG→CGG) ‡	pcaB →	3‑carboxy‑cis,cis‑muconate cycloisomerase
RA	1,580,604	C→T	7.3%	V265I (GTC→ATC)	ttgB ←	efflux pump membrane protein TtgB
RA	1,580,605	A→G	7.2%	D264D (GAT→GAC)	ttgB ←	efflux pump membrane protein TtgB
RA	1,580,995	C→A	100%	K134N (AAG→AAT)	ttgB ←	efflux pump membrane protein TtgB
RA	1,582,780	T→A	8.4%	intergenic (‑226/‑32)	ttgA ← / → ttgR	efflux pump periplasmic linker TtgA/HTH‑type transcriptional regulator TtgR
RA	1,582,787	T→G	7.8%	intergenic (‑233/‑25)	ttgA ← / → ttgR	efflux pump periplasmic linker TtgA/HTH‑type transcriptional regulator TtgR
RA	1,591,982	C→A	14.0%	intergenic (‑89/‑114)	PP_1395 ← / → PP_1396	AraC family transcriptional regulator/hypothetical protein
RA	1,591,987	T→G	11.4%	intergenic (‑94/‑109)	PP_1395 ← / → PP_1396	AraC family transcriptional regulator/hypothetical protein
RA	1,598,170	T→C	5.5%	I198V (ATC→GTC)	dctB ←	C4‑dicarboxylate transport sensor protein
RA	1,598,813	C→A	5.3%	intergenic (‑52/+79)	dctB ← / ← bglX	C4‑dicarboxylate transport sensor protein/beta‑D‑glucoside glucohydrolase
RA	1,598,828	A→G	9.2%	intergenic (‑67/+64)	dctB ← / ← bglX	C4‑dicarboxylate transport sensor protein/beta‑D‑glucoside glucohydrolase
RA	1,598,831	C→G	9.1%	intergenic (‑70/+61)	dctB ← / ← bglX	C4‑dicarboxylate transport sensor protein/beta‑D‑glucoside glucohydrolase
RA	1,598,832	T→C	9.1%	intergenic (‑71/+60)	dctB ← / ← bglX	C4‑dicarboxylate transport sensor protein/beta‑D‑glucoside glucohydrolase
RA	1,598,833	G→A	8.6%	intergenic (‑72/+59)	dctB ← / ← bglX	C4‑dicarboxylate transport sensor protein/beta‑D‑glucoside glucohydrolase
RA	1,598,834	C→G	8.4%	intergenic (‑73/+58)	dctB ← / ← bglX	C4‑dicarboxylate transport sensor protein/beta‑D‑glucoside glucohydrolase
RA	1,598,837	C→T	8.6%	intergenic (‑76/+55)	dctB ← / ← bglX	C4‑dicarboxylate transport sensor protein/beta‑D‑glucoside glucohydrolase
RA	1,620,347	G→C	5.9%	intergenic (‑113/‑88)	opdH ← / → tctD	tricarboxylate‑specific outer membrane porin/transcriptional regulator TctD
RA	1,620,348	C→G	6.2%	intergenic (‑114/‑87)	opdH ← / → tctD	tricarboxylate‑specific outer membrane porin/transcriptional regulator TctD
RA	1,620,349	G→C	6.4%	intergenic (‑115/‑86)	opdH ← / → tctD	tricarboxylate‑specific outer membrane porin/transcriptional regulator TctD
RA	1,622,913	C→T	6.7%	L148L (TTG→TTA) ‡	PP_1422 ←	hypothetical protein
RA	1,622,914	A→T	6.3%	L148* (TTG→TAG) ‡	PP_1422 ←	hypothetical protein
RA	1,622,915	A→G	6.3%	L148L (TTG→CTG) ‡	PP_1422 ←	hypothetical protein
RA	1,625,207	G→T	7.1%	intergenic (+30/+27)	PP_1425 → / ← nadB	hypothetical protein/L‑aspartate oxidase
RA	1,625,208	A→C	7.6%	intergenic (+31/+26)	PP_1425 → / ← nadB	hypothetical protein/L‑aspartate oxidase
RA	1,637,315	T→C	7.9%	intergenic (+24/+42)	pdxJ → / ← PP_1437	pyridoxine 5'‑phosphate synthase/heavy metal sensor histidine kinase
RA	1,637,325	A→T	13.0%	intergenic (+34/+32)	pdxJ → / ← PP_1437	pyridoxine 5'‑phosphate synthase/heavy metal sensor histidine kinase
RA	1,637,326	A→T	13.1%	intergenic (+35/+31)	pdxJ → / ← PP_1437	pyridoxine 5'‑phosphate synthase/heavy metal sensor histidine kinase
RA	1,637,342	A→G	10.1%	intergenic (+51/+15)	pdxJ → / ← PP_1437	pyridoxine 5'‑phosphate synthase/heavy metal sensor histidine kinase
RA	1,637,344	C→T	7.7%	intergenic (+53/+13)	pdxJ → / ← PP_1437	pyridoxine 5'‑phosphate synthase/heavy metal sensor histidine kinase
RA	1,639,575	C→T	9.7%	intergenic (‑165/‑146)	czcR‑III ← / → PP_1439	response regulator/hypothetical protein
RA	1,639,576	G→T	9.2%	intergenic (‑166/‑145)	czcR‑III ← / → PP_1439	response regulator/hypothetical protein
RA	1,639,580	G→A	9.4%	intergenic (‑170/‑141)	czcR‑III ← / → PP_1439	response regulator/hypothetical protein
RA	1,639,581	T→C	9.8%	intergenic (‑171/‑140)	czcR‑III ← / → PP_1439	response regulator/hypothetical protein
RA	1,639,585	A→C	9.2%	intergenic (‑175/‑136)	czcR‑III ← / → PP_1439	response regulator/hypothetical protein
RA	1,639,586	A→G	9.4%	intergenic (‑176/‑135)	czcR‑III ← / → PP_1439	response regulator/hypothetical protein
RA	1,642,271	G→C	12.5%	intergenic (‑99/+53)	PP_1442 ← / ← lon‑I	hypothetical protein/DNA‑binding ATP‑dependent protease
RA	1,642,277	G→C	11.9%	intergenic (‑105/+47)	PP_1442 ← / ← lon‑I	hypothetical protein/DNA‑binding ATP‑dependent protease
RA	1,642,278	C→G	11.7%	intergenic (‑106/+46)	PP_1442 ← / ← lon‑I	hypothetical protein/DNA‑binding ATP‑dependent protease
RA	1,642,279	G→C	11.6%	intergenic (‑107/+45)	PP_1442 ← / ← lon‑I	hypothetical protein/DNA‑binding ATP‑dependent protease
RA	1,642,285	G→C	11.8%	intergenic (‑113/+39)	PP_1442 ← / ← lon‑I	hypothetical protein/DNA‑binding ATP‑dependent protease
RA	1,652,200	A→G	5.2%	intergenic (+119/+42)	PP_1448 → / ← PP_1449	membrane protein/hypothetical protein
RA	1,657,538	T→A	7.6%	D319V (GAC→GTC)	PP_1450 ←	TPS family activation/secretion protein
RA	1,663,075	A→T	6.2%	intergenic (+21/+17)	purT → / ← yhjE	phosphoribosylglycinamide formyltransferase/metabolite transport protein YhjE
RA	1,663,076	A→T	6.2%	intergenic (+22/+16)	purT → / ← yhjE	phosphoribosylglycinamide formyltransferase/metabolite transport protein YhjE
RA	1,663,077	A→T	6.2%	intergenic (+23/+15)	purT → / ← yhjE	phosphoribosylglycinamide formyltransferase/metabolite transport protein YhjE
RA	1,676,160	C→G	6.0%	intergenic (+22/‑38)	hom → / → thrC	homoserine dehydrogenase/threonine synthase
RA	1,676,163	C→G	6.2%	intergenic (+25/‑35)	hom → / → thrC	homoserine dehydrogenase/threonine synthase
RA	1,677,420	T→G	5.6%	L408R (CTG→CGG) ‡	thrC →	threonine synthase
RA	1,677,421	G→C	5.7%	L408L (CTG→CTC) ‡	thrC →	threonine synthase
RA	1,677,428	G→C	6.3%	A411P (GCG→CCG) ‡	thrC →	threonine synthase
RA	1,677,429	C→A	5.5%	A411E (GCG→GAG) ‡	thrC →	threonine synthase
RA	1,690,412	G→A	6.1%	T140M (ACG→ATG) ‡	ydcS ←	polyamine ABC transporter, periplasmic polyamine‑binding protein
RA	1,690,413	T→C	6.1%	T140A (ACG→GCG) ‡	ydcS ←	polyamine ABC transporter, periplasmic polyamine‑binding protein
RA	1,703,248	A→G	30.3%	intergenic (+97/‑70)	lysS → / → PP_1497	lysine‑‑tRNA ligase/TetR family transcriptional regulator
RA	1,703,250	G→C	27.7%	intergenic (+99/‑68)	lysS → / → PP_1497	lysine‑‑tRNA ligase/TetR family transcriptional regulator
RA	1,703,252	C→T	29.4%	intergenic (+101/‑66)	lysS → / → PP_1497	lysine‑‑tRNA ligase/TetR family transcriptional regulator
RA	1,706,336	T→G	8.7%	M134R (ATG→AGG)	PP_1500 →	lipoprotein
RA	1,706,338	G→C	8.7%	A135P (GCC→CCC) ‡	PP_1500 →	lipoprotein
RA	1,706,340	C→A	8.7%	A135A (GCC→GCA) ‡	PP_1500 →	lipoprotein
RA	1,710,161	T→A	9.2%	A260A (GCT→GCA)	ppc →	phosphoenolpyruvate carboxylase
RA	1,710,935	T→C	5.7%	L518L (CTT→CTC)	ppc →	phosphoenolpyruvate carboxylase
RA	1,712,951	T→A	11.7%	intergenic (+34/‑106)	adk → / → tsaB	adenylate kinase/endopeptidase
RA	1,712,952	T→A	11.6%	intergenic (+35/‑105)	adk → / → tsaB	adenylate kinase/endopeptidase
RA	1,714,464	C→A	6.2%	P103Q (CCG→CAG)	PP_1509 →	hypothetical protein
RA	1,730,146	G→C	5.1%	A314A (GCC→GCG) ‡	dapE ←	succinyl‑diaminopimelate desuccinylase
RA	1,730,148	C→A	5.1%	A314S (GCC→TCC) ‡	dapE ←	succinyl‑diaminopimelate desuccinylase
RA	1,730,159	T→G	5.9%	D310A (GAC→GCC)	dapE ←	succinyl‑diaminopimelate desuccinylase
RA	1,730,161	G→C	5.1%	L309L (CTC→CTG)	dapE ←	succinyl‑diaminopimelate desuccinylase
RA	1,741,930	C→G	6.1%	intergenic (‑18/+66)	PP_1538 ← / ← PP_1539	hypothetical protein/hypothetical protein
RA	1,741,935	C→G	7.6%	intergenic (‑23/+61)	PP_1538 ← / ← PP_1539	hypothetical protein/hypothetical protein
RA	1,761,927	A→T	7.5%	N359Y (AAC→TAC) ‡	PP_1567 →	capsid protein
RA	1,761,928	A→T	7.5%	N359I (AAC→ATC) ‡	PP_1567 →	capsid protein
RA	1,784,030	G→A	7.1%	A16V (GCG→GTG)	glnD ←	uridylyltransferase
RA	1,822,188	G→T	6.5%	intergenic (+30/+28)	PP_mr22 → / ← fdxA	PrrB_RsmZ ncRNA/ferredoxin 1
RA	1,822,189	A→T	6.6%	intergenic (+31/+27)	PP_mr22 → / ← fdxA	PrrB_RsmZ ncRNA/ferredoxin 1
RA	1,822,190	A→C	6.6%	intergenic (+32/+26)	PP_mr22 → / ← fdxA	PrrB_RsmZ ncRNA/ferredoxin 1
RA	1,825,091	G→C	6.3%	R55G (CGC→GGC)	mutS ←	DNA mismatch repair protein MutS
RA	1,835,165	A→G	7.2%	F132L (TTT→CTT)	PP_1639 ←	SprT family protein
MC JC	1,843,382	Δ8 bp	100%	coding (1405‑1412/2754 nt)	gacS ←	sensor protein GacS
RA	1,859,527	A→C	9.4%	intergenic (‑119/+37)	PP_1662 ← / ← PP_1663	hypothetical protein/hypothetical protein
RA	1,859,529	T→A	9.1%	intergenic (‑121/+35)	PP_1662 ← / ← PP_1663	hypothetical protein/hypothetical protein
RA	1,859,531	G→T	9.2%	intergenic (‑123/+33)	PP_1662 ← / ← PP_1663	hypothetical protein/hypothetical protein
RA	1,863,829	T→C	6.0%	T145T (ACT→ACC)	PP_1667 →	transporter
RA	1,893,945	G→C	10.4%	R24P (CGT→CCT) ‡	PP_1699 →	2‑pyrone‑4,6‑dicarboxylic acid hydrolase
RA	1,893,946	T→A	9.8%	R24R (CGT→CGA) ‡	PP_1699 →	2‑pyrone‑4,6‑dicarboxylic acid hydrolase
RA	1,893,947	G→C	10.0%	G25R (GGG→CGG)	PP_1699 →	2‑pyrone‑4,6‑dicarboxylic acid hydrolase
RA	1,897,179	T→C	6.5%	intergenic (‑32/+112)	PP_mr24 ← / ← rdgC	mini‑ykkC regulatory region/recombination‑associated protein RdgC
RA	1,897,185	C→T	8.6%	intergenic (‑38/+106)	PP_mr24 ← / ← rdgC	mini‑ykkC regulatory region/recombination‑associated protein RdgC
RA	1,897,188	G→A	8.2%	intergenic (‑41/+103)	PP_mr24 ← / ← rdgC	mini‑ykkC regulatory region/recombination‑associated protein RdgC
RA	1,897,189	A→C	8.4%	intergenic (‑42/+102)	PP_mr24 ← / ← rdgC	mini‑ykkC regulatory region/recombination‑associated protein RdgC
RA	1,897,203	G→T	9.7%	intergenic (‑56/+88)	PP_mr24 ← / ← rdgC	mini‑ykkC regulatory region/recombination‑associated protein RdgC
RA	1,897,207	T→A	9.5%	intergenic (‑60/+84)	PP_mr24 ← / ← rdgC	mini‑ykkC regulatory region/recombination‑associated protein RdgC
RA	1,897,211	A→C	9.1%	intergenic (‑64/+80)	PP_mr24 ← / ← rdgC	mini‑ykkC regulatory region/recombination‑associated protein RdgC
RA	1,903,525	G→C	12.3%	intergenic (+50/‑221)	PP_1703 → / → nirB	assimilatory nitrate reductase/sulfite reductase/nitrite reductase large subunit
RA	1,903,526	G→C	12.2%	intergenic (+51/‑220)	PP_1703 → / → nirB	assimilatory nitrate reductase/sulfite reductase/nitrite reductase large subunit
RA	1,906,456	G→T	6.5%	V53V (GTG→GTT)	nirD →	nitrite reductase
RA	1,914,237	C→G	5.0%	P202A (CCG→GCG)	pcaQ →	transcriptional regulator PcaQ
RA	1,918,256	C→G	10.9%	intergenic (‑32/+86)	PP_1718 ← / ← prc	EAL domain‑containing diguanylate phosphodiesterase/tail‑specific protease Prc
RA	1,918,257	T→C	11.1%	intergenic (‑33/+85)	PP_1718 ← / ← prc	EAL domain‑containing diguanylate phosphodiesterase/tail‑specific protease Prc
RA	1,918,258	G→A	11.3%	intergenic (‑34/+84)	PP_1718 ← / ← prc	EAL domain‑containing diguanylate phosphodiesterase/tail‑specific protease Prc
RA	1,918,259	C→G	11.3%	intergenic (‑35/+83)	PP_1718 ← / ← prc	EAL domain‑containing diguanylate phosphodiesterase/tail‑specific protease Prc
RA	1,932,638:1	+C	100%	intergenic (‑105/+45)	rluA ← / ← minE	bifunctional tRNA pseudouridine(32) synthase TrmQ/ribosomal large subunit pseudouridine synthase RluA/cell division topological specificity factor
RA	1,938,846	C→G	5.4%	P70P (CCG→CCC)	PP_1738 ←	hypothetical protein
RA	1,951,835	A→C	5.3%	I569S (ATC→AGC)	mnmC ←	methyltransferase/FAD‑dependent oxidoreductase
RA	1,951,838	G→T	5.6%	P568H (CCT→CAT) ‡	mnmC ←	methyltransferase/FAD‑dependent oxidoreductase
RA	1,951,839	G→C	5.8%	P568A (CCT→GCT) ‡	mnmC ←	methyltransferase/FAD‑dependent oxidoreductase
RA	1,977,148	C→A	5.3%	A271E (GCG→GAG)	PP_1770 →	3‑phosphoshikimate 1‑carboxyvinyltransferase
RA	1,978,708	C→G	12.7%	F45L (TTC→TTG)	cmk →	cytidylate kinase
RA	1,993,602	G→T	5.5%	intergenic (+40/+58)	PP_1780 → / ← PP_1781	mannosyltransferase/acyltransferase
RA	1,993,604	A→C	5.3%	intergenic (+42/+56)	PP_1780 → / ← PP_1781	mannosyltransferase/acyltransferase
RA	1,995,952	G→T	8.2%	intergenic (‑198/+87)	PP_mr26 ← / ← rfbC	C4 ncRNA/dTDP‑4‑dehydrorhamnose 3,5‑epimerase
RA	1,995,954	G→T	6.5%	intergenic (‑200/+85)	PP_mr26 ← / ← rfbC	C4 ncRNA/dTDP‑4‑dehydrorhamnose 3,5‑epimerase
RA	1,995,955	A→T	6.6%	intergenic (‑201/+84)	PP_mr26 ← / ← rfbC	C4 ncRNA/dTDP‑4‑dehydrorhamnose 3,5‑epimerase
RA	1,995,956	A→C	6.6%	intergenic (‑202/+83)	PP_mr26 ← / ← rfbC	C4 ncRNA/dTDP‑4‑dehydrorhamnose 3,5‑epimerase
RA	1,995,958	A→C	6.6%	intergenic (‑204/+81)	PP_mr26 ← / ← rfbC	C4 ncRNA/dTDP‑4‑dehydrorhamnose 3,5‑epimerase
RA	2,007,238	G→A	5.4%	L42L (CTG→TTG)	PP_1790 ←	acylneuraminate cytidylyltransferase
RA	2,007,239	T→C	5.4%	Q41Q (CAA→CAG)	PP_1790 ←	acylneuraminate cytidylyltransferase
RA	2,015,317	T→A	6.7%	E57D (GAA→GAT)	PP_1794 ←	hypothetical protein
RA	2,023,484	Δ1 bp	5.6%	coding (516/897 nt)	rmd →	oxidoreductase Rmd
RA	2,023,489	A→G	5.3%	E174G (GAG→GGG)	rmd →	oxidoreductase Rmd
RA	2,023,495	T→C	5.3%	F176S (TTC→TCC)	rmd →	oxidoreductase Rmd
RA	2,023,499:1	+C	5.3%	coding (531/897 nt)	rmd →	oxidoreductase Rmd
RA	2,034,007	G→T	5.1%	K496N (AAG→AAT)	pgi‑I →	glucose 6‑phosphate isomerase
RA	2,052,784	G→T	8.2%	intergenic (+16/+34)	prmB → / ← PP_1828	N5‑glutamine S‑adenosyl‑L‑methionine‑dependent methyltransferase/hypothetical protein
RA	2,052,786	A→C	7.4%	intergenic (+18/+32)	prmB → / ← PP_1828	N5‑glutamine S‑adenosyl‑L‑methionine‑dependent methyltransferase/hypothetical protein
RA	2,054,316	G→C	5.2%	P104A (CCG→GCG)	PP_1829 ←	alpha/beta family hydrolase
RA	2,054,324	G→C	5.4%	A101G (GCC→GGC)	PP_1829 ←	alpha/beta family hydrolase
RA	2,068,151	A→T	7.1%	intergenic (‑96/+25)	plsC ← / ← PP_1845	1‑acyl‑sn‑glycerol‑3‑phosphate acyltransferase/enoyl‑CoA hydratase/isomerase family protein
RA	2,077,428	T→C	6.2%	F51S (TTC→TCC)	PP_1853 →	LysR family transcriptional regulator
RA	2,090,926	T→C	5.7%	R84R (CGT→CGC)	deaD →	ATP‑dependent DEAD‑box RNA helicase DeaD
RA	2,090,928	A→G	5.7%	E85G (GAG→GGG)	deaD →	ATP‑dependent DEAD‑box RNA helicase DeaD
RA	2,095,189	G→C	11.5%	intergenic (‑240/+77)	htpX ← / ← alaA	protease HtpX/glutamate‑pyruvate aminotransferase
RA	2,128,229	A→T	10.0%	A1200A (GCA→GCT)	PP_1887 →	hypothetical protein
RA	2,128,232	A→T	10.3%	Q1201H (CAA→CAT)	PP_1887 →	hypothetical protein
RA	2,128,233	A→T	9.6%	M1202L (ATG→TTG)	PP_1887 →	hypothetical protein
RA	2,128,236	A→T	10.0%	S1203C (AGC→TGC)	PP_1887 →	hypothetical protein
RA	2,131,375	A→G	5.3%	M275T (ATG→ACG)	fimD ←	type I pili subunit FimD
RA	2,131,450	G→T	5.3%	T250K (ACG→AAG) ‡	fimD ←	type I pili subunit FimD
RA	2,131,451	T→G	6.4%	T250P (ACG→CCG) ‡	fimD ←	type I pili subunit FimD
RA	2,131,452	C→A	6.1%	L249L (CTG→CTT) ‡	fimD ←	type I pili subunit FimD
RA	2,131,453	A→C	5.3%	L249R (CTG→CGG) ‡	fimD ←	type I pili subunit FimD
RA	2,132,962	G→A	9.1%	T17M (ACG→ATG)	PP_1890 ←	type I pili chaperone protein FimC
RA	2,135,131	C→A	5.1%	K540N (AAG→AAT)	fadE ←	medium‑long chain acyl‑CoA dehydrogenase
RA	2,138,409	T→G	5.5%	L171R (CTG→CGG)	yadG →	ABC transporter ATP‑binding protein
RA	2,171,668	G→A	6.4%	intergenic (+203/+200)	PP_5484 → / ← PP_1924	hypothetical protein/phosphinothricin N‑acetyltransferase
RA	2,184,221	C→A	5.2%	P93P (CCC→CCA)	PP_5490 →	site‑specific DNA recombinase
RA	2,184,222	T→G	5.3%	W94G (TGG→GGG)	PP_5490 →	site‑specific DNA recombinase
RA	2,242,037	G→A	7.1%	intergenic (+35/‑27)	PP_t28 → / → PP_t29	tRNA‑Glu/tRNA‑Ala
RA	2,242,040	G→A	7.1%	intergenic (+38/‑24)	PP_t28 → / → PP_t29	tRNA‑Glu/tRNA‑Ala
RA	2,242,046	T→C	7.2%	intergenic (+44/‑18)	PP_t28 → / → PP_t29	tRNA‑Glu/tRNA‑Ala
RA	2,242,049	T→C	7.3%	intergenic (+47/‑15)	PP_t28 → / → PP_t29	tRNA‑Glu/tRNA‑Ala
RA	2,246,241	C→T	18.3%	intergenic (+30/+61)	ibpA → / ← PP_1983	small heat shock protein IbpA/PAS/PAC/GAF sensor‑containing diguanylate cyclase/phosphodiesterase
RA	2,246,242	A→G	18.3%	intergenic (+31/+60)	ibpA → / ← PP_1983	small heat shock protein IbpA/PAS/PAC/GAF sensor‑containing diguanylate cyclase/phosphodiesterase
RA	2,254,518	T→G	5.4%	P279P (CCT→CCG)	leuB →	3‑isopropylmalate dehydrogenase
RA	2,254,521	C→G	5.3%	C280W (TGC→TGG)	leuB →	3‑isopropylmalate dehydrogenase
RA	2,254,524	C→A	5.1%	H281Q (CAC→CAA)	leuB →	3‑isopropylmalate dehydrogenase
RA	2,255,974	G→T	9.8%	intergenic (+34/‑670)	asd → / → PP_1990	aspartate‑semialdehyde dehydrogenase/transposase
RA	2,255,975	T→C	9.9%	intergenic (+35/‑669)	asd → / → PP_1990	aspartate‑semialdehyde dehydrogenase/transposase
RA	2,255,976	G→A	9.8%	intergenic (+36/‑668)	asd → / → PP_1990	aspartate‑semialdehyde dehydrogenase/transposase
RA	2,255,977	A→C	10.1%	intergenic (+37/‑667)	asd → / → PP_1990	aspartate‑semialdehyde dehydrogenase/transposase
RA	2,256,224	G→T	9.0%	intergenic (+284/‑420)	asd → / → PP_1990	aspartate‑semialdehyde dehydrogenase/transposase
RA	2,256,225	G→C	9.8%	intergenic (+285/‑419)	asd → / → PP_1990	aspartate‑semialdehyde dehydrogenase/transposase
RA	2,256,226	A→C	10.0%	intergenic (+286/‑418)	asd → / → PP_1990	aspartate‑semialdehyde dehydrogenase/transposase
RA	2,264,563	G→A	100%	M171I (ATG→ATA)	accD →	acetyl‑CoA carboxylase carboxyltransferase subunit beta
RA	2,273,052	A→G	10.3%	intergenic (+17/+274)	PP_2003 → / ← PP_2004	hypothetical protein/AraC family transcriptional regulator
RA	2,273,062	C→G	10.4%	intergenic (+27/+264)	PP_2003 → / ← PP_2004	hypothetical protein/AraC family transcriptional regulator
RA	2,273,066	A→T	10.8%	intergenic (+31/+260)	PP_2003 → / ← PP_2004	hypothetical protein/AraC family transcriptional regulator
RA	2,273,070	C→G	10.6%	intergenic (+35/+256)	PP_2003 → / ← PP_2004	hypothetical protein/AraC family transcriptional regulator
RA	2,282,770	T→G	39.8%	intergenic (‑162/+67)	PP_2010 ← / ← PP_2011	cytochrome b561/hypothetical protein
RA	2,282,774	G→C	43.5%	intergenic (‑166/+63)	PP_2010 ← / ← PP_2011	cytochrome b561/hypothetical protein
RA	2,282,775	G→C	43.8%	intergenic (‑167/+62)	PP_2010 ← / ← PP_2011	cytochrome b561/hypothetical protein
RA	2,282,779	C→A	44.8%	intergenic (‑171/+58)	PP_2010 ← / ← PP_2011	cytochrome b561/hypothetical protein
RA	2,294,021	T→A	11.1%	L6M (TTG→ATG)	PP_2020 →	lipoprotein
RA	2,298,604	G→A	5.1%	D506D (GAC→GAT)	sbcC ←	exonuclease subunit SbcC
RA	2,316,255:1	+C	5.9%	coding (59/1548 nt)	PP_2038 →	long‑chain‑fatty‑acid‑‑CoA ligase
RA	2,316,260	Δ1 bp	6.1%	coding (64/1548 nt)	PP_2038 →	long‑chain‑fatty‑acid‑‑CoA ligase
RA	2,320,804	A→C	5.8%	V146G (GTG→GGG)	PP_2041 ←	LysR family transcriptional regulator
RA	2,325,726	C→G	6.1%	A526A (GCG→GCC)	PP_2045 ←	metallo‑beta‑lactamase family protein
RA	2,335,393	A→T	5.8%	F355Y (TTC→TAC)	PP_2052 ←	bifunctional sugar‑phosphatase/mannitol‑1‑phosphate 5‑dehydrogenase
RA	2,336,497	C→T	13.6%	intergenic (‑41/+39)	PP_2052 ← / ← PP_5500	bifunctional sugar‑phosphatase/mannitol‑1‑phosphate 5‑dehydrogenase/hypothetical protein
RA	2,336,498	A→T	13.5%	intergenic (‑42/+38)	PP_2052 ← / ← PP_5500	bifunctional sugar‑phosphatase/mannitol‑1‑phosphate 5‑dehydrogenase/hypothetical protein
RA	2,336,499	A→G	13.6%	intergenic (‑43/+37)	PP_2052 ← / ← PP_5500	bifunctional sugar‑phosphatase/mannitol‑1‑phosphate 5‑dehydrogenase/hypothetical protein
RA	2,344,669	C→A	12.8%	intergenic (‑20/+55)	PP_2061 ← / ← PP_2062	hypothetical protein/hypothetical protein
RA	2,344,674	Δ1 bp	11.0%	intergenic (‑25/+50)	PP_2061 ← / ← PP_2062	hypothetical protein/hypothetical protein
RA	2,344,681	A→C	10.5%	intergenic (‑32/+43)	PP_2061 ← / ← PP_2062	hypothetical protein/hypothetical protein
RA	2,344,682	G→T	10.7%	intergenic (‑33/+42)	PP_2061 ← / ← PP_2062	hypothetical protein/hypothetical protein
RA	2,344,688:1	+C	8.0%	intergenic (‑39/+36)	PP_2061 ← / ← PP_2062	hypothetical protein/hypothetical protein
RA	2,344,693	T→G	7.8%	intergenic (‑44/+31)	PP_2061 ← / ← PP_2062	hypothetical protein/hypothetical protein
RA	2,350,523	C→G	6.0%	G910G (GGC→GGG)	PP_2065 →	multidrug RND transporter
RA	2,350,525	T→C	6.0%	L911P (CTG→CCG)	PP_2065 →	multidrug RND transporter
RA	2,376,708	T→C	5.6%	intergenic (+69/‑136)	PP_2083 → / → PP_2084	lipase/ribonuclease activity regulator
RA	2,385,793	Δ1 bp	6.1%	coding (85/576 nt)	PP_2093 ←	two‑component system response regulator NasT
RA	2,385,797:1	+A	5.8%	coding (81/576 nt)	PP_2093 ←	two‑component system response regulator NasT
RA	2,389,141	T→C	6.3%	M1T (ATG→ACG) †	rlmKL →	23S rRNA (guanine(2445)‑N(2))/(guanine(2069)‑N(7))‑ methyltransferase
RA	2,389,144	G→A	6.3%	R2H (CGT→CAT)	rlmKL →	23S rRNA (guanine(2445)‑N(2))/(guanine(2069)‑N(7))‑ methyltransferase
RA	2,395,035	G→A	7.2%	L120L (CTG→TTG)	dacB ←	D‑alanyl‑D‑alanine carboxypeptidase
RA	2,409,206	C→G	5.6%	E748Q (GAG→CAG)	acnA‑I ←	aconitate hydratase
RA	2,419,540	C→T	6.0%	P231S (CCG→TCG)	ctpH →	methyl‑accepting chemotaxis protein CtpH
RA	2,420,598	Δ1 bp	10.4%	intergenic (+81/+26)	ctpH → / ← PP_t62	methyl‑accepting chemotaxis protein CtpH/tRNA‑Pro
RA	2,420,602:1	+T	10.3%	intergenic (+85/+22)	ctpH → / ← PP_t62	methyl‑accepting chemotaxis protein CtpH/tRNA‑Pro
RA	2,421,944	G→C	6.1%	G78R (GGC→CGC)	moeA →	molybdenum::molybdopterin ligase
RA	2,421,952	G→C	5.5%	P80P (CCG→CCC)	moeA →	molybdenum::molybdopterin ligase
RA	2,440,461:1	+A	5.3%	intergenic (+26/‑50)	pcaF‑II → / → PP_2138	beta‑ketoadipyl‑CoA thiolase subunit beta/hypothetical protein
RA	2,440,466	Δ1 bp	5.4%	intergenic (+31/‑45)	pcaF‑II → / → PP_2138	beta‑ketoadipyl‑CoA thiolase subunit beta/hypothetical protein
RA	2,445,044	T→G	8.3%	E156D (GAA→GAC) ‡	lexA‑I ←	transcriptional repressor
RA	2,445,045	T→A	7.3%	E156V (GAA→GTA) ‡	lexA‑I ←	transcriptional repressor
RA	2,445,046	C→A	8.3%	E156* (GAA→TAA) ‡	lexA‑I ←	transcriptional repressor
RA	2,453,596	G→A	5.4%	A508V (GCC→GTC)	mfd ←	transcription‑repair coupling factor
RA	2,453,602	T→A	5.2%	Q506L (CAG→CTG)	mfd ←	transcription‑repair coupling factor
RA	2,453,608	T→C	5.3%	D504G (GAC→GGC)	mfd ←	transcription‑repair coupling factor
RA	2,458,107	T→C	5.6%	intergenic (+179/‑26)	PP_2150 → / → sthA	thiamine biosynthesis lipoprotein/pyridine nucleotide transhydrogenase
RA	2,460,731	G→C	6.7%	L25V (CTG→GTG)	PP_2153 ←	hypothetical protein
RA	2,460,732	G→C	6.8%	H24Q (CAC→CAG)	PP_2153 ←	hypothetical protein
RA	2,464,992	C→T	5.9%	A216T (GCC→ACC)	PP_2157 ←	sensor histidine kinase
RA	2,469,842	T→C	10.9%	intergenic (+11/+24)	vacJ → / ← PP_2164	lipoprotein VacJ/hypothetical protein
RA	2,469,844	G→A	12.2%	intergenic (+13/+22)	vacJ → / ← PP_2164	lipoprotein VacJ/hypothetical protein
RA	2,469,851	A→T	12.2%	intergenic (+20/+15)	vacJ → / ← PP_2164	lipoprotein VacJ/hypothetical protein
RA	2,469,852	A→T	13.1%	intergenic (+21/+14)	vacJ → / ← PP_2164	lipoprotein VacJ/hypothetical protein
RA	2,469,853	A→T	13.9%	intergenic (+22/+13)	vacJ → / ← PP_2164	lipoprotein VacJ/hypothetical protein
RA	2,469,860	T→C	11.6%	intergenic (+29/+6)	vacJ → / ← PP_2164	lipoprotein VacJ/hypothetical protein
RA	2,469,862	G→A	10.9%	intergenic (+31/+4)	vacJ → / ← PP_2164	lipoprotein VacJ/hypothetical protein
RA	2,474,141	C→T	25.0%	intergenic (‑46/+134)	PP_2167 ← / ← tal	PhoD‑like phosphatase/transaldolase
RA	2,474,143	T→C	29.9%	intergenic (‑48/+132)	PP_2167 ← / ← tal	PhoD‑like phosphatase/transaldolase
RA	2,474,148	T→C	23.1%	intergenic (‑53/+127)	PP_2167 ← / ← tal	PhoD‑like phosphatase/transaldolase
RA	2,474,149	C→T	22.5%	intergenic (‑54/+126)	PP_2167 ← / ← tal	PhoD‑like phosphatase/transaldolase
RA	2,474,154	A→G	22.5%	intergenic (‑59/+121)	PP_2167 ← / ← tal	PhoD‑like phosphatase/transaldolase
RA	2,474,155	G→A	24.9%	intergenic (‑60/+120)	PP_2167 ← / ← tal	PhoD‑like phosphatase/transaldolase
RA	2,474,160	G→A	26.3%	intergenic (‑65/+115)	PP_2167 ← / ← tal	PhoD‑like phosphatase/transaldolase
RA	2,474,162	A→G	26.3%	intergenic (‑67/+113)	PP_2167 ← / ← tal	PhoD‑like phosphatase/transaldolase
RA	2,475,280	A→G	8.4%	intergenic (‑79/+78)	tal ← / ← dusA	transaldolase/tRNA dihydrouridine synthase DusA
RA	2,475,283	C→A	8.2%	intergenic (‑82/+75)	tal ← / ← dusA	transaldolase/tRNA dihydrouridine synthase DusA
RA	2,475,286	T→G	8.3%	intergenic (‑85/+72)	tal ← / ← dusA	transaldolase/tRNA dihydrouridine synthase DusA
RA	2,475,289	C→T	8.2%	intergenic (‑88/+69)	tal ← / ← dusA	transaldolase/tRNA dihydrouridine synthase DusA
RA	2,517,557	G→C	6.0%	intergenic (+54/‑24)	PP_2210 → / → PP_2211	LysR family transcriptional regulator/AraC family transcriptional regulator
RA	2,530,959	A→C	9.7%	T66T (ACA→ACC)	PP_2219 →	hypothetical protein
RA	2,538,457	C→T	9.6%	L194L (CTG→CTA) ‡	mrpAB ←	K(+)/H(+) antiporter subunit A/B
RA	2,538,459	G→T	9.3%	L194M (CTG→ATG) ‡	mrpAB ←	K(+)/H(+) antiporter subunit A/B
RA	2,538,465	T→G	9.4%	K192Q (AAG→CAG)	mrpAB ←	K(+)/H(+) antiporter subunit A/B
RA	2,538,467	T→A	9.4%	D191V (GAC→GTC)	mrpAB ←	K(+)/H(+) antiporter subunit A/B
RA	2,538,469	C→A	8.8%	L190L (CTG→CTT)	mrpAB ←	K(+)/H(+) antiporter subunit A/B
RA	2,538,475	A→C	8.8%	Y188* (TAT→TAG) ‡	mrpAB ←	K(+)/H(+) antiporter subunit A/B
RA	2,538,477	A→G	8.7%	Y188H (TAT→CAT) ‡	mrpAB ←	K(+)/H(+) antiporter subunit A/B
RA	2,539,129	G→C	5.9%	intergenic (‑91/+60)	mrpAB ← / ← PP_2231	K(+)/H(+) antiporter subunit A/B/DMT superfamily permease
RA	2,539,130	C→T	5.9%	intergenic (‑92/+59)	mrpAB ← / ← PP_2231	K(+)/H(+) antiporter subunit A/B/DMT superfamily permease
RA	2,539,134	G→C	6.1%	intergenic (‑96/+55)	mrpAB ← / ← PP_2231	K(+)/H(+) antiporter subunit A/B/DMT superfamily permease
RA	2,539,138	A→G	6.2%	intergenic (‑100/+51)	mrpAB ← / ← PP_2231	K(+)/H(+) antiporter subunit A/B/DMT superfamily permease
RA	2,539,139	G→C	6.2%	intergenic (‑101/+50)	mrpAB ← / ← PP_2231	K(+)/H(+) antiporter subunit A/B/DMT superfamily permease
RA	2,540,809	T→A	11.8%	intergenic (+22/+27)	PP_2232 → / ← PP_2233	XRE family transcriptional regulator/isochorismatase family hydrolase
RA	2,540,810	G→C	11.9%	intergenic (+23/+26)	PP_2232 → / ← PP_2233	XRE family transcriptional regulator/isochorismatase family hydrolase
RA	2,540,811	T→A	10.8%	intergenic (+24/+25)	PP_2232 → / ← PP_2233	XRE family transcriptional regulator/isochorismatase family hydrolase
RA	2,546,823	T→C	9.8%	intergenic (+22/+18)	PP_2238 → / ← PP_5504	metallopeptidase/hypothetical protein
RA	2,546,826	G→A	9.8%	intergenic (+25/+15)	PP_2238 → / ← PP_5504	metallopeptidase/hypothetical protein
RA	2,548,024	A→G	5.9%	L60L (TTG→CTG)	rhtA ←	threonine/homoserine exporter
RA	2,559,991	T→G	6.0%	intergenic (+16/‑48)	fepA → / → PP_2243	ferric enterobactin transport system outer membrane subunit/hypothetical protein
RA	2,574,849	T→C	7.1%	V9A (GTG→GCG)	PP_2258 →	sensory box protein
RA	2,574,852	A→C	7.0%	D10A (GAC→GCC)	PP_2258 →	sensory box protein
RA	2,574,854	G→A	7.5%	A11T (GCG→ACG)	PP_2258 →	sensory box protein
RA	2,576,169	T→G	5.4%	L449R (CTG→CGG)	PP_2258 →	sensory box protein
RA	2,591,521	C→T	8.0%	A146V (GCG→GTG)	PP_2269 →	N‑acetylmuramoyl‑L‑alanine amidase
RA	2,601,180	C→T	13.1%	L219L (CTC→CTT)	PP_2279 →	head‑to‑tail joining protein
RA	2,601,181	A→G	13.1%	K220E (AAG→GAG)	PP_2279 →	head‑to‑tail joining protein
RA	2,633,457	T→G	6.5%	intergenic (+100/‑82)	hupB → / → PP_2304	DNA binding regulator subunit beta B/peptidyl‑prolyl cis‑trans isomerase D
RA	2,633,458	C→A	6.6%	intergenic (+101/‑81)	hupB → / → PP_2304	DNA binding regulator subunit beta B/peptidyl‑prolyl cis‑trans isomerase D
RA	2,644,840	G→C	5.2%	P825R (CCG→CGG) ‡	PP_2316 ←	ABC transporter permease
RA	2,644,841	G→C	5.3%	P825A (CCG→GCG) ‡	PP_2316 ←	ABC transporter permease
RA	2,650,088	C→A	8.1%	intergenic (+27/+107)	PP_2320 → / ← oprI	hypothetical protein/major outer membrane lipoprotein
RA	2,650,160	A→T	8.3%	intergenic (+99/+35)	PP_2320 → / ← oprI	hypothetical protein/major outer membrane lipoprotein
RA	2,650,161	A→T	8.1%	intergenic (+100/+34)	PP_2320 → / ← oprI	hypothetical protein/major outer membrane lipoprotein
RA	2,654,962	G→A	5.0%	T217T (ACG→ACA)	cysB →	transcriptional regulator CysB
RA	2,659,276	T→C	5.3%	T354A (ACC→GCC)	PP_2331 ←	membrane protein
RA	2,666,641	T→A	6.9%	L835Q (CTG→CAG)	acnA‑II →	aconitate hydratase
RA	2,669,671	T→G	9.7%	intergenic (+38/+37)	prpD → / ← acnB	2‑methylcitrate dehydratase/aconitate hydratase B
RA	2,669,674	C→A	9.7%	intergenic (+41/+34)	prpD → / ← acnB	2‑methylcitrate dehydratase/aconitate hydratase B
RA	2,721,382	T→A	8.0%	intergenic (‑344/‑98)	PP_2381 ← / → PP_2382	hypothetical protein/putative transporter
RA	2,721,384	G→T	8.0%	intergenic (‑346/‑96)	PP_2381 ← / → PP_2382	hypothetical protein/putative transporter
RA	2,721,390	T→A	8.3%	intergenic (‑352/‑90)	PP_2381 ← / → PP_2382	hypothetical protein/putative transporter
RA	2,721,398	A→C	8.7%	intergenic (‑360/‑82)	PP_2381 ← / → PP_2382	hypothetical protein/putative transporter
RA	2,721,400	T→A	8.7%	intergenic (‑362/‑80)	PP_2381 ← / → PP_2382	hypothetical protein/putative transporter
RA	2,726,160	G→A	7.3%	Q166* (CAG→TAG)	PP_2387 ←	hypothetical protein
RA	2,726,161	G→C	8.5%	Y165* (TAC→TAG) ‡	PP_2387 ←	hypothetical protein
RA	2,726,162	T→C	7.2%	Y165C (TAC→TGC) ‡	PP_2387 ←	hypothetical protein
RA	2,740,843	Δ1 bp	5.3%	coding (3222/4494 nt)	PP_2395 →	leucine‑rich repeat‑containing protein
RA	2,741,748	C→A	12.0%	P1376Q (CCA→CAA)	PP_2395 →	leucine‑rich repeat‑containing protein
RA	2,741,751	T→G	7.9%	L1377W (TTG→TGG)	PP_2395 →	leucine‑rich repeat‑containing protein
RA	2,745,175	G→T	10.4%	intergenic (+18/+17)	PP_2399 → / ← PP_2400	hypothetical protein/hypothetical protein
RA	2,745,176	C→G	10.4%	intergenic (+19/+16)	PP_2399 → / ← PP_2400	hypothetical protein/hypothetical protein
RA	2,745,177	A→C	9.5%	intergenic (+20/+15)	PP_2399 → / ← PP_2400	hypothetical protein/hypothetical protein
RA	2,774,810	T→C	9.3%	P234P (CCA→CCG) ‡	PP_5521 ←	hypothetical protein
RA	2,774,811	G→C	9.1%	P234R (CCA→CGA) ‡	PP_5521 ←	hypothetical protein
RA	2,774,812	G→A	8.7%	P234S (CCA→TCA) ‡	PP_5521 ←	hypothetical protein
RA	2,776,838	C→A	13.3%	A395A (GCC→GCA)	sotB →	sugar efflux transporter
RA	2,776,839	G→A	11.9%	V396I (GTT→ATT) ‡	sotB →	sugar efflux transporter
RA	2,776,840	T→C	12.1%	V396A (GTT→GCT) ‡	sotB →	sugar efflux transporter
RA	2,776,841	T→G	12.1%	V396V (GTT→GTG) ‡	sotB →	sugar efflux transporter
RA	2,787,623	G→A	13.0%	intergenic (+70/‑55)	ahpC → / → ahpF	peroxiredoxin/alkylhydroperoxide reductase small subunit/alkyl hydroperoxide reductase subunit F
RA	2,787,629	C→G	12.8%	intergenic (+76/‑49)	ahpC → / → ahpF	peroxiredoxin/alkylhydroperoxide reductase small subunit/alkyl hydroperoxide reductase subunit F
RA	2,787,630	C→G	12.8%	intergenic (+77/‑48)	ahpC → / → ahpF	peroxiredoxin/alkylhydroperoxide reductase small subunit/alkyl hydroperoxide reductase subunit F
RA	2,787,636	T→C	13.8%	intergenic (+83/‑42)	ahpC → / → ahpF	peroxiredoxin/alkylhydroperoxide reductase small subunit/alkyl hydroperoxide reductase subunit F
RA	2,799,171	A→G	13.0%	intergenic (‑185/+31)	PP_2452 ← / ← ansB	hypothetical protein/glutaminase‑asparaginase
RA	2,799,177	C→T	12.3%	intergenic (‑191/+25)	PP_2452 ← / ← ansB	hypothetical protein/glutaminase‑asparaginase
RA	2,799,180	A→G	12.0%	intergenic (‑194/+22)	PP_2452 ← / ← ansB	hypothetical protein/glutaminase‑asparaginase
RA	2,799,186	C→T	11.1%	intergenic (‑200/+16)	PP_2452 ← / ← ansB	hypothetical protein/glutaminase‑asparaginase
RA	2,799,301	A→G	8.2%	A330A (GCT→GCC) ‡	ansB ←	glutaminase‑asparaginase
RA	2,799,302	G→C	8.1%	A330G (GCT→GGT) ‡	ansB ←	glutaminase‑asparaginase
RA	2,799,303	C→T	7.9%	A330T (GCT→ACT) ‡	ansB ←	glutaminase‑asparaginase
RA	2,801,973	C→A	5.6%	R119R (CGC→CGA)	rbsA‑I →	ribose ABC transporter ‑ ATP‑binding subunit
RA	2,801,975	T→G	5.7%	F120C (TTC→TGC)	rbsA‑I →	ribose ABC transporter ‑ ATP‑binding subunit
RA	2,802,991	A→C	8.5%	K459Q (AAG→CAG) ‡	rbsA‑I →	ribose ABC transporter ‑ ATP‑binding subunit
RA	2,802,992	A→T	8.5%	K459M (AAG→ATG) ‡	rbsA‑I →	ribose ABC transporter ‑ ATP‑binding subunit
RA	2,802,993	G→T	8.5%	K459N (AAG→AAT) ‡	rbsA‑I →	ribose ABC transporter ‑ ATP‑binding subunit
JC	2,837,076	(CATGGTGG)13→1	24.5%	intergenic (‑28/+60)	sad‑I ← / ← PP_2489	NAD+‑dependent succinate semialdehyde dehydrogenase/xenobiotic reductase
RA	2,844,675	T→C	8.5%	intergenic (‑35/+45)	PP_2495 ← / ← PP_2496	hypothetical protein/hypothetical protein
RA	2,844,678	A→T	6.9%	intergenic (‑38/+42)	PP_2495 ← / ← PP_2496	hypothetical protein/hypothetical protein
RA	2,844,679	A→T	6.4%	intergenic (‑39/+41)	PP_2495 ← / ← PP_2496	hypothetical protein/hypothetical protein
RA	2,844,682	A→T	7.9%	intergenic (‑42/+38)	PP_2495 ← / ← PP_2496	hypothetical protein/hypothetical protein
RA	2,844,683	A→T	7.0%	intergenic (‑43/+37)	PP_2495 ← / ← PP_2496	hypothetical protein/hypothetical protein
RA	2,844,686	G→A	7.1%	intergenic (‑46/+34)	PP_2495 ← / ← PP_2496	hypothetical protein/hypothetical protein
RA	2,868,876	G→C	8.5%	intergenic (+415/‑516)	PP_2520 → / → PP_2522	hypothetical protein/transposase
RA	2,868,877	G→C	8.5%	intergenic (+416/‑515)	PP_2520 → / → PP_2522	hypothetical protein/transposase
RA	2,885,718	T→G	7.1%	E54A (GAG→GCG)	PP_2541 ←	transcriptional factor‑like protein
RA	2,885,724	A→T	7.0%	L52Q (CTG→CAG)	PP_2541 ←	transcriptional factor‑like protein
RA	2,885,730	C→A	6.9%	R50L (CGC→CTC)	PP_2541 ←	transcriptional factor‑like protein
RA	2,892,031	G→A	6.6%	A246V (GCC→GTC)	PP_2547 ←	LysR family transcriptional regulator
RA	2,921,460	G→A	100%	G3494R (GGG→AGG)	PP_2561 →	hemolysin‑type calcium‑binding bacteriocin
RA	2,941,835	C→T	6.5%	R122H (CGT→CAT)	PP_2575 ←	hypothetical protein
RA	2,951,334	G→C	9.5%	intergenic (‑113/+48)	oguA ← / ← PP_2585	8‑oxoguanine deaminase/alpha‑ketoglutaric semialdehyde dehydrogenase
RA	2,958,799	G→C	15.2%	intergenic (+65/+77)	PP_2589 → / ← PP_2590	aldehyde dehydrogenase family protein/ferric siderophore receptor
RA	2,973,809	A→G	7.5%	L22P (CTG→CCG)	PP_2600 ←	hypothetical protein
RA	2,973,811	C→G	8.9%	G21G (GGG→GGC) ‡	PP_2600 ←	hypothetical protein
RA	2,973,813	C→T	8.0%	G21R (GGG→AGG) ‡	PP_2600 ←	hypothetical protein
RA	2,985,345	G→A	6.9%	S20F (TCC→TTC)	PP_2611 ←	membrane protein
RA	3,004,819	A→G	7.2%	H467R (CAC→CGC)	PP_2627 →	membrane protein
RA	3,019,936	T→A	8.6%	N158K (AAT→AAA)	PP_2638 →	cellulose synthase operon protein C
RA	3,023,034	G→A	7.7%	intergenic (+53/‑285)	PP_2638 → / → dapA‑II	cellulose synthase operon protein C/4‑hydroxy‑tetrahydrodipicolinate synthase
RA	3,025,532	G→A	8.0%	V368V (GTC→GTT)	PP_2641 ←	iron‑sulfur cluster‑binding protein
RA	3,030,719	C→T	8.6%	P9L (CCG→CTG)	mgtA →	ATP‑dependent magnesium transporter
RA	3,030,722	A→G	8.4%	Q10R (CAG→CGG)	mgtA →	ATP‑dependent magnesium transporter
RA	3,043,569	C→A	10.5%	D76E (GAC→GAA)	pstS →	phosphate ABC transporter substrate‑binding protein
RA	3,043,570	T→G	10.9%	F77V (TTC→GTC)	pstS →	phosphate ABC transporter substrate‑binding protein
RA	3,048,604	G→T	12.5%	intergenic (+59/‑237)	PP_2661 → / → PP_2662	hypothetical protein/hypothetical protein
RA	3,048,605	A→C	12.5%	intergenic (+60/‑236)	PP_2661 → / → PP_2662	hypothetical protein/hypothetical protein
RA	3,065,902	G→C	8.7%	G12G (GGG→GGC)	PP_2678 →	hydrolase
RA	3,065,904	T→G	8.5%	L13R (CTG→CGG)	PP_2678 →	hydrolase
RA	3,065,907	C→A	8.5%	P14Q (CCG→CAG)	PP_2678 →	hydrolase
RA	3,065,909	G→C	8.2%	A15P (GCC→CCC)	PP_2678 →	hydrolase
RA	3,067,430	G→T	7.5%	A157S (GCC→TCC)	qedH‑II →	quinoprotein ethanol dehydrogenase
RA	3,067,433	C→T	8.1%	L158L (CTG→TTG)	qedH‑II →	quinoprotein ethanol dehydrogenase
RA	3,067,436	A→T	8.3%	N159Y (AAC→TAC) ‡	qedH‑II →	quinoprotein ethanol dehydrogenase
RA	3,067,437	A→T	8.3%	N159I (AAC→ATC) ‡	qedH‑II →	quinoprotein ethanol dehydrogenase
RA	3,067,440	A→G	8.1%	K160R (AAG→AGG)	qedH‑II →	quinoprotein ethanol dehydrogenase
RA	3,067,443	A→C	8.5%	D161A (GAC→GCC)	qedH‑II →	quinoprotein ethanol dehydrogenase
RA	3,067,448	G→A	7.4%	G163S (GGC→AGC)	qedH‑II →	quinoprotein ethanol dehydrogenase
RA	3,079,889	G→A	11.1%	A61V (GCC→GTC)	PP_2689 ←	endoribonuclease
RA	3,104,368	T→G	5.8%	V299G (GTC→GGC)	PP_2714 →	sensor histidine kinase
RA	3,105,532	Δ1 bp	7.4%	coding (20/702 nt)	arsH ←	ArsH protein
RA	3,105,669	G→C	12.0%	L123V (CTG→GTG)	PP_2716 ←	arsenate reductase
RA	3,105,670	T→A	11.2%	T122T (ACA→ACT) ‡	PP_2716 ←	arsenate reductase
RA	3,105,671	G→C	11.9%	T122R (ACA→AGA) ‡	PP_2716 ←	arsenate reductase
RA	3,112,856	A→T	8.0%	L97L (CTT→CTA) ‡	PP_2727 ←	C factor cell‑cell signaling protein
RA	3,112,857	A→G	8.2%	L97P (CTT→CCT) ‡	PP_2727 ←	C factor cell‑cell signaling protein
RA	3,131,465	C→T	6.4%	S115L (TCG→TTG)	PP_2748 →	ABC transporter ATP‑binding protein
RA	3,136,826	G→A	8.9%	V10I (GTC→ATC)	PP_2753 →	ABC transporter ATP‑binding protein
RA	3,144,909	T→C	10.3%	V106A (GTT→GCT)	PP_2760 →	ribose ABC transporter permease
RA	3,144,912	T→A	6.9%	V107D (GTC→GAC)	PP_2760 →	ribose ABC transporter permease
RA	3,144,915	G→A	9.8%	S108N (AGC→AAC)	PP_2760 →	ribose ABC transporter permease
RA	3,165,136	T→G	7.3%	V216G (GTT→GGT)	PP_2779 →	putative Beta‑ketoacyl synthase
RA	3,183,329	A→C	6.0%	E330A (GAG→GCG)	PP_2793 →	acyl‑CoA dehydrogenase family protein
RA	3,188,086	A→T	6.3%	intergenic (+43/+219)	actP‑II → / ← PP_2798	acetate permease/oxidoreductase
RA	3,212,278	A→T	10.1%	*189R (TGA→AGA)	PP_2816 ←	transcriptional regulator NfxB
RA	3,228,100	C→G	6.0%	R313R (CGC→CGG)	PP_2828 →	hypothetical protein
RA	3,228,103	C→G	6.0%	A314A (GCC→GCG)	PP_2828 →	hypothetical protein
RA	3,243,222	G→A	5.9%	P433P (CCG→CCA)	PP_2839 →	hypothetical protein
RA	3,250,655	C→G	6.9%	L14V (CTG→GTG)	ureJ →	urease accessory protein UreJ
RA	3,254,420	C→A	9.9%	G440C (GGC→TGC)	PP_2852 ←	sulfatase domain‑containing protein
RA	3,268,052	C→A	5.9%	H175N (CAC→AAC) ‡	azoR1 →	FMN‑dependent NADH‑azoreductase
RA	3,268,054	C→A	5.7%	H175Q (CAC→CAA) ‡	azoR1 →	FMN‑dependent NADH‑azoreductase
RA	3,268,059	T→A	5.9%	L177Q (CTG→CAG)	azoR1 →	FMN‑dependent NADH‑azoreductase
RA	3,268,064	T→G	5.9%	Y179D (TAT→GAT) ‡	azoR1 →	FMN‑dependent NADH‑azoreductase
RA	3,268,065	A→T	5.5%	Y179F (TAT→TTT) ‡	azoR1 →	FMN‑dependent NADH‑azoreductase
RA	3,268,066	T→G	5.5%	Y179* (TAT→TAG) ‡	azoR1 →	FMN‑dependent NADH‑azoreductase
RA	3,273,641	G→C	9.1%	G106A (GGC→GCC)	PP_2871 →	class II aldolase/adducin domain‑containing protein
RA	3,316,910	G→C	7.3%	intergenic (‑113/+60)	ribC ← / ← treSA	riboflavin synthase/trehalose synthase A
RA	3,316,912	G→C	7.6%	intergenic (‑115/+58)	ribC ← / ← treSA	riboflavin synthase/trehalose synthase A
RA	3,316,914	G→C	7.4%	intergenic (‑117/+56)	ribC ← / ← treSA	riboflavin synthase/trehalose synthase A
RA	3,318,911	G→C	7.0%	A42A (GCC→GCG)	treSA ←	trehalose synthase A
RA	3,320,330	G→C	6.9%	G22A (GGC→GCC)	ybgL →	nitrogen‑containing compound degradation protein
RA	3,324,425	T→C	9.0%	T237A (ACC→GCC)	PP_2924 ←	hypothetical protein
RA	3,324,428	T→C	9.3%	S236G (AGC→GGC)	PP_2924 ←	hypothetical protein
RA	3,324,435	G→A	9.0%	G233G (GGC→GGT)	PP_2924 ←	hypothetical protein
RA	3,349,185	A→G	7.7%	N498S (AAC→AGC) ‡	PP_2944 →	sensor histidine kinase
RA	3,349,186	C→G	7.8%	N498K (AAC→AAG) ‡	PP_2944 →	sensor histidine kinase
RA	3,349,187	C→T	7.8%	L499L (CTG→TTG)	PP_2944 →	sensor histidine kinase
RA	3,376,435	Δ1 bp	9.5%	intergenic (+10/‑138)	PP_2975 → / → PP_2976	insertion element ISR1 protein A3/transposase
RA	3,376,439	G→C	9.5%	intergenic (+14/‑134)	PP_2975 → / → PP_2976	insertion element ISR1 protein A3/transposase
RA	3,376,442:1	+T	9.5%	intergenic (+17/‑131)	PP_2975 → / → PP_2976	insertion element ISR1 protein A3/transposase
RA	3,376,949	A→T	7.5%	noncoding (111/117 nt) Q23H (CAA→CAT)	PP_mr38 → tnpB →	ALIL regulatory region transposase subunit B
RA	3,394,820	C→G	5.8%	H107Q (CAC→CAG)	PP_2998 →	2‑dehydropantoate 2‑reductase
RA	3,394,823	G→T	5.3%	E108D (GAG→GAT)	PP_2998 →	2‑dehydropantoate 2‑reductase
RA	3,394,825	A→T	5.2%	D109V (GAC→GTC)	PP_2998 →	2‑dehydropantoate 2‑reductase
RA	3,394,827	A→C	5.3%	I110L (ATC→CTC)	PP_2998 →	2‑dehydropantoate 2‑reductase
RA	3,409,918	G→T	7.7%	intergenic (‑484/‑52)	PP_3022 ← / → PP_3024	AraC family transcriptional regulator/hypothetical protein
RA	3,409,921	G→C	6.7%	intergenic (‑487/‑49)	PP_3022 ← / → PP_3024	AraC family transcriptional regulator/hypothetical protein
RA	3,409,923	C→G	6.7%	intergenic (‑489/‑47)	PP_3022 ← / → PP_3024	AraC family transcriptional regulator/hypothetical protein
RA	3,409,925	G→C	6.7%	intergenic (‑491/‑45)	PP_3022 ← / → PP_3024	AraC family transcriptional regulator/hypothetical protein
RA	3,409,928	A→C	7.6%	intergenic (‑494/‑42)	PP_3022 ← / → PP_3024	AraC family transcriptional regulator/hypothetical protein
RA	3,416,097	A→C	7.3%	S382A (TCG→GCG)	PP_3029 ←	DNA cytosine methyltransferase family protein
RA	3,422,165	C→T	6.8%	A108V (GCG→GTG)	PP_3038 →	TraC domain‑containing protein
RA	3,440,625	A→T	7.3%	E123V (GAG→GTG)	PP_3060 →	tail sheath protein
RA	3,440,629	G→T	6.4%	L124L (CTG→CTT)	PP_3060 →	tail sheath protein
RA	3,440,630	A→C	6.0%	K125Q (AAG→CAG)	PP_3060 →	tail sheath protein
RA	3,455,168	G→A	7.8%	N241N (AAC→AAT)	aacs ←	acetoacetyl‑CoA synthetase
RA	3,463,450	C→A	6.0%	G303V (GGC→GTC)	PP_3078 ←	ABC transporter substrate‑binding protein
RA	3,463,544	G→C	7.9%	L272V (CTG→GTG)	PP_3078 ←	ABC transporter substrate‑binding protein
RA	3,463,547	C→G	7.9%	D271H (GAC→CAC)	PP_3078 ←	ABC transporter substrate‑binding protein
RA	3,463,550	G→C	7.7%	R270G (CGT→GGT)	PP_3078 ←	ABC transporter substrate‑binding protein
RA	3,466,055	G→C	8.3%	noncoding (105/119 nt)	PP_mr39 ←	P15 ncRNA
RA	3,466,056	A→T	8.0%	noncoding (104/119 nt)	PP_mr39 ←	P15 ncRNA
RA	3,466,057	A→T	8.0%	noncoding (103/119 nt)	PP_mr39 ←	P15 ncRNA
RA	3,466,058	G→C	8.1%	noncoding (102/119 nt)	PP_mr39 ←	P15 ncRNA
RA	3,470,058	C→A	5.7%	intergenic (+119/+14)	PP_3083 → / ← PP_3084	membrane protein/ferric siderophore receptor
RA	3,470,060	C→G	5.9%	intergenic (+121/+12)	PP_3083 → / ← PP_3084	membrane protein/ferric siderophore receptor
RA	3,470,062	T→G	6.0%	intergenic (+123/+10)	PP_3083 → / ← PP_3084	membrane protein/ferric siderophore receptor
RA	3,483,010	A→C	5.5%	S972A (TCG→GCG)	PP_3091 ←	membrane protein
RA	3,483,011	G→T	6.0%	R971R (CGC→CGA)	PP_3091 ←	membrane protein
RA	3,483,015	T→A	5.8%	Q970L (CAG→CTG)	PP_3091 ←	membrane protein
RA	3,483,798	G→C	5.5%	P709R (CCG→CGG)	PP_3091 ←	membrane protein
RA	3,486,941	G→T	7.7%	P357H (CCC→CAC)	PP_3093 ←	hypothetical protein
RA	3,493,652	A→C	5.7%	L184R (CTG→CGG)	PP_3097 ←	hypothetical protein
RA	3,494,816	T→C	6.9%	P466P (CCA→CCG)	puuD ←	uricase/urate oxidase
RA	3,494,821	T→A	7.4%	K465* (AAG→TAG)	puuD ←	uricase/urate oxidase
RA	3,494,825	G→A	6.2%	P463P (CCC→CCT)	puuD ←	uricase/urate oxidase
RA	3,534,777	C→A	8.0%	intergenic (+64/‑91)	atoB → / → PP_3124	3‑oxoacid CoA‑transferase subunit B/short chain fatty acid transporter
RA	3,534,793	G→A	9.7%	intergenic (+80/‑75)	atoB → / → PP_3124	3‑oxoacid CoA‑transferase subunit B/short chain fatty acid transporter
RA	3,536,544	C→G	7.1%	A61G (GCC→GGC)	PP_3125 →	Cro/CI family transcriptional regulator
RA	3,553,793	C→T	7.8%	R154C (CGC→TGC)	PP_3138 →	VirK domain‑containing protein
RA	3,553,796	A→G	7.8%	S155G (AGC→GGC)	PP_3138 →	VirK domain‑containing protein
RA	3,553,797:1	+C	7.7%	coding (464/1002 nt)	PP_3138 →	VirK domain‑containing protein
RA	3,554,063	A→T	9.2%	I244F (ATC→TTC)	PP_3138 →	VirK domain‑containing protein
RA	3,554,067	G→T	9.8%	W245L (TGG→TTG)	PP_3138 →	VirK domain‑containing protein
RA	3,554,070	A→C	9.6%	Q246P (CAA→CCA)	PP_3138 →	VirK domain‑containing protein
RA	3,564,987	A→T	8.9%	intergenic (‑62/+19)	potF‑II ← / ← PP_3148	putrescine‑binding protein/glutamine synthetase
RA	3,591,576	T→A	16.1%	L258M (TTG→ATG) ‡	PP_3169 →	membrane protein
RA	3,591,577	T→A	16.1%	L258* (TTG→TAG) ‡	PP_3169 →	membrane protein
RA	3,609,520	C→T	7.5%	G238D (GGC→GAC)	PP_3183 ←	SCO1/SenC family protein
RA	3,624,250	T→A	6.4%	E413V (GAA→GTA)	PP_3195 ←	hypothetical protein
RA	3,638,656	T→G	9.4%	L218V (TTG→GTG)	PP_3205 →	fumarylacetoacetate hydrolase family protein
RA	3,638,660	C→A	11.6%	P219Q (CCG→CAG)	PP_3205 →	fumarylacetoacetate hydrolase family protein
RA	3,638,663	T→G	9.3%	L220R (CTG→CGG)	PP_3205 →	fumarylacetoacetate hydrolase family protein
RA	3,638,667	C→A	9.3%	H221Q (CAC→CAA)	PP_3205 →	fumarylacetoacetate hydrolase family protein
RA	3,638,708	G→C	7.4%	G235A (GGC→GCC)	PP_3205 →	fumarylacetoacetate hydrolase family protein
RA	3,645,902	A→T	7.0%	L32Q (CTG→CAG)	PP_3212 ←	Rieske 2Fe‑2S family protein
RA	3,645,905	A→T	7.0%	L31Q (CTG→CAG)	PP_3212 ←	Rieske 2Fe‑2S family protein
RA	3,695,938	A→G	6.4%	V77A (GTG→GCG)	ligD ←	DNA ligase D
RA	3,695,944	A→T	6.0%	L75Q (CTG→CAG)	ligD ←	DNA ligase D
RA	3,695,950	C→T	6.2%	R73H (CGC→CAC)	ligD ←	DNA ligase D
RA	3,697,445	C→G	5.6%	S15T (AGC→ACC)	PP_5595 ←	hypothetical protein
RA	3,713,824	A→G	5.8%	I230I (ATT→ATC)	paaK ←	phenylacetate‑CoA ligase
RA	3,718,081	A→G	6.7%	L171P (CTT→CCT)	paaG ←	2‑(1,2‑epoxy‑1,2‑dihydrophenyl)acetyl‑CoA isomerase
RA	3,722,804	T→A	8.6%	Y21N (TAT→AAT) ‡	PP_3288 →	universal stress protein family protein
RA	3,722,805	A→T	8.3%	Y21F (TAT→TTT) ‡	PP_3288 →	universal stress protein family protein
RA	3,722,806	T→A	8.5%	Y21* (TAT→TAA) ‡	PP_3288 →	universal stress protein family protein
RA	3,723,022	G→A	8.0%	V93V (GTG→GTA)	PP_3288 →	universal stress protein family protein
RA	3,735,139	Δ1 bp	10.8%	coding (36/3093 nt)	PP_3302 →	RND family transporter
RA	3,735,143:1	+T	11.8%	coding (40/3093 nt)	PP_3302 →	RND family transporter
RA	3,741,959	A→T	5.8%	intergenic (‑27/+386)	PP_3305 ← / ← PP_3306	TerC family membrane protein/hypothetical protein
RA	3,741,960	A→T	5.8%	intergenic (‑28/+385)	PP_3305 ← / ← PP_3306	TerC family membrane protein/hypothetical protein
RA	3,741,967	T→C	5.9%	intergenic (‑35/+378)	PP_3305 ← / ← PP_3306	TerC family membrane protein/hypothetical protein
RA	3,748,871	G→T	6.2%	intergenic (‑111/+84)	kefB‑II ← / ← PP_3312	glutathione‑regulated potassium/H+ antiporter/heat shock protein
RA	3,748,874	A→C	6.2%	intergenic (‑114/+81)	kefB‑II ← / ← PP_3312	glutathione‑regulated potassium/H+ antiporter/heat shock protein
RA	3,758,946	G→A	6.8%	D71N (GAC→AAC)	PP_3323 →	CobW/P47K family protein
RA	3,766,151	G→T	5.7%	R161L (CGA→CTA) ‡	PP_5599 →	LysR family transcriptional regulator
RA	3,766,152	A→C	5.8%	R161R (CGA→CGC) ‡	PP_5599 →	LysR family transcriptional regulator
RA	3,766,716	G→C	11.2%	R50P (CGT→CCT) ‡	PP_3329 →	membrane protein
RA	3,766,717	T→G	9.8%	R50R (CGT→CGG) ‡	PP_3329 →	membrane protein
RA	3,766,720	C→A	10.0%	I51I (ATC→ATA)	PP_3329 →	membrane protein
RA	3,766,721	G→C	10.0%	G52R (GGT→CGT)	PP_3329 →	membrane protein
RA	3,775,321	C→A	8.0%	M52I (ATG→ATT) ‡	PP_3336 ←	hypothetical protein
RA	3,775,322	A→T	7.9%	M52K (ATG→AAG) ‡	PP_3336 ←	hypothetical protein
RA	3,775,325	G→C	7.9%	P51R (CCC→CGC) ‡	PP_3336 ←	hypothetical protein
RA	3,775,326	G→C	7.9%	P51A (CCC→GCC) ‡	PP_3336 ←	hypothetical protein
RA	3,775,329	A→T	7.8%	L50M (TTG→ATG)	PP_3336 ←	hypothetical protein
RA	3,775,330	T→G	7.5%	A49A (GCA→GCC)	PP_3336 ←	hypothetical protein
RA	3,786,016	C→T	7.5%	R398H (CGC→CAC)	mhpT ←	3‑(3‑hydroxy‑phenyl)propionate transporter MhpT
JC	3,787,938	(TCCACGACGCCGACAGCGGCAAGGTGCCGTA)1→2	83.4%	coding (697/1392 nt)	PP_3350 ←	hypothetical protein
RA	3,812,883	T→G	6.5%	intergenic (+22/‑41)	PP_3368 → / → PP_3369	MFS transporter/LysR family transcriptional regulator
RA	3,812,994	A→T	7.4%	K24M (AAG→ATG)	PP_3369 →	LysR family transcriptional regulator
RA	3,816,188	G→A	6.5%	G211G (GGC→GGT)	cpxR ←	two‑component system regulator CpxR
RA	3,834,352	C→G	6.3%	V339V (GTC→GTG)	vgrG‑II →	type VI secretion system protein
RA	3,834,354	G→C	6.2%	S340T (AGC→ACC)	vgrG‑II →	type VI secretion system protein
RA	3,840,286	A→G	10.3%	D411D (GAT→GAC) ‡	PP_3390 ←	porin
RA	3,840,288	C→T	7.6%	D411N (GAT→AAT) ‡	PP_3390 ←	porin
RA	3,845,703:1	+G	100%	intergenic (‑70/+28)	PP_3394 ← / ← PP_3395	3‑hydroxy‑3‑methylglutaryl‑CoA lyase/LysR family transcriptional regulator
RA	3,845,927	C→T	6.8%	G257D (GGC→GAC)	PP_3395 ←	LysR family transcriptional regulator
RA	3,853,118	T→A	28.3%	I169N (ATT→AAT)	alkB →	alpha‑ketoglutarate‑ and Fe(II)‑dependent dioxygenase
RA	3,865,278	G→C	8.2%	R123G (CGG→GGG)	PP_3414 ←	methyl‑accepting chemotaxis transducer/sensory box protein
RA	3,865,284	C→G	8.4%	E121Q (GAG→CAG)	PP_3414 ←	methyl‑accepting chemotaxis transducer/sensory box protein
RA	3,865,286	T→A	8.3%	D120V (GAC→GTC)	PP_3414 ←	methyl‑accepting chemotaxis transducer/sensory box protein
RA	3,865,288	C→G	9.8%	L119L (CTG→CTC)	PP_3414 ←	methyl‑accepting chemotaxis transducer/sensory box protein
RA	3,880,375	C→G	6.7%	A737G (GCC→GGC)	mexF →	multidrug RND transporter MexF
RA	3,880,378	C→G	6.7%	A738G (GCC→GGC)	mexF →	multidrug RND transporter MexF
RA	3,892,916	C→A	7.3%	L94M (CTG→ATG)	rarD →	chloramphenicol‑sensitive protein
RA	3,892,921	T→G	7.4%	H95Q (CAT→CAG)	rarD →	chloramphenicol‑sensitive protein
RA	3,896,083	T→G	5.5%	Q221P (CAG→CCG)	PP_3439 ←	AraC family transcriptional regulator
RA	3,897,761	A→G	7.7%	I50I (ATT→ATC)	PP_3440 ←	hypothetical protein
RA	3,900,119	T→G	5.8%	L176R (CTG→CGG)	PP_3443 →	glyceraldehyde‑3‑phosphate dehydrogenase
RA	3,914,433	G→C	9.5%	R118R (CGC→CGG)	PP_3454 ←	transcriptional regulator
RA	3,935,077	T→A	6.1%	E112D (GAA→GAT)	PP_3467 ←	sigma‑54 dependent transcriptional regulator
RA	3,949,101:1	+A	6.9%	coding (433/642 nt)	PP_3485 ←	hypothetical protein
RA	3,949,108	Δ1 bp	6.7%	coding (426/642 nt)	PP_3485 ←	hypothetical protein
RA	3,949,113	T→C	6.6%	S141G (AGC→GGC)	PP_3485 ←	hypothetical protein
RA	3,949,602	G→C	7.2%	P479A (CCC→GCC)	PP_3486 ←	cytochrome c
RA	3,949,604	A→C	6.1%	L478R (CTG→CGG)	PP_3486 ←	cytochrome c
RA	3,951,159	T→C	100%	intergenic (‑123/+72)	PP_3486 ← / ← PP_3487	cytochrome c/hypothetical protein
RA	3,951,161	A→T	100%	intergenic (‑125/+70)	PP_3486 ← / ← PP_3487	cytochrome c/hypothetical protein
RA	3,953,931:1	+G	5.1%	coding (592/1977 nt)	PP_5606 ←	YVTN beta‑propeller repeat‑containing protein
RA	3,982,835	G→T	6.8%	G118G (GGG→GGT)	PP_3510 →	hypothetical protein
RA	3,982,838	T→A	7.2%	H119Q (CAT→CAA)	PP_3510 →	hypothetical protein
RA	3,982,841	A→C	7.0%	*120C (TGA→TGC)	PP_3510 →	hypothetical protein
RA	3,984,040	G→T	7.8%	intergenic (+34/+156)	ilvE → / ← PP_3512	branched‑chain‑amino acid aminotransferase/membrane protein
RA	3,984,041	C→T	7.5%	intergenic (+35/+155)	ilvE → / ← PP_3512	branched‑chain‑amino acid aminotransferase/membrane protein
RA	3,984,042	A→G	7.7%	intergenic (+36/+154)	ilvE → / ← PP_3512	branched‑chain‑amino acid aminotransferase/membrane protein
RA	3,984,043	A→C	7.7%	intergenic (+37/+153)	ilvE → / ← PP_3512	branched‑chain‑amino acid aminotransferase/membrane protein
RA	3,996,897	G→T	5.1%	P89H (CCT→CAT)	PP_3525 ←	hypothetical protein
RA	3,996,900	A→C	5.3%	M88R (ATG→AGG)	PP_3525 ←	hypothetical protein
JC	4,022,908	+AGCGAG	42.2%	intergenic (‑603/+65)	PP_3547 ← / ← emrB	NAD(P)‑binding oxidoreductase/multidrug transporter permease
RA	4,027,829	C→A	9.7%	A201S (GCC→TCC)	PP_3552 ←	two‑component system sensor histidine kinase
RA	4,042,321	C→A	7.4%	L137I (CTC→ATC) ‡	PP_3563 →	hypothetical protein
RA	4,042,322	T→G	6.8%	L137R (CTC→CGC) ‡	PP_3563 →	hypothetical protein
RA	4,045,934	C→A	7.7%	Q262H (CAG→CAT) ‡	PP_3567 ←	LysR family transcriptional regulator
RA	4,045,935	T→G	6.1%	Q262P (CAG→CCG) ‡	PP_3567 ←	LysR family transcriptional regulator
RA	4,049,907	A→G	26.6%	intergenic (+40/‑61)	quiA → / → oprB‑III	quinate dehydrogenase/carbohydrate‑selective porin
RA	4,054,949	A→G	5.1%	Q60Q (CAA→CAG)	PP_3574 →	hypothetical protein
RA	4,057,759	C→T	7.1%	V305V (GTG→GTA)	PP_3576 ←	transmembrane sensor
RA	4,061,390	C→A	5.9%	L107M (CTG→ATG) ‡	PP_3579 →	membrane protein
RA	4,061,391	T→G	5.3%	L107R (CTG→CGG) ‡	PP_3579 →	membrane protein
RA	4,066,001	A→C	7.9%	R1021R (CGT→CGG)	mdtC ←	multidrug transporter membrane protein
RA	4,066,004	G→T	7.7%	N1020K (AAC→AAA)	mdtC ←	multidrug transporter membrane protein
RA	4,066,007	G→C	8.0%	F1019L (TTC→TTG)	mdtC ←	multidrug transporter membrane protein
RA	4,066,010	A→C	8.0%	R1018R (CGT→CGG)	mdtC ←	multidrug transporter membrane protein
RA	4,066,013	G→T	7.5%	H1017Q (CAC→CAA)	mdtC ←	multidrug transporter membrane protein
RA	4,080,866	G→T	5.9%	intergenic (‑90/+73)	amaC ← / ← dpkA	D‑lysine aminotransferase/delta 1‑piperideine‑2‑carboxylate reductase
RA	4,083,051	G→C	6.2%	G17A (GGT→GCT)	PP_3593 →	amino acid ABC transporter substrate‑binding protein
RA	4,083,053	G→C	6.4%	A18P (GCC→CCC)	PP_3593 →	amino acid ABC transporter substrate‑binding protein
RA	4,113,568	C→T	6.4%	T71I (ACC→ATC)	PP_3619 →	hypothetical protein
RA	4,131,110	T→A	7.2%	intergenic (+22/+90)	PP_3634 → / ← PP_3635	GNAT family acetyltransferase/sulfonate ABC transporter permease
RA	4,131,111	T→A	8.0%	intergenic (+23/+89)	PP_3634 → / ← PP_3635	GNAT family acetyltransferase/sulfonate ABC transporter permease
RA	4,133,525	G→A	7.0%	T148T (ACC→ACT) ‡	PP_3637 ←	sulfonate ABC transporter ATP‑binding protein
RA	4,133,526	G→C	6.9%	T148S (ACC→AGC) ‡	PP_3637 ←	sulfonate ABC transporter ATP‑binding protein
RA	4,133,527	T→C	6.9%	T148A (ACC→GCC) ‡	PP_3637 ←	sulfonate ABC transporter ATP‑binding protein
RA	4,138,575	A→C	8.1%	D25A (GAC→GCC)	PP_3643 →	oxidoreductase
RA	4,138,583	G→C	11.3%	G28R (GGC→CGC) ‡	PP_3643 →	oxidoreductase
RA	4,138,585	C→A	12.3%	G28G (GGC→GGA) ‡	PP_3643 →	oxidoreductase
RA	4,138,586	T→G	12.9%	S29A (TCG→GCG) ‡	PP_3643 →	oxidoreductase
RA	4,138,588	G→C	13.1%	S29S (TCG→TCC) ‡	PP_3643 →	oxidoreductase
RA	4,138,596	G→T	11.5%	G32V (GGC→GTC)	PP_3643 →	oxidoreductase
RA	4,143,612	T→G	7.4%	F84C (TTC→TGC)	PP_3647 →	oxidoreductase
RA	4,143,615	C→A	7.1%	A85E (GCA→GAA)	PP_3647 →	oxidoreductase
RA	4,150,023	C→T	11.5%	intergenic (+22/‑375)	PP_3654 → / → PP_3655	leucine‑responsive regulatory protein/cytosine/purine/uracil/thiamine/allantoin permease family protein
RA	4,163,502	T→G	8.5%	intergenic (‑41/‑141)	pssA ← / → PP_3665	CDP‑diacylglycerol‑‑serine O‑phosphatidyltransferase/AraC family transcriptional regulator
RA	4,163,505	C→A	9.0%	intergenic (‑44/‑138)	pssA ← / → PP_3665	CDP‑diacylglycerol‑‑serine O‑phosphatidyltransferase/AraC family transcriptional regulator
RA	4,163,509	G→A	7.6%	intergenic (‑48/‑134)	pssA ← / → PP_3665	CDP‑diacylglycerol‑‑serine O‑phosphatidyltransferase/AraC family transcriptional regulator
RA	4,166,192	G→T	8.6%	intergenic (‑91/+72)	PP_3666 ← / ← creA	MHS family metabolite MFS transporter/creatinase
RA	4,166,193	A→C	8.5%	intergenic (‑92/+71)	PP_3666 ← / ← creA	MHS family metabolite MFS transporter/creatinase
RA	4,196,284	C→A	7.9%	intergenic (+126/+243)	PP_5618 → / ← PP_5619	Cro/CI family transcriptional regulator/hypothetical protein
RA	4,196,292	G→A	8.4%	intergenic (+134/+235)	PP_5618 → / ← PP_5619	Cro/CI family transcriptional regulator/hypothetical protein
RA	4,196,293	G→C	8.5%	intergenic (+135/+234)	PP_5618 → / ← PP_5619	Cro/CI family transcriptional regulator/hypothetical protein
RA	4,196,294	T→C	8.4%	intergenic (+136/+233)	PP_5618 → / ← PP_5619	Cro/CI family transcriptional regulator/hypothetical protein
RA	4,196,302	T→G	8.7%	intergenic (+144/+225)	PP_5618 → / ← PP_5619	Cro/CI family transcriptional regulator/hypothetical protein
RA	4,207,035	G→T	8.2%	C247* (TGC→TGA)	PP_3691 ←	DNA helicase‑related protein
RA	4,210,754	T→G	6.4%	intergenic (+31/+38)	PP_3692 → / ← PP_5621	hypothetical protein/hypothetical protein
RA	4,210,755	C→T	6.3%	intergenic (+32/+37)	PP_3692 → / ← PP_5621	hypothetical protein/hypothetical protein
RA	4,210,756	A→T	6.3%	intergenic (+33/+36)	PP_3692 → / ← PP_5621	hypothetical protein/hypothetical protein
RA	4,210,758	C→A	6.1%	intergenic (+35/+34)	PP_3692 → / ← PP_5621	hypothetical protein/hypothetical protein
RA	4,224,495	G→A	7.8%	intergenic (‑607/+214)	PP_3703 ← / ← PP_3704	hypothetical protein/hypothetical protein
RA	4,236,545	A→T	7.3%	A76A (GCT→GCA)	catA‑I ←	catechol 1,2‑dioxygenase
RA	4,236,548	A→T	7.3%	A75A (GCT→GCA) ‡	catA‑I ←	catechol 1,2‑dioxygenase
RA	4,236,550	C→G	7.4%	A75P (GCT→CCT) ‡	catA‑I ←	catechol 1,2‑dioxygenase
RA	4,240,242	T→G	7.1%	R16S (AGA→AGC)	PP_3717 ←	LuxR family transcriptional regulator
RA	4,240,247	C→A	6.8%	A15S (GCT→TCT)	PP_3717 ←	LuxR family transcriptional regulator
RA	4,246,185	C→G	8.1%	M30I (ATG→ATC)	alr ←	alanine racemase
RA	4,246,188	C→G	6.5%	S29S (TCG→TCC)	alr ←	alanine racemase
RA	4,252,190	A→G	8.4%	intergenic (‑158/+82)	PP_3726 ← / ← rocE	enoyl‑CoA hydratase/isomerase family protein/amino acid permease RocE
RA	4,252,194	C→A	5.6%	intergenic (‑162/+78)	PP_3726 ← / ← rocE	enoyl‑CoA hydratase/isomerase family protein/amino acid permease RocE
RA	4,252,197	A→G	6.8%	intergenic (‑165/+75)	PP_3726 ← / ← rocE	enoyl‑CoA hydratase/isomerase family protein/amino acid permease RocE
RA	4,252,202	G→C	6.9%	intergenic (‑170/+70)	PP_3726 ← / ← rocE	enoyl‑CoA hydratase/isomerase family protein/amino acid permease RocE
RA	4,252,205	G→C	6.9%	intergenic (‑173/+67)	PP_3726 ← / ← rocE	enoyl‑CoA hydratase/isomerase family protein/amino acid permease RocE
RA	4,252,210	C→T	7.0%	intergenic (‑178/+62)	PP_3726 ← / ← rocE	enoyl‑CoA hydratase/isomerase family protein/amino acid permease RocE
RA	4,252,213	T→G	6.4%	intergenic (‑181/+59)	PP_3726 ← / ← rocE	enoyl‑CoA hydratase/isomerase family protein/amino acid permease RocE
RA	4,252,217	C→T	7.1%	intergenic (‑185/+55)	PP_3726 ← / ← rocE	enoyl‑CoA hydratase/isomerase family protein/amino acid permease RocE
RA	4,271,005	T→C	7.3%	I382T (ATC→ACC)	mrdA‑I →	transpeptidase
RA	4,278,028	G→C	7.0%	A66P (GCA→CCA)	glcG →	hypothetical protein
RA	4,282,382	A→G	5.7%	V283A (GTG→GCG)	PP_3753 ←	AraC family transcriptional regulator
RA	4,289,430	T→G	7.5%	K1053Q (AAG→CAG)	PP_3761 ←	two‑component system sensor histidine kinase/response regulator
RA	4,289,432	T→A	7.7%	H1052L (CAC→CTC)	PP_3761 ←	two‑component system sensor histidine kinase/response regulator
RA	4,289,435	T→A	7.7%	E1051V (GAG→GTG)	PP_3761 ←	two‑component system sensor histidine kinase/response regulator
RA	4,289,437	C→A	7.7%	L1050L (CTG→CTT)	PP_3761 ←	two‑component system sensor histidine kinase/response regulator
RA	4,327,519	T→C	5.9%	S163P (TCG→CCG)	PP_3797 →	membrane protein
RA	4,340,075	A→T	41.4%	intergenic (+60/‑271)	ribAB‑II → / → PP_3814	3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase/polyamine ABC transportersubstrate‑binding protein
RA	4,340,076	G→C	43.0%	intergenic (+61/‑270)	ribAB‑II → / → PP_3814	3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase/polyamine ABC transportersubstrate‑binding protein
RA	4,340,081	A→G	40.0%	intergenic (+66/‑265)	ribAB‑II → / → PP_3814	3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase/polyamine ABC transportersubstrate‑binding protein
RA	4,340,082	C→T	40.0%	intergenic (+67/‑264)	ribAB‑II → / → PP_3814	3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase/polyamine ABC transportersubstrate‑binding protein
RA	4,340,083	A→G	40.8%	intergenic (+68/‑263)	ribAB‑II → / → PP_3814	3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase/polyamine ABC transportersubstrate‑binding protein
RA	4,340,084	C→T	40.0%	intergenic (+69/‑262)	ribAB‑II → / → PP_3814	3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase/polyamine ABC transportersubstrate‑binding protein
RA	4,340,089	G→C	34.3%	intergenic (+74/‑257)	ribAB‑II → / → PP_3814	3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase/polyamine ABC transportersubstrate‑binding protein
RA	4,340,090	A→T	33.6%	intergenic (+75/‑256)	ribAB‑II → / → PP_3814	3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase/polyamine ABC transportersubstrate‑binding protein
RA	4,346,529	A→G	6.9%	L188P (CTG→CCG)	gor ←	glutathione reductase
RA	4,348,705	A→G	52.3%	intergenic (‑70/+404)	PP_3820 ← / ← galU	group II intron‑encoding maturase/UTP‑glucose‑1‑phosphate uridylyltransferase
RA	4,357,746	T→C	12.1%	intergenic (+92/‑162)	PP_3831 → / → PP_3832	hypothetical protein/CsrA‑like carbon storage regulator
RA	4,357,747	G→A	8.8%	intergenic (+93/‑161)	PP_3831 → / → PP_3832	hypothetical protein/CsrA‑like carbon storage regulator
RA	4,377,197	C→T	7.5%	R125R (CGG→CGA)	PP_3852 ←	BNR domain‑containing protein
RA	4,385,286	G→T	6.3%	P84T (CCA→ACA)	PP_3860 ←	FluMu protein gp47
RA	4,385,288	A→C	7.4%	V83G (GTT→GGT)	PP_3860 ←	FluMu protein gp47
RA	4,395,520	T→C	6.3%	D85G (GAC→GGC)	PP_3871 ←	hypothetical protein
RA	4,399,270	Δ1 bp	8.2%	coding (620/972 nt)	PP_3878 ←	minor capsid protein C
RA	4,405,314	C→T	10.0%	G83R (GGG→AGG)	PP_3886 ←	hypothetical protein
RA	4,405,320	T→C	9.8%	M81V (ATG→GTG)	PP_3886 ←	hypothetical protein
RA	4,405,321	G→A	10.0%	H80H (CAC→CAT)	PP_3886 ←	hypothetical protein
RA	4,405,327	A→G	7.8%	P78P (CCT→CCC)	PP_3886 ←	hypothetical protein
RA	4,425,139	G→C	6.3%	intergenic (‑197/‑603)	PP_5647 ← / → PP_3917	hypothetical protein/hypothetical protein
RA	4,425,141	G→C	6.7%	intergenic (‑199/‑601)	PP_5647 ← / → PP_3917	hypothetical protein/hypothetical protein
RA	4,425,143	G→C	6.9%	intergenic (‑201/‑599)	PP_5647 ← / → PP_3917	hypothetical protein/hypothetical protein
RA	4,425,312	T→A	6.4%	intergenic (‑370/‑430)	PP_5647 ← / → PP_3917	hypothetical protein/hypothetical protein
RA	4,439,785	T→G	8.6%	L232R (CTC→CGC) ‡	PP_3934 →	LysR family transcriptional regulator
RA	4,439,786	C→G	8.7%	L232L (CTC→CTG) ‡	PP_3934 →	LysR family transcriptional regulator
RA	4,439,787	C→A	8.4%	R233S (CGC→AGC)	PP_3934 →	LysR family transcriptional regulator
RA	4,442,628	C→G	9.2%	intergenic (‑98/+40)	nicP‑II ← / ← nicT	porin‑like protein/metabolite transport protein NicT
RA	4,442,629	C→G	9.2%	intergenic (‑99/+39)	nicP‑II ← / ← nicT	porin‑like protein/metabolite transport protein NicT
RA	4,447,843	C→G	7.4%	intergenic (‑279/‑43)	nicC ← / → nicX	6‑hydroxynicotinate 3‑monooxygenase/2,5‑dihydroxypyridine 5,6‑dioxygenase
RA	4,447,848	Δ1 bp	7.4%	intergenic (‑284/‑38)	nicC ← / → nicX	6‑hydroxynicotinate 3‑monooxygenase/2,5‑dihydroxypyridine 5,6‑dioxygenase
RA	4,477,813	T→G	8.5%	Q60P (CAG→CCG) ‡	PP_3968 ←	sensor histidine kinase
RA	4,477,814	G→C	8.3%	Q60E (CAG→GAG) ‡	PP_3968 ←	sensor histidine kinase
RA	4,477,817	G→C	8.4%	H59D (CAT→GAT)	PP_3968 ←	sensor histidine kinase
RA	4,477,818	C→A	8.9%	A58A (GCG→GCT)	PP_3968 ←	sensor histidine kinase
RA	4,478,868	G→C	9.0%	V73V (GTG→GTC)	ybdR →	Zn‑dependent oxidoreductase
RA	4,488,991	A→G	8.2%	intergenic (+344/+227)	PP_3981 → / ← PP_3982	transposase/hypothetical protein
RA	4,488,992	C→G	8.1%	intergenic (+345/+226)	PP_3981 → / ← PP_3982	transposase/hypothetical protein
RA	4,488,993	C→T	8.0%	intergenic (+346/+225)	PP_3981 → / ← PP_3982	transposase/hypothetical protein
RA	4,502,922	C→G	5.1%	A184G (GCC→GGC)	xanP →	xanthine permease
RA	4,502,924	A→C	5.1%	N185H (AAT→CAT)	xanP →	xanthine permease
RA	4,503,789	C→T	15.3%	intergenic (+38/‑60)	xanP → / → tusD	xanthine permease/sulfur transfer protein complex subunit TusD
RA	4,503,790	A→G	15.9%	intergenic (+39/‑59)	xanP → / → tusD	xanthine permease/sulfur transfer protein complex subunit TusD
RA	4,517,232	A→C	7.3%	intergenic (+69/+17)	infA → / ← clpA	translation initiation factor IF‑1/ATP‑dependent serine protease
RA	4,517,233	A→T	7.2%	intergenic (+70/+16)	infA → / ← clpA	translation initiation factor IF‑1/ATP‑dependent serine protease
RA	4,517,234	G→T	7.6%	intergenic (+71/+15)	infA → / ← clpA	translation initiation factor IF‑1/ATP‑dependent serine protease
RA	4,520,454	A→T	6.7%	intergenic (+45/+27)	cspD → / ← icd	DNA replication inhibitor/NADP(+)‑specific isocitrate dehydrogenase
RA	4,520,464	A→G	6.4%	intergenic (+55/+17)	cspD → / ← icd	DNA replication inhibitor/NADP(+)‑specific isocitrate dehydrogenase
RA	4,522,239	T→G	6.1%	F30V (TTC→GTC) ‡	idh →	isocitrate dehydrogenase
RA	4,522,241	C→G	6.2%	F30L (TTC→TTG) ‡	idh →	isocitrate dehydrogenase
RA	4,522,243	C→A	6.2%	T31N (ACC→AAC)	idh →	isocitrate dehydrogenase
RA	4,526,642	G→T	8.4%	G151V (GGC→GTC)	PP_4015 →	HflD‑like high frequency lysogenization protein
RA	4,526,645	A→C	7.5%	D152A (GAC→GCC)	PP_4015 →	HflD‑like high frequency lysogenization protein
RA	4,530,025	T→A	29.4%	intergenic (+31/‑137)	PP_4018 → / → topB	acetyltransferase/DNA topoisomerase III
RA	4,530,026	T→A	29.5%	intergenic (+32/‑136)	PP_4018 → / → topB	acetyltransferase/DNA topoisomerase III
RA	4,547,594	T→C	8.2%	intergenic (‑249/‑95)	pydP ← / → pydB	NCS1 family transporter PydP/bifunctional D‑hydantoinase/dihydropyrimidinase
RA	4,547,601	G→T	12.2%	intergenic (‑256/‑88)	pydP ← / → pydB	NCS1 family transporter PydP/bifunctional D‑hydantoinase/dihydropyrimidinase
RA	4,547,602	A→C	10.4%	intergenic (‑257/‑87)	pydP ← / → pydB	NCS1 family transporter PydP/bifunctional D‑hydantoinase/dihydropyrimidinase
RA	4,547,609	G→A	11.0%	intergenic (‑264/‑80)	pydP ← / → pydB	NCS1 family transporter PydP/bifunctional D‑hydantoinase/dihydropyrimidinase
RA	4,549,025	A→C	5.8%	E446A (GAG→GCG)	pydB →	bifunctional D‑hydantoinase/dihydropyrimidinase
RA	4,549,029	G→C	6.1%	P447P (CCG→CCC)	pydB →	bifunctional D‑hydantoinase/dihydropyrimidinase
RA	4,555,988	T→G	6.1%	E170A (GAG→GCG) ‡	zwfB ←	glucose 6‑phosphate 1‑dehydrogenase
RA	4,555,989	C→A	5.3%	E170* (GAG→TAG) ‡	zwfB ←	glucose 6‑phosphate 1‑dehydrogenase
RA	4,563,124	T→G	8.3%	Q246P (CAG→CCG)	vgrG‑III ←	type VI secretion system protein
RA	4,563,782	C→T	12.1%	D27N (GAT→AAT)	vgrG‑III ←	type VI secretion system protein
RA	4,563,785	G→A	10.8%	L26L (CTG→TTG)	vgrG‑III ←	type VI secretion system protein
RA	4,563,786	C→G	10.9%	K25N (AAG→AAC) ‡	vgrG‑III ←	type VI secretion system protein
RA	4,563,787	T→C	10.6%	K25R (AAG→AGG) ‡	vgrG‑III ←	type VI secretion system protein
RA	4,563,790	A→G	10.8%	F24S (TTC→TCC)	vgrG‑III ←	type VI secretion system protein
RA	4,578,135	T→G	7.6%	E659A (GAG→GCG) ‡	glgB ←	1,4‑alpha‑glucan branching enzyme
RA	4,578,136	C→A	8.4%	E659* (GAG→TAG) ‡	glgB ←	1,4‑alpha‑glucan branching enzyme
RA	4,586,030	2 bp→TC	100%	intergenic (+113/+101)	PP_4061 → / ← PP_4063	hypothetical protein/long‑chain fatty acid‑‑CoA ligase
RA	4,586,033:1	+G	100%	intergenic (+116/+99)	PP_4061 → / ← PP_4063	hypothetical protein/long‑chain fatty acid‑‑CoA ligase
RA	4,586,056:1	+C	100%	intergenic (+139/+76)	PP_4061 → / ← PP_4063	hypothetical protein/long‑chain fatty acid‑‑CoA ligase
RA	4,597,389	A→G	6.0%	V807A (GTC→GCC)	PP_4071 ←	membrane protein
RA	4,631,564	A→T	7.8%	intergenic (+1338/‑97)	PP_4094 → / → PP_4096	hypothetical protein/hypothetical protein
RA	4,632,499	A→C	6.5%	intergenic (+104/+55)	PP_4096 → / ← PP_t59	hypothetical protein/tRNA‑Gly
RA	4,649,273	G→A	7.0%	G547G (GGC→GGT)	PP_4113 ←	hypothetical protein
RA	4,658,398	A→C	5.2%	E345A (GAA→GCA) ‡	nuoC →	NADH‑quinone oxidoreductase subunit C/D
RA	4,658,399	A→T	5.2%	E345D (GAA→GAT) ‡	nuoC →	NADH‑quinone oxidoreductase subunit C/D
RA	4,683,159	T→A	8.2%	intergenic (+18/‑203)	mltD → / → PP_4146	membrane‑bound lytic murein transglycosylase D/peptide ABC transporter substrate‑binding protein
RA	4,683,160	T→A	8.1%	intergenic (+19/‑202)	mltD → / → PP_4146	membrane‑bound lytic murein transglycosylase D/peptide ABC transporter substrate‑binding protein
RA	4,683,161	T→A	8.1%	intergenic (+20/‑201)	mltD → / → PP_4146	membrane‑bound lytic murein transglycosylase D/peptide ABC transporter substrate‑binding protein
RA	4,707,318	C→G	8.0%	intergenic (‑20/+90)	PP_4163 ← / ← PP_4164	hypothetical protein/alpha/beta hydrolase
RA	4,725,040	G→A	5.5%	intergenic (+25/+43)	PP_5661 → / ← PP_4183	putative lipoprotein/membrane protein
RA	4,733,482	C→A	88.9%	R718L (CGC→CTC)	sucA ←	2‑oxoglutarate dehydrogenase subunit E1
RA	4,740,805	Δ1 bp	100%	intergenic (+42/+711)	gltA → / ← yeiW	citrate synthase/putative oxidoreductase
RA	4,740,816	T→G	100%	intergenic (+53/+700)	gltA → / ← yeiW	citrate synthase/putative oxidoreductase
RA	4,740,819	2 bp→CT	100%	intergenic (+56/+696)	gltA → / ← yeiW	citrate synthase/putative oxidoreductase
RA	4,740,839	C→G	27.8%	intergenic (+76/+677)	gltA → / ← yeiW	citrate synthase/putative oxidoreductase
RA	4,740,841	T→A	26.3%	intergenic (+78/+675)	gltA → / ← yeiW	citrate synthase/putative oxidoreductase
RA	4,740,842	T→A	26.3%	intergenic (+79/+674)	gltA → / ← yeiW	citrate synthase/putative oxidoreductase
RA	4,740,844	C→G	26.4%	intergenic (+81/+672)	gltA → / ← yeiW	citrate synthase/putative oxidoreductase
RA	4,741,229	A→C	100%	intergenic (+466/+287)	gltA → / ← yeiW	citrate synthase/putative oxidoreductase
RA	4,741,231	C→G	100%	intergenic (+468/+285)	gltA → / ← yeiW	citrate synthase/putative oxidoreductase
RA	4,741,234	C→T	100%	intergenic (+471/+282)	gltA → / ← yeiW	citrate synthase/putative oxidoreductase
RA	4,741,236	2 bp→TG	100%	intergenic (+473/+279)	gltA → / ← yeiW	citrate synthase/putative oxidoreductase
RA	4,741,239	A→G	100%	intergenic (+476/+277)	gltA → / ← yeiW	citrate synthase/putative oxidoreductase
RA	4,741,243	3 bp→TGC	100%	intergenic (+480/+271)	gltA → / ← yeiW	citrate synthase/putative oxidoreductase
RA	4,741,255	C→T	100%	intergenic (+492/+261)	gltA → / ← yeiW	citrate synthase/putative oxidoreductase
RA	4,741,257	A→C	100%	intergenic (+494/+259)	gltA → / ← yeiW	citrate synthase/putative oxidoreductase
RA	4,741,260	2 bp→GC	100%	intergenic (+497/+255)	gltA → / ← yeiW	citrate synthase/putative oxidoreductase
RA	4,741,263	A→C	100%	intergenic (+500/+253)	gltA → / ← yeiW	citrate synthase/putative oxidoreductase
RA	4,741,272	A→G	100%	intergenic (+509/+244)	gltA → / ← yeiW	citrate synthase/putative oxidoreductase
RA	4,741,274	A→C	100%	intergenic (+511/+242)	gltA → / ← yeiW	citrate synthase/putative oxidoreductase
RA	4,741,276	G→C	100%	intergenic (+513/+240)	gltA → / ← yeiW	citrate synthase/putative oxidoreductase
RA	4,741,278	C→T	100%	intergenic (+515/+238)	gltA → / ← yeiW	citrate synthase/putative oxidoreductase
RA	4,741,283:1	+T	100%	intergenic (+520/+233)	gltA → / ← yeiW	citrate synthase/putative oxidoreductase
RA	4,741,289	C→G	100%	intergenic (+526/+227)	gltA → / ← yeiW	citrate synthase/putative oxidoreductase
RA	4,741,292	C→T	100%	intergenic (+529/+224)	gltA → / ← yeiW	citrate synthase/putative oxidoreductase
RA	4,741,294	C→G	100%	intergenic (+531/+222)	gltA → / ← yeiW	citrate synthase/putative oxidoreductase
RA	4,741,296	A→C	100%	intergenic (+533/+220)	gltA → / ← yeiW	citrate synthase/putative oxidoreductase
RA	4,741,298	C→T	100%	intergenic (+535/+218)	gltA → / ← yeiW	citrate synthase/putative oxidoreductase
RA	4,781,474	A→T	6.6%	L1947Q (CTG→CAG)	pvdJ ←	non‑ribosomal peptide synthetase
RA	4,782,869	T→C	6.6%	E1482G (GAG→GGG)	pvdJ ←	non‑ribosomal peptide synthetase
RA	4,796,612	C→T	27.7%	intergenic (‑170/+48)	pvdH ← / ← PP_4224	diaminobutyrate‑2‑oxoglutarate transaminase/sensor histidine kinase
RA	4,796,614	G→C	27.8%	intergenic (‑172/+46)	pvdH ← / ← PP_4224	diaminobutyrate‑2‑oxoglutarate transaminase/sensor histidine kinase
RA	4,796,617	G→C	26.4%	intergenic (‑175/+43)	pvdH ← / ← PP_4224	diaminobutyrate‑2‑oxoglutarate transaminase/sensor histidine kinase
RA	4,796,619	A→G	27.7%	intergenic (‑177/+41)	pvdH ← / ← PP_4224	diaminobutyrate‑2‑oxoglutarate transaminase/sensor histidine kinase
RA	4,796,627	C→T	25.7%	intergenic (‑185/+33)	pvdH ← / ← PP_4224	diaminobutyrate‑2‑oxoglutarate transaminase/sensor histidine kinase
RA	4,806,674	G→A	8.0%	G406G (GGC→GGT)	PP_4234 ←	bifunctional aldehyde oxidase/xanthine dehydrogenase
RA	4,807,254	G→A	6.9%	S213F (TCC→TTC)	PP_4234 ←	bifunctional aldehyde oxidase/xanthine dehydrogenase
RA	4,821,760	C→A	6.1%	E3144* (GAG→TAG)	pvdL ←	non‑ribosomal peptide synthetase
RA	4,837,280	C→T	5.3%	A429A (GCC→GCT)	ccoN‑I →	cbb3‑type cytochrome c oxidase subunit 1
RA	4,837,281	A→G	5.4%	S430G (AGC→GGC)	ccoN‑I →	cbb3‑type cytochrome c oxidase subunit 1
RA	4,837,288	C→A	6.6%	P432Q (CCA→CAA)	ccoN‑I →	cbb3‑type cytochrome c oxidase subunit 1
RA	4,852,458	G→T	24.9%	intergenic (‑129/+168)	recR ← / ← ybaB	recombination protein RecR/nucleoid‑associated broad specificity regulator
RA	4,852,459	A→T	17.4%	intergenic (‑130/+167)	recR ← / ← ybaB	recombination protein RecR/nucleoid‑associated broad specificity regulator
RA	4,852,460	A→C	26.3%	intergenic (‑131/+166)	recR ← / ← ybaB	recombination protein RecR/nucleoid‑associated broad specificity regulator
RA	4,853,037	A→G	7.0%	S688S (AGT→AGC)	dnaX ←	DNA polymerase III subunit gamma
RA	4,853,042	C→T	6.9%	A687T (GCT→ACT)	dnaX ←	DNA polymerase III subunit gamma
RA	4,882,207:1	+A	5.1%	coding (1290/1356 nt)	uacT →	uric acid permease
RA	4,882,212	Δ1 bp	5.1%	coding (1295/1356 nt)	uacT →	uric acid permease
RA	4,891,874	T→C	5.1%	Y346H (TAC→CAC)	ttuD →	hydroxypyruvate reductase
RA	4,896,445	G→A	21.0%	intergenic (+78/‑130)	PP_4304 → / → sbp‑I	VIC family cation transporter/sulfate ABC transporter substrate‑binding protein
RA	4,899,879	G→T	5.6%	C93F (TGC→TTC)	PP_4308 →	AsnC family transcriptional regulator
RA	4,900,065	A→G	8.4%	intergenic (+26/‑472)	PP_4308 → / → PP_4309	AsnC family transcriptional regulator/NCS1 family transporter
RA	4,900,069	G→A	8.5%	intergenic (+30/‑468)	PP_4308 → / → PP_4309	AsnC family transcriptional regulator/NCS1 family transporter
RA	4,900,070	T→C	8.7%	intergenic (+31/‑467)	PP_4308 → / → PP_4309	AsnC family transcriptional regulator/NCS1 family transporter
RA	4,900,074	C→T	9.0%	intergenic (+35/‑463)	PP_4308 → / → PP_4309	AsnC family transcriptional regulator/NCS1 family transporter
RA	4,908,054	A→C	8.1%	intergenic (‑30/‑252)	PP_4317 ← / → PP_4318	hypothetical protein/transposase
RA	4,918,174	C→G	8.1%	L191L (CTC→CTG)	PP_4328 →	hypothetical protein
RA	4,936,626	G→C	6.1%	intergenic (‑37/‑381)	flhA ← / → PP_4345	flagellar export pore protein/GntR family transcriptional regulator
RA	4,936,628	G→C	5.4%	intergenic (‑39/‑379)	flhA ← / → PP_4345	flagellar export pore protein/GntR family transcriptional regulator
RA	4,936,630	G→C	5.2%	intergenic (‑41/‑377)	flhA ← / → PP_4345	flagellar export pore protein/GntR family transcriptional regulator
RA	4,937,119	A→T	5.9%	E38V (GAA→GTA)	PP_4345 →	GntR family transcriptional regulator
RA	4,945,616	C→G	5.1%	R322P (CGG→CCG)	flhB ←	flagellin export apparatus substrate specificity protein
RA	4,945,627	C→G	5.6%	P318P (CCG→CCC)	flhB ←	flagellin export apparatus substrate specificity protein
RA	4,950,972	T→G	15.7%	intergenic (‑122/+35)	fliL ← / ← fliK	flagellar protein FliL/flagellar hook‑length control protein FliK
RA	4,961,913	A→G	6.0%	R175R (CGT→CGC) ‡	atoC ←	two‑component system DNA‑binding transcriptional activator AtoC
RA	4,961,914	C→T	5.9%	R175H (CGT→CAT) ‡	atoC ←	two‑component system DNA‑binding transcriptional activator AtoC
RA	4,967,639	A→G	7.5%	V13A (GTC→GCC)	fliD ←	flagellar filament capping protein
RA	4,967,641	G→T	7.4%	G12G (GGC→GGA)	fliD ←	flagellar filament capping protein
RA	4,967,646	A→C	7.2%	S11A (TCC→GCC)	fliD ←	flagellar filament capping protein
RA	4,967,648	C→T	7.2%	G10D (GGC→GAC)	fliD ←	flagellar filament capping protein
RA	4,970,597	G→C	5.2%	intergenic (‑355/+39)	fliC ← / ← PP_4379	flagellin/3‑oxoacyl‑ACP synthase
RA	4,970,603	T→C	5.5%	intergenic (‑361/+33)	fliC ← / ← PP_4379	flagellin/3‑oxoacyl‑ACP synthase
RA	4,970,604	G→C	5.6%	intergenic (‑362/+32)	fliC ← / ← PP_4379	flagellin/3‑oxoacyl‑ACP synthase
RA	4,970,611	G→C	6.0%	intergenic (‑369/+25)	fliC ← / ← PP_4379	flagellin/3‑oxoacyl‑ACP synthase
RA	4,972,881	A→T	5.0%	F223I (TTT→ATT)	flgL ←	flagellar hook‑associated protein FlgL
RA	4,975,249	T→A	6.9%	T119S (ACT→TCT)	flgK ←	flagellar hook‑associated protein FlgK
JC	4,980,585	+GGC	100%	intergenic (‑24/+44)	PP_4387 ← / ← flgE	hypothetical protein/flagellar hook protein FlgE
RA	4,989,285	A→G	10.3%	P158P (CCT→CCC) ‡	PP_4398 ←	MFS transporter
RA	4,989,287	G→C	10.5%	P158A (CCT→GCT) ‡	PP_4398 ←	MFS transporter
RA	4,989,288	G→C	10.5%	G157G (GGC→GGG) ‡	PP_4398 ←	MFS transporter
RA	4,989,290	C→T	10.7%	G157S (GGC→AGC) ‡	PP_4398 ←	MFS transporter
RA	4,998,171	G→T	7.6%	intergenic (‑71/‑145)	PP_4405 ← / → PP_4406	sensory box protein/hypothetical protein
RA	4,998,172	A→C	7.8%	intergenic (‑72/‑144)	PP_4405 ← / → PP_4406	sensory box protein/hypothetical protein
RA	5,006,817	C→G	5.1%	R1057G (CGA→GGA)	PP_4410 →	hypothetical protein
RA	5,013,283	T→C	5.9%	V35A (GTG→GCG)	PP_5678 →	hypothetical protein
RA	5,013,287	G→C	5.6%	L36L (CTG→CTC)	PP_5678 →	hypothetical protein
RA	5,016,329	A→T	5.3%	I345N (ATC→AAC)	PP_4421 ←	aminotransferase
RA	5,026,750	A→T	5.9%	T20T (ACA→ACT)	ocd →	ornithine cyclodeaminase
RA	5,026,752	A→T	5.9%	D21V (GAC→GTC)	ocd →	ornithine cyclodeaminase
RA	5,026,754	A→T	5.9%	S22C (AGT→TGT)	ocd →	ornithine cyclodeaminase
RA	5,032,757	T→C	5.9%	P92P (CCT→CCC)	PP_4435 →	hypothetical protein
RA	5,032,761	C→G	6.3%	R94G (CGA→GGA)	PP_4435 →	hypothetical protein
RA	5,054,819	A→G	5.8%	P190P (CCT→CCC)	PP_4454 ←	opine ABC transporter permease
RA	5,079,126	T→A	9.0%	intergenic (‑371/+26)	mgtE ← / ← PP_t56	magnesium transporter/tRNA‑Arg
RA	5,079,129	T→A	9.8%	intergenic (‑374/+23)	mgtE ← / ← PP_t56	magnesium transporter/tRNA‑Arg
RA	5,079,596	A→T	10.9%	intergenic (‑67/+5)	PP_t54 ← / ← PP_t53	tRNA‑Arg/tRNA‑Arg
RA	5,090,047	A→G	10.3%	L297P (CTG→CCG)	astA‑II ←	arginine N‑succinyltransferase subunit alpha
RA	5,090,049	G→C	11.7%	G296G (GGC→GGG) ‡	astA‑II ←	arginine N‑succinyltransferase subunit alpha
RA	5,090,051	C→T	10.6%	G296S (GGC→AGC) ‡	astA‑II ←	arginine N‑succinyltransferase subunit alpha
RA	5,096,464	A→G	10.2%	V101A (GTC→GCC) ‡	argT ←	lysine/arginine/ornithine ABC transporter substrate‑binding protein
RA	5,096,465	C→T	10.1%	V101I (GTC→ATC) ‡	argT ←	lysine/arginine/ornithine ABC transporter substrate‑binding protein
RA	5,096,560	T→A	5.5%	E69V (GAG→GTG)	argT ←	lysine/arginine/ornithine ABC transporter substrate‑binding protein
RA	5,103,088	A→T	8.0%	intergenic (+20/‑170)	phhB → / → PP_5694	pterin‑4‑alpha‑carbinolamine dehydratase/hypothetical protein
RA	5,103,089	G→C	8.6%	intergenic (+21/‑169)	phhB → / → PP_5694	pterin‑4‑alpha‑carbinolamine dehydratase/hypothetical protein
RA	5,103,090	A→T	8.4%	intergenic (+22/‑168)	phhB → / → PP_5694	pterin‑4‑alpha‑carbinolamine dehydratase/hypothetical protein
RA	5,124,166	Δ1 bp	8.5%	intergenic (‑35/‑93)	PP_4510 ← / → PP_4511	hypothetical protein/AraC family transcriptional regulator
RA	5,132,960	C→A	6.6%	A14A (GCC→GCA)	tolC →	agglutination protein
RA	5,132,963	G→C	7.7%	L15L (CTG→CTC)	tolC →	agglutination protein
RA	5,132,966	G→C	6.6%	A16A (GCG→GCC)	tolC →	agglutination protein
RA	5,132,969	T→G	6.8%	S17R (AGT→AGG)	tolC →	agglutination protein
RA	5,137,445	A→G	5.6%	C53R (TGC→CGC)	PP_4522 ←	LysR family transcriptional regulator
RA	5,137,665	A→G	6.6%	intergenic (‑64/‑149)	PP_4522 ← / → PP_4523	LysR family transcriptional regulator/agmatinase
RA	5,137,670	C→T	6.6%	intergenic (‑69/‑144)	PP_4522 ← / → PP_4523	LysR family transcriptional regulator/agmatinase
RA	5,153,310	C→A	8.9%	intergenic (‑1387/+27)	PP_5696 ← / ← PP_4537	hypothetical protein/membrane protein
RA	5,153,311	C→G	8.9%	intergenic (‑1388/+26)	PP_5696 ← / ← PP_4537	hypothetical protein/membrane protein
RA	5,153,312	T→G	8.3%	intergenic (‑1389/+25)	PP_5696 ← / ← PP_4537	hypothetical protein/membrane protein
RA	5,162,202	T→A	7.9%	W324R (TGG→AGG) ‡	PP_4544 →	hypothetical protein
RA	5,162,204	G→C	9.2%	W324C (TGG→TGC) ‡	PP_4544 →	hypothetical protein
RA	5,162,206	T→A	8.2%	L325Q (CTG→CAG)	PP_4544 →	hypothetical protein
RA	5,162,208	G→C	9.1%	A326P (GCT→CCT) ‡	PP_4544 →	hypothetical protein
RA	5,162,210	T→A	10.2%	A326A (GCT→GCA) ‡	PP_4544 →	hypothetical protein
RA	5,175,099	A→T	6.6%	intergenic (‑120/‑99)	fadD‑II ← / → PP_4551	long‑chain‑fatty acid‑‑CoA ligase/alpha/beta family hydrolase
RA	5,180,012	C→G	8.5%	intergenic (‑240/‑43)	PP_4557 ← / → PP_4558	hypothetical protein/GNAT family acetyltransferase
RA	5,182,854	G→T	6.4%	G115V (GGC→GTC)	PP_4562 →	hypothetical protein
RA	5,182,992	A→T	10.1%	F248I (TTC→ATC)	PP_4563 ←	hypothetical protein
RA	5,182,997	T→A	10.4%	K246M (AAG→ATG) ‡	PP_4563 ←	hypothetical protein
RA	5,182,998	T→A	10.4%	K246* (AAG→TAG) ‡	PP_4563 ←	hypothetical protein
RA	5,183,003	A→T	11.7%	I244N (ATC→AAC)	PP_4563 ←	hypothetical protein
RA	5,184,110	A→C	5.5%	M83L (ATG→CTG)	PP_4564 →	lipoprotein
RA	5,184,117	C→T	5.5%	A85V (GCC→GTC)	PP_4564 →	lipoprotein
RA	5,184,120	A→G	5.9%	D86G (GAC→GGC)	PP_4564 →	lipoprotein
RA	5,187,584	G→A	12.0%	R30H (CGC→CAC) ‡	PP_4567 →	hypothetical protein
RA	5,187,585	C→G	12.3%	R30R (CGC→CGG) ‡	PP_4567 →	hypothetical protein
RA	5,187,586	C→G	12.3%	L31V (CTG→GTG) ‡	PP_4567 →	hypothetical protein
RA	5,187,587	T→C	11.3%	L31P (CTG→CCG) ‡	PP_4567 →	hypothetical protein
RA	5,187,984	C→A	5.6%	R163R (CGC→CGA)	PP_4567 →	hypothetical protein
RA	5,208,043	A→C	5.1%	N222K (AAT→AAG)	PP_4589 ←	D‑isomer specific 2‑hydroxyacid dehydrogenase family protein
RA	5,212,488	C→A	5.1%	intergenic (+52/+42)	PP_4593 → / ← PP_4594	hypothetical protein/cystathionine gamma‑synthase
RA	5,212,491	T→G	5.1%	intergenic (+55/+39)	PP_4593 → / ← PP_4594	hypothetical protein/cystathionine gamma‑synthase
RA	5,229,179	G→A	5.7%	intergenic (‑121/+55)	PP_4606 ← / ← PP_4607	ferric siderophore receptor/transmembrane sensor
RA	5,229,191	Δ1 bp	10.3%	intergenic (‑133/+43)	PP_4606 ← / ← PP_4607	ferric siderophore receptor/transmembrane sensor
RA	5,229,195	C→G	11.6%	intergenic (‑137/+39)	PP_4606 ← / ← PP_4607	ferric siderophore receptor/transmembrane sensor
RA	5,229,198	C→G	10.9%	intergenic (‑140/+36)	PP_4606 ← / ← PP_4607	ferric siderophore receptor/transmembrane sensor
RA	5,229,201:1	+C	11.1%	intergenic (‑143/+33)	PP_4606 ← / ← PP_4607	ferric siderophore receptor/transmembrane sensor
RA	5,229,213	T→C	7.3%	intergenic (‑155/+21)	PP_4606 ← / ← PP_4607	ferric siderophore receptor/transmembrane sensor
RA	5,235,070	A→G	5.5%	H135R (CAC→CGC)	fecA →	outer membrane ferric citrate porin
RA	5,256,864	T→A	8.2%	intergenic (+16/+29)	PP_5703 → / ← PP_4634	type III effector protein HopJ/alpha/beta family hydrolase
RA	5,257,689	A→C	5.1%	V38G (GTG→GGG)	PP_4634 ←	alpha/beta family hydrolase
RA	5,257,696	G→C	5.1%	P36A (CCG→GCG)	PP_4634 ←	alpha/beta family hydrolase
RA	5,257,697	G→C	5.1%	R35R (CGC→CGG)	PP_4634 ←	alpha/beta family hydrolase
RA	5,257,704	G→T	5.2%	P33H (CCC→CAC)	PP_4634 ←	alpha/beta family hydrolase
RA	5,274,268	T→A	5.3%	H330L (CAC→CTC)	cioB ←	cyanide insensitive ubiquinol oxidase subunit II
RA	5,276,837	A→G	7.2%	intergenic (‑141/‑203)	cioA ← / → PP_4652	cyanide insensitive ubiquinol oxidase subunit I/membrane protein
RA	5,276,838	A→T	6.5%	intergenic (‑142/‑202)	cioA ← / → PP_4652	cyanide insensitive ubiquinol oxidase subunit I/membrane protein
RA	5,276,840	G→A	7.4%	intergenic (‑144/‑200)	cioA ← / → PP_4652	cyanide insensitive ubiquinol oxidase subunit I/membrane protein
RA	5,276,843	T→C	7.4%	intergenic (‑147/‑197)	cioA ← / → PP_4652	cyanide insensitive ubiquinol oxidase subunit I/membrane protein
RA	5,276,845	A→T	7.2%	intergenic (‑149/‑195)	cioA ← / → PP_4652	cyanide insensitive ubiquinol oxidase subunit I/membrane protein
RA	5,276,846	C→T	7.8%	intergenic (‑150/‑194)	cioA ← / → PP_4652	cyanide insensitive ubiquinol oxidase subunit I/membrane protein
RA	5,285,376	A→T	5.5%	E594V (GAG→GTG)	PP_4658 →	methyl‑accepting chemotaxis protein
RA	5,302,647	G→C	6.1%	L376V (CTG→GTG)	recB ←	Chi activated ATP‑dependent DNA helicase/dsDNA/ssDNA exonuclease
RA	5,302,657	G→A	8.3%	A372A (GCC→GCT)	recB ←	Chi activated ATP‑dependent DNA helicase/dsDNA/ssDNA exonuclease
RA	5,302,660	C→G	8.3%	E371D (GAG→GAC) ‡	recB ←	Chi activated ATP‑dependent DNA helicase/dsDNA/ssDNA exonuclease
RA	5,302,661	T→A	8.6%	E371V (GAG→GTG) ‡	recB ←	Chi activated ATP‑dependent DNA helicase/dsDNA/ssDNA exonuclease
RA	5,302,662	C→G	8.2%	E371Q (GAG→CAG) ‡	recB ←	Chi activated ATP‑dependent DNA helicase/dsDNA/ssDNA exonuclease
RA	5,302,665	T→C	8.4%	S370G (AGC→GGC)	recB ←	Chi activated ATP‑dependent DNA helicase/dsDNA/ssDNA exonuclease
RA	5,313,276	C→G	12.2%	intergenic (‑595/+119)	PP_16SG ← / ← msrQ	16S ribosomal RNA/methionine sulfoxide reductase heme‑binding subunit
RA	5,313,279	C→G	12.0%	intergenic (‑598/+116)	PP_16SG ← / ← msrQ	16S ribosomal RNA/methionine sulfoxide reductase heme‑binding subunit
RA	5,322,154	C→T	6.1%	S366S (TCG→TCA)	mrcB ←	transglycosylase/transpeptidase
RA	5,322,735	T→G	5.4%	I173L (ATC→CTC)	mrcB ←	transglycosylase/transpeptidase
RA	5,322,736	C→A	6.2%	K172N (AAG→AAT)	mrcB ←	transglycosylase/transpeptidase
RA	5,323,120	A→T	5.8%	D44E (GAT→GAA)	mrcB ←	transglycosylase/transpeptidase
RA	5,323,124	A→C	5.3%	L43R (CTC→CGC)	mrcB ←	transglycosylase/transpeptidase
RA	5,324,153	T→C	6.6%	C263R (TGC→CGC)	PP_4684 →	kinase‑like domain‑containing protein
RA	5,325,511	T→A	5.9%	noncoding (133/149 nt)	PP_mr52 →	PrrF ncRNA
RA	5,331,397	T→G	5.7%	Q55P (CAG→CCG)	PP_4692 ←	aspartate/tyrosine/aromatic aminotransferase
RA	5,331,399	G→C	7.2%	G54G (GGC→GGG) ‡	PP_4692 ←	aspartate/tyrosine/aromatic aminotransferase
RA	5,331,401	C→A	6.2%	G54C (GGC→TGC) ‡	PP_4692 ←	aspartate/tyrosine/aromatic aminotransferase
RA	5,333,664	C→A	7.1%	L32M (CTG→ATG) ‡	PP_4695 →	two‑component system sensor histidine kinase
RA	5,333,666	G→C	8.2%	L32L (CTG→CTC) ‡	PP_4695 →	two‑component system sensor histidine kinase
RA	5,333,668	T→G	7.2%	I33S (ATC→AGC)	PP_4695 →	two‑component system sensor histidine kinase
RA	5,339,889	C→T	6.1%	L373L (CTG→TTG)	pcnB →	poly(A) polymerase
RA	5,339,896	G→T	6.8%	R375L (CGC→CTC) ‡	pcnB →	poly(A) polymerase
RA	5,339,897	C→G	7.4%	R375R (CGC→CGG) ‡	pcnB →	poly(A) polymerase
RA	5,339,900	C→G	7.4%	R376R (CGC→CGG)	pcnB →	poly(A) polymerase
RA	5,339,901	A→C	7.0%	S377R (AGC→CGC)	pcnB →	poly(A) polymerase
RA	5,339,908	A→G	5.8%	K379R (AAG→AGG)	pcnB →	poly(A) polymerase
RA	5,341,584	G→T	7.5%	V231L (GTG→TTG) ‡	panB →	3‑methyl‑2‑oxobutanoate hydroxymethyltransferase
RA	5,341,586	G→C	8.3%	V231V (GTG→GTC) ‡	panB →	3‑methyl‑2‑oxobutanoate hydroxymethyltransferase
RA	5,341,588	A→C	7.0%	K232T (AAG→ACG)	panB →	3‑methyl‑2‑oxobutanoate hydroxymethyltransferase
RA	5,343,615	C→G	9.5%	I285M (ATC→ATG)	pgi‑II →	glucose 6‑phosphate isomerase
RA	5,343,619	C→A	8.2%	L287M (CTG→ATG)	pgi‑II →	glucose 6‑phosphate isomerase
RA	5,343,624	C→G	7.7%	A288A (GCC→GCG)	pgi‑II →	glucose 6‑phosphate isomerase
RA	5,344,246	A→C	5.6%	K496Q (AAG→CAG) ‡	pgi‑II →	glucose 6‑phosphate isomerase
RA	5,344,247	A→T	5.5%	K496M (AAG→ATG) ‡	pgi‑II →	glucose 6‑phosphate isomerase
RA	5,344,248	G→T	6.8%	K496N (AAG→AAT) ‡	pgi‑II →	glucose 6‑phosphate isomerase
RA	5,344,252	T→C	5.5%	F498L (TTC→CTC)	pgi‑II →	glucose 6‑phosphate isomerase
RA	5,344,467	C→G	13.8%	intergenic (+42/‑136)	pgi‑II → / → acsA‑II	glucose 6‑phosphate isomerase/acetyl‑CoA synthetase
RA	5,344,471	C→T	15.0%	intergenic (+46/‑132)	pgi‑II → / → acsA‑II	glucose 6‑phosphate isomerase/acetyl‑CoA synthetase
RA	5,344,480	A→G	13.8%	intergenic (+55/‑123)	pgi‑II → / → acsA‑II	glucose 6‑phosphate isomerase/acetyl‑CoA synthetase
RA	5,344,484	C→G	12.9%	intergenic (+59/‑119)	pgi‑II → / → acsA‑II	glucose 6‑phosphate isomerase/acetyl‑CoA synthetase
RA	5,344,489	Δ1 bp	14.3%	intergenic (+64/‑114)	pgi‑II → / → acsA‑II	glucose 6‑phosphate isomerase/acetyl‑CoA synthetase
RA	5,344,490	Δ1 bp	14.3%	intergenic (+65/‑113)	pgi‑II → / → acsA‑II	glucose 6‑phosphate isomerase/acetyl‑CoA synthetase
RA	5,350,476	G→C	5.6%	intergenic (+13/+69)	PP_4704 → / ← PP_4705	hypothetical protein/glyoxalase
RA	5,359,353	G→C	5.3%	A306G (GCC→GGC)	nusA ←	transcription termination/antitermination factor L
RA	5,360,629	T→G	5.5%	E70D (GAA→GAC) ‡	rimP ←	ribosome maturation factor
RA	5,360,630	T→A	5.5%	E70V (GAA→GTA) ‡	rimP ←	ribosome maturation factor
RA	5,360,631	C→A	5.3%	E70* (GAA→TAA) ‡	rimP ←	ribosome maturation factor
RA	5,361,071	A→T	6.5%	intergenic (‑78/+23)	PP_t49 ← / ← PP_t48	tRNA‑Met/tRNA‑Leu
RA	5,361,072	A→T	6.9%	intergenic (‑79/+22)	PP_t49 ← / ← PP_t48	tRNA‑Met/tRNA‑Leu
RA	5,362,215	C→G	5.3%	V49L (GTG→CTG)	tpiA ←	triose phosphate isomerase
RA	5,362,216	C→G	5.3%	Q48H (CAG→CAC)	tpiA ←	triose phosphate isomerase
RA	5,378,020	C→G	8.9%	K68N (AAG→AAC)	grpE ←	heat shock protein GrpE
RA	5,378,260	A→T	6.7%	intergenic (‑37/‑156)	grpE ← / → recN	heat shock protein GrpE/DNA repair/recombination protein
RA	5,381,267	T→C	10.2%	intergenic (+32/+33)	bamE → / ← PP_4732	outer membrane protein assembly factor BamE/hypothetical protein
RA	5,381,268	T→A	10.2%	intergenic (+33/+32)	bamE → / ← PP_4732	outer membrane protein assembly factor BamE/hypothetical protein
RA	5,381,269	G→A	10.4%	intergenic (+34/+31)	bamE → / ← PP_4732	outer membrane protein assembly factor BamE/hypothetical protein
RA	5,382,269	A→T	8.2%	E124D (GAA→GAT)	smpB →	SsrA‑binding protein
RA	5,382,270	A→T	9.2%	I125F (ATC→TTC)	smpB →	SsrA‑binding protein
RA	5,383,303	G→T	12.0%	intergenic (‑23/‑234)	pdhR ← / → lldP	DNA‑binding transcriptional regulator LldR/L‑lactate permease
RA	5,383,305	C→A	12.0%	intergenic (‑25/‑232)	pdhR ← / → lldP	DNA‑binding transcriptional regulator LldR/L‑lactate permease
RA	5,383,308	A→T	15.9%	intergenic (‑28/‑229)	pdhR ← / → lldP	DNA‑binding transcriptional regulator LldR/L‑lactate permease
RA	5,383,311	T→G	12.0%	intergenic (‑31/‑226)	pdhR ← / → lldP	DNA‑binding transcriptional regulator LldR/L‑lactate permease
RA	5,383,313	A→C	12.0%	intergenic (‑33/‑224)	pdhR ← / → lldP	DNA‑binding transcriptional regulator LldR/L‑lactate permease
RA	5,385,617	Δ1 bp	5.9%	coding (348/1146 nt)	lldD →	L‑lactate dehydrogenase
RA	5,391,329	A→G	8.4%	E82E (GAA→GAG)	PP_5707 →	hypothetical protein
RA	5,391,330	C→T	8.2%	L83F (CTC→TTC)	PP_5707 →	hypothetical protein
RA	5,420,010	G→T	5.4%	P232P (CCG→CCT)	PP_4759 →	transcriptional regulator, GntR family
RA	5,420,014	T→A	5.5%	*234R (TGA→AGA) ‡	PP_4759 →	transcriptional regulator, GntR family
RA	5,420,016	A→T	6.1%	*234C (TGA→TGT) ‡	PP_4759 →	transcriptional regulator, GntR family
RA	5,420,018	T→A	5.5%	intergenic (+2/+70)	PP_4759 → / ← PP_4760	transcriptional regulator, GntR family/alcohol dehydrogenase
RA	5,420,022	A→C	5.7%	intergenic (+6/+66)	PP_4759 → / ← PP_4760	transcriptional regulator, GntR family/alcohol dehydrogenase
RA	5,420,450	A→G	6.1%	W217R (TGG→CGG)	PP_4760 ←	alcohol dehydrogenase
RA	5,420,452	G→C	6.1%	A216G (GCC→GGC)	PP_4760 ←	alcohol dehydrogenase
RA	5,420,454	C→T	6.1%	P215P (CCG→CCA)	PP_4760 ←	alcohol dehydrogenase
RA	5,440,363	T→C	8.2%	T155A (ACC→GCC)	amn ←	AMP nucleosidase
RA	5,440,368	G→A	8.6%	A153V (GCG→GTG)	amn ←	AMP nucleosidase
RA	5,449,171	C→G	6.3%	P14A (CCC→GCC) ‡	ybeZ →	nucleoside triphosphate hydrolase domain‑containing protein
RA	5,449,172	C→G	6.2%	P14R (CCC→CGC) ‡	ybeZ →	nucleoside triphosphate hydrolase domain‑containing protein
RA	5,449,173	C→G	6.4%	P14P (CCC→CCG) ‡	ybeZ →	nucleoside triphosphate hydrolase domain‑containing protein
RA	5,459,560	T→G	7.8%	intergenic (+18/‑22)	PP_4795 → / → holA	lipoprotein/DNA polymerase III subunit delta
RA	5,462,261	G→A	7.2%	D401N (GAT→AAT) ‡	PP_4798 →	membrane‑bound lytic murein transglycosylase
RA	5,462,262	A→T	7.2%	D401V (GAT→GTT) ‡	PP_4798 →	membrane‑bound lytic murein transglycosylase
RA	5,462,263	T→C	7.3%	D401D (GAT→GAC) ‡	PP_4798 →	membrane‑bound lytic murein transglycosylase
RA	5,462,393	T→G	5.8%	intergenic (+16/+18)	PP_4798 → / ← PP_4799	membrane‑bound lytic murein transglycosylase/muramoyltetrapeptide carboxypeptidase
RA	5,462,394	G→C	7.4%	intergenic (+17/+17)	PP_4798 → / ← PP_4799	membrane‑bound lytic murein transglycosylase/muramoyltetrapeptide carboxypeptidase
RA	5,485,150	A→G	20.0%	intergenic (+56/‑91)	purH → / → purD	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase/phosphoribosylamine‑‑glycine ligase
RA	5,485,153	A→G	24.2%	intergenic (+59/‑88)	purH → / → purD	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase/phosphoribosylamine‑‑glycine ligase
RA	5,485,154	T→C	28.5%	intergenic (+60/‑87)	purH → / → purD	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase/phosphoribosylamine‑‑glycine ligase
RA	5,485,159	G→A	28.6%	intergenic (+65/‑82)	purH → / → purD	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase/phosphoribosylamine‑‑glycine ligase
RA	5,485,162	T→C	27.6%	intergenic (+68/‑79)	purH → / → purD	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase/phosphoribosylamine‑‑glycine ligase
RA	5,485,167	G→A	20.0%	intergenic (+73/‑74)	purH → / → purD	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase/phosphoribosylamine‑‑glycine ligase
RA	5,485,168	C→T	20.0%	intergenic (+74/‑73)	purH → / → purD	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase/phosphoribosylamine‑‑glycine ligase
RA	5,485,171	C→T	20.0%	intergenic (+77/‑70)	purH → / → purD	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase/phosphoribosylamine‑‑glycine ligase
RA	5,489,782	G→T	7.3%	M88I (ATG→ATT)	PP_4825 →	MarC family membrane protein
RA	5,503,135	C→A	6.9%	L29M (CTG→ATG) ‡	oprC →	copper receptor OprC
RA	5,503,136	T→G	6.9%	L29R (CTG→CGG) ‡	oprC →	copper receptor OprC
RA	5,503,142	C→G	7.1%	A31G (GCC→GGC)	oprC →	copper receptor OprC
RA	5,503,148	C→A	7.1%	P33H (CCT→CAT) ‡	oprC →	copper receptor OprC
RA	5,503,149	T→G	6.9%	P33P (CCT→CCG) ‡	oprC →	copper receptor OprC
RA	5,513,985	T→G	5.8%	Y204D (TAC→GAC) ‡	urtE →	ABC transporter ATP‑binding protein
RA	5,513,986	A→T	5.8%	Y204F (TAC→TTC) ‡	urtE →	ABC transporter ATP‑binding protein
RA	5,513,987	C→A	5.7%	Y204* (TAC→TAA) ‡	urtE →	ABC transporter ATP‑binding protein
RA	5,515,926	G→C	5.7%	P34A (CCC→GCC)	cbpA ←	curved DNA‑binding protein
RA	5,521,817	C→T	8.9%	intergenic (‑32/‑35)	lip ← / → PP_4855	lipase/osmotically‑inducible lipoprotein OsmE
RA	5,521,818	A→T	8.8%	intergenic (‑33/‑34)	lip ← / → PP_4855	lipase/osmotically‑inducible lipoprotein OsmE
RA	5,521,819	A→G	8.8%	intergenic (‑34/‑33)	lip ← / → PP_4855	lipase/osmotically‑inducible lipoprotein OsmE
RA	5,522,791	T→A	10.0%	intergenic (+25/+15)	PP_4856 → / ← yhjG	Dps family ferritin/protein YhjG
RA	5,522,792	T→A	10.0%	intergenic (+26/+14)	PP_4856 → / ← yhjG	Dps family ferritin/protein YhjG
RA	5,522,793	T→A	10.0%	intergenic (+27/+13)	PP_4856 → / ← yhjG	Dps family ferritin/protein YhjG
RA	5,522,794	T→A	10.0%	intergenic (+28/+12)	PP_4856 → / ← yhjG	Dps family ferritin/protein YhjG
RA	5,531,010	A→C	9.1%	R421R (CGT→CGG)	braE ←	high‑affinity branched‑chain amino acid ABC transporter permease BraE
RA	5,531,013	G→T	10.1%	I420I (ATC→ATA)	braE ←	high‑affinity branched‑chain amino acid ABC transporter permease BraE
JC	5,555,608	+GCC	100%	intergenic (‑84/+87)	PP_4887 ← / ← PP_4888	hypothetical protein/methyl‑accepting chemotaxis transducer
RA	5,565,760	T→C	6.2%	M576V (ATG→GTG)	mutL ←	DNA mismatch repair protein MutL
RA	5,566,961	C→G	6.1%	L175F (TTG→TTC)	mutL ←	DNA mismatch repair protein MutL
RA	5,567,178	A→T	6.2%	L103* (TTG→TAG) ‡	mutL ←	DNA mismatch repair protein MutL
RA	5,567,179	A→T	6.2%	L103M (TTG→ATG) ‡	mutL ←	DNA mismatch repair protein MutL
RA	5,570,177	T→G	7.7%	A24A (GCA→GCC) ‡	nnrD ←	ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase
RA	5,570,178	G→C	6.4%	A24G (GCA→GGA) ‡	nnrD ←	ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase
RA	5,574,789	C→T	9.6%	D169N (GAC→AAC)	motB ←	flagellar motor rotation protein
RA	5,574,790	G→C	10.0%	F168L (TTC→TTG) ‡	motB ←	flagellar motor rotation protein
RA	5,574,791	A→G	10.0%	F168S (TTC→TCC) ‡	motB ←	flagellar motor rotation protein
RA	5,582,813	T→A	6.5%	H178L (CAC→CTC)	PP_4911 ←	hypothetical protein
RA	5,582,816	T→A	6.7%	Q177L (CAG→CTG)	PP_4911 ←	hypothetical protein
RA	5,582,819	T→A	6.8%	Q176L (CAG→CTG)	PP_4911 ←	hypothetical protein
RA	5,582,822	T→A	6.8%	E175V (GAG→GTG)	PP_4911 ←	hypothetical protein
RA	5,610,648	G→C	5.7%	M21I (ATG→ATC)	emrE →	small multidrug resistance protein
RA	5,610,649	A→G	6.4%	K22E (AAG→GAG)	emrE →	small multidrug resistance protein
RA	5,613,523	T→A	8.6%	A158A (GCT→GCA)	PP_4933 →	hypothetical protein
RA	5,613,529	G→C	8.0%	E160D (GAG→GAC)	PP_4933 →	hypothetical protein
RA	5,613,535	T→A	7.8%	G162G (GGT→GGA)	PP_4933 →	hypothetical protein
RA	5,623,395	G→T	7.3%	R115R (CGG→AGG)	PP_4941 ←	hypothetical protein
RA	5,623,396	A→C	7.4%	P114P (CCT→CCG)	PP_4941 ←	hypothetical protein
RA	5,623,970	T→C	9.0%	I221V (ATC→GTC)	PP_4942 ←	hypothetical protein
RA	5,623,973	C→T	8.7%	A220T (GCC→ACC)	PP_4942 ←	hypothetical protein
RA	5,623,976	T→G	8.9%	I219L (ATT→CTT)	PP_4942 ←	hypothetical protein
RA	5,623,978	G→C	10.0%	P218R (CCG→CGG)	PP_4942 ←	hypothetical protein
RA	5,623,980	C→A	8.3%	K217N (AAG→AAT)	PP_4942 ←	hypothetical protein
RA	5,623,983	A→G	8.9%	G216G (GGT→GGC)	PP_4942 ←	hypothetical protein
RA	5,623,986	G→A	9.1%	D215D (GAC→GAT)	PP_4942 ←	hypothetical protein
RA	5,631,113	G→A	8.3%	G215S (GGC→AGC)	putA →	proline dehydrogenase/1‑pyrroline‑5‑carboxylate dehydrogenase
RA	5,631,116	A→T	8.2%	K216* (AAG→TAG) ‡	putA →	proline dehydrogenase/1‑pyrroline‑5‑carboxylate dehydrogenase
RA	5,631,117	A→T	8.1%	K216M (AAG→ATG) ‡	putA →	proline dehydrogenase/1‑pyrroline‑5‑carboxylate dehydrogenase
RA	5,631,120	T→C	7.9%	L217P (CTG→CCG)	putA →	proline dehydrogenase/1‑pyrroline‑5‑carboxylate dehydrogenase
RA	5,640,095	T→G	6.2%	L396W (TTG→TGG)	PP_4950 →	hypothetical protein
RA	5,640,100	G→C	6.8%	G398R (GGC→CGC) ‡	PP_4950 →	hypothetical protein
RA	5,640,101	G→C	5.5%	G398A (GGC→GCC) ‡	PP_4950 →	hypothetical protein
RA	5,640,106	C→A	5.4%	Q400K (CAG→AAG)	PP_4950 →	hypothetical protein
RA	5,651,374	T→G	5.1%	intergenic (‑182/+31)	PP_4959 ← / ← fba	diguanylate cyclase/fructose‑bisphosphate aldolase
RA	5,651,377	C→A	5.2%	intergenic (‑185/+28)	PP_4959 ← / ← fba	diguanylate cyclase/fructose‑bisphosphate aldolase
RA	5,655,626:1	+A	29.0%	intergenic (‑81/+71)	epd ← / ← tktA	D‑erythrose 4‑phosphate dehydrogenase/transketolase A
RA	5,655,631	T→G	33.2%	intergenic (‑86/+66)	epd ← / ← tktA	D‑erythrose 4‑phosphate dehydrogenase/transketolase A
RA	5,655,636	C→A	27.2%	intergenic (‑91/+61)	epd ← / ← tktA	D‑erythrose 4‑phosphate dehydrogenase/transketolase A
RA	5,655,641	Δ1 bp	29.0%	intergenic (‑96/+56)	epd ← / ← tktA	D‑erythrose 4‑phosphate dehydrogenase/transketolase A
RA	5,658,116	T→G	5.6%	H57Q (CAT→CAG)	sahR →	methionine metabolism transcriptional regulator
RA	5,660,182	G→T	11.1%	intergenic (+35/‑194)	metK → / → ligB	methionine adenosyltransferase/DNA ligase B
RA	5,660,185	A→C	9.6%	intergenic (+38/‑191)	metK → / → ligB	methionine adenosyltransferase/DNA ligase B
RA	5,669,964	C→G	8.9%	H147Q (CAC→CAG)	metF →	5,10‑methylenetetrahydrofolate reductase
RA	5,669,965	C→G	9.2%	L148V (CTG→GTG)	metF →	5,10‑methylenetetrahydrofolate reductase
RA	5,674,750:1	+G	100%	intergenic (+112/+28)	rhlE‑II → / ← yceI	ATP‑dependent RNA helicase/polyisoprene‑binding acidic stress response factor
RA	5,674,753	G→C	100%	intergenic (+115/+25)	rhlE‑II → / ← yceI	ATP‑dependent RNA helicase/polyisoprene‑binding acidic stress response factor
JC	5,681,415	+CGGG	89.2%	intergenic (‑133/+71)	PP_4986 ← / ← PP_4987	hemolysin III family channel protein/putative Chemotaxis protein
RA	5,682,324	A→C	6.6%	R1523R (CGT→CGG)	PP_4988 ←	signal transduction histidine kinase CheA/CheY‑like receiver
RA	5,682,338	G→T	6.2%	P1519T (CCG→ACG)	PP_4988 ←	signal transduction histidine kinase CheA/CheY‑like receiver
RA	5,689,863	G→A	5.3%	P11S (CCG→TCG)	pilH ←	twitching motility protein PilH
RA	5,689,867	G→C	5.4%	D9E (GAC→GAG)	pilH ←	twitching motility protein PilH
RA	5,689,871	T→C	5.6%	D8G (GAC→GGC)	pilH ←	twitching motility protein PilH
RA	5,698,154	A→C	7.3%	K263T (AAG→ACG)	hslU →	protease HslVU ATPase subunit
RA	5,698,157	G→T	6.9%	R264L (CGT→CTT)	hslU →	protease HslVU ATPase subunit
RA	5,707,113	G→C	5.5%	L377L (CTG→CTC)	PP_5009 →	hypothetical protein
RA	5,715,410	C→A	5.3%	P26Q (CCG→CAG)	tatB →	Sec‑independent protein translocase protein TatB
RA	5,734,772	G→C	7.1%	R298G (CGT→GGT)	hutH ←	histidine ammonia‑lyase
RA	5,734,779	G→C	8.0%	T295T (ACC→ACG)	hutH ←	histidine ammonia‑lyase
RA	5,736,533	C→T	6.7%	V305M (GTG→ATG)	hutU ←	urocanate hydratase
RA	5,740,467	T→G	28.0%	intergenic (+32/+39)	hutF → / ← PP_5037	formiminoglutamate deiminase/lipocalin family lipoprotein
RA	5,740,470	A→T	23.0%	intergenic (+35/+36)	hutF → / ← PP_5037	formiminoglutamate deiminase/lipocalin family lipoprotein
RA	5,740,471	A→T	24.6%	intergenic (+36/+35)	hutF → / ← PP_5037	formiminoglutamate deiminase/lipocalin family lipoprotein
RA	5,740,474	C→A	23.3%	intergenic (+39/+32)	hutF → / ← PP_5037	formiminoglutamate deiminase/lipocalin family lipoprotein
RA	5,740,484	T→C	12.0%	intergenic (+49/+22)	hutF → / ← PP_5037	formiminoglutamate deiminase/lipocalin family lipoprotein
RA	5,741,508	A→T	6.4%	intergenic (‑179/+49)	PP_5038 ← / ← PP_5039	lipoprotein/hypothetical protein
RA	5,746,485	G→C	13.4%	intergenic (+32/+67)	PP_5042 → / ← PP_5043	hypothetical protein/PhoPQ‑activated pathogenicity‑like protein
RA	5,746,488	G→C	13.3%	intergenic (+35/+64)	PP_5042 → / ← PP_5043	hypothetical protein/PhoPQ‑activated pathogenicity‑like protein
RA	5,748,696	G→T	5.9%	N428K (AAC→AAA)	typA ←	ribosome associated GTPase
RA	5,751,719	G→T	7.5%	intergenic (‑157/‑314)	thiI ← / → glnA	tRNA sulfurtransferase/glutamine synthetase
RA	5,751,725	A→G	11.1%	intergenic (‑163/‑308)	thiI ← / → glnA	tRNA sulfurtransferase/glutamine synthetase
RA	5,751,729	G→T	11.9%	intergenic (‑167/‑304)	thiI ← / → glnA	tRNA sulfurtransferase/glutamine synthetase
RA	5,751,730	G→T	11.7%	intergenic (‑168/‑303)	thiI ← / → glnA	tRNA sulfurtransferase/glutamine synthetase
RA	5,751,735	A→C	10.0%	intergenic (‑173/‑298)	thiI ← / → glnA	tRNA sulfurtransferase/glutamine synthetase
RA	5,751,736	A→C	10.0%	intergenic (‑174/‑297)	thiI ← / → glnA	tRNA sulfurtransferase/glutamine synthetase
RA	5,751,740	C→T	10.6%	intergenic (‑178/‑293)	thiI ← / → glnA	tRNA sulfurtransferase/glutamine synthetase
RA	5,751,746	A→C	10.6%	intergenic (‑184/‑287)	thiI ← / → glnA	tRNA sulfurtransferase/glutamine synthetase
RA	5,753,485	T→G	10.7%	intergenic (+46/‑320)	glnA → / → glnL	glutamine synthetase/two‑component system sensor histidine kinase/phosphatase GlnL/GlnG
RA	5,753,486	C→A	10.5%	intergenic (+47/‑319)	glnA → / → glnL	glutamine synthetase/two‑component system sensor histidine kinase/phosphatase GlnL/GlnG
RA	5,763,847	T→C	6.1%	V408A (GTT→GCT)	PP_5057 →	M23/M37 family peptidase
RA	5,763,850	G→T	6.2%	G409V (GGC→GTC)	PP_5057 →	M23/M37 family peptidase
RA	5,763,853	A→C	6.1%	D410A (GAC→GCC)	PP_5057 →	M23/M37 family peptidase
RA	5,763,856	G→A	6.0%	S411N (AGC→AAC)	PP_5057 →	M23/M37 family peptidase
RA	5,776,247	G→A	7.2%	P188P (CCG→CCA)	betA‑II →	choline dehydrogenase
RA	5,776,248	A→T	8.1%	M189L (ATG→TTG) ‡	betA‑II →	choline dehydrogenase
RA	5,776,249	T→C	7.2%	M189T (ATG→ACG) ‡	betA‑II →	choline dehydrogenase
RA	5,776,696	G→A	7.2%	G338D (GGT→GAT)	betA‑II →	choline dehydrogenase
RA	5,776,699	T→C	7.2%	I339T (ATC→ACC)	betA‑II →	choline dehydrogenase
RA	5,776,703	C→T	7.2%	G340G (GGC→GGT)	betA‑II →	choline dehydrogenase
RA	5,807,984	A→G	14.7%	intergenic (+119/+36)	mrcA → / ← maeB	penicillin‑insensitive transglycosylase/penicillin‑sensitive transpeptidase/malic enzyme B
RA	5,807,985	T→C	15.7%	intergenic (+120/+35)	mrcA → / ← maeB	penicillin‑insensitive transglycosylase/penicillin‑sensitive transpeptidase/malic enzyme B
RA	5,807,986	G→A	15.1%	intergenic (+121/+34)	mrcA → / ← maeB	penicillin‑insensitive transglycosylase/penicillin‑sensitive transpeptidase/malic enzyme B
RA	5,807,987	C→T	15.0%	intergenic (+122/+33)	mrcA → / ← maeB	penicillin‑insensitive transglycosylase/penicillin‑sensitive transpeptidase/malic enzyme B
RA	5,815,531	C→T	7.9%	intergenic (+15/+76)	PP_5090 → / ← PP_5091	cell division protein/membrane protein
RA	5,815,536	G→T	10.2%	intergenic (+20/+71)	PP_5090 → / ← PP_5091	cell division protein/membrane protein
RA	5,815,539	A→C	12.7%	intergenic (+23/+68)	PP_5090 → / ← PP_5091	cell division protein/membrane protein
RA	5,815,544	A→G	10.9%	intergenic (+28/+63)	PP_5090 → / ← PP_5091	cell division protein/membrane protein
RA	5,824,712	T→G	6.2%	intergenic (+136/+38)	PP_5102 → / ← trmB	hypothetical protein/tRNA (guanosine(46)‑N7)‑methyltransferase TrmB
RA	5,856,513	A→T	6.1%	E147V (GAA→GTA) ‡	PP_5133 →	membrane protein
RA	5,856,514	A→T	6.1%	E147D (GAA→GAT) ‡	PP_5133 →	membrane protein
RA	5,856,520	T→A	6.3%	F149L (TTT→TTA)	PP_5133 →	membrane protein
RA	5,860,125	G→C	5.6%	A535G (GCC→GGC)	PP_5136 ←	ABC transporter permease
RA	5,860,127	A→G	5.6%	G534G (GGT→GGC)	PP_5136 ←	ABC transporter permease
RA	5,866,696	G→T	10.9%	intergenic (+19/+38)	PP_5140 → / ← thyA	MerR family transcriptional regulator/thymidylate synthase
RA	5,866,697	A→C	10.0%	intergenic (+20/+37)	PP_5140 → / ← thyA	MerR family transcriptional regulator/thymidylate synthase
RA	5,867,733:1	+C	5.8%	intergenic (‑28/+24)	thyA ← / ← lgt	thymidylate synthase/prolipoprotein diacylglyceryl transferase
RA	5,867,738	Δ1 bp	5.6%	intergenic (‑33/+19)	thyA ← / ← lgt	thymidylate synthase/prolipoprotein diacylglyceryl transferase
RA	5,887,056	T→G	6.5%	intergenic (‑41/‑89)	PP_5161 ← / → PP_5162	lysophospholipase/hypothetical protein
RA	5,887,059	C→T	6.5%	intergenic (‑44/‑86)	PP_5161 ← / → PP_5162	lysophospholipase/hypothetical protein
RA	5,887,060	G→C	6.5%	intergenic (‑45/‑85)	PP_5161 ← / → PP_5162	lysophospholipase/hypothetical protein
RA	5,887,061	A→G	6.5%	intergenic (‑46/‑84)	PP_5161 ← / → PP_5162	lysophospholipase/hypothetical protein
RA	5,887,064	C→A	7.2%	intergenic (‑49/‑81)	PP_5161 ← / → PP_5162	lysophospholipase/hypothetical protein
RA	5,897,770	A→G	11.9%	intergenic (‑170/+64)	PP_5172 ← / ← PP_5173	hypothetical protein/RND family transporter
RA	5,897,773	G→A	12.8%	intergenic (‑173/+61)	PP_5172 ← / ← PP_5173	hypothetical protein/RND family transporter
RA	5,897,778	C→G	14.9%	intergenic (‑178/+56)	PP_5172 ← / ← PP_5173	hypothetical protein/RND family transporter
RA	5,897,779	G→C	12.5%	intergenic (‑179/+55)	PP_5172 ← / ← PP_5173	hypothetical protein/RND family transporter
RA	5,897,782	G→C	13.6%	intergenic (‑182/+52)	PP_5172 ← / ← PP_5173	hypothetical protein/RND family transporter
RA	5,897,783	C→G	14.0%	intergenic (‑183/+51)	PP_5172 ← / ← PP_5173	hypothetical protein/RND family transporter
RA	5,897,788	T→C	14.3%	intergenic (‑188/+46)	PP_5172 ← / ← PP_5173	hypothetical protein/RND family transporter
RA	5,897,791	C→T	13.9%	intergenic (‑191/+43)	PP_5172 ← / ← PP_5173	hypothetical protein/RND family transporter
RA	5,903,165	A→C	12.1%	intergenic (‑129/‑139)	PP_5175 ← / → PP_5176	HlyD family secretion protein/hypothetical protein
RA	5,906,148	G→A	6.7%	T218I (ACC→ATC) ‡	spuF ←	spermidine/putrescine ABC transporter ATP binding protein
RA	5,906,149	T→C	6.7%	T218A (ACC→GCC) ‡	spuF ←	spermidine/putrescine ABC transporter ATP binding protein
RA	5,907,906:1	+G	9.5%	coding (61/1095 nt)	spuE ←	spermidine/putrescine ABC transporter substrate‑binding protein
RA	5,907,912	Δ1 bp	9.2%	coding (55/1095 nt)	spuE ←	spermidine/putrescine ABC transporter substrate‑binding protein
RA	5,925,579:1	+C	9.6%	coding (566/1083 nt)	gcvT‑II ←	aminomethyltransferase
RA	5,925,584	Δ1 bp	9.3%	coding (561/1083 nt)	gcvT‑II ←	aminomethyltransferase
RA	5,925,591	C→A	5.8%	R185L (CGC→CTC)	gcvT‑II ←	aminomethyltransferase
RA	5,941,332	T→G	7.5%	intergenic (+58/+123)	yhhJ → / ← PP_5722	translation‑like protein/hypothetical protein
RA	5,941,333	T→A	7.4%	intergenic (+59/+122)	yhhJ → / ← PP_5722	translation‑like protein/hypothetical protein
RA	5,941,334	T→A	7.5%	intergenic (+60/+121)	yhhJ → / ← PP_5722	translation‑like protein/hypothetical protein
RA	5,941,335	C→A	7.1%	intergenic (+61/+120)	yhhJ → / ← PP_5722	translation‑like protein/hypothetical protein
RA	5,948,682	T→A	6.5%	intergenic (‑63/+19)	PP_mr62 ← / ← trxA	Pseudomon‑Rho regulatory region/thioredoxin I
RA	5,948,683	T→A	5.8%	intergenic (‑64/+18)	PP_mr62 ← / ← trxA	Pseudomon‑Rho regulatory region/thioredoxin I
RA	5,959,995	A→T	7.2%	noncoding (74/103 nt)	PP_mr63 ←	rnk_pseudo ncRNA
RA	5,959,996	A→T	7.7%	noncoding (73/103 nt)	PP_mr63 ←	rnk_pseudo ncRNA
RA	5,965,571	A→C	5.6%	intergenic (+69/+31)	had → / ← PP_5232	(S)‑2‑haloacid dehalogenase/hypothetical protein
RA	5,988,809	G→A	20.2%	intergenic (+103/‑443)	kefB‑III → / → PP_mr64	glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA	5,988,819	T→C	19.5%	intergenic (+113/‑433)	kefB‑III → / → PP_mr64	glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA	5,988,824	C→T	19.6%	intergenic (+118/‑428)	kefB‑III → / → PP_mr64	glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA	5,988,825	G→T	19.3%	intergenic (+119/‑427)	kefB‑III → / → PP_mr64	glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA	5,988,826	C→T	19.3%	intergenic (+120/‑426)	kefB‑III → / → PP_mr64	glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA	5,988,829	A→G	20.3%	intergenic (+123/‑423)	kefB‑III → / → PP_mr64	glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA	5,988,835	G→C	19.0%	intergenic (+129/‑417)	kefB‑III → / → PP_mr64	glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA	5,988,837	C→G	20.0%	intergenic (+131/‑415)	kefB‑III → / → PP_mr64	glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA	5,988,840	C→T	20.0%	intergenic (+134/‑412)	kefB‑III → / → PP_mr64	glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA	5,988,844	C→G	19.3%	intergenic (+138/‑408)	kefB‑III → / → PP_mr64	glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA	5,988,848	C→T	20.2%	intergenic (+142/‑404)	kefB‑III → / → PP_mr64	glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA	5,988,850	C→T	20.2%	intergenic (+144/‑402)	kefB‑III → / → PP_mr64	glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA	5,988,889	C→A	26.7%	intergenic (+183/‑363)	kefB‑III → / → PP_mr64	glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA	5,988,894	C→T	28.6%	intergenic (+188/‑358)	kefB‑III → / → PP_mr64	glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA	5,988,895	A→G	28.5%	intergenic (+189/‑357)	kefB‑III → / → PP_mr64	glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA	5,988,905	T→C	33.3%	intergenic (+199/‑347)	kefB‑III → / → PP_mr64	glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA	5,988,911	Δ1 bp	32.9%	intergenic (+205/‑341)	kefB‑III → / → PP_mr64	glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
RA	5,995,016	G→A	6.4%	intergenic (+144/+33)	PP_5251 → / ← PP_5252	transporter/hypothetical protein
RA	5,995,018	T→A	6.3%	intergenic (+146/+31)	PP_5251 → / ← PP_5252	transporter/hypothetical protein
RA	5,995,020	T→C	6.3%	intergenic (+148/+29)	PP_5251 → / ← PP_5252	transporter/hypothetical protein
RA	6,002,326	G→T	5.3%	intergenic (‑26/+120)	amaA ← / ← amaB	L‑pipecolate oxidase/L‑piperidine‑6‑carboxylate dehydrogenase
RA	6,011,493	G→C	6.1%	K115N (AAG→AAC)	rep →	single‑stranded DNA dependent ATPase
RA	6,011,500	C→A	5.2%	L118M (CTG→ATG)	rep →	single‑stranded DNA dependent ATPase
RA	6,013,836	G→A	13.1%	intergenic (+41/+69)	xpt → / ← PP_5266	xanthine phosphoribosyltransferase/acetyl‑CoA hydrolase family protein
RA	6,013,838	A→G	13.1%	intergenic (+43/+67)	xpt → / ← PP_5266	xanthine phosphoribosyltransferase/acetyl‑CoA hydrolase family protein
RA	6,013,846	T→G	14.4%	intergenic (+51/+59)	xpt → / ← PP_5266	xanthine phosphoribosyltransferase/acetyl‑CoA hydrolase family protein
RA	6,013,885	T→C	100%	intergenic (+90/+20)	xpt → / ← PP_5266	xanthine phosphoribosyltransferase/acetyl‑CoA hydrolase family protein
RA	6,023,159	G→A	6.6%	intergenic (+74/+70)	PP_5273 → / ← PP_5274	oxidoreductase/hypothetical protein
RA	6,023,160	T→C	7.8%	intergenic (+75/+69)	PP_5273 → / ← PP_5274	oxidoreductase/hypothetical protein
RA	6,027,222	A→T	5.2%	F212Y (TTC→TAC)	PP_5277 ←	MFS transporter
RA	6,035,933	A→G	5.7%	I155V (ATC→GTC)	algC →	phosphomannomutase/phosphoglucomutase
RA	6,045,721	A→C	6.8%	R130R (CGT→CGG) ‡	PP_5298 ←	glutamine amidotransferase
RA	6,045,722	C→A	6.9%	R130L (CGT→CTT) ‡	PP_5298 ←	glutamine amidotransferase
RA	6,045,725	T→G	7.9%	Q129P (CAG→CCG)	PP_5298 ←	glutamine amidotransferase
RA	6,061,252	T→C	8.0%	D39G (GAC→GGC)	hupA ←	DNA‑binding protein HU‑alpha
RA	6,061,256	T→G	8.1%	K38Q (AAG→CAG)	hupA ←	DNA‑binding protein HU‑alpha
RA	6,061,258	T→A	8.0%	D37V (GAC→GTC)	hupA ←	DNA‑binding protein HU‑alpha
RA	6,061,260	C→A	8.0%	L36L (CTG→CTT)	hupA ←	DNA‑binding protein HU‑alpha
RA	6,061,264	G→A	6.8%	A35V (GCC→GTC)	hupA ←	DNA‑binding protein HU‑alpha
RA	6,080,988	T→A	16.4%	intergenic (+35/+27)	PP_5332 → / ← PP_5333	hypothetical protein/hypothetical protein
RA	6,080,989	T→A	17.6%	intergenic (+36/+26)	PP_5332 → / ← PP_5333	hypothetical protein/hypothetical protein
RA	6,103,201	T→A	5.5%	C12S (TGC→AGC)	PP_5353 →	hypothetical protein
RA	6,103,207	G→A	6.6%	G14S (GGC→AGC) ‡	PP_5353 →	hypothetical protein
RA	6,103,209	C→G	7.0%	G14G (GGC→GGG) ‡	PP_5353 →	hypothetical protein
RA	6,103,211	T→C	8.9%	L15P (CTG→CCG)	PP_5353 →	hypothetical protein
RA	6,103,217	T→A	6.4%	L17Q (CTG→CAG)	PP_5353 →	hypothetical protein
RA	6,104,053	T→A	8.1%	intergenic (+31/‑83)	PP_5353 → / → PP_5354	hypothetical protein/hypothetical protein
RA	6,104,054	T→A	8.8%	intergenic (+32/‑82)	PP_5353 → / → PP_5354	hypothetical protein/hypothetical protein
RA	6,129,160	A→C	8.1%	intergenic (+22/+45)	PP_5376 → / ← PP_5377	hypothetical protein/hypothetical protein
RA	6,129,170	C→T	9.7%	intergenic (+32/+35)	PP_5376 → / ← PP_5377	hypothetical protein/hypothetical protein
RA	6,129,173	A→T	9.7%	intergenic (+35/+32)	PP_5376 → / ← PP_5377	hypothetical protein/hypothetical protein
RA	6,129,176	A→G	9.9%	intergenic (+38/+29)	PP_5376 → / ← PP_5377	hypothetical protein/hypothetical protein
RA	6,157,486	G→T	5.8%	G309V (GGA→GTA)	PP_5400 →	hypothetical protein
RA	6,167,902	C→G	8.8%	P328A (CCA→GCA) ‡	PP_5407 →	TnsD‑like transposition protein
RA	6,167,904	A→T	8.0%	P328P (CCA→CCT) ‡	PP_5407 →	TnsD‑like transposition protein
RA	6,167,906	C→G	8.2%	A329G (GCG→GGG)	PP_5407 →	TnsD‑like transposition protein
RA	6,174,708	G→T	7.1%	intergenic (‑70/+49)	glmU ← / ← atpC	bifunctional N‑acetyl glucosamine‑1‑phosphate uridyltransferase/glucosamine‑1‑phosphate acetyl transferase/ATP synthase subunit epsilon

Unassigned missing coverage evidence
			seq id	start	end	size	←reads	reads→	gene	description
*	*	÷	NC_002947	171361–176317	176317	1–4957	25 [24]	[24] 25	PP_16SA–[PP_5SA]	PP_16SA,PP_23SA,[PP_5SA]
*	*	÷	NC_002947	176625–181702	181702	1–5078	25 [24]	[24] 26	PP_16SB–[PP_r01]	PP_16SB,PP_23SB,[PP_r01]
*	*	÷	NC_002947	2038174	2038379	206	25 [24]	[24] 25	[rffE]	[rffE]

Unassigned new junction evidence
		seq id	position	reads (cov)	reads (cov)	score	skew	freq	annotation	gene	product
*	?	NC_002947	= 14514	58 (0.890)	3 (0.050)	3/250	NT	5.2%	coding (1185/2421 nt)	gyrB	DNA gyrase subunit B
	?	NC_002947	= 14535	55 (0.890)					coding (1206/2421 nt)	gyrB	DNA gyrase subunit B
*	?	NC_002947	21747 =	71 (1.090)	4 (0.070)	4/246	NT	5.7%	coding (1550/1917 nt)	PP_0016	hypothetical protein
	?	NC_002947	21788 =	66 (1.090)					coding (1591/1917 nt)	PP_0016	hypothetical protein
*	?	NC_002947	38445 =	55 (0.850)	5 (0.080)	4/252	NT	8.7%	coding (185/984 nt)	PP_0034	bactoprenol glycosyl‑transferase
	?	NC_002947	38482 =	52 (0.840)					coding (148/984 nt)	PP_0034	bactoprenol glycosyl‑transferase
*	?	NC_002947	= 69476	65 (1.000)	5 (0.080)	5/250	NT	6.6%	coding (371/528 nt)	gmhB	D‑glycero‑beta‑D‑manno‑heptose‑1,7‑bisphosphate 7‑phosphatase
	?	NC_002947	= 69511	80 (1.300)					coding (336/528 nt)	gmhB	D‑glycero‑beta‑D‑manno‑heptose‑1,7‑bisphosphate 7‑phosphatase
*	?	NC_002947	= 69752	73 (1.120)	4 (0.060)	4/250	NT	6.1%	coding (95/528 nt)	gmhB	D‑glycero‑beta‑D‑manno‑heptose‑1,7‑bisphosphate 7‑phosphatase
	?	NC_002947	= 69823	55 (0.890)					coding (24/528 nt)	gmhB	D‑glycero‑beta‑D‑manno‑heptose‑1,7‑bisphosphate 7‑phosphatase
*	?	NC_002947	= 77240	89 (1.370)	5 (0.080)	5/256	NT	5.4%	coding (304/1311 nt)	rsmB	ribosomal RNA small subunit methyltransferase B
	?	NC_002947	= 77271	88 (1.390)					coding (273/1311 nt)	rsmB	ribosomal RNA small subunit methyltransferase B
*	?	NC_002947	87921 =	65 (1.000)	4 (0.060)	4/258	NT	5.6%	coding (1397/1518 nt)	betC	choline‑sulfatase
	?	NC_002947	88027 =	71 (1.120)					coding (1291/1518 nt)	betC	choline‑sulfatase
*	?	NC_002947	102940 =	59 (0.910)	4 (0.070)	4/248	NT	6.5%	coding (1760/2052 nt)	prlC	oligopeptidase A
	?	NC_002947	103008 =	60 (0.980)					coding (1828/2052 nt)	prlC	oligopeptidase A
*	?	NC_002947	= 116151	79 (1.210)	4 (0.060)	4/252	NT	5.1%	coding (454/894 nt)	PP_0110	CyoE‑like protoheme IX farnesyltransferase
	?	NC_002947	= 116188	72 (1.160)					coding (491/894 nt)	PP_0110	CyoE‑like protoheme IX farnesyltransferase
*	?	NC_002947	= 149397	54 (0.830)	3 (0.050)	3/250	NT	5.5%	coding (423/792 nt)	PP_0141	ABC transporter ATP‑binding protein
	?	NC_002947	= 149444	52 (0.840)					coding (376/792 nt)	PP_0141	ABC transporter ATP‑binding protein
*	?	NC_002947	= 176399	NA (NA)	12 (0.190) +CGAAA	9/254	NT	16.1%	intergenic (+43/‑420)	PP_5SA/PP_16SB	5S ribosomal RNA/16S ribosomal RNA
	?	NC_002947	= 182013	65 (1.000)					intergenic (+2/+63)	PP_5SB/PP_0160	5S ribosomal RNA/ferrioxamine receptor
*	?	NC_002947	= 189705	78 (1.200)	4 (0.060)	4/254	NT	5.3%	coding (1814/1947 nt)	PP_0165	GGDEF domain‑containing protein
	?	NC_002947	= 189728	68 (1.090)					coding (1837/1947 nt)	PP_0165	GGDEF domain‑containing protein
*	?	NC_002947	= 198486	40 (0.610)	6 (0.100)	5/256	NT	15.0%	coding (3992/26049 nt)	PP_0168	putative surface adhesion protein
	?	NC_002947	= 199110	29 (0.460)					coding (4616/26049 nt)	PP_0168	putative surface adhesion protein
*	?	NC_002947	= 199465	70 (1.080)	5 (0.080)	3/252	NT	7.1%	coding (4971/26049 nt)	PP_0168	putative surface adhesion protein
	?	NC_002947	= 201400	64 (1.030)					coding (6906/26049 nt)	PP_0168	putative surface adhesion protein
*	?	NC_002947	205646 =	54 (0.830)	5 (0.080)	5/258	NT	8.7%	coding (11152/26049 nt)	PP_0168	putative surface adhesion protein
	?	NC_002947	209593 =	NA (NA)					coding (15099/26049 nt)	PP_0168	putative surface adhesion protein
*	?	NC_002947	= 230790	73 (1.120)	4 (0.070)	4/248	NT	5.3%	coding (451/1419 nt)	PP_0179	putative efflux transporter
	?	NC_002947	= 230851	75 (1.230)					coding (512/1419 nt)	PP_0179	putative efflux transporter
*	?	NC_002947	237212 =	73 (1.120)	5 (0.080)	4/248	NT	7.1%	coding (93/744 nt)	algR	alginate biosynthesis regulatory protein
	?	NC_002947	237246 =	63 (1.030)					coding (127/744 nt)	algR	alginate biosynthesis regulatory protein
*	?	NC_002947	= 244060	76 (1.170)	4 (0.070)	4/248	NT	5.2%	coding (111/663 nt)	fkl	FKBP‑type peptidyl‑prolyl cis‑trans isomerase
	?	NC_002947	= 244104	74 (1.210)					coding (67/663 nt)	fkl	FKBP‑type peptidyl‑prolyl cis‑trans isomerase
*	?	NC_002947	249203 =	60 (0.920)	5 (0.080)	5/252	NT	7.5%	coding (645/747 nt)	qmcA	membrane protease family protein
	?	NC_002947	249245 =	66 (1.060)					coding (603/747 nt)	qmcA	membrane protease family protein
*	?	NC_002947	= 262457	51 (0.780)	3 (0.050)	3/254	NT	5.6%	coding (939/966 nt)	PP_0210	phycobiliprotein
	?	NC_002947	= 262523	52 (0.830)					coding (40/282 nt)	PP_0211	hypothetical protein
*	?	NC_002947	= 276259	56 (0.860)	3 (0.050)	3/246	NT	5.2%	coding (909/1221 nt)	PP_0223	DszC family monooxygenase
	?	NC_002947	= 276281	57 (0.940)					coding (887/1221 nt)	PP_0223	DszC family monooxygenase
*	?	NC_002947	277706 =	61 (0.940)	4 (0.070)	4/246	NT	6.4%	coding (800/1242 nt)	PP_0224	DszC family monooxygenase
	?	NC_002947	277759 =	60 (0.990)					coding (747/1242 nt)	PP_0224	DszC family monooxygenase
*	?	NC_002947	= 316954	60 (0.920)	4 (0.060)	3/252	NT	6.5%	coding (977/1407 nt)	dctD‑I	C4‑dicarboxylate transport transcriptional regulator
	?	NC_002947	= 316978	57 (0.920)					coding (953/1407 nt)	dctD‑I	C4‑dicarboxylate transport transcriptional regulator
*	?	NC_002947	317963 =	59 (0.910)	5 (0.080)	5/258	NT	7.1%	coding (1779/1815 nt)	PP_0264	sensor histidine kinase
	?	NC_002947	318058 =	73 (1.150)					coding (1684/1815 nt)	PP_0264	sensor histidine kinase
*	?	NC_002947	325042 =	73 (1.120)	4 (0.060)	4/250	NT	5.2%	coding (328/1320 nt)	oprQ	outer‑membrane porin D
	?	NC_002947	325096 =	77 (1.250)					coding (382/1320 nt)	oprQ	outer‑membrane porin D
*	?	NC_002947	= 380855	15 (0.230)	3 (0.060)	3/218	NT	13.2%	intergenic (+45/+64)	gbcB/PP_0317	glycine‑betaine dioxygenase subunit/methyl‑accepting chemotaxis transducer
	?	NC_002947	= 380889	27 (0.500)					intergenic (+79/+30)	gbcB/PP_0317	glycine‑betaine dioxygenase subunit/methyl‑accepting chemotaxis transducer
*	?	NC_002947	400299 =	NA (NA)	4 (0.060)	4/256	NT	12.8%	intergenic (+34/‑116)	PP_0333/PP_0334	hypothetical protein/transposase
	?	NC_002947	400368 =	28 (0.430)					intergenic (+103/‑47)	PP_0333/PP_0334	hypothetical protein/transposase
*	?	NC_002947	431740 =	64 (0.980)	4 (0.060)	4/254	NT	6.2%	coding (574/1938 nt)	PP_0354	CBS domain‑containing protein
	?	NC_002947	431794 =	60 (0.960)					coding (520/1938 nt)	PP_0354	CBS domain‑containing protein
*	?	NC_002947	437647 =	57 (0.880)	3 (0.050)	3/248	NT	6.3%	coding (713/1008 nt)	rdoA	serine/threonine protein kinase
	?	NC_002947	437711 =	36 (0.590)					coding (649/1008 nt)	rdoA	serine/threonine protein kinase
*	?	NC_002947	478261 =	31 (0.480)	7 (0.140)	5/204	NT	31.9%	intergenic (+9/+101)	PP_0393/cca	2‑amino‑4‑hydroxy‑6‑ hydroxymethyldihydropteridine pyrophosphokinase/multifunctional tRNA nucleotidyltransferase/2',3'‑cyclic phosphodiesterase/2' nucleotidase/phosphatase
	?	NC_002947	478356 =	6 (0.120)					intergenic (+104/+6)	PP_0393/cca	2‑amino‑4‑hydroxy‑6‑ hydroxymethyldihydropteridine pyrophosphokinase/multifunctional tRNA nucleotidyltransferase/2',3'‑cyclic phosphodiesterase/2' nucleotidase/phosphatase
*	?	NC_002947	= 492829	57 (0.880)	3 (0.050)	3/252	NT	5.3%	coding (279/1020 nt)	PP_0405	hypothetical protein
	?	NC_002947	= 492862	52 (0.840)					coding (312/1020 nt)	PP_0405	hypothetical protein
*	?	NC_002947	= 497023	90 (1.380)	5 (0.080)	5/248	NT	5.3%	coding (895/2388 nt)	PP_0409	two‑component system sensor histidine kinase
	?	NC_002947	= 497096	93 (1.520)					coding (968/2388 nt)	PP_0409	two‑component system sensor histidine kinase
*	?	NC_002947	503484 =	89 (1.370)	4 (0.060)	4/252	NT	5.0%	coding (515/828 nt)	PP_0414	polyamine ABC transporter permease
	?	NC_002947	503527 =	67 (1.080)					coding (558/828 nt)	PP_0414	polyamine ABC transporter permease
*	?	NC_002947	505695 =	80 (1.230)	4 (0.060)	4/250	NT	5.1%	coding (189/1482 nt)	trpE	anthranilate synthase component 1
	?	NC_002947	505753 =	73 (1.190)					coding (247/1482 nt)	trpE	anthranilate synthase component 1
*	?	NC_002947	= 506909	58 (0.890)	5 (0.080)	5/248	NT	8.0%	coding (1403/1482 nt)	trpE	anthranilate synthase component 1
	?	NC_002947	= 506932	60 (0.980)					coding (1426/1482 nt)	trpE	anthranilate synthase component 1
*	?	NC_002947	= 548338	82 (1.260)	4 (0.070)	4/248	NT	5.2%	coding (1188/2148 nt)	fusA	elongation factor G 1
	?	NC_002947	= 548382	70 (1.150)					coding (1232/2148 nt)	fusA	elongation factor G 1
*	?	NC_002947	565405 =	60 (0.920)	4 (0.060)	4/256	NT	6.3%	coding (885/1440 nt)	katA	catalase
	?	NC_002947	565446 =	60 (0.950)					coding (926/1440 nt)	katA	catalase
*	?	NC_002947	= 568378	77 (1.180)	4 (0.060)	4/258	NT	5.2%	coding (1118/2835 nt)	uvrA	uvrABC excinuclease protein A
	?	NC_002947	= 568410	71 (1.120)					coding (1086/2835 nt)	uvrA	uvrABC excinuclease protein A
*	?	NC_002947	= 582183	65 (1.000)	4 (0.060)	3/258	NT	5.5%	coding (49/1923 nt)	selB	selenocysteyl‑tRNA‑specific translation elongation factor
	?	NC_002947	= 582217	75 (1.180)					coding (83/1923 nt)	selB	selenocysteyl‑tRNA‑specific translation elongation factor
*	?	NC_002947	594771 =	31 (0.480)	4 (0.070)	3/242	NT	7.2%	intergenic (‑10/+117)	PP_0505/PP_0506	hypothetical protein/ABC transporter permease
	?	NC_002947	594856 =	74 (1.240)					intergenic (‑95/+32)	PP_0505/PP_0506	hypothetical protein/ABC transporter permease
*	?	NC_002947	611927 =	NA (NA)	9 (0.150)	7/246	NT	NA	coding (824/966 nt)	PP_0526	transposase
	?	NC_002947	611970 =	NA (NA)					coding (867/966 nt)	PP_0526	transposase
*	?	NC_002947	615051 =	70 (1.080)	4 (0.060)	4/252	NT	5.8%	coding (196/888 nt)	ispA	farnesyl diphosphate synthase
	?	NC_002947	615099 =	64 (1.030)					coding (148/888 nt)	ispA	farnesyl diphosphate synthase
*	?	NC_002947	= 685159	76 (1.170)	4 (0.070)	3/248	NT	5.4%	coding (1088/2400 nt)	cadA‑II	cadmium translocating P‑type ATPase
	?	NC_002947	= 685252	70 (1.150)					coding (995/2400 nt)	cadA‑II	cadmium translocating P‑type ATPase
*	?	NC_002947	726896 =	36 (0.550)	4 (0.070)	4/236	NT	8.4%	intergenic (‑143/+124)	PP_0620/PP_0621	GntR family transcriptional regulator/hypothetical protein
	?	NC_002947	726983 =	55 (0.950)					intergenic (‑230/+37)	PP_0620/PP_0621	GntR family transcriptional regulator/hypothetical protein
*	?	NC_002947	= 741869	NA (NA)	8 (0.130)	5/252	NT	NA	intergenic (+469/‑31)	PP_t12/PP_0635	tRNA‑Thr/group II intron‑encoding maturase
	?	NC_002947	= 741902	NA (NA)					coding (3/1422 nt)	PP_0635	group II intron‑encoding maturase
*	?	NC_002947	742597 =	NA (NA)	5 (0.080)	4/258	NT	NA	coding (698/1422 nt)	PP_0635	group II intron‑encoding maturase
	?	NC_002947	742657 =	NA (NA)					coding (758/1422 nt)	PP_0635	group II intron‑encoding maturase
*	?	NC_002947	755172 =	67 (1.030)	3 (0.050)	3/244	NT	5.0%	intergenic (‑18/‑233)	PP_0645/PP_0646	hypothetical protein/hypothetical protein
	?	NC_002947	755232 =	51 (0.850)					intergenic (‑78/‑173)	PP_0645/PP_0646	hypothetical protein/hypothetical protein
*	?	NC_002947	783402 =	54 (0.830)	3 (0.050)	3/250	NT	5.5%	coding (2524/3831 nt)	PP_0672	sensory box protein
	?	NC_002947	783435 =	52 (0.840)					coding (2491/3831 nt)	PP_0672	sensory box protein
*	?	NC_002947	= 796840	81 (1.240)	4 (0.070)	4/232	NT	5.4%	intergenic (+42/‑148)	PP_0681/PP_0682	hypothetical protein/inner membrane protein
	?	NC_002947	= 796878	68 (1.190)					intergenic (+80/‑110)	PP_0681/PP_0682	hypothetical protein/inner membrane protein
*	?	NC_002947	877021 =	71 (1.090)	4 (0.070)	3/240	NT	5.9%	coding (138/999 nt)	rsmC	16S rRNA methyltransferase
	?	NC_002947	877102 =	63 (1.070)					coding (57/999 nt)	rsmC	16S rRNA methyltransferase
*	?	NC_002947	883223 =	61 (0.940)	5 (0.080)	5/252	NT	7.9%	coding (826/1365 nt)	PP_0766	hypothetical protein
	?	NC_002947	883266 =	58 (0.930)					coding (869/1365 nt)	PP_0766	hypothetical protein
*	?	NC_002947	= 896151	50 (0.770)	6 (0.100)	6/240	NT	10.0%	coding (264/1191 nt)	PP_0778	group 1 family glycosyl transferase
	?	NC_002947	= 896209	62 (1.050)					coding (206/1191 nt)	PP_0778	group 1 family glycosyl transferase
*	?	NC_002947	967850 =	77 (1.180)	4 (0.070)	4/234	NT	5.4%	intergenic (‑29/+139)	PP_0830/PP_0831	acetyltransferase/hypothetical protein
	?	NC_002947	967941 =	72 (1.250)					intergenic (‑120/+48)	PP_0830/PP_0831	acetyltransferase/hypothetical protein
*	?	NC_002947	977784 =	51 (0.780)	3 (0.050)	3/248	NT	5.3%	coding (736/786 nt)	cysE	serine acetyltransferase
	?	NC_002947	977853 =	60 (0.980)					intergenic (+19/‑161)	cysE/iscR	serine acetyltransferase/DNA‑binding transcriptional regulator IscR
*	?	NC_002947	982038 =	81 (1.240)	5 (0.080)	5/250	NT	7.1%	coding (915/1863 nt)	hscA	DnaK‑like molecular chaperone
	?	NC_002947	982093 =	55 (0.890)					coding (970/1863 nt)	hscA	DnaK‑like molecular chaperone
*	?	NC_002947	1021094 =	50 (0.770)	3 (0.050)	3/252	NT	5.7%	coding (893/1011 nt)	dppB	dipeptide ABC transporter permease
	?	NC_002947	1021134 =	52 (0.840)					coding (853/1011 nt)	dppB	dipeptide ABC transporter permease
*	?	NC_002947	1028604 =	74 (1.140)	5 (0.080)	5/252	NT	6.9%	coding (136/1626 nt)	dppA‑III	dipeptide ABC transporter substrate‑binding protein
	?	NC_002947	1028658 =	65 (1.050)					coding (82/1626 nt)	dppA‑III	dipeptide ABC transporter substrate‑binding protein
*	?	NC_002947	1055572 =	78 (1.200)	4 (0.060)	4/256	NT	5.3%	coding (260/1332 nt)	PP_0913	hypothetical protein
	?	NC_002947	1055610 =	67 (1.060)					coding (222/1332 nt)	PP_0913	hypothetical protein
*	?	NC_002947	1083135 =	47 (0.720)	3 (0.050)	3/248	NT	6.2%	coding (2790/3822 nt)	PP_0938	hypothetical protein
	?	NC_002947	1083175 =	46 (0.750)					coding (2830/3822 nt)	PP_0938	hypothetical protein
*	?	NC_002947	1114870 =	22 (0.340)	4 (0.080)	4/214	NT	19.6%	intergenic (‑64/+115)	rlmF/valS	ribosomal RNA large subunit methyltransferase F/valine‑‑tRNA ligase
	?	NC_002947	1114946 =	15 (0.280)					intergenic (‑140/+39)	rlmF/valS	ribosomal RNA large subunit methyltransferase F/valine‑‑tRNA ligase
*	?	NC_002947	1118321 =	77 (1.180)	5 (0.080)	4/254	NT	6.3%	coding (394/429 nt)	holC	DNA polymerase III subunit chi
	?	NC_002947	1118359 =	74 (1.180)					coding (356/429 nt)	holC	DNA polymerase III subunit chi
*	?	NC_002947	= 1125330	77 (1.180)	4 (0.060)	3/254	NT	5.2%	coding (1217/1377 nt)	tdcG‑II	L‑serine dehydratase
	?	NC_002947	= 1125398	72 (1.150)					coding (1149/1377 nt)	tdcG‑II	L‑serine dehydratase
*	?	NC_002947	1130825 =	82 (1.260)	5 (0.080)	5/250	NT	6.6%	coding (658/774 nt)	PP_0991	hypothetical protein
	?	NC_002947	1130861 =	63 (1.020)					coding (622/774 nt)	PP_0991	hypothetical protein
*	?	NC_002947	1141102 =	62 (0.950)	3 (0.050)	3/254	NT	5.1%	coding (1327/1428 nt)	arcD‑I	arginine/ornithine antiporter
	?	NC_002947	1141161 =	51 (0.810)					coding (1268/1428 nt)	arcD‑I	arginine/ornithine antiporter
*	?	NC_002947	= 1176199	74 (1.140)	6 (0.100)	5/252	NT	8.7%	coding (630/1470 nt)	guaB	IMP dehydrogenase and single strand DNA binding factor
	?	NC_002947	= 1176283	56 (0.900)					coding (714/1470 nt)	guaB	IMP dehydrogenase and single strand DNA binding factor
*	?	NC_002947	1189969 =	63 (0.970)	4 (0.060)	3/256	NT	5.7%	coding (132/291 nt)	tatB‑I	Sec‑independent protein translocase TatB
	?	NC_002947	1190047 =	72 (1.140)					coding (54/291 nt)	tatB‑I	Sec‑independent protein translocase TatB
*	?	NC_002947	= 1216282	54 (0.830)	5 (0.080)	5/244	NT	8.4%	coding (677/4305 nt)	PP_1061	ATP‑dependent DNA helicase
	?	NC_002947	= 1216314	59 (0.980)					coding (645/4305 nt)	PP_1061	ATP‑dependent DNA helicase
*	?	NC_002947	= 1234054	73 (1.120)	4 (0.060)	3/252	NT	5.2%	coding (1232/1500 nt)	glpK	glycerol kinase
	?	NC_002947	= 1234089	75 (1.210)					coding (1197/1500 nt)	glpK	glycerol kinase
*	?	NC_002947	= 1257367	61 (0.940)	5 (0.080)	5/248	NT	8.0%	intergenic (‑53/‑91)	PP_mr14/dcd	cspA regulatory region/deoxycytidine triphosphate deaminase
	?	NC_002947	= 1257394	57 (0.930)					intergenic (‑80/‑64)	PP_mr14/dcd	cspA regulatory region/deoxycytidine triphosphate deaminase
*	?	NC_002947	= 1257829	77 (1.180)	6 (0.100)	4/244	NT	7.4%	coding (372/567 nt)	dcd	deoxycytidine triphosphate deaminase
	?	NC_002947	= 1257855	78 (1.300)					coding (398/567 nt)	dcd	deoxycytidine triphosphate deaminase
*	?	NC_002947	1270104 =	72 (1.110)	4 (0.060)	4/252	NT	5.9%	coding (492/705 nt)	PP_1110	serine acetyltransferase
	?	NC_002947	1270147 =	58 (0.930)					coding (535/705 nt)	PP_1110	serine acetyltransferase
*	?	NC_002947	1288899 =	63 (0.970)	4 (0.060)	4/250	NT	6.1%	coding (172/2349 nt)	PP_1126	hydrolase
	?	NC_002947	1288937 =	63 (1.020)					coding (210/2349 nt)	PP_1126	hydrolase
*	?	NC_002947	1294685 =	98 (1.510)	8 (0.130)	8/250	NT	8.2%	coding (166/465 nt)	slyB	outer membrane lipoprotein
	?	NC_002947	1294721 =	87 (1.410)					coding (202/465 nt)	slyB	outer membrane lipoprotein
*	?	NC_002947	1296784 =	NA (NA)	8 (0.130)	5/250	NT	NA	intergenic (‑537/‑29)	nhaA‑I/PP_1133	Na(+)/H(+) antiporter NhaA/transposase
	?	NC_002947	1296822 =	NA (NA)					coding (10/1329 nt)	PP_1133	transposase
*	?	NC_002947	= 1296790	NA (NA)	4 (0.060)	3/250	NT	NA	intergenic (‑543/‑23)	nhaA‑I/PP_1133	Na(+)/H(+) antiporter NhaA/transposase
	?	NC_002947	= 1296814	NA (NA)					coding (2/1329 nt)	PP_1133	transposase
*	?	NC_002947	= 1298264	NA (NA)	6 (0.090)	5/258	NT	NA	intergenic (+123/+306)	PP_1133/PP_1134	transposase/hypothetical protein
	?	NC_002947	= 1298312	NA (NA)					intergenic (+171/+258)	PP_1133/PP_1134	transposase/hypothetical protein
*	?	NC_002947	1298266 =	NA (NA)	7 (0.110)	5/256	NT	NA	intergenic (+125/+304)	PP_1133/PP_1134	transposase/hypothetical protein
	?	NC_002947	1298312 =	NA (NA)					intergenic (+171/+258)	PP_1133/PP_1134	transposase/hypothetical protein
*	?	NC_002947	= 1311776	52 (0.800)	4 (0.070)	3/246	NT	9.6%	intergenic (‑244/+34)	PP_1144/rapA	membrane protein/RNA polymerase‑associated protein RapA
	?	NC_002947	5594166 =	27 (0.450)					intergenic (‑113/+32)	PP_4921/thiC	NCS1 family transporter/phosphomethylpyrimidine synthase
*	?	NC_002947	1324755 =	48 (0.740)	4 (0.060)	3/252	NT	7.2%	coding (276/897 nt)	yfdC	inner membrane protein
	?	NC_002947	1324815 =	57 (0.920)					coding (216/897 nt)	yfdC	inner membrane protein
*	?	NC_002947	= 1331705	NA (NA)	3 (0.050)	3/254	NT	NA	coding (930/1644 nt)	PP_1157	acetolactate synthase
	?	NC_002947	= 1331731	NA (NA)					coding (956/1644 nt)	PP_1157	acetolactate synthase
*	?	NC_002947	= 1346121	73 (1.120)	5 (0.080)	4/250	NT	6.8%	coding (772/807 nt)	udh	uronate dehydrogenase
	?	NC_002947	= 1346145	69 (1.120)					coding (748/807 nt)	udh	uronate dehydrogenase
*	?	NC_002947	1393111 =	71 (1.090)	4 (0.060)	4/254	NT	5.5%	coding (96/525 nt)	ruvC	crossover junction endodeoxyribonuclease RuvC
	?	NC_002947	1393154 =	70 (1.120)					coding (139/525 nt)	ruvC	crossover junction endodeoxyribonuclease RuvC
*	?	NC_002947	= 1408145	43 (0.660)	4 (0.060)	4/254	NT	7.4%	coding (598/1509 nt)	PP_1230	hypothetical protein
	?	NC_002947	= 1408184	59 (0.940)					coding (637/1509 nt)	PP_1230	hypothetical protein
*	?	NC_002947	1411391 =	71 (1.090)	4 (0.060)	3/250	NT	6.2%	coding (544/1437 nt)	PP_1232	hypothetical protein
	?	NC_002947	1411454 =	53 (0.860)					coding (481/1437 nt)	PP_1232	hypothetical protein
*	?	NC_002947	1419549 =	41 (0.630)	7 (0.140)	6/206	NT	27.5%	intergenic (‑38/+98)	PP_1242/PP_1244	hypothetical protein/hypothetical protein
	?	NC_002947	1419637 =	5 (0.100)					intergenic (‑126/+10)	PP_1242/PP_1244	hypothetical protein/hypothetical protein
*	?	NC_002947	= 1420319	58 (0.890)	4 (0.060)	3/250	NT	6.4%	intergenic (‑279/‑202)	PP_mr17/PP_1245	C4 ncRNA/hypothetical protein
	?	NC_002947	= 1420345	62 (1.010)					intergenic (‑305/‑176)	PP_mr17/PP_1245	C4 ncRNA/hypothetical protein
*	?	NC_002947	= 1421526	60 (0.920)	8 (0.130)	8/250	NT	11.4%	coding (107/1860 nt)	PP_1246	hypothetical protein
	?	NC_002947	= 1421564	67 (1.090)					coding (145/1860 nt)	PP_1246	hypothetical protein
*	?	NC_002947	= 1427107	NA (NA)	12 (0.190)	6/252	NT	NA	coding (1005/1422 nt)	PP_1250	group II intron‑encoding maturase
	?	NC_002947	= 1427157	NA (NA)					coding (1055/1422 nt)	PP_1250	group II intron‑encoding maturase
*	?	NC_002947	= 1433243	55 (0.850)	5 (0.080)	5/250	NT	7.9%	coding (1141/1248 nt)	PP_1255	cis‑4‑hydroxy‑D‑proline oxidase
	?	NC_002947	= 1433258	65 (1.060)					coding (1126/1248 nt)	PP_1255	cis‑4‑hydroxy‑D‑proline oxidase
*	?	NC_002947	1445018 =	74 (1.140)	4 (0.060)	4/252	NT	5.2%	coding (642/1530 nt)	PP_1263	fusaric acid resistance protein
	?	NC_002947	1445074 =	76 (1.220)					coding (698/1530 nt)	PP_1263	fusaric acid resistance protein
*	?	NC_002947	1448517 =	80 (1.230)	5 (0.080)	4/256	NT	6.2%	coding (237/861 nt)	PP_1266	fusaric acid resistance protein
	?	NC_002947	1448572 =	74 (1.170)					coding (292/861 nt)	PP_1266	fusaric acid resistance protein
*	?	NC_002947	= 1453168	72 (1.110)	4 (0.070)	3/248	NT	6.2%	coding (1330/1542 nt)	PP_1271	putative Multidrug efflux MFS transporter
	?	NC_002947	= 1453262	53 (0.870)					coding (1424/1542 nt)	PP_1271	putative Multidrug efflux MFS transporter
*	?	NC_002947	1487006 =	26 (0.400)	8 (0.160)	7/204	NT	36.3%	intergenic (+22/+108)	yhdZ/degS	amino acid ABC transporter ATP‑binding protein/serine endoprotease DegS
	?	NC_002947	1487096 =	8 (0.160)					intergenic (+112/+18)	yhdZ/degS	amino acid ABC transporter ATP‑binding protein/serine endoprotease DegS
*	?	NC_002947	= 1531769	6 (0.090)	3 (0.060)	3/216	NT	22.3%	coding (107/630 nt)	PP_1344	hypothetical protein
	?	NC_002947	= 1531817	16 (0.300)					coding (59/630 nt)	PP_1344	hypothetical protein
*	?	NC_002947	= 1587492	75 (1.150)	5 (0.080)	4/256	NT	6.3%	intergenic (‑87/‑97)	PP_1391/PP_1392	LysR family transcriptional regulator/NAD‑binding protein
	?	NC_002947	= 1587553	76 (1.200)					intergenic (‑148/‑36)	PP_1391/PP_1392	LysR family transcriptional regulator/NAD‑binding protein
*	?	NC_002947	1587794 =	55 (0.850)	6 (0.100)	6/256	NT	9.5%	coding (206/615 nt)	PP_1392	NAD‑binding protein
	?	NC_002947	1587826 =	61 (0.970)					coding (238/615 nt)	PP_1392	NAD‑binding protein
*	?	NC_002947	= 1603427	62 (0.950)	4 (0.060)	4/250	NT	5.7%	coding (985/1011 nt)	PP_1406	hypothetical protein
	?	NC_002947	= 1603463	73 (1.190)					coding (949/1011 nt)	PP_1406	hypothetical protein
*	?	NC_002947	1607679 =	58 (0.890)	4 (0.060)	4/250	NT	7.0%	intergenic (‑146/+198)	PP_1408/rsuA	(R)‑3‑hydroxydecanoyl‑ACP:CoA transacylase/16S rRNA pseudouridine(516) synthase
	?	NC_002947	1607722 =	51 (0.830)					intergenic (‑189/+155)	PP_1408/rsuA	(R)‑3‑hydroxydecanoyl‑ACP:CoA transacylase/16S rRNA pseudouridine(516) synthase
*	?	NC_002947	= 1635920	68 (1.040)	4 (0.060)	3/250	NT	5.5%	coding (97/684 nt)	recO	DNA repair protein RecO
	?	NC_002947	= 1635965	73 (1.190)					coding (142/684 nt)	recO	DNA repair protein RecO
*	?	NC_002947	= 1641737	60 (0.920)	4 (0.060)	3/252	NT	6.7%	intergenic (‑47/+43)	cmoA/PP_1442	tRNA 5‑methoxyuridine(34)/uridine‑5‑oxyacetic acid(34) metyltransferase CmoA/hypothetical protein
	?	NC_002947	= 1641757	54 (0.870)					intergenic (‑67/+23)	cmoA/PP_1442	tRNA 5‑methoxyuridine(34)/uridine‑5‑oxyacetic acid(34) metyltransferase CmoA/hypothetical protein
*	?	NC_002947	1657908 =	63 (0.970)	3 (0.050)	3/248	NT	5.3%	coding (586/1698 nt)	PP_1450	TPS family activation/secretion protein
	?	NC_002947	1657960 =	47 (0.770)					coding (534/1698 nt)	PP_1450	TPS family activation/secretion protein
*	?	NC_002947	1659485 =	71 (1.090)	5 (0.080)	5/254	NT	6.6%	coding (283/552 nt)	PP_1452	MutT/nudix family protein
	?	NC_002947	1659535 =	74 (1.180)					coding (233/552 nt)	PP_1452	MutT/nudix family protein
*	?	NC_002947	1661709 =	82 (1.260)	5 (0.080)	4/250	NT	6.4%	coding (381/468 nt)	PP_1456	membrane protein
	?	NC_002947	1661749 =	69 (1.120)					coding (421/468 nt)	PP_1456	membrane protein
*	?	NC_002947	1693906 =	63 (0.970)	4 (0.070)	4/248	NT	6.8%	coding (375/507 nt)	PP_1489	CheW domain‑containing protein
	?	NC_002947	1693965 =	51 (0.830)					coding (434/507 nt)	PP_1489	CheW domain‑containing protein
*	?	NC_002947	1725387 =	50 (0.770)	5 (0.080)	5/256	NT	9.9%	coding (214/399 nt)	PP_1519	lipoprotein
	?	NC_002947	1725428 =	43 (0.680)					coding (173/399 nt)	PP_1519	lipoprotein
*	?	NC_002947	1727918 =	67 (1.030)	4 (0.060)	4/252	NT	6.4%	coding (246/2487 nt)	plsB	glycerol‑3‑phosphate acyltransferase
	?	NC_002947	1727976 =	53 (0.850)					coding (188/2487 nt)	plsB	glycerol‑3‑phosphate acyltransferase
*	?	NC_002947	1731163 =	22 (0.340)	5 (0.100)	5/208	NT	21.1%	intergenic (‑76/+115)	dapE/PP_1526	succinyl‑diaminopimelate desuccinylase/beta‑(1‑3)‑glucosyl transferase
	?	NC_002947	1731255 =	20 (0.390)					intergenic (‑168/+23)	dapE/PP_1526	succinyl‑diaminopimelate desuccinylase/beta‑(1‑3)‑glucosyl transferase
*	?	NC_002947	= 1732096	60 (0.920)	3 (0.050)	3/248	NT	5.1%	coding (1774/2592 nt)	PP_1526	beta‑(1‑3)‑glucosyl transferase
	?	NC_002947	= 1732123	56 (0.920)					coding (1747/2592 nt)	PP_1526	beta‑(1‑3)‑glucosyl transferase
*	?	NC_002947	= 1748694	52 (0.800)	4 (0.060)	3/252	NT	7.3%	intergenic (‑27/‑305)	PP_1548/PP_5744	hypothetical protein/hypothetical protein
	?	NC_002947	= 1748725	52 (0.840)					intergenic (‑58/‑274)	PP_1548/PP_5744	hypothetical protein/hypothetical protein
*	?	NC_002947	= 1762550	92 (1.410)	6 (0.100)	3/254	NT	6.6%	coding (184/477 nt)	PP_1569	hypothetical protein
	?	NC_002947	= 1762579	82 (1.310)					coding (213/477 nt)	PP_1569	hypothetical protein
*	?	NC_002947	= 1776725	57 (0.880)	6 (0.100)	5/248	NT	9.2%	coding (328/501 nt)	PP_1584	hypothetical protein
	?	NC_002947	= 1776759	65 (1.060)					coding (362/501 nt)	PP_1584	hypothetical protein
*	?	NC_002947	1780555 =	77 (1.180)	6 (0.100)	4/252	NT	7.5%	coding (789/1197 nt)	dapC	N‑succinyl‑L,L‑diaminopimelate aminotransferase
	?	NC_002947	1780593 =	74 (1.190)					coding (751/1197 nt)	dapC	N‑succinyl‑L,L‑diaminopimelate aminotransferase
*	?	NC_002947	1785193 =	57 (0.880)	4 (0.070)	4/248	NT	6.6%	noncoding (72/100 nt)	PP_mr21	t44 ncRNA
	?	NC_002947	1785229 =	59 (0.970)					intergenic (+8/‑18)	PP_mr21/rpsB	t44 ncRNA/30S ribosomal protein S2
*	?	NC_002947	1799851 =	29 (0.450)	6 (0.110)	5/218	NT	25.6%	intergenic (+21/‑166)	rnhB/dnaEA	ribonuclease HII/DNA polymerase III subunit alpha
	?	NC_002947	1799939 =	11 (0.210)					intergenic (+109/‑78)	rnhB/dnaEA	ribonuclease HII/DNA polymerase III subunit alpha
*	?	NC_002947	1812849 =	57 (0.880)	6 (0.090)	6/258	NT	9.7%	coding (328/1116 nt)	frmA	glutathione‑dependent formaldehyde dehydrogenase
	?	NC_002947	1812891 =	56 (0.880)					coding (370/1116 nt)	frmA	glutathione‑dependent formaldehyde dehydrogenase
*	?	NC_002947	1824128 =	74 (1.140)	5 (0.080)	4/252	NT	6.8%	coding (1126/2574 nt)	mutS	DNA mismatch repair protein MutS
	?	NC_002947	1824165 =	67 (1.080)					coding (1089/2574 nt)	mutS	DNA mismatch repair protein MutS
*	?	NC_002947	= 1837775	60 (0.920)	4 (0.070)	4/248	NT	6.2%	coding (394/672 nt)	PP_1642	hypothetical protein
	?	NC_002947	= 1837804	65 (1.060)					coding (423/672 nt)	PP_1642	hypothetical protein
*	?	NC_002947	= 1868194	48 (0.740)	4 (0.060)	4/254	NT	7.2%	coding (308/1296 nt)	cobB	cobyrinate a,c‑diamide synthase
	?	NC_002947	= 1868243	57 (0.910)					coding (357/1296 nt)	cobB	cobyrinate a,c‑diamide synthase
*	?	NC_002947	1868402 =	60 (0.920)	3 (0.050)	3/248	NT	5.2%	coding (516/1296 nt)	cobB	cobyrinate a,c‑diamide synthase
	?	NC_002947	1868447 =	54 (0.880)					coding (561/1296 nt)	cobB	cobyrinate a,c‑diamide synthase
*	?	NC_002947	= 1932033	69 (1.060)	4 (0.060)	4/254	NT	5.5%	coding (501/636 nt)	rluA	bifunctional tRNA pseudouridine(32) synthase TrmQ/ribosomal large subunit pseudouridine synthase RluA
	?	NC_002947	= 1932067	72 (1.150)					coding (467/636 nt)	rluA	bifunctional tRNA pseudouridine(32) synthase TrmQ/ribosomal large subunit pseudouridine synthase RluA
*	?	NC_002947	= 1940495	73 (1.120)	4 (0.070)	4/248	NT	5.1%	coding (782/1578 nt)	PP_1740	beta (1‑6) glucans synthase
	?	NC_002947	= 1940529	81 (1.330)					coding (748/1578 nt)	PP_1740	beta (1‑6) glucans synthase
*	?	NC_002947	1974528 =	52 (0.800)	4 (0.060)	4/252	NT	8.0%	coding (538/1086 nt)	serC	3‑phosphoserine/phosphohydroxythreonine aminotransferase
	?	NC_002947	1974623 =	43 (0.690)					coding (633/1086 nt)	serC	3‑phosphoserine/phosphohydroxythreonine aminotransferase
*	?	NC_002947	= 1975504	50 (0.770)	3 (0.050)	3/250	NT	6.0%	coding (436/1104 nt)	pheA	bifunctional chorismate mutase/prephenate dehydratase
	?	NC_002947	= 1975538	46 (0.750)					coding (470/1104 nt)	pheA	bifunctional chorismate mutase/prephenate dehydratase
*	?	NC_002947	2012318 =	50 (0.770)	6 (0.100)	4/254	NT	10.6%	coding (1704/2589 nt)	PP_1793	group 2 family glycosyl transferase
	?	NC_002947	2012373 =	53 (0.850)					coding (1649/2589 nt)	PP_1793	group 2 family glycosyl transferase
*	?	NC_002947	2020198 =	46 (0.710)	4 (0.060)	4/252	NT	8.7%	coding (151/1416 nt)	PP_1798	outer membrane efflux protein
	?	NC_002947	2020246 =	40 (0.640)					coding (199/1416 nt)	PP_1798	outer membrane efflux protein
*	?	NC_002947	2046394 =	63 (0.970)	4 (0.070)	4/248	NT	6.6%	coding (1608/1941 nt)	PP_1819	methyl‑accepting chemotaxis transducer
	?	NC_002947	2046467 =	54 (0.880)					coding (1681/1941 nt)	PP_1819	methyl‑accepting chemotaxis transducer
*	?	NC_002947	2048794 =	55 (0.850)	4 (0.070)	4/230	NT	8.7%	intergenic (+33/+106)	PP_1821/PP_1822	glutathione S‑transferase family protein/hypothetical protein
	?	NC_002947	2048885 =	36 (0.640)					intergenic (+124/+15)	PP_1821/PP_1822	glutathione S‑transferase family protein/hypothetical protein
*	?	NC_002947	= 2083276	37 (0.570)	7 (0.120)	7/242	NT	15.4%	intergenic (‑43/‑71)	PP_1861/PP_1862	LysR family transcriptional regulator/membrane protein
	?	NC_002947	= 2083292	43 (0.720)					intergenic (‑59/‑55)	PP_1861/PP_1862	LysR family transcriptional regulator/membrane protein
*	?	NC_002947	= 2084301	53 (0.810)	3 (0.050)	3/250	NT	5.8%	coding (676/852 nt)	PP_1863	LysR family transcriptional regulator
	?	NC_002947	= 2084335	47 (0.760)					coding (642/852 nt)	PP_1863	LysR family transcriptional regulator
*	?	NC_002947	2090572 =	78 (1.200)	4 (0.060)	4/252	NT	5.7%	intergenic (+249/‑103)	PP_1867/deaD	hypothetical protein/ATP‑dependent DEAD‑box RNA helicase DeaD
	?	NC_002947	2090654 =	59 (0.950)					intergenic (+331/‑21)	PP_1867/deaD	hypothetical protein/ATP‑dependent DEAD‑box RNA helicase DeaD
*	?	NC_002947	= 2099957	20 (0.310)	8 (0.130)	4/244	NT	26.0%	intergenic (‑68/‑137)	PP_1875/PP_1876	two‑component system sensor histidine kinase/response regulator/AAA family ATP/GTP‑binding protein
	?	NC_002947	= 2100056	27 (0.450)					intergenic (‑167/‑38)	PP_1875/PP_1876	two‑component system sensor histidine kinase/response regulator/AAA family ATP/GTP‑binding protein
*	?	NC_002947	2134148 =	68 (1.040)	4 (0.060)	4/250	NT	5.8%	coding (87/411 nt)	PP_1892	hypothetical protein
	?	NC_002947	2134211 =	66 (1.070)					coding (24/411 nt)	PP_1892	hypothetical protein
*	?	NC_002947	2158339 =	78 (1.200)	6 (0.100)	6/254	NT	8.1%	coding (689/741 nt)	fabG	3‑oxoacyl‑ACP reductase subunit
	?	NC_002947	2158379 =	62 (0.990)					coding (729/741 nt)	fabG	3‑oxoacyl‑ACP reductase subunit
*	?	NC_002947	= 2229008	63 (0.970)	4 (0.070)	4/246	NT	6.7%	coding (144/783 nt)	ycfH	tRNA D‑aminoacylase
	?	NC_002947	= 2229057	53 (0.870)					coding (193/783 nt)	ycfH	tRNA D‑aminoacylase
*	?	NC_002947	= 2235551	55 (0.850)	5 (0.080)	5/258	NT	7.7%	coding (662/2016 nt)	uvrB	uvrABC excinuclease protein B
	?	NC_002947	= 2235589	66 (1.040)					coding (700/2016 nt)	uvrB	uvrABC excinuclease protein B
*	?	NC_002947	= 2236934	31 (0.480)	9 (0.160)	9/232	NT	26.0%	intergenic (+29/+99)	uvrB/PP_1975	uvrABC excinuclease protein B/EmrB/QacA family drug resistance transporter
	?	NC_002947	= 2236993	24 (0.420)					intergenic (+88/+40)	uvrB/PP_1975	uvrABC excinuclease protein B/EmrB/QacA family drug resistance transporter
*	?	NC_002947	2248955 =	57 (0.880)	4 (0.060)	3/250	NT	6.1%	coding (644/3297 nt)	PP_1983	PAS/PAC/GAF sensor‑containing diguanylate cyclase/phosphodiesterase
	?	NC_002947	2249028 =	70 (1.140)					coding (571/3297 nt)	PP_1983	PAS/PAC/GAF sensor‑containing diguanylate cyclase/phosphodiesterase
*	?	NC_002947	= 2249427	79 (1.210)	4 (0.070)	4/244	NT	5.3%	coding (172/3297 nt)	PP_1983	PAS/PAC/GAF sensor‑containing diguanylate cyclase/phosphodiesterase
	?	NC_002947	= 2249469	69 (1.150)					coding (130/3297 nt)	PP_1983	PAS/PAC/GAF sensor‑containing diguanylate cyclase/phosphodiesterase
*	?	NC_002947	= 2258059	NA (NA)	9 (0.150)	7/248	NT	24.8%	intergenic (+114/‑278)	PP_1990/asd	transposase/aspartate‑semialdehyde dehydrogenase
	?	NC_002947	= 2258152	29 (0.450)					intergenic (+207/‑185)	PP_1990/asd	transposase/aspartate‑semialdehyde dehydrogenase
*	?	NC_002947	2260519 =	47 (0.720)	3 (0.050)	3/246	NT	5.7%	coding (1107/2736 nt)	fimV	motility protein FimV
	?	NC_002947	2260618 =	56 (0.920)					coding (1206/2736 nt)	fimV	motility protein FimV
*	?	NC_002947	= 2265714	60 (0.920)	5 (0.080)	5/254	NT	7.3%	coding (774/1311 nt)	folC	bifunctional folypolyglutamate synthase/dihydrofolate synthase
	?	NC_002947	= 2265748	69 (1.100)					coding (808/1311 nt)	folC	bifunctional folypolyglutamate synthase/dihydrofolate synthase
*	?	NC_002947	= 2269992	36 (0.550)	3 (0.050)	3/248	NT	7.4%	coding (795/1212 nt)	metZ	O‑succinylhomoserine sulfhydrylase
	?	NC_002947	= 2270034	41 (0.670)					coding (837/1212 nt)	metZ	O‑succinylhomoserine sulfhydrylase
*	?	NC_002947	2290876 =	65 (1.000)	6 (0.100)	5/254	NT	8.8%	coding (227/960 nt)	PP_2018	BNR domain‑containing protein
	?	NC_002947	2290934 =	62 (0.990)					coding (285/960 nt)	PP_2018	BNR domain‑containing protein
*	?	NC_002947	= 2295510	58 (0.890)	4 (0.060)	4/254	NT	6.3%	intergenic (+55/‑68)	ppgL/PP_5496	L‑alpha‑hydroxyglutaric acid gamma‑lactonase/hypothetical protein
	?	NC_002947	= 2295563	64 (1.020)					intergenic (+108/‑15)	ppgL/PP_5496	L‑alpha‑hydroxyglutaric acid gamma‑lactonase/hypothetical protein
*	?	NC_002947	2295836 =	52 (0.800)	6 (0.100)	5/248	NT	10.4%	intergenic (+82/+51)	PP_5496/PP_2023	hypothetical protein/glutathione S‑transferase family protein
	?	NC_002947	4282152 =	55 (0.900)					coding (1078/1089 nt)	PP_3753	AraC family transcriptional regulator
*	?	NC_002947	2301453 =	0 (0.000)	64 (1.010)	52/258	NT	100%	intergenic (‑97/‑234)	sbcD/PP_5497	exonuclease subunit SbcD/rhs repeat‑associated core domain‑containing protein
	?	NC_002947	2925429 =	NA (NA)					intergenic (‑177/+388)	PP_2563/PP_2564	antibiotic biosynthesis protein/quercetin 2,3‑dioxygenase
*	?	NC_002947	= 2301454	0 (0.000)	51 (0.800)	38/260	NT	100%	intergenic (‑98/‑233)	sbcD/PP_5497	exonuclease subunit SbcD/rhs repeat‑associated core domain‑containing protein
	?	NC_002947	5545321 =	NA (NA)					intergenic (‑461/+416)	rpsF/rlmB	30S ribosomal protein S6/23S rRNA (guanosine(2251)‑2'‑O)‑methyltransferase RlmB
*	?	NC_002947	= 2331608	64 (0.980)	4 (0.060)	4/254	NT	6.0%	coding (152/1164 nt)	PP_2049	alcohol dehydrogenase
	?	NC_002947	= 2331631	63 (1.010)					coding (175/1164 nt)	PP_2049	alcohol dehydrogenase
*	?	NC_002947	2335275 =	65 (1.000)	4 (0.070)	4/248	NT	6.5%	coding (1182/2124 nt)	PP_2052	bifunctional sugar‑phosphatase/mannitol‑1‑phosphate 5‑dehydrogenase
	?	NC_002947	2335366 =	54 (0.880)					coding (1091/2124 nt)	PP_2052	bifunctional sugar‑phosphatase/mannitol‑1‑phosphate 5‑dehydrogenase
*	?	NC_002947	2354027 =	47 (0.720)	4 (0.060)	4/250	NT	8.2%	coding (505/1278 nt)	PP_2068	multidrug MFS transporter membrane fusion protein
	?	NC_002947	2354077 =	45 (0.730)					coding (455/1278 nt)	PP_2068	multidrug MFS transporter membrane fusion protein
*	?	NC_002947	= 2357793	49 (0.750)	5 (0.080)	5/250	NT	8.9%	coding (518/825 nt)	PP_2072	AraC family transcriptional regulator
	?	NC_002947	= 2357821	56 (0.910)					coding (490/825 nt)	PP_2072	AraC family transcriptional regulator
*	?	NC_002947	2363970 =	61 (0.940)	5 (0.080)	4/248	NT	8.5%	intergenic (‑94/+239)	PP_2076/lysA‑I	hypothetical protein/diaminopimelate decarboxylase
	?	NC_002947	2364009 =	50 (0.820)					intergenic (‑133/+200)	PP_2076/lysA‑I	hypothetical protein/diaminopimelate decarboxylase
*	?	NC_002947	2369957 =	74 (1.140)	4 (0.070)	4/246	NT	6.0%	coding (2775/4866 nt)	gdhB	NAD‑specific glutamate dehydrogenase
	?	NC_002947	2370004 =	56 (0.920)					coding (2822/4866 nt)	gdhB	NAD‑specific glutamate dehydrogenase
*	?	NC_002947	= 2370297	80 (1.230)	4 (0.060)	4/254	NT	5.3%	coding (3115/4866 nt)	gdhB	NAD‑specific glutamate dehydrogenase
	?	NC_002947	= 2370339	67 (1.070)					coding (3157/4866 nt)	gdhB	NAD‑specific glutamate dehydrogenase
*	?	NC_002947	= 2396665	44 (0.680)	3 (0.050)	3/252	NT	6.3%	coding (2992/3636 nt)	PP_2100	two‑component system sensor protein
	?	NC_002947	= 2396687	48 (0.770)					coding (2970/3636 nt)	PP_2100	two‑component system sensor protein
*	?	NC_002947	2403799 =	44 (0.680)	4 (0.070)	4/244	NT	8.3%	coding (426/1209 nt)	PP_2106	ammonium transporter
	?	NC_002947	2403860 =	48 (0.800)					coding (487/1209 nt)	PP_2106	ammonium transporter
*	?	NC_002947	= 2412070	47 (0.720)	4 (0.070)	3/246	NT	7.3%	coding (399/1065 nt)	rlmM	23S rRNA (cytidine(2498)‑2'‑O)‑methyltransferase RlmM
	?	NC_002947	= 2412116	58 (0.960)					coding (445/1065 nt)	rlmM	23S rRNA (cytidine(2498)‑2'‑O)‑methyltransferase RlmM
*	?	NC_002947	2417879 =	60 (0.920)	4 (0.060)	4/254	NT	6.9%	coding (914/1764 nt)	PP_2119	ABC transporter permease/ATP‑binding protein
	?	NC_002947	2417925 =	51 (0.810)					coding (960/1764 nt)	PP_2119	ABC transporter permease/ATP‑binding protein
*	?	NC_002947	= 2449404	57 (0.880)	3 (0.050)	3/248	NT	5.6%	coding (1679/3318 nt)	PP_2146	SNF2/RAD54 family helicase
	?	NC_002947	= 2449438	48 (0.790)					coding (1645/3318 nt)	PP_2146	SNF2/RAD54 family helicase
*	?	NC_002947	= 2472140	21 (0.320)	7 (0.150)	5/186	NT	25.1%	intergenic (+44/+105)	PP_2166/PP_2167	anti‑anti‑sigma factor/PhoD‑like phosphatase
	?	NC_002947	= 2472186	27 (0.590)					intergenic (+90/+59)	PP_2166/PP_2167	anti‑anti‑sigma factor/PhoD‑like phosphatase
*	?	NC_002947	2492920 =	56 (0.860)	3 (0.050)	3/254	NT	5.9%	coding (2343/2883 nt)	PP_2185	formate dehydrogenase subunit alpha
	?	NC_002947	2492955 =	42 (0.670)					coding (2378/2883 nt)	PP_2185	formate dehydrogenase subunit alpha
*	?	NC_002947	2510081 =	71 (1.090)	4 (0.060)	4/256	NT	5.9%	coding (1650/1725 nt)	copA‑I	copper resistance protein A
	?	NC_002947	2510127 =	58 (0.920)					coding (1604/1725 nt)	copA‑I	copper resistance protein A
*	?	NC_002947	= 2521191	62 (0.950)	4 (0.070)	4/246	NT	6.4%	coding (2442/4446 nt)	PP_2212	leucine‑rich repeat‑containing protein
	?	NC_002947	= 2521226	59 (0.970)					coding (2477/4446 nt)	PP_2212	leucine‑rich repeat‑containing protein
*	?	NC_002947	= 2534391	58 (0.890)	4 (0.060)	4/250	NT	6.0%	coding (1392/1680 nt)	mrpD	K(+)/H(+) antiporter subunit D
	?	NC_002947	= 2534468	70 (1.140)					coding (1315/1680 nt)	mrpD	K(+)/H(+) antiporter subunit D
*	?	NC_002947	= 2558475	64 (0.980)	4 (0.060)	3/252	NT	6.3%	coding (735/2235 nt)	fepA	ferric enterobactin transport system outer membrane subunit
	?	NC_002947	= 2558511	57 (0.920)					coding (771/2235 nt)	fepA	ferric enterobactin transport system outer membrane subunit
*	?	NC_002947	= 2560802	56 (0.860)	3 (0.050)	3/250	NT	5.5%	coding (629/786 nt)	PP_2244	TauE‑like transmembrane protein
	?	NC_002947	= 2560846	50 (0.810)					coding (585/786 nt)	PP_2244	TauE‑like transmembrane protein
*	?	NC_002947	2562661 =	72 (1.110)	4 (0.060)	4/252	NT	5.5%	coding (399/1137 nt)	dauA	FAD‑dependent catabolic D‑arginine dehydrogenase
	?	NC_002947	2562688 =	68 (1.100)					coding (426/1137 nt)	dauA	FAD‑dependent catabolic D‑arginine dehydrogenase
*	?	NC_002947	= 2634122	43 (0.660)	4 (0.060)	4/254	NT	8.4%	coding (584/1872 nt)	PP_2304	peptidyl‑prolyl cis‑trans isomerase D
	?	NC_002947	= 2634150	46 (0.730)					coding (612/1872 nt)	PP_2304	peptidyl‑prolyl cis‑trans isomerase D
*	?	NC_002947	2646103 =	56 (0.860)	5 (0.080)	3/248	NT	8.8%	coding (1211/2499 nt)	PP_2316	ABC transporter permease
	?	NC_002947	2646141 =	51 (0.830)					coding (1173/2499 nt)	PP_2316	ABC transporter permease
*	?	NC_002947	2665181 =	53 (0.810)	3 (0.050)	3/250	NT	6.2%	coding (1044/2589 nt)	acnA‑II	aconitate hydratase
	?	NC_002947	2665218 =	41 (0.670)					coding (1081/2589 nt)	acnA‑II	aconitate hydratase
*	?	NC_002947	= 2692656	63 (0.970)	4 (0.060)	4/252	NT	6.1%	coding (280/504 nt)	PP_2360	type I pili subunit CsuA/B
	?	NC_002947	= 2692684	62 (1.000)					coding (308/504 nt)	PP_2360	type I pili subunit CsuA/B
*	?	NC_002947	2707496 =	73 (1.120)	4 (0.060)	4/250	NT	5.8%	coding (77/495 nt)	PP_2370	hypothetical protein
	?	NC_002947	2707545 =	62 (1.010)					coding (28/495 nt)	PP_2370	hypothetical protein
*	?	NC_002947	2751160 =	65 (1.000)	5 (0.080)	4/250	NT	7.7%	intergenic (‑225/‑14)	aroQ‑II/czcC‑II	type II 3‑dehydroquinate dehydratase/cobalt‑zinc‑cadmium resistance protein
	?	NC_002947	2751195 =	58 (0.940)					coding (22/1278 nt)	czcC‑II	cobalt‑zinc‑cadmium resistance protein
*	?	NC_002947	2786671 =	43 (0.660)	3 (0.050)	3/250	NT	6.5%	intergenic (‑3/‑319)	alx/ahpC	alkaline‑induced transporter/peroxiredoxin/alkylhydroperoxide reductase small subunit
	?	NC_002947	2786743 =	45 (0.730)					intergenic (‑75/‑247)	alx/ahpC	alkaline‑induced transporter/peroxiredoxin/alkylhydroperoxide reductase small subunit
*	?	NC_002947	= 2792854	69 (1.060)	4 (0.060)	3/252	NT	5.6%	coding (184/240 nt)	PP_5524	hypothetical protein
	?	NC_002947	= 2792876	68 (1.100)					coding (206/240 nt)	PP_5524	hypothetical protein
*	?	NC_002947	= 2823827	47 (0.720)	4 (0.060)	4/250	NT	8.4%	intergenic (+2/‑98)	PP_5528/iorA‑I	hypothetical protein/isoquinoline 1‑oxidoreductase subunit alpha
	?	NC_002947	= 2823848	43 (0.700)					intergenic (+23/‑77)	PP_5528/iorA‑I	hypothetical protein/isoquinoline 1‑oxidoreductase subunit alpha
*	?	NC_002947	2852056 =	62 (0.950)	5 (0.080)	4/250	NT	7.5%	coding (486/519 nt)	PP_5531	hypothetical protein
	?	NC_002947	2852100 =	65 (1.060)					intergenic (+11/+194)	PP_5531/PP_2505	hypothetical protein/GAF domain/GGDEF domain‑containing protein
*	?	NC_002947	2863930 =	62 (0.950)	5 (0.080)	4/246	NT	8.1%	coding (990/1194 nt)	gllR	HTH‑type transcriptional regulator GalR
	?	NC_002947	2863974 =	56 (0.920)					coding (1034/1194 nt)	gllR	HTH‑type transcriptional regulator GalR
*	?	NC_002947	2881022 =	46 (0.710)	4 (0.070)	4/248	NT	8.7%	coding (864/1176 nt)	PP_2535	transport protein
	?	NC_002947	2881070 =	41 (0.670)					coding (912/1176 nt)	PP_2535	transport protein
*	?	NC_002947	2915278 =	45 (0.690)	4 (0.070)	4/248	NT	9.1%	coding (4298/10827 nt)	PP_2561	hemolysin‑type calcium‑binding bacteriocin
	?	NC_002947	2915368 =	38 (0.620)					coding (4388/10827 nt)	PP_2561	hemolysin‑type calcium‑binding bacteriocin
*	?	NC_002947	= 2921662	39 (0.600)	3 (0.050)	3/256	NT	7.7%	coding (10682/10827 nt)	PP_2561	hemolysin‑type calcium‑binding bacteriocin
	?	NC_002947	= 2921684	34 (0.540)					coding (10704/10827 nt)	PP_2561	hemolysin‑type calcium‑binding bacteriocin
*	?	NC_002947	2923286 =	66 (1.010)	3 (0.050)	3/248	NT	5.2%	coding (1967/2772 nt)	PP_2563	antibiotic biosynthesis protein
	?	NC_002947	2923338 =	48 (0.790)					coding (1915/2772 nt)	PP_2563	antibiotic biosynthesis protein
*	?	NC_002947	2939916 =	58 (0.890)	3 (0.050)	3/254	NT	5.8%	coding (226/648 nt)	PP_2572	hypothetical protein
	?	NC_002947	2939957 =	41 (0.660)					coding (185/648 nt)	PP_2572	hypothetical protein
*	?	NC_002947	= 2948808	50 (0.770)	3 (0.050)	3/250	NT	5.8%	coding (274/591 nt)	PP_2582	heme oxygenase
	?	NC_002947	= 2948834	51 (0.830)					coding (248/591 nt)	PP_2582	heme oxygenase
*	?	NC_002947	= 2951757	49 (0.750)	4 (0.060)	4/252	NT	7.2%	coding (1206/1581 nt)	PP_2585	alpha‑ketoglutaric semialdehyde dehydrogenase
	?	NC_002947	= 2951779	56 (0.900)					coding (1184/1581 nt)	PP_2585	alpha‑ketoglutaric semialdehyde dehydrogenase
*	?	NC_002947	2954524 =	41 (0.630)	4 (0.060)	4/254	NT	9.8%	intergenic (‑27/‑254)	PP_2586/PP_2587	putative amino acid transporter/LuxR family transcriptional regulator
	?	NC_002947	2954563 =	34 (0.540)					intergenic (‑66/‑215)	PP_2586/PP_2587	putative amino acid transporter/LuxR family transcriptional regulator
*	?	NC_002947	2954950 =	42 (0.650)	3 (0.050)	3/246	NT	6.8%	coding (173/843 nt)	PP_2587	LuxR family transcriptional regulator
	?	NC_002947	2955026 =	43 (0.710)					coding (249/843 nt)	PP_2587	LuxR family transcriptional regulator
*	?	NC_002947	2973290 =	50 (0.770)	3 (0.050)	3/250	NT	6.6%	coding (584/1713 nt)	PP_2600	hypothetical protein
	?	NC_002947	2973324 =	37 (0.600)					coding (550/1713 nt)	PP_2600	hypothetical protein
*	?	NC_002947	= 2996268	43 (0.660)	3 (0.050)	3/254	NT	7.2%	coding (576/1017 nt)	PP_2620	hypothetical protein
	?	NC_002947	= 2996321	36 (0.580)					coding (523/1017 nt)	PP_2620	hypothetical protein
*	?	NC_002947	= 3039605	46 (0.710)	4 (0.060)	3/254	NT	9.3%	coding (690/1344 nt)	PP_2651	MFS transporter
	?	NC_002947	= 3039659	34 (0.540)					coding (744/1344 nt)	PP_2651	MFS transporter
*	?	NC_002947	3041377 =	49 (0.750)	5 (0.080)	5/252	NT	9.9%	coding (615/819 nt)	PP_2653	Cro/CI family transcriptional regulator
	?	NC_002947	3041425 =	44 (0.710)					coding (567/819 nt)	PP_2653	Cro/CI family transcriptional regulator
*	?	NC_002947	= 3069869	44 (0.680)	4 (0.060)	4/256	NT	8.5%	coding (958/1521 nt)	aldB‑II	aldehyde dehydrogenase
	?	NC_002947	= 3069900	43 (0.680)					coding (989/1521 nt)	aldB‑II	aldehyde dehydrogenase
*	?	NC_002947	= 3115549	47 (0.720)	5 (0.080)	4/248	NT	10.0%	coding (287/1527 nt)	PP_2732	hypothetical protein
	?	NC_002947	= 3115576	46 (0.750)					coding (314/1527 nt)	PP_2732	hypothetical protein
*	?	NC_002947	3162747 =	48 (0.740)	3 (0.050)	3/254	NT	5.6%	coding (115/570 nt)	PP_2777	acyl carrier protein
	?	NC_002947	3162782 =	55 (0.880)					coding (150/570 nt)	PP_2777	acyl carrier protein
*	?	NC_002947	= 3185491	47 (0.720)	3 (0.050)	3/256	NT	6.1%	coding (1128/1647 nt)	PP_2795	AMP‑binding domain‑containing protein
	?	NC_002947	= 3185532	47 (0.740)					coding (1169/1647 nt)	PP_2795	AMP‑binding domain‑containing protein
*	?	NC_002947	3190461 =	48 (0.740)	3 (0.050)	3/252	NT	6.4%	coding (189/1380 nt)	PP_2799	class III aminotransferase
	?	NC_002947	3190500 =	42 (0.680)					coding (150/1380 nt)	PP_2799	class III aminotransferase
*	?	NC_002947	3204236 =	56 (0.860)	3 (0.050)	3/254	NT	5.9%	coding (987/1422 nt)	PP_2810	hypothetical protein
	?	NC_002947	3204339 =	42 (0.670)					coding (1090/1422 nt)	PP_2810	hypothetical protein
*	?	NC_002947	3238303 =	59 (0.910)	3 (0.050)	3/252	NT	5.1%	coding (742/1218 nt)	PP_2836	2‑keto‑3‑deoxyxylonate dehydratase
	?	NC_002947	3238338 =	56 (0.900)					coding (777/1218 nt)	PP_2836	2‑keto‑3‑deoxyxylonate dehydratase
*	?	NC_002947	3253299 =	33 (0.510)	3 (0.050)	3/248	NT	7.4%	coding (143/729 nt)	PP_2851	hypothetical protein
	?	NC_002947	3253355 =	44 (0.720)					coding (87/729 nt)	PP_2851	hypothetical protein
*	?	NC_002947	= 3279872	67 (1.030)	4 (0.060)	4/256	NT	6.3%	coding (208/594 nt)	PP_2879	hypothetical protein
	?	NC_002947	= 3279915	55 (0.870)					coding (165/594 nt)	PP_2879	hypothetical protein
*	?	NC_002947	= 3365591	52 (0.800)	3 (0.050)	3/250	NT	5.1%	coding (259/1002 nt)	PP_2962	alcohol dehydrogenase
	?	NC_002947	= 3365634	63 (1.020)					coding (302/1002 nt)	PP_2962	alcohol dehydrogenase
*	?	NC_002947	= 3394320	49 (0.750)	4 (0.070)	4/244	NT	8.9%	coding (87/900 nt)	PP_2997	protein CnmA
	?	NC_002947	= 3394357	37 (0.620)					coding (50/900 nt)	PP_2997	protein CnmA
*	?	NC_002947	= 3425260	62 (0.950)	4 (0.060)	4/250	NT	6.7%	coding (337/348 nt)	PP_3040	holin
	?	NC_002947	= 3425359	53 (0.860)					intergenic (+88/‑77)	PP_3040/PP_3041	holin/hypothetical protein
*	?	NC_002947	= 3436572	52 (0.800)	4 (0.060)	4/256	NT	6.8%	coding (507/813 nt)	gpI	tail formation protein
	?	NC_002947	= 3436604	59 (0.940)					coding (539/813 nt)	gpI	tail formation protein
*	?	NC_002947	= 3436901	38 (0.580)	3 (0.050)	3/252	NT	6.5%	coding (27/879 nt)	PP_3056	tail fiber protein
	?	NC_002947	= 3436957	50 (0.810)					coding (83/879 nt)	PP_3056	tail fiber protein
*	?	NC_002947	= 3437612	49 (0.750)	3 (0.050)	3/250	NT	5.6%	coding (738/879 nt)	PP_3056	tail fiber protein
	?	NC_002947	= 3437669	54 (0.880)					coding (795/879 nt)	PP_3056	tail fiber protein
*	?	NC_002947	3483872 =	79 (1.210)	5 (0.080)	5/256	NT	6.9%	coding (2052/3804 nt)	PP_3091	membrane protein
	?	NC_002947	3483909 =	59 (0.940)					coding (2015/3804 nt)	PP_3091	membrane protein
*	?	NC_002947	= 3490531	64 (0.980)	4 (0.060)	4/254	NT	6.4%	coding (860/2637 nt)	clpV	protein ClpV1
	?	NC_002947	= 3490575	55 (0.880)					coding (816/2637 nt)	clpV	protein ClpV1
*	?	NC_002947	= 3507486	38 (0.580)	4 (0.070)	4/244	NT	10.1%	coding (804/969 nt)	PP_3104	hypothetical protein
	?	NC_002947	= 3507509	36 (0.600)					coding (827/969 nt)	PP_3104	hypothetical protein
*	?	NC_002947	= 3547910	40 (0.610)	4 (0.060)	3/252	NT	8.8%	coding (855/1377 nt)	PP_3132	polysaccharide transporter
	?	NC_002947	= 3547946	45 (0.720)					coding (891/1377 nt)	PP_3132	polysaccharide transporter
*	?	NC_002947	= 3568272	57 (0.880)	3 (0.050)	3/250	NT	5.3%	coding (829/1998 nt)	PP_3150	hypothetical protein
	?	NC_002947	= 3568302	54 (0.880)					coding (859/1998 nt)	PP_3150	hypothetical protein
*	?	NC_002947	= 3590330	55 (0.850)	4 (0.070)	4/246	NT	7.4%	coding (851/1251 nt)	nicP‑I	porin‑like protein
	?	NC_002947	= 3590342	49 (0.810)					coding (863/1251 nt)	nicP‑I	porin‑like protein
*	?	NC_002947	= 3596506	44 (0.680)	3 (0.050)	3/254	NT	6.0%	coding (500/1098 nt)	nemA	FMN‑linked N‑ethylmaleimide reductase
	?	NC_002947	= 3596535	51 (0.810)					coding (471/1098 nt)	nemA	FMN‑linked N‑ethylmaleimide reductase
*	?	NC_002947	3612481 =	61 (0.940)	4 (0.060)	4/254	NT	6.6%	coding (1203/3396 nt)	mcoA	Mn(II) copper oxidase A
	?	NC_002947	3612513 =	54 (0.860)					coding (1171/3396 nt)	mcoA	Mn(II) copper oxidase A
*	?	NC_002947	3617158 =	47 (0.720)	5 (0.080)	5/254	NT	9.9%	coding (183/1170 nt)	PP_3188	hypothetical protein
	?	NC_002947	3617187 =	46 (0.730)					coding (212/1170 nt)	PP_3188	hypothetical protein
*	?	NC_002947	= 3685928	51 (0.780)	3 (0.050)	3/256	NT	5.2%	coding (336/1332 nt)	PP_3251	hypothetical protein
	?	NC_002947	= 3685965	59 (0.940)					coding (373/1332 nt)	PP_3251	hypothetical protein
*	?	NC_002947	= 3690761	61 (0.940)	4 (0.070)	4/244	NT	6.4%	coding (462/660 nt)	PP_3256	group 2 family glycosyl transferase
	?	NC_002947	= 3690788	60 (1.000)					coding (435/660 nt)	PP_3256	group 2 family glycosyl transferase
*	?	NC_002947	= 3693334	60 (0.920)	3 (0.050)	3/252	NT	5.1%	coding (292/1044 nt)	PP_3259	acyl‑CoA dehydrogenase‑related protein
	?	NC_002947	= 3693379	55 (0.890)					coding (247/1044 nt)	PP_3259	acyl‑CoA dehydrogenase‑related protein
*	?	NC_002947	= 3753103	54 (0.830)	3 (0.050)	3/250	NT	5.3%	coding (780/2823 nt)	PP_3316	chaperone‑associated ATPase
	?	NC_002947	= 3753144	57 (0.930)					coding (739/2823 nt)	PP_3316	chaperone‑associated ATPase
*	?	NC_002947	= 3758114	42 (0.650)	4 (0.070)	4/248	NT	8.5%	coding (427/1002 nt)	hemBB	porphobilinogen synthase
	?	NC_002947	= 3758136	47 (0.770)					coding (449/1002 nt)	hemBB	porphobilinogen synthase
*	?	NC_002947	= 3815726	62 (0.950)	4 (0.060)	4/252	NT	6.3%	coding (394/1260 nt)	PP_3371	sensor histidine kinase
	?	NC_002947	= 3815758	60 (0.970)					coding (362/1260 nt)	PP_3371	sensor histidine kinase
*	?	NC_002947	= 3837139	46 (0.710)	3 (0.050)	3/252	NT	5.9%	coding (734/2673 nt)	PP_3388	hypothetical protein
	?	NC_002947	= 3837164	51 (0.820)					coding (759/2673 nt)	PP_3388	hypothetical protein
*	?	NC_002947	3857801 =	44 (0.680)	3 (0.050)	3/254	NT	7.2%	intergenic (+35/‑259)	PP_mr41/cbtA	Cobalamin regulatory region/cobalt transporter subunit A
	?	NC_002947	3857832 =	35 (0.560)					intergenic (+66/‑228)	PP_mr41/cbtA	Cobalamin regulatory region/cobalt transporter subunit A
*	?	NC_002947	3881637 =	67 (1.030)	5 (0.080)	4/248	NT	7.8%	coding (296/1416 nt)	oprN	multidrug RND transporter outer membrane protein OprN
	?	NC_002947	3881700 =	55 (0.900)					coding (359/1416 nt)	oprN	multidrug RND transporter outer membrane protein OprN
*	?	NC_002947	= 3895667	60 (0.920)	4 (0.060)	4/250	NT	6.6%	coding (318/582 nt)	PP_3438	membrane protein
	?	NC_002947	= 3895689	57 (0.930)					coding (340/582 nt)	PP_3438	membrane protein
*	?	NC_002947	3912823 =	66 (1.010)	5 (0.080)	4/256	NT	7.6%	coding (1256/1302 nt)	PP_3453	sensor protein RstB
	?	NC_002947	3912875 =	58 (0.920)					coding (1204/1302 nt)	PP_3453	sensor protein RstB
*	?	NC_002947	3919020 =	52 (0.800)	4 (0.070)	4/248	NT	6.9%	coding (2802/3129 nt)	mexB	multidrug resistance protein MexB
	?	NC_002947	3919144 =	59 (0.970)					coding (2926/3129 nt)	mexB	multidrug resistance protein MexB
*	?	NC_002947	= 3971392	NA (NA)	4 (0.060)	4/256	NT	NA	coding (1311/1536 nt)	PP_3501	transposase
	?	NC_002947	= 3971433	NA (NA)					coding (1352/1536 nt)	PP_3501	transposase
*	?	NC_002947	= 3973644	51 (0.780)	3 (0.050)	3/248	NT	5.2%	coding (829/1326 nt)	PP_3503	sigma‑54 dependent transcriptional regulator
	?	NC_002947	= 3973680	62 (1.010)					coding (793/1326 nt)	PP_3503	sigma‑54 dependent transcriptional regulator
*	?	NC_002947	3991309 =	78 (1.200)	5 (0.080)	5/248	NT	7.6%	coding (318/894 nt)	PP_3517	hypothetical protein
	?	NC_002947	3991355 =	48 (0.790)					coding (272/894 nt)	PP_3517	hypothetical protein
*	?	NC_002947	4027966 =	53 (0.810)	4 (0.060)	4/256	NT	8.0%	coding (464/1407 nt)	PP_3552	two‑component system sensor histidine kinase
	?	NC_002947	4028017 =	41 (0.650)					coding (413/1407 nt)	PP_3552	two‑component system sensor histidine kinase
*	?	NC_002947	= 4031446	70 (1.080)	6 (0.100)	5/250	NT	8.4%	coding (1109/1770 nt)	PP_3554	acyl‑CoA dehydrogenase family protein
	?	NC_002947	= 4031526	64 (1.040)					coding (1189/1770 nt)	PP_3554	acyl‑CoA dehydrogenase family protein
*	?	NC_002947	= 4037012	70 (1.080)	4 (0.070)	4/246	NT	5.4%	coding (2063/2145 nt)	PP_3557	methyl‑accepting chemotaxis transducer
	?	NC_002947	= 4037047	74 (1.220)					coding (2098/2145 nt)	PP_3557	methyl‑accepting chemotaxis transducer
*	?	NC_002947	4040473 =	49 (0.750)	3 (0.050)	3/252	NT	5.7%	coding (361/948 nt)	PP_3561	membrane protein
	?	NC_002947	4040529 =	52 (0.840)					coding (417/948 nt)	PP_3561	membrane protein
*	?	NC_002947	4063840 =	81 (1.240)	4 (0.060)	4/256	NT	5.1%	coding (499/2088 nt)	PP_3581	membrane protein
	?	NC_002947	4063870 =	69 (1.090)					coding (469/2088 nt)	PP_3581	membrane protein
*	?	NC_002947	4094105 =	55 (0.850)	3 (0.050)	3/252	NT	5.3%	coding (1102/1581 nt)	PP_3602	2,5‑dioxovalerate dehydrogenase
	?	NC_002947	4094144 =	55 (0.890)					coding (1141/1581 nt)	PP_3602	2,5‑dioxovalerate dehydrogenase
*	?	NC_002947	4098066 =	60 (0.920)	5 (0.080)	5/246	NT	9.3%	coding (624/975 nt)	qor‑II	quinone oxidoreductase
	?	NC_002947	4098108 =	42 (0.690)					coding (582/975 nt)	qor‑II	quinone oxidoreductase
*	?	NC_002947	4111640 =	46 (0.710)	4 (0.060)	4/250	NT	9.5%	coding (469/897 nt)	PP_3617	membrane protein
	?	NC_002947	4111713 =	33 (0.540)					coding (542/897 nt)	PP_3617	membrane protein
*	?	NC_002947	4114305 =	38 (0.580)	3 (0.050)	3/238	NT	8.9%	intergenic (+52/+94)	PP_3619/ycaO	hypothetical protein/ribosomal protein S12 methylthiotransferase accessory factor
	?	NC_002947	4114376 =	27 (0.460)					intergenic (+123/+23)	PP_3619/ycaO	hypothetical protein/ribosomal protein S12 methylthiotransferase accessory factor
*	?	NC_002947	4136298 =	43 (0.660)	4 (0.060)	4/256	NT	8.8%	coding (507/921 nt)	PP_3640	AraC family transcriptional regulator
	?	NC_002947	4136336 =	41 (0.650)					coding (545/921 nt)	PP_3640	AraC family transcriptional regulator
*	?	NC_002947	= 4150041	20 (0.310)	11 (0.200)	9/228	NT	35.9%	intergenic (+40/‑357)	PP_3654/PP_3655	leucine‑responsive regulatory protein/cytosine/purine/uracil/thiamine/allantoin permease family protein
	?	NC_002947	= 4150072	22 (0.390)					intergenic (+71/‑326)	PP_3654/PP_3655	leucine‑responsive regulatory protein/cytosine/purine/uracil/thiamine/allantoin permease family protein
*	?	NC_002947	= 4168379	55 (0.850)	3 (0.050)	3/250	NT	5.6%	coding (1514/2256 nt)	katG	catalase‑peroxidase
	?	NC_002947	= 4168417	50 (0.810)					coding (1476/2256 nt)	katG	catalase‑peroxidase
*	?	NC_002947	= 4172033	46 (0.710)	3 (0.050)	3/250	NT	6.2%	coding (90/879 nt)	PP_3670	DMT superfamily permease
	?	NC_002947	= 4172070	48 (0.780)					coding (53/879 nt)	PP_3670	DMT superfamily permease
*	?	NC_002947	= 4172389	59 (0.910)	5 (0.080)	5/254	NT	7.6%	coding (23/825 nt)	PP_3671	aldo/keto reductase family oxidoreductase
	?	NC_002947	= 4172456	64 (1.020)					coding (90/825 nt)	PP_3671	aldo/keto reductase family oxidoreductase
*	?	NC_002947	4191542 =	53 (0.810)	4 (0.060)	4/250	NT	7.8%	intergenic (‑874/‑283)	PP_5612/PP_5613	hypothetical protein/hypothetical protein
	?	NC_002947	4191584 =	44 (0.710)					intergenic (‑916/‑241)	PP_5612/PP_5613	hypothetical protein/hypothetical protein
*	?	NC_002947	= 4267998	46 (0.710)	3 (0.050)	3/252	NT	6.8%	coding (1303/1341 nt)	PP_3740	MFS transporter
	?	NC_002947	= 4268029	38 (0.610)					coding (1272/1341 nt)	PP_3740	MFS transporter
*	?	NC_002947	4317676 =	55 (0.850)	4 (0.070)	4/246	NT	6.8%	coding (209/273 nt)	PP_5628	hypothetical protein
	?	NC_002947	4317723 =	58 (0.960)					coding (256/273 nt)	PP_5628	hypothetical protein
*	?	NC_002947	= 4319235	39 (0.600)	4 (0.070)	4/246	NT	9.8%	coding (206/807 nt)	PP_3790	diaminopimelate epimerase
	?	NC_002947	= 4319255	37 (0.610)					coding (226/807 nt)	PP_3790	diaminopimelate epimerase
*	?	NC_002947	4323361 =	57 (0.880)	6 (0.100)	5/250	NT	10.0%	intergenic (‑1371/‑52)	PP_3792/PP_5631	hypothetical protein/hypothetical protein
	?	NC_002947	4323398 =	54 (0.880)					intergenic (‑1408/‑15)	PP_3792/PP_5631	hypothetical protein/hypothetical protein
*	?	NC_002947	4340292 =	85 (1.310)	5 (0.080)	5/252	NT	6.0%	intergenic (+277/‑54)	ribAB‑II/PP_3814	3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase/polyamine ABC transportersubstrate‑binding protein
	?	NC_002947	4340316 =	75 (1.210)					intergenic (+301/‑30)	ribAB‑II/PP_3814	3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase/polyamine ABC transportersubstrate‑binding protein
*	?	NC_002947	= 4341102	55 (0.850)	3 (0.050)	3/246	NT	5.3%	coding (757/1026 nt)	PP_3814	polyamine ABC transportersubstrate‑binding protein
	?	NC_002947	= 4341141	57 (0.940)					coding (796/1026 nt)	PP_3814	polyamine ABC transportersubstrate‑binding protein
*	?	NC_002947	4348206 =	NA (NA)	3 (0.050)	3/250	NT	NA	coding (430/1422 nt)	PP_3820	group II intron‑encoding maturase
	?	NC_002947	4392679 =	NA (NA)					coding (336/1422 nt)	PP_3868	group II intron‑encoding maturase
*	?	NC_002947	= 4353640	44 (0.680)	3 (0.050)	3/248	NT	5.9%	coding (766/1086 nt)	yrpB	2‑nitropropane dioxygenase
	?	NC_002947	= 4353676	55 (0.900)					coding (802/1086 nt)	yrpB	2‑nitropropane dioxygenase
*	?	NC_002947	4363393 =	52 (0.800)	4 (0.060)	4/256	NT	7.3%	coding (479/1011 nt)	adhP	alcohol dehydrogenase
	?	NC_002947	4363437 =	51 (0.810)					coding (523/1011 nt)	adhP	alcohol dehydrogenase
*	?	NC_002947	4374410 =	55 (0.850)	5 (0.080)	5/254	NT	8.9%	coding (1424/1971 nt)	PP_3849	hemolysin‑type calcium‑binding protein
	?	NC_002947	4374445 =	49 (0.780)					coding (1459/1971 nt)	PP_3849	hemolysin‑type calcium‑binding protein
*	?	NC_002947	4378615 =	62 (0.950)	3 (0.050)	3/250	NT	5.1%	coding (98/540 nt)	PP_3854	lysozyme
	?	NC_002947	4378653 =	53 (0.860)					coding (60/540 nt)	PP_3854	lysozyme
*	?	NC_002947	4389226 =	76 (1.170)	4 (0.070)	4/244	NT	5.6%	coding (1515/1956 nt)	PP_3865	tail protein
	?	NC_002947	4389271 =	65 (1.080)					coding (1470/1956 nt)	PP_3865	tail protein
*	?	NC_002947	4390817 =	46 (0.710)	4 (0.060)	3/252	NT	8.1%	coding (108/192 nt)	PP_5640	hypothetical protein
	?	NC_002947	4390856 =	47 (0.760)					coding (69/192 nt)	PP_5640	hypothetical protein
*	?	NC_002947	= 4424373	42 (0.650)	6 (0.100)	5/250	NT	11.7%	coding (286/393 nt)	PP_3916	hypothetical protein
	?	NC_002947	= 4424397	51 (0.830)					coding (310/393 nt)	PP_3916	hypothetical protein
*	?	NC_002947	= 4425815	66 (1.010)	4 (0.060)	4/250	NT	5.6%	coding (74/339 nt)	PP_3917	hypothetical protein
	?	NC_002947	= 4425843	72 (1.170)					coding (102/339 nt)	PP_3917	hypothetical protein
*	?	NC_002947	4433225 =	94 (1.440)	5 (0.080)	5/252	NT	5.6%	coding (220/351 nt)	PP_5648	hypothetical protein
	?	NC_002947	4433278 =	78 (1.260)					coding (167/351 nt)	PP_5648	hypothetical protein
*	?	NC_002947	4457381 =	50 (0.770)	4 (0.060)	3/258	NT	8.0%	coding (19/696 nt)	pcaI	3‑oxoadipate CoA‑transferase subunit A
	?	NC_002947	4457483 =	43 (0.680)					coding (121/696 nt)	pcaI	3‑oxoadipate CoA‑transferase subunit A
*	?	NC_002947	= 4461580	52 (0.800)	3 (0.050)	3/248	NT	6.2%	coding (68/2028 nt)	PP_3955	permease
	?	NC_002947	= 4461605	42 (0.690)					coding (93/2028 nt)	PP_3955	permease
*	?	NC_002947	4475646 =	64 (0.980)	5 (0.080)	4/254	NT	7.2%	coding (289/336 nt)	PP_3965	transposase
	?	NC_002947	4475715 =	68 (1.090)					coding (220/336 nt)	PP_3965	transposase
*	?	NC_002947	= 4511711	71 (1.090)	4 (0.070)	4/248	NT	5.5%	coding (78/1326 nt)	rarA	DNA‑dependent ATPase
	?	NC_002947	= 4511745	70 (1.150)					coding (44/1326 nt)	rarA	DNA‑dependent ATPase
*	?	NC_002947	4515693 =	67 (1.030)	6 (0.100)	4/256	NT	8.6%	coding (295/681 nt)	aat	leucyl/phenylalanyl‑tRNA‑‑protein transferase
	?	NC_002947	4515729 =	62 (0.980)					coding (331/681 nt)	aat	leucyl/phenylalanyl‑tRNA‑‑protein transferase
*	?	NC_002947	= 4525157	86 (1.320)	4 (0.070)	4/246	NT	5.1%	coding (88/1125 nt)	mnmA	tRNA 2‑thiouridine(34) synthase MnmA
	?	NC_002947	= 4525183	68 (1.120)					coding (114/1125 nt)	mnmA	tRNA 2‑thiouridine(34) synthase MnmA
*	?	NC_002947	= 4533579	51 (0.780)	6 (0.100)	5/240	NT	10.5%	intergenic (+21/‑153)	PP_4020/cpo	oxidoreductase/non‑heme chloroperoxidase
	?	NC_002947	= 4533644	56 (0.950)					intergenic (+86/‑88)	PP_4020/cpo	oxidoreductase/non‑heme chloroperoxidase
*	?	NC_002947	4566566 =	50 (0.770)	3 (0.050)	3/252	NT	6.0%	coding (235/1743 nt)	treZ	malto‑oligosyltrehalose trehalohydrolase
	?	NC_002947	4566611 =	47 (0.760)					coding (280/1743 nt)	treZ	malto‑oligosyltrehalose trehalohydrolase
*	?	NC_002947	= 4575531	43 (0.660)	8 (0.130)	8/244	NT	17.3%	intergenic (+49/‑73)	glgX/ybhP‑II	glycogen debranching enzyme/phosphohydrolase
	?	NC_002947	= 4575558	37 (0.620)					intergenic (+76/‑46)	glgX/ybhP‑II	glycogen debranching enzyme/phosphohydrolase
*	?	NC_002947	= 4600285	56 (0.860)	4 (0.070)	3/248	NT	6.9%	coding (987/1467 nt)	PP_4072	hypothetical protein
	?	NC_002947	= 4600338	55 (0.900)					coding (934/1467 nt)	PP_4072	hypothetical protein
*	?	NC_002947	4601389 =	53 (0.810)	4 (0.060)	4/250	NT	8.1%	coding (503/633 nt)	PP_4073	hypothetical protein
	?	NC_002947	4601426 =	41 (0.670)					coding (466/633 nt)	PP_4073	hypothetical protein
*	?	NC_002947	4603515 =	54 (0.830)	4 (0.060)	4/250	NT	7.5%	intergenic (+846/‑656)	PP_4074/PP_4076	hypothetical protein/hypothetical protein
	?	NC_002947	4603585 =	47 (0.760)					intergenic (+916/‑586)	PP_4074/PP_4076	hypothetical protein/hypothetical protein
*	?	NC_002947	= 4609857	56 (0.860)	4 (0.070)	4/244	NT	7.2%	coding (344/876 nt)	PP_4081	type IV/VI secretion system protein
	?	NC_002947	= 4609877	52 (0.870)					coding (364/876 nt)	PP_4081	type IV/VI secretion system protein
*	?	NC_002947	= 4611681	73 (1.120)	4 (0.060)	4/250	NT	5.7%	intergenic (+643/‑1464)	hcpC‑II/PP_4084	hemolysin‑coregulated protein/hypothetical protein
	?	NC_002947	= 4611701	63 (1.020)					intergenic (+663/‑1444)	hcpC‑II/PP_4084	hemolysin‑coregulated protein/hypothetical protein
*	?	NC_002947	4626524 =	NA (NA)	10 (0.150)	4/264	NT	NA	coding (980/1533 nt)	PP_4091	transposase
	?	NC_002947	4626581 =	NA (NA)					coding (923/1533 nt)	PP_4091	transposase
*	?	NC_002947	4670169 =	74 (1.140)	5 (0.080)	5/258	NT	6.4%	coding (501/1470 nt)	nuoN	NADH‑quinone oxidoreductase subunit N
	?	NC_002947	4670231 =	75 (1.180)					coding (563/1470 nt)	nuoN	NADH‑quinone oxidoreductase subunit N
*	?	NC_002947	= 4689025	71 (1.090)	4 (0.060)	4/256	NT	5.6%	coding (926/1020 nt)	PP_4149	ABC transporter permease
	?	NC_002947	= 4689062	65 (1.030)					coding (963/1020 nt)	PP_4149	ABC transporter permease
*	?	NC_002947	= 4696832	80 (1.230)	4 (0.060)	4/250	NT	5.5%	coding (459/906 nt)	PP_4156	LysR family transcriptional regulator
	?	NC_002947	= 4696904	61 (0.990)					coding (531/906 nt)	PP_4156	LysR family transcriptional regulator
*	?	NC_002947	= 4700136	61 (0.940)	4 (0.070)	3/244	NT	6.2%	coding (552/2655 nt)	kdpD	sensor protein
	?	NC_002947	= 4700167	64 (1.060)					coding (521/2655 nt)	kdpD	sensor protein
*	?	NC_002947	= 4702645	64 (0.980)	4 (0.060)	4/252	NT	5.8%	coding (815/2055 nt)	kdpB	K+ transporting ATPase subunit KdpB
	?	NC_002947	= 4702677	69 (1.110)					coding (783/2055 nt)	kdpB	K+ transporting ATPase subunit KdpB
*	?	NC_002947	4732101 =	55 (0.850)	4 (0.060)	4/256	NT	7.2%	coding (660/1224 nt)	sucB	2‑oxoglutarate dehydrogenase dihydrolipoyltranssuccinylase subunit
	?	NC_002947	4732147 =	50 (0.790)					coding (614/1224 nt)	sucB	2‑oxoglutarate dehydrogenase dihydrolipoyltranssuccinylase subunit
*	?	NC_002947	= 4773087	72 (1.110)	4 (0.070)	4/246	NT	6.0%	coding (6180/10413 nt)	pvdD	non‑ribosomal peptide synthetase
	?	NC_002947	= 4773150	58 (0.960)					coding (6117/10413 nt)	pvdD	non‑ribosomal peptide synthetase
*	?	NC_002947	4808174 =	1 (0.020)	28 (0.590)	20/194	NT	59.7%	intergenic (‑283/‑272)	PP_4234/dsbD‑II	bifunctional aldehyde oxidase/xanthine dehydrogenase/thiol/disulfide interchange protein 2
	?	NC_002947	= 5988935	37 (0.780)					intergenic (+229/‑317)	kefB‑III/PP_mr64	glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
*	?	NC_002947	= 4808179	1 (0.020)	17 (0.290)	14/240	NT	35.1%	intergenic (‑288/‑267)	PP_4234/dsbD‑II	bifunctional aldehyde oxidase/xanthine dehydrogenase/thiol/disulfide interchange protein 2
	?	NC_002947	5988765 =	62 (1.050)					intergenic (+59/‑487)	kefB‑III/PP_mr64	glutathione‑regulated potassium/H+ antiporter/C4 ncRNA
*	?	NC_002947	= 4837742	54 (0.830)	3 (0.050)	3/252	NT	5.4%	coding (311/609 nt)	ccoO‑I	cbb3‑type cytochrome c oxidase subunit
	?	NC_002947	= 4837792	54 (0.870)					coding (361/609 nt)	ccoO‑I	cbb3‑type cytochrome c oxidase subunit
*	?	NC_002947	4839026 =	72 (1.110)	4 (0.060)	4/250	NT	6.1%	coding (790/942 nt)	ccoP‑I	cbb3‑type cytochrome c oxidase subunit
	?	NC_002947	4839072 =	55 (0.890)					coding (836/942 nt)	ccoP‑I	cbb3‑type cytochrome c oxidase subunit
*	?	NC_002947	= 4845076	62 (0.950)	3 (0.050)	3/254	NT	5.5%	coding (493/531 nt)	PP_4260	hypothetical protein
	?	NC_002947	= 4845104	44 (0.700)					coding (521/531 nt)	PP_4260	hypothetical protein
*	?	NC_002947	= 4870838	61 (0.940)	5 (0.080)	5/252	NT	7.9%	coding (69/846 nt)	xdhC	xanthine dehydrogenase accessory factor
	?	NC_002947	= 4870879	59 (0.950)					coding (110/846 nt)	xdhC	xanthine dehydrogenase accessory factor
*	?	NC_002947	4889569 =	15 (0.230)	8 (0.150)	7/210	NT	40.1%	intergenic (+15/‑138)	hyi/glxR	hydroxypyruvate isomerase/2‑hydroxy‑3‑oxopropionate reductase
	?	NC_002947	4889660 =	12 (0.230)					intergenic (+106/‑47)	hyi/glxR	hydroxypyruvate isomerase/2‑hydroxy‑3‑oxopropionate reductase
*	?	NC_002947	= 4889595	14 (0.220)	6 (0.120)	5/210	NT	34.2%	intergenic (+41/‑112)	hyi/glxR	hydroxypyruvate isomerase/2‑hydroxy‑3‑oxopropionate reductase
	?	NC_002947	= 4889632	12 (0.230)					intergenic (+78/‑75)	hyi/glxR	hydroxypyruvate isomerase/2‑hydroxy‑3‑oxopropionate reductase
*	?	NC_002947	= 4896398	34 (0.520)	7 (0.130)	7/222	NT	22.0%	intergenic (+31/‑177)	PP_4304/sbp‑I	VIC family cation transporter/sulfate ABC transporter substrate‑binding protein
	?	NC_002947	= 4896445	21 (0.380)					intergenic (+78/‑130)	PP_4304/sbp‑I	VIC family cation transporter/sulfate ABC transporter substrate‑binding protein
*	?	NC_002947	4896901 =	66 (1.010)	4 (0.060)	4/254	NT	5.8%	coding (327/999 nt)	sbp‑I	sulfate ABC transporter substrate‑binding protein
	?	NC_002947	4896938 =	66 (1.050)					coding (364/999 nt)	sbp‑I	sulfate ABC transporter substrate‑binding protein
*	?	NC_002947	4897592 =	68 (1.040)	4 (0.070)	3/248	NT	6.1%	coding (952/957 nt)	PP_4306	hypothetical protein
	?	NC_002947	4897630 =	59 (0.970)					coding (914/957 nt)	PP_4306	hypothetical protein
*	?	NC_002947	4905667 =	79 (1.210)	4 (0.060)	4/252	NT	5.5%	coding (356/489 nt)	PP_4314	hypothetical protein
	?	NC_002947	4905704 =	62 (1.000)					coding (319/489 nt)	PP_4314	hypothetical protein
*	?	NC_002947	= 4955433	68 (1.040)	4 (0.070)	3/246	NT	5.6%	coding (1322/1374 nt)	fliI	flagellum‑specific ATP synthase
	?	NC_002947	= 4955456	72 (1.190)					coding (1299/1374 nt)	fliI	flagellum‑specific ATP synthase
*	?	NC_002947	4979191 =	57 (0.880)	3 (0.050)	3/248	NT	5.2%	coding (231/786 nt)	flgG	flagellar basal‑body rod protein FlgG
	?	NC_002947	4979266 =	56 (0.920)					coding (156/786 nt)	flgG	flagellar basal‑body rod protein FlgG
*	?	NC_002947	= 5017985	54 (0.830)	4 (0.060)	3/252	NT	6.8%	coding (872/1473 nt)	gabD‑II	succinate‑semialdehyde dehydrogenase
	?	NC_002947	= 5018018	58 (0.930)					coding (839/1473 nt)	gabD‑II	succinate‑semialdehyde dehydrogenase
*	?	NC_002947	= 5083008	64 (0.980)	4 (0.060)	4/252	NT	6.6%	coding (1258/2625 nt)	alaS	alanine‑‑tRNA ligase
	?	NC_002947	= 5083059	53 (0.850)					coding (1207/2625 nt)	alaS	alanine‑‑tRNA ligase
*	?	NC_002947	5084615 =	54 (0.830)	3 (0.050)	3/252	NT	5.6%	intergenic (‑350/+35)	alaS/astE	alanine‑‑tRNA ligase/succinylglutamate desuccinylase
	?	NC_002947	5084650 =	50 (0.810)					coding (1008/1008 nt)	astE	succinylglutamate desuccinylase
*	?	NC_002947	= 5094749	61 (0.940)	4 (0.060)	4/258	NT	6.3%	coding (457/699 nt)	hisM	histidine/lysine/arginine/ornithine ABC transporter permease
	?	NC_002947	= 5094777	59 (0.930)					coding (429/699 nt)	hisM	histidine/lysine/arginine/ornithine ABC transporter permease
*	?	NC_002947	= 5114635	50 (0.770)	4 (0.060)	4/250	NT	7.8%	coding (313/666 nt)	yciO	maturation protein
	?	NC_002947	= 5114657	47 (0.760)					coding (291/666 nt)	yciO	maturation protein
*	?	NC_002947	= 5145719	64 (0.980)	4 (0.070)	3/244	NT	6.0%	coding (1035/1323 nt)	srmB	ATP‑dependent DEAD‑box RNA helicase
	?	NC_002947	= 5145802	66 (1.100)					coding (952/1323 nt)	srmB	ATP‑dependent DEAD‑box RNA helicase
*	?	NC_002947	= 5152855	0 (0.000)	3 (0.050)	3/248	NT	100%	intergenic (‑932/+482)	PP_5696/PP_4537	hypothetical protein/membrane protein
	?	NC_002947	= 5152920	NA (NA)					intergenic (‑997/+417)	PP_5696/PP_4537	hypothetical protein/membrane protein
*	?	NC_002947	5160379 =	67 (1.030)	4 (0.070)	3/248	NT	5.6%	coding (676/1212 nt)	PP_4543	hypothetical protein
	?	NC_002947	5160418 =	72 (1.180)					coding (637/1212 nt)	PP_4543	hypothetical protein
*	?	NC_002947	5167753 =	67 (1.030)	7 (0.110)	7/250	NT	10.3%	coding (127/3906 nt)	hrpA	ATP‑dependent helicase HrpA
	?	NC_002947	5167791 =	58 (0.940)					coding (89/3906 nt)	hrpA	ATP‑dependent helicase HrpA
*	?	NC_002947	5175549 =	58 (0.890)	4 (0.060)	4/250	NT	6.8%	coding (352/945 nt)	PP_4551	alpha/beta family hydrolase
	?	NC_002947	5175599 =	54 (0.880)					coding (402/945 nt)	PP_4551	alpha/beta family hydrolase
*	?	NC_002947	5180685 =	63 (0.970)	4 (0.060)	4/252	NT	6.6%	coding (302/537 nt)	def‑II	peptide deformylase
	?	NC_002947	5180727 =	54 (0.870)					coding (260/537 nt)	def‑II	peptide deformylase
*	?	NC_002947	5201579 =	33 (0.510)	5 (0.110)	4/190	NT	24.0%	intergenic (‑65/‑115)	PP_4582/PP_4583	membrane protein/putative Peptidase
	?	NC_002947	5201674 =	8 (0.170)					intergenic (‑160/‑20)	PP_4582/PP_4583	membrane protein/putative Peptidase
*	?	NC_002947	= 5210234	43 (0.660)	6 (0.110)	6/232	NT	10.6%	intergenic (‑100/+78)	rnd/PP_4592	ribonuclease D/metal dependent hydrolase
	?	NC_002947	= 5210293	63 (1.100)					intergenic (‑159/+19)	rnd/PP_4592	ribonuclease D/metal dependent hydrolase
*	?	NC_002947	= 5225821	69 (1.060)	4 (0.060)	4/254	NT	6.0%	coding (59/876 nt)	PP_4605	AraC family transcriptional regulator
	?	NC_002947	= 5225852	60 (0.960)					coding (90/876 nt)	PP_4605	AraC family transcriptional regulator
*	?	NC_002947	5258313 =	53 (0.810)	3 (0.050)	3/248	NT	5.2%	coding (844/1212 nt)	PP_4635	trans‑2‑enoyl‑CoA reductase
	?	NC_002947	5258382 =	59 (0.970)					coding (775/1212 nt)	PP_4635	trans‑2‑enoyl‑CoA reductase
*	?	NC_002947	5288394 =	25 (0.380)	4 (0.080)	4/204	NT	20.9%	intergenic (‑75/+109)	PP_4660/mdaB	LysR family transcriptional regulator/drug activity modulator B
	?	NC_002947	5288488 =	11 (0.220)					intergenic (‑169/+15)	PP_4660/mdaB	LysR family transcriptional regulator/drug activity modulator B
*	?	NC_002947	= 5288423	24 (0.370)	3 (0.060)	3/204	NT	16.9%	intergenic (‑104/+80)	PP_4660/mdaB	LysR family transcriptional regulator/drug activity modulator B
	?	NC_002947	= 5288457	11 (0.220)					intergenic (‑138/+46)	PP_4660/mdaB	LysR family transcriptional regulator/drug activity modulator B
*	?	NC_002947	= 5295494	83 (1.280)	5 (0.080)	5/250	NT	6.0%	intergenic (+25/+101)	PP_4668/PP_4669	LysR family transcriptional regulator/OmpA family protein
	?	NC_002947	= 5295563	79 (1.280)					intergenic (+94/+32)	PP_4668/PP_4669	LysR family transcriptional regulator/OmpA family protein
*	?	NC_002947	5366891 =	82 (1.260)	4 (0.060)	3/250	NT	5.3%	coding (486/624 nt)	rlmE	ribosomal RNA large subunit methyltransferase E
	?	NC_002947	5366942 =	66 (1.070)					coding (435/624 nt)	rlmE	ribosomal RNA large subunit methyltransferase E
*	?	NC_002947	5384955 =	58 (0.890)	5 (0.080)	5/246	NT	7.5%	coding (1419/1671 nt)	lldP	L‑lactate permease
	?	NC_002947	5385070 =	70 (1.160)					coding (1534/1671 nt)	lldP	L‑lactate permease
*	?	NC_002947	= 5404344	60 (0.920)	5 (0.090)	5/232	NT	7.5%	intergenic (‑642/+75)	PP_4746/PP_4748	transposase/amino acid ABC transporter substrate‑binding protein
	?	NC_002947	= 5404374	71 (1.240)					intergenic (‑672/+45)	PP_4746/PP_4748	transposase/amino acid ABC transporter substrate‑binding protein
*	?	NC_002947	5417913 =	66 (1.010)	5 (0.080)	5/252	NT	7.4%	coding (1158/1368 nt)	PP_4758	MFS transporter
	?	NC_002947	5417958 =	62 (1.000)					coding (1113/1368 nt)	PP_4758	MFS transporter
*	?	NC_002947	= 5423098	70 (1.080)	4 (0.060)	4/250	NT	5.8%	coding (308/537 nt)	PP_4763	acetyltransferase
	?	NC_002947	= 5423127	64 (1.040)					coding (279/537 nt)	PP_4763	acetyltransferase
*	?	NC_002947	5430223 =	77 (1.180)	4 (0.060)	4/250	NT	5.3%	coding (96/480 nt)	PP_4769	hypothetical protein
	?	NC_002947	5430263 =	71 (1.150)					coding (56/480 nt)	PP_4769	hypothetical protein
*	?	NC_002947	5441588 =	74 (1.140)	4 (0.060)	4/258	NT	5.0%	coding (996/1653 nt)	PP_4780	acyl‑CoA dehydrogenase
	?	NC_002947	5441618 =	79 (1.240)					coding (966/1653 nt)	PP_4780	acyl‑CoA dehydrogenase
*	?	NC_002947	= 5442678	52 (0.800)	3 (0.050)	3/254	NT	5.2%	intergenic (‑95/+113)	PP_4780/PP_4781	acyl‑CoA dehydrogenase/sensor histidine kinase
	?	NC_002947	= 5442726	60 (0.960)					intergenic (‑143/+65)	PP_4780/PP_4781	acyl‑CoA dehydrogenase/sensor histidine kinase
*	?	NC_002947	= 5492209	68 (1.040)	8 (0.130)	7/250	NT	10.4%	intergenic (‑10/+109)	PP_5716/cobJ	hypothetical protein/precorrin‑3B C17‑methyltransferase
	?	NC_002947	= 5492261	74 (1.200)					intergenic (‑62/+57)	PP_5716/cobJ	hypothetical protein/precorrin‑3B C17‑methyltransferase
*	?	NC_002947	5519019 =	56 (0.860)	5 (0.080)	4/244	NT	8.6%	coding (711/789 nt)	PP_4852	AraC family transcriptional regulator
	?	NC_002947	5519086 =	55 (0.920)					coding (644/789 nt)	PP_4852	AraC family transcriptional regulator
*	?	NC_002947	= 5519028	60 (0.920)	4 (0.070)	4/244	NT	6.8%	coding (702/789 nt)	PP_4852	AraC family transcriptional regulator
	?	NC_002947	= 5519075	55 (0.920)					coding (655/789 nt)	PP_4852	AraC family transcriptional regulator
*	?	NC_002947	= 5526992	58 (0.890)	3 (0.050)	3/256	NT	5.1%	coding (505/1134 nt)	PP_4860	mannose‑6‑phosphate isomerase
	?	NC_002947	= 5527020	55 (0.870)					coding (533/1134 nt)	PP_4860	mannose‑6‑phosphate isomerase
*	?	NC_002947	5537031 =	23 (0.350)	3 (0.060)	4/210	NT	18.0%	intergenic (+8/+95)	nadE/PP_4870	NH(3)‑dependent NAD(+) synthetase/azurin
	?	NC_002947	5537107 =	9 (0.170)					intergenic (+84/+19)	nadE/PP_4870	NH(3)‑dependent NAD(+) synthetase/azurin
*	?	NC_002947	5540637 =	68 (1.040)	4 (0.060)	3/256	NT	5.8%	coding (349/2355 nt)	PP_4872	hypothetical protein
	?	NC_002947	5540669 =	63 (1.000)					coding (317/2355 nt)	PP_4872	hypothetical protein
*	?	NC_002947	5545321 =	NA (NA)	50 (0.780)	43/260	NT	98.1%	intergenic (‑461/+416)	rpsF/rlmB	30S ribosomal protein S6/23S rRNA (guanosine(2251)‑2'‑O)‑methyltransferase RlmB
	?	NC_002947	= 5621245	1 (0.020)					coding (19/774 nt)	PP_4939	hypothetical protein
*	?	NC_002947	= 5545666	NA (NA)	76 (1.200)	63/258	NT	98.7%	intergenic (‑806/+71)	rpsF/rlmB	30S ribosomal protein S6/23S rRNA (guanosine(2251)‑2'‑O)‑methyltransferase RlmB
	?	NC_002947	5621244 =	1 (0.020)					coding (20/774 nt)	PP_4939	hypothetical protein
*	?	NC_002947	5548441 =	56 (0.860)	3 (0.050)	3/246	NT	5.7%	coding (613/2574 nt)	rnr	exoribonuclease R
	?	NC_002947	5548480 =	48 (0.790)					coding (574/2574 nt)	rnr	exoribonuclease R
*	?	NC_002947	5555200 =	73 (1.120)	6 (0.100)	5/246	NT	8.4%	coding (325/459 nt)	PP_4887	hypothetical protein
	?	NC_002947	5555263 =	63 (1.040)					coding (262/459 nt)	PP_4887	hypothetical protein
*	?	NC_002947	5591337 =	61 (0.940)	4 (0.060)	4/254	NT	6.9%	coding (545/630 nt)	nudF	ADP‑ribose/sugar pyrophosphatase
	?	NC_002947	5591385 =	50 (0.800)					coding (497/630 nt)	nudF	ADP‑ribose/sugar pyrophosphatase
*	?	NC_002947	= 5619220	76 (1.170)	6 (0.100)	4/248	NT	7.5%	coding (469/606 nt)	PP_4937	toluene tolerance protein
	?	NC_002947	= 5619241	76 (1.240)					coding (490/606 nt)	PP_4937	toluene tolerance protein
*	?	NC_002947	5629835 =	66 (1.010)	4 (0.060)	4/250	NT	5.9%	coding (431/1629 nt)	putP	sodium/L‑proline transporter
	?	NC_002947	5629883 =	66 (1.070)					coding (383/1629 nt)	putP	sodium/L‑proline transporter
*	?	NC_002947	= 5639727	81 (1.240)	4 (0.070)	4/248	NT	5.1%	coding (819/1320 nt)	PP_4950	hypothetical protein
	?	NC_002947	= 5639774	73 (1.190)					coding (866/1320 nt)	PP_4950	hypothetical protein
*	?	NC_002947	5644528 =	62 (0.950)	4 (0.070)	4/248	NT	5.9%	intergenic (+9/‑120)	yhiN/PP_4954	FAD/NAD(P)‑binding domain‑containing oxidoreductase/membrane protein
	?	NC_002947	5644617 =	70 (1.150)					intergenic (+98/‑31)	yhiN/PP_4954	FAD/NAD(P)‑binding domain‑containing oxidoreductase/membrane protein
*	?	NC_002947	5667574 =	61 (0.940)	5 (0.080)	3/252	NT	8.3%	coding (121/402 nt)	PP_4975	acyl‑CoA thioesterase
	?	NC_002947	5667616 =	53 (0.850)					coding (79/402 nt)	PP_4975	acyl‑CoA thioesterase
*	?	NC_002947	5671615 =	35 (0.540)	5 (0.090)	5/216	NT	15.0%	intergenic (+34/‑136)	PP_4978/PP_4979	hypothetical protein/substrate‑binding protein
	?	NC_002947	5671700 =	28 (0.530)					intergenic (+119/‑51)	PP_4978/PP_4979	hypothetical protein/substrate‑binding protein
*	?	NC_002947	5698727 =	56 (0.860)	4 (0.070)	4/230	NT	9.8%	intergenic (+17/‑150)	hslU/PP_5002	protease HslVU ATPase subunit/hypothetical protein
	?	NC_002947	5698810 =	25 (0.440)					intergenic (+100/‑67)	hslU/PP_5002	protease HslVU ATPase subunit/hypothetical protein
*	?	NC_002947	5715379 =	66 (1.010)	4 (0.060)	4/250	NT	6.0%	coding (46/378 nt)	tatB	Sec‑independent protein translocase protein TatB
	?	NC_002947	5715434 =	63 (1.020)					coding (101/378 nt)	tatB	Sec‑independent protein translocase protein TatB
*	?	NC_002947	= 5740403	62 (0.950)	4 (0.070)	3/246	NT	6.8%	coding (1333/1365 nt)	hutF	formiminoglutamate deiminase
	?	NC_002947	= 5740534	52 (0.860)					coding (545/573 nt)	PP_5037	lipocalin family lipoprotein
*	?	NC_002947	= 5750710	73 (1.120)	5 (0.080)	4/254	NT	6.8%	coding (853/1455 nt)	thiI	tRNA sulfurtransferase
	?	NC_002947	= 5750758	67 (1.070)					coding (805/1455 nt)	thiI	tRNA sulfurtransferase
*	?	NC_002947	= 5797371	65 (1.000)	4 (0.060)	4/256	NT	6.6%	coding (529/4446 nt)	gltB	L‑glutamate synthase subunit alpha
	?	NC_002947	= 5797412	50 (0.790)					coding (488/4446 nt)	gltB	L‑glutamate synthase subunit alpha
*	?	NC_002947	5807429 =	56 (0.860)	3 (0.050)	3/254	NT	5.6%	coding (2018/2454 nt)	mrcA	penicillin‑insensitive transglycosylase/penicillin‑sensitive transpeptidase
	?	NC_002947	5807464 =	47 (0.750)					coding (2053/2454 nt)	mrcA	penicillin‑insensitive transglycosylase/penicillin‑sensitive transpeptidase
*	?	NC_002947	= 5811876	69 (1.060)	4 (0.060)	4/250	NT	6.0%	coding (1204/2220 nt)	priA	primosome assembly protein
	?	NC_002947	= 5811907	59 (0.960)					coding (1235/2220 nt)	priA	primosome assembly protein
*	?	NC_002947	5823897 =	83 (1.280)	5 (0.080)	5/252	NT	5.9%	coding (833/1176 nt)	yggW	coproporphyrinogen/heterocyclic compound oxidase
	?	NC_002947	5823932 =	80 (1.290)					coding (868/1176 nt)	yggW	coproporphyrinogen/heterocyclic compound oxidase
*	?	NC_002947	5842554 =	64 (0.980)	4 (0.060)	4/250	NT	6.3%	coding (1123/1431 nt)	calB	coniferyl aldehyde dehydrogenase
	?	NC_002947	5842578 =	58 (0.940)					coding (1147/1431 nt)	calB	coniferyl aldehyde dehydrogenase
*	?	NC_002947	= 5850864	44 (0.680)	4 (0.070)	4/248	NT	7.6%	coding (1569/1842 nt)	ilvD	dihydroxy‑acid dehydratase
	?	NC_002947	= 5850932	56 (0.920)					coding (1637/1842 nt)	ilvD	dihydroxy‑acid dehydratase
*	?	NC_002947	= 5857772	82 (1.260)	7 (0.110)	6/254	NT	8.3%	coding (321/1371 nt)	PP_5134	hypothetical protein
	?	NC_002947	= 5857793	76 (1.210)					coding (342/1371 nt)	PP_5134	hypothetical protein
*	?	NC_002947	5861744 =	63 (0.970)	4 (0.060)	4/254	NT	6.6%	coding (1045/1059 nt)	fbpC	ABC transporter ATP‑binding protein
	?	NC_002947	5861782 =	52 (0.830)					coding (1007/1059 nt)	fbpC	ABC transporter ATP‑binding protein
*	?	NC_002947	= 5875315	61 (0.940)	5 (0.080)	5/258	NT	7.2%	coding (856/1515 nt)	ilvA‑II	threonine deaminase
	?	NC_002947	= 5875360	70 (1.100)					coding (811/1515 nt)	ilvA‑II	threonine deaminase
*	?	NC_002947	= 5877007	34 (0.520)	4 (0.080)	4/216	NT	12.0%	intergenic (+29/+76)	rpiA/PP_5151	ribose‑5‑phosphate isomerase A/hypothetical protein
	?	NC_002947	= 5877041	31 (0.580)					intergenic (+63/+42)	rpiA/PP_5151	ribose‑5‑phosphate isomerase A/hypothetical protein
*	?	NC_002947	5890484 =	60 (0.920)	4 (0.060)	4/250	NT	6.8%	coding (2139/2367 nt)	PP_5164	penicillin amidase family protein
	?	NC_002947	5890539 =	53 (0.860)					coding (2194/2367 nt)	PP_5164	penicillin amidase family protein
*	?	NC_002947	5907241 =	80 (1.230)	5 (0.080)	4/246	NT	6.7%	coding (726/1095 nt)	spuE	spermidine/putrescine ABC transporter substrate‑binding protein
	?	NC_002947	5907301 =	64 (1.060)					coding (666/1095 nt)	spuE	spermidine/putrescine ABC transporter substrate‑binding protein
*	?	NC_002947	5914157 =	33 (0.510)	5 (0.100)	4/208	NT	17.3%	intergenic (+49/+104)	spuI/argA	glutamylpolyamine synthetase/amino acid N‑acetyltransferase
	?	NC_002947	5914253 =	22 (0.430)					intergenic (+145/+8)	spuI/argA	glutamylpolyamine synthetase/amino acid N‑acetyltransferase
*	?	NC_002947	5916596 =	73 (1.120)	5 (0.080)	5/256	NT	6.6%	coding (231/1143 nt)	argE	acetylornithine deacetylase
	?	NC_002947	5916648 =	71 (1.130)					coding (179/1143 nt)	argE	acetylornithine deacetylase
*	?	NC_002947	= 5924551	51 (0.780)	3 (0.060)	3/214	NT	7.4%	intergenic (‑121/+76)	gcvP‑II/gcvH‑II	glycine dehydrogenase/glycine cleavage system protein H
	?	NC_002947	= 5924587	34 (0.650)					intergenic (‑157/+40)	gcvP‑II/gcvH‑II	glycine dehydrogenase/glycine cleavage system protein H
*	?	NC_002947	5943601 =	47 (0.720)	3 (0.060)	3/220	NT	8.9%	intergenic (+9/+76)	PP_5210/PP_5211	alcohol dehydrogenase/ChaC‑related protein
	?	NC_002947	5943666 =	22 (0.410)					intergenic (+74/+11)	PP_5210/PP_5211	alcohol dehydrogenase/ChaC‑related protein
*	?	NC_002947	= 5961195	61 (0.940)	4 (0.060)	4/254	NT	6.2%	coding (91/1248 nt)	lysA‑II	diaminopimelate decarboxylase
	?	NC_002947	= 5961227	63 (1.010)					coding (123/1248 nt)	lysA‑II	diaminopimelate decarboxylase
*	?	NC_002947	= 5962360	70 (1.080)	7 (0.120)	6/246	NT	9.8%	coding (37/864 nt)	dapF	diaminopimelate epimerase
	?	NC_002947	= 5962379	63 (1.040)					coding (56/864 nt)	dapF	diaminopimelate epimerase
*	?	NC_002947	= 5971553	72 (1.110)	4 (0.060)	4/250	NT	5.3%	coding (133/222 nt)	PP_5237	hypothetical protein
	?	NC_002947	= 5971603	75 (1.220)					coding (183/222 nt)	PP_5237	hypothetical protein
*	?	NC_002947	= 6019270	31 (0.480)	3 (0.060)	3/218	NT	10.6%	intergenic (‑71/+74)	dadX/dadA‑II	alanine racemase/D‑amino acid:quinone oxidoreductase
	?	NC_002947	= 6019300	25 (0.470)					intergenic (‑101/+44)	dadX/dadA‑II	alanine racemase/D‑amino acid:quinone oxidoreductase
*	?	NC_002947	= 6040029	94 (1.440)	6 (0.100)	5/250	NT	6.2%	coding (34/780 nt)	PP_5292	catabolite repression control protein
	?	NC_002947	= 6040072	92 (1.490)					coding (77/780 nt)	PP_5292	catabolite repression control protein
*	?	NC_002947	= 6050074	73 (1.120)	5 (0.080)	4/256	NT	6.5%	coding (936/2109 nt)	spoT	bifunctional (p)ppGpp synthase/hydrolase
	?	NC_002947	= 6050143	73 (1.160)					coding (1005/2109 nt)	spoT	bifunctional (p)ppGpp synthase/hydrolase
*	?	NC_002947	6072711 =	74 (1.140)	4 (0.060)	4/254	NT	5.7%	coding (1545/1671 nt)	PP_5327	phosphate ABC transporter permease
	?	NC_002947	6072738 =	62 (0.990)					coding (1518/1671 nt)	PP_5327	phosphate ABC transporter permease
*	?	NC_002947	6118288 =	61 (0.940)	4 (0.060)	4/260	NT	6.2%	coding (740/1158 nt)	PP_5368	MFS transporter
	?	NC_002947	6118338 =	60 (0.940)					coding (690/1158 nt)	PP_5368	MFS transporter
*	?	NC_002947	6142056 =	73 (1.120)	6 (0.100)	6/244	NT	7.8%	coding (1792/3159 nt)	cusA	CzcA family RND family copper transporter
	?	NC_002947	6142126 =	75 (1.250)					coding (1862/3159 nt)	cusA	CzcA family RND family copper transporter
*	?	NC_002947	= 6142721	79 (1.210)	6 (0.100)	6/248	NT	7.1%	coding (2457/3159 nt)	cusA	CzcA family RND family copper transporter
	?	NC_002947	= 6142749	84 (1.370)					coding (2485/3159 nt)	cusA	CzcA family RND family copper transporter