breseq  version 0.33.1  revision 8505477f25b3
mutation predictions | marginal predictions | summary statistics | genome diff | command line log

Predicted mutations
evidence seq id position mutation freq annotation gene description
RA CP000731 81 N→G 100% intergenic (–/‑151) – / → repA –/replication protein A
RA CP000731 5,779 C→T 10.3% intergenic (+296/‑1192) cadX → / → USA300HOU_pUSA300HOUMR0010 cadmium efflux regulator/MarR family transcriptional regulator
RA CP000731 5,784 A→G 8.6% intergenic (+301/‑1187) cadX → / → USA300HOU_pUSA300HOUMR0010 cadmium efflux regulator/MarR family transcriptional regulator
JC CP000731 6,552 +28 bp 100% intergenic (+1069/‑419) cadX → / → USA300HOU_pUSA300HOUMR0010 cadmium efflux regulator/MarR family transcriptional regulator
RA CP000731 12,012 A→G 10.1% intergenic (+175/+48) USA300HOU_pUSA300HOUMR0014 → / ← USA300HOU_pUSA300HOUMR0015 recombinase/hypothetical protein
RA CP000731 12,017 C→T 11.0% intergenic (+180/+43) USA300HOU_pUSA300HOUMR0014 → / ← USA300HOU_pUSA300HOUMR0015 recombinase/hypothetical protein
RA CP000731 25,663 Δ1 bp 100% coding (316/333 nt) USA300HOU_pUSA300HOUMR0031 → hypothetical protein
RA NC_012417 2,287 C→G 11.1% E130Q (GAA→CAA)  USA300HOU_RS14900 ← hypothetical protein
RA USA300TCH1516_ALE 3,343 Δ1 bp 5.5% intergenic (+27/‑363) dnaN → / → USA300HOU_RS00015 DNA polymerase III subunit beta/hypothetical protein
RA USA300TCH1516_ALE 3,344 A→T 10.8% intergenic (+28/‑362) dnaN → / → USA300HOU_RS00015 DNA polymerase III subunit beta/hypothetical protein
RA USA300TCH1516_ALE 3,352:1 +T 5.7% intergenic (+36/‑354) dnaN → / → USA300HOU_RS00015 DNA polymerase III subunit beta/hypothetical protein
RA USA300TCH1516_ALE 3,353 A→C 5.9% intergenic (+37/‑353) dnaN → / → USA300HOU_RS00015 DNA polymerase III subunit beta/hypothetical protein
RA USA300TCH1516_ALE 8,213 T→A 5.7% I394I (ATT→ATA)  gyrA → DNA gyrase subunit A
RA USA300TCH1516_ALE 9,710 T→C 14.9% intergenic (+15/+72) gyrA → / ← nnrD DNA gyrase subunit A/ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase
RA USA300TCH1516_ALE 9,716 T→C 15.3% intergenic (+21/+66) gyrA → / ← nnrD DNA gyrase subunit A/ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase
RA USA300TCH1516_ALE 9,719 G→A 14.4% intergenic (+24/+63) gyrA → / ← nnrD DNA gyrase subunit A/ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase
RA USA300TCH1516_ALE 9,725 G→A 12.1% intergenic (+30/+57) gyrA → / ← nnrD DNA gyrase subunit A/ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase
RA USA300TCH1516_ALE 24,137 G→A 5.9% intergenic (+389/‑41) purA → / → USA300TCH1516_00018 Adenylosuccinate synthetase/tRNA‑Glu
RA USA300TCH1516_ALE 41,166 G→A 9.8% intergenic (‑33/‑67) pbp ← / → mecR1 Beta‑lactam‑inducible penicillin‑binding protein/Methicillin resistance mecR1 protein
RA USA300TCH1516_ALE 41,171 T→C 8.3% intergenic (‑38/‑62) pbp ← / → mecR1 Beta‑lactam‑inducible penicillin‑binding protein/Methicillin resistance mecR1 protein
RA USA300TCH1516_ALE 44,009 T→A 5.9% intergenic (‑44/+92) USA300TCH1516_00035 ← / ← USA300HOU_RS00180 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 53,905 C→G 5.1% S281R (AGC→AGG)  USA300HOU_RS00220 → hypothetical protein
RA USA300TCH1516_ALE 70,101 A→T 6.1% I228N (ATT→AAT)  argF_1 ← Ornithine carbamoyltransferase
RA USA300TCH1516_ALE 77,971:1 +C 7.1% intergenic (+80/‑347) USA300HOU_RS00350 → / → USA300HOU_RS00355 Monoacylglycerol lipase/hypothetical protein
RA USA300TCH1516_ALE 77,973 A→T 7.2% intergenic (+82/‑345) USA300HOU_RS00350 → / → USA300HOU_RS00355 Monoacylglycerol lipase/hypothetical protein
RA USA300TCH1516_ALE 77,975 Δ1 bp 7.0% intergenic (+84/‑343) USA300HOU_RS00350 → / → USA300HOU_RS00355 Monoacylglycerol lipase/hypothetical protein
RA USA300TCH1516_ALE 77,984 T→C 8.7% intergenic (+93/‑334) USA300HOU_RS00350 → / → USA300HOU_RS00355 Monoacylglycerol lipase/hypothetical protein
RA USA300TCH1516_ALE 79,612 A→T 11.5% intergenic (+221/‑39) USA300HOU_RS00355 → / → cmoB hypothetical protein/tRNA U34 carboxymethyltransferase
RA USA300TCH1516_ALE 79,619 T→A 11.2% intergenic (+228/‑32) USA300HOU_RS00355 → / → cmoB hypothetical protein/tRNA U34 carboxymethyltransferase
RA USA300TCH1516_ALE 79,626 A→T 10.6% intergenic (+235/‑25) USA300HOU_RS00355 → / → cmoB hypothetical protein/tRNA U34 carboxymethyltransferase
RA USA300TCH1516_ALE 85,835 T→A 5.5% intergenic (+854/‑166) nikE_1 → / → copB Nickel import ATP‑binding protein NikE/Copper‑exporting P‑type ATPase B
RA USA300TCH1516_ALE 92,982 C→T 12.8% intergenic (‑67/‑70) ricR_1 ← / → glpE Copper‑sensing transcriptional repressor RicR/Thiosulfate sulfurtransferase GlpE
RA USA300TCH1516_ALE 92,987 A→G 15.3% intergenic (‑72/‑65) ricR_1 ← / → glpE Copper‑sensing transcriptional repressor RicR/Thiosulfate sulfurtransferase GlpE
RA USA300TCH1516_ALE 99,276 G→C 11.1% intergenic (+70/+2) USA300HOU_RS00465 → / ← tetA_1 hypothetical protein/Tetracycline resistance protein, class C
RA USA300TCH1516_ALE 109,958 G→A 7.4% intergenic (+37/‑184) plc → / → USA300HOU_RS00515 1‑phosphatidylinositol phosphodiesterase/putative lipoprotein
RA USA300TCH1516_ALE 109,964 T→A 7.2% intergenic (+43/‑178) plc → / → USA300HOU_RS00515 1‑phosphatidylinositol phosphodiesterase/putative lipoprotein
RA USA300TCH1516_ALE 109,970 T→C 7.5% intergenic (+49/‑172) plc → / → USA300HOU_RS00515 1‑phosphatidylinositol phosphodiesterase/putative lipoprotein
RA USA300TCH1516_ALE 110,660 T→A 7.0% I173I (ATT→ATA)  USA300HOU_RS00515 → putative lipoprotein
RA USA300TCH1516_ALE 111,512 A→G 27.3% S194S (TCA→TCG)  USA300HOU_RS00520 → putative lipoprotein
RA USA300TCH1516_ALE 111,516 C→A 26.5% Q196K (CAA→AAA)  USA300HOU_RS00520 → putative lipoprotein
RA USA300TCH1516_ALE 115,755 T→A 13.2% intergenic (+22/‑129) btr → / → yxeP_1 HTH‑type transcriptional activator Btr/putative hydrolase YxeP
RA USA300TCH1516_ALE 115,758 Δ1 bp 13.1% intergenic (+25/‑126) btr → / → yxeP_1 HTH‑type transcriptional activator Btr/putative hydrolase YxeP
RA USA300TCH1516_ALE 115,762:1 +T 13.2% intergenic (+29/‑122) btr → / → yxeP_1 HTH‑type transcriptional activator Btr/putative hydrolase YxeP
RA USA300TCH1516_ALE 115,765 T→A 12.7% intergenic (+32/‑119) btr → / → yxeP_1 HTH‑type transcriptional activator Btr/putative hydrolase YxeP
RA USA300TCH1516_ALE 126,542 A→G 5.7% I119V (ATT→GTT)  lctP_1 → L‑lactate permease
RA USA300TCH1516_ALE 134,187 G→A 8.2% intergenic (‑60/‑171) yfiY ← / → sbnA putative siderophore‑binding lipoprotein YfiY/putative siderophore biosynthesis protein SbnA
RA USA300TCH1516_ALE 168,343 G→A 11.8% intergenic (+310/+38) yfkN_1 → / ← USA300TCH1516_00148 Trifunctional nucleotide phosphoesterase protein YfkN/hypothetical protein
RA USA300TCH1516_ALE 168,350 A→T 12.6% intergenic (+317/+31) yfkN_1 → / ← USA300TCH1516_00148 Trifunctional nucleotide phosphoesterase protein YfkN/hypothetical protein
RA USA300TCH1516_ALE 168,354 C→G 11.9% intergenic (+321/+27) yfkN_1 → / ← USA300TCH1516_00148 Trifunctional nucleotide phosphoesterase protein YfkN/hypothetical protein
RA USA300TCH1516_ALE 168,358 A→T 10.3% intergenic (+325/+23) yfkN_1 → / ← USA300TCH1516_00148 Trifunctional nucleotide phosphoesterase protein YfkN/hypothetical protein
RA USA300TCH1516_ALE 171,069 A→T 6.5% intergenic (+418/‑32) USA300HOU_RS07235 → / → adhE hypothetical protein/Aldehyde‑alcohol dehydrogenase
RA USA300TCH1516_ALE 171,072 A→T 6.4% intergenic (+421/‑29) USA300HOU_RS07235 → / → adhE hypothetical protein/Aldehyde‑alcohol dehydrogenase
RA USA300TCH1516_ALE 186,459 A→G 8.8% Q345R (CAA→CGA)  USA300HOU_RS00855 → hypothetical protein
RA USA300TCH1516_ALE 217,026 A→G 6.2% intergenic (‑220/+33) rocD2_1 ← / ← brnQ_1 Ornithine aminotransferase 2/Branched‑chain amino acid transport system 2 carrier protein
RA USA300TCH1516_ALE 217,027 G→T 6.1% intergenic (‑221/+32) rocD2_1 ← / ← brnQ_1 Ornithine aminotransferase 2/Branched‑chain amino acid transport system 2 carrier protein
RA USA300TCH1516_ALE 217,036 T→A 12.0% intergenic (‑230/+23) rocD2_1 ← / ← brnQ_1 Ornithine aminotransferase 2/Branched‑chain amino acid transport system 2 carrier protein
RA USA300TCH1516_ALE 217,045 A→C 9.3% intergenic (‑239/+14) rocD2_1 ← / ← brnQ_1 Ornithine aminotransferase 2/Branched‑chain amino acid transport system 2 carrier protein
RA USA300TCH1516_ALE 217,046 C→T 8.4% intergenic (‑240/+13) rocD2_1 ← / ← brnQ_1 Ornithine aminotransferase 2/Branched‑chain amino acid transport system 2 carrier protein
RA USA300TCH1516_ALE 228,312 T→C 8.0% intergenic (+158/+36) ybbH_1 → / ← USA300TCH1516_00200 putative HTH‑type transcriptional regulator YbbH/hypothetical protein
RA USA300TCH1516_ALE 228,316 G→A 8.3% intergenic (+162/+32) ybbH_1 → / ← USA300TCH1516_00200 putative HTH‑type transcriptional regulator YbbH/hypothetical protein
RA USA300TCH1516_ALE 228,319 T→C 8.8% intergenic (+165/+29) ybbH_1 → / ← USA300TCH1516_00200 putative HTH‑type transcriptional regulator YbbH/hypothetical protein
RA USA300TCH1516_ALE 253,983 A→G 7.4% intergenic (+196/+166) asbF → / ← USA300HOU_RS01125 3‑dehydroshikimate dehydratase/hypothetical protein
RA USA300TCH1516_ALE 253,984 G→T 7.6% intergenic (+197/+165) asbF → / ← USA300HOU_RS01125 3‑dehydroshikimate dehydratase/hypothetical protein
RA USA300TCH1516_ALE 253,991 A→C 7.4% intergenic (+204/+158) asbF → / ← USA300HOU_RS01125 3‑dehydroshikimate dehydratase/hypothetical protein
RA USA300TCH1516_ALE 253,992 C→T 6.6% intergenic (+205/+157) asbF → / ← USA300HOU_RS01125 3‑dehydroshikimate dehydratase/hypothetical protein
RA USA300TCH1516_ALE 254,002 A→G 5.1% intergenic (+215/+147) asbF → / ← USA300HOU_RS01125 3‑dehydroshikimate dehydratase/hypothetical protein
RA USA300TCH1516_ALE 265,618 A→G 6.1% intergenic (+18/+146) ugpQ_2 → / ← scn_1 Glycerophosphodiester phosphodiesterase, cytoplasmic/Staphylococcal complement inhibitor
RA USA300TCH1516_ALE 265,622 T→G 6.4% intergenic (+22/+142) ugpQ_2 → / ← scn_1 Glycerophosphodiester phosphodiesterase, cytoplasmic/Staphylococcal complement inhibitor
RA USA300TCH1516_ALE 265,628 A→T 6.7% intergenic (+28/+136) ugpQ_2 → / ← scn_1 Glycerophosphodiester phosphodiesterase, cytoplasmic/Staphylococcal complement inhibitor
RA USA300TCH1516_ALE 265,629 G→C 6.9% intergenic (+29/+135) ugpQ_2 → / ← scn_1 Glycerophosphodiester phosphodiesterase, cytoplasmic/Staphylococcal complement inhibitor
RA USA300TCH1516_ALE 265,630 A→T 6.8% intergenic (+30/+134) ugpQ_2 → / ← scn_1 Glycerophosphodiester phosphodiesterase, cytoplasmic/Staphylococcal complement inhibitor
RA USA300TCH1516_ALE 265,636 C→A 7.6% intergenic (+36/+128) ugpQ_2 → / ← scn_1 Glycerophosphodiester phosphodiesterase, cytoplasmic/Staphylococcal complement inhibitor
RA USA300TCH1516_ALE 265,640 C→T 6.7% intergenic (+40/+124) ugpQ_2 → / ← scn_1 Glycerophosphodiester phosphodiesterase, cytoplasmic/Staphylococcal complement inhibitor
RA USA300TCH1516_ALE 269,671 T→G 9.6% T82P (ACG→CCG)  fadA ← 3‑ketoacyl‑CoA thiolase
RA USA300TCH1516_ALE 290,156 A→T 5.6% intergenic (+47/‑180) gatB_1 → / → gatC_1 PTS system galactitol‑specific EIIB component/PTS system galactitol‑specific EIIC component
RA USA300TCH1516_ALE 299,457 G→T 6.0% *390L (TGA→TTA)  tarF_1 → Teichoic acid glycerol‑phosphate transferase
RA USA300TCH1516_ALE 299,460 A→C 5.6% intergenic (+2/‑274) tarF_1 → / → tarI Teichoic acid glycerol‑phosphate transferase/Ribitol‑5‑phosphate cytidylyltransferase 1
RA USA300TCH1516_ALE 341,450 G→C 14.2% D134H (GAT→CAT)  USA300HOU_RS01525 → hypothetical protein
RA USA300TCH1516_ALE 346,350 C→T 5.9% I55I (ATC→ATT)  sotB → sugar efflux transporter
RA USA300TCH1516_ALE 346,353 A→T 5.9% V56V (GTA→GTT)  sotB → sugar efflux transporter
RA USA300TCH1516_ALE 346,356 A→G 5.3% T57T (ACA→ACG)  sotB → sugar efflux transporter
RA USA300TCH1516_ALE 348,156 A→C 10.3% A31A (GCA→GCC)  yezG_5 → putative antitoxin YezG
RA USA300TCH1516_ALE 348,159 G→T 10.4% M32I (ATG→ATT)  yezG_5 → putative antitoxin YezG
RA USA300TCH1516_ALE 372,106 T→A 10.5% intergenic (‑166/‑204) ylbJ ← / → lip2 Sporulation integral membrane protein YlbJ/Lipase 2
RA USA300TCH1516_ALE 401,399 A→C 9.0% intergenic (‑184/‑57) USA300HOU_RS01845 ← / → sutR hypothetical protein/HTH‑type transcriptional regulator SutR
RA USA300TCH1516_ALE 401,404 G→T 8.6% intergenic (‑189/‑52) USA300HOU_RS01845 ← / → sutR hypothetical protein/HTH‑type transcriptional regulator SutR
RA USA300TCH1516_ALE 413,758 G→A 5.7% I167I (ATC→ATT)  metI ← Cystathionine gamma‑synthase/O‑acetylhomoserine (thiol)‑lyase
RA USA300TCH1516_ALE 413,761 A→T 6.0% I166I (ATT→ATA)  metI ← Cystathionine gamma‑synthase/O‑acetylhomoserine (thiol)‑lyase
RA USA300TCH1516_ALE 413,764 T→C 6.0% S165S (TCA→TCG)  metI ← Cystathionine gamma‑synthase/O‑acetylhomoserine (thiol)‑lyase
RA USA300TCH1516_ALE 418,825 A→T 7.2% N53I (AAT→ATT)  rpsF → 30S ribosomal protein S6
RA USA300TCH1516_ALE 419,955 C→T 7.7% intergenic (+173/+93) rpsR → / ← USA300HOU_RS01950 30S ribosomal protein S18/hypothetical protein
RA USA300TCH1516_ALE 419,964 A→T 10.7% intergenic (+182/+84) rpsR → / ← USA300HOU_RS01950 30S ribosomal protein S18/hypothetical protein
RA USA300TCH1516_ALE 419,965 A→T 10.7% intergenic (+183/+83) rpsR → / ← USA300HOU_RS01950 30S ribosomal protein S18/hypothetical protein
RA USA300TCH1516_ALE 428,600 T→C 8.0% T231A (ACT→GCT)  ahpF ← Alkyl hydroperoxide reductase subunit F
RA USA300TCH1516_ALE 428,608 C→G 5.6% G228A (GGT→GCT) ‡ ahpF ← Alkyl hydroperoxide reductase subunit F
RA USA300TCH1516_ALE 428,609 C→G 5.6% G228R (GGT→CGT) ‡ ahpF ← Alkyl hydroperoxide reductase subunit F
RA USA300TCH1516_ALE 447,278:1 +T 5.9% intergenic (+266/‑20) tst_1 → / → speC_1 Toxic shock syndrome toxin‑1/Exotoxin type C
RA USA300TCH1516_ALE 455,079 A→T 6.3% intergenic (+79/‑301) tst_3 → / → speC_5 Toxic shock syndrome toxin‑1/Exotoxin type C
RA USA300TCH1516_ALE 512,643 A→G 12.4% intergenic (+711/‑6052) recR → / → speA_2 Recombination protein RecR/Arginine decarboxylase
RA USA300TCH1516_ALE 536,863 T→A 9.0% intergenic (+56/‑255) rplY → / → pth 50S ribosomal protein L25/Peptidyl‑tRNA hydrolase
RA USA300TCH1516_ALE 536,868 T→A 10.0% intergenic (+61/‑250) rplY → / → pth 50S ribosomal protein L25/Peptidyl‑tRNA hydrolase
RA USA300TCH1516_ALE 536,876 T→C 5.2% intergenic (+69/‑242) rplY → / → pth 50S ribosomal protein L25/Peptidyl‑tRNA hydrolase
RA USA300TCH1516_ALE 536,877 G→A 5.2% intergenic (+70/‑241) rplY → / → pth 50S ribosomal protein L25/Peptidyl‑tRNA hydrolase
RA USA300TCH1516_ALE 576,902 T→A 5.6% intergenic (+325/‑65) gltX → / → cysE Glutamate‑‑tRNA ligase/Serine acetyltransferase
RA USA300TCH1516_ALE 576,908 Δ1 bp 7.7% intergenic (+331/‑59) gltX → / → cysE Glutamate‑‑tRNA ligase/Serine acetyltransferase
RA USA300TCH1516_ALE 576,915 C→G 11.6% intergenic (+338/‑52) gltX → / → cysE Glutamate‑‑tRNA ligase/Serine acetyltransferase
RA USA300TCH1516_ALE 576,920:1 +T 7.9% intergenic (+343/‑47) gltX → / → cysE Glutamate‑‑tRNA ligase/Serine acetyltransferase
RA USA300TCH1516_ALE 581,901 G→C 6.9% V13L (GTG→CTG)  nusG_2 → Transcription termination/antitermination protein NusG
RA USA300TCH1516_ALE 583,939 G→A 6.0% intergenic (+23/‑249) rplA → / → rplJ 50S ribosomal protein L1/50S ribosomal protein L10
RA USA300TCH1516_ALE 583,948 A→T 9.7% intergenic (+32/‑240) rplA → / → rplJ 50S ribosomal protein L1/50S ribosomal protein L10
RA USA300TCH1516_ALE 583,951 A→T 8.0% intergenic (+35/‑237) rplA → / → rplJ 50S ribosomal protein L1/50S ribosomal protein L10
RA USA300TCH1516_ALE 583,960 T→C 6.7% intergenic (+44/‑228) rplA → / → rplJ 50S ribosomal protein L1/50S ribosomal protein L10
RA USA300TCH1516_ALE 593,430 T→A 7.8% intergenic (+22/‑115) rpoC → / → rplGB DNA‑directed RNA polymerase subunit beta'/Ribosome‑associated protein L7Ae‑like protein
RA USA300TCH1516_ALE 593,433 T→A 7.4% intergenic (+25/‑112) rpoC → / → rplGB DNA‑directed RNA polymerase subunit beta'/Ribosome‑associated protein L7Ae‑like protein
RA USA300TCH1516_ALE 594,887 T→A 5.8% intergenic (+41/‑82) rpsG → / → fusA 30S ribosomal protein S7/Elongation factor G
RA USA300TCH1516_ALE 594,888 T→A 5.7% intergenic (+42/‑81) rpsG → / → fusA 30S ribosomal protein S7/Elongation factor G
RA USA300TCH1516_ALE 597,160 G→T 5.4% intergenic (+110/‑107) fusA → / → tuf Elongation factor G/Elongation factor Tu
RA USA300TCH1516_ALE 597,163 A→C 5.6% intergenic (+113/‑104) fusA → / → tuf Elongation factor G/Elongation factor Tu
RA USA300TCH1516_ALE 598,492 A→G 5.9% intergenic (+41/+241) tuf → / ← yxeP_2 Elongation factor Tu/putative hydrolase YxeP
RA USA300TCH1516_ALE 598,495 C→T 5.8% intergenic (+44/+238) tuf → / ← yxeP_2 Elongation factor Tu/putative hydrolase YxeP
RA USA300TCH1516_ALE 604,132 Δ1 bp 6.3% coding (1563/1638 nt) araB → Ribulokinase
RA USA300TCH1516_ALE 631,535 G→A 7.6% intergenic (+161/‑341) gph_1 → / → proP Phosphoglycolate phosphatase/Proline/betaine transporter
RA USA300TCH1516_ALE 631,536 T→C 7.5% intergenic (+162/‑340) gph_1 → / → proP Phosphoglycolate phosphatase/Proline/betaine transporter
RA USA300TCH1516_ALE 631,620 T→C 5.8% intergenic (+246/‑256) gph_1 → / → proP Phosphoglycolate phosphatase/Proline/betaine transporter
RA USA300TCH1516_ALE 631,623 C→A 5.2% intergenic (+249/‑253) gph_1 → / → proP Phosphoglycolate phosphatase/Proline/betaine transporter
RA USA300TCH1516_ALE 631,632:1 +T 5.0% intergenic (+258/‑244) gph_1 → / → proP Phosphoglycolate phosphatase/Proline/betaine transporter
RA USA300TCH1516_ALE 631,637 T→G 5.3% intergenic (+263/‑239) gph_1 → / → proP Phosphoglycolate phosphatase/Proline/betaine transporter
RA USA300TCH1516_ALE 631,640 G→A 5.1% intergenic (+266/‑236) gph_1 → / → proP Phosphoglycolate phosphatase/Proline/betaine transporter
RA USA300TCH1516_ALE 659,371 T→A 8.3% intergenic (+177/‑735) USA300TCH1516_00590 → / → USA300HOU_RS03165 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 659,372 T→G 9.4% intergenic (+178/‑734) USA300TCH1516_00590 → / → USA300HOU_RS03165 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 659,375 C→A 7.3% intergenic (+181/‑731) USA300TCH1516_00590 → / → USA300HOU_RS03165 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 659,376 T→A 7.7% intergenic (+182/‑730) USA300TCH1516_00590 → / → USA300HOU_RS03165 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 667,057 C→A 9.0% P16H (CCT→CAT)  USA300TCH1516_00600 → hypothetical protein
RA USA300TCH1516_ALE 667,064 T→G 11.9% D18E (GAT→GAG)  USA300TCH1516_00600 → hypothetical protein
RA USA300TCH1516_ALE 692,551 Δ1 bp 5.2% coding (423/1092 nt) USA300HOU_RS03340 ← hypothetical protein
RA USA300TCH1516_ALE 693,250 A→G 5.0% A67A (GCT→GCC)  USA300HOU_RS03345 ← hypothetical protein
RA USA300TCH1516_ALE 693,253 G→C 5.2% Y66* (TAC→TAG)  USA300HOU_RS03345 ← hypothetical protein
RA USA300TCH1516_ALE 693,258 T→A 7.8% I65F (ATT→TTT)  USA300HOU_RS03345 ← hypothetical protein
RA USA300TCH1516_ALE 693,263 G→C 5.4% P63R (CCT→CGT)  USA300HOU_RS03345 ← hypothetical protein
RA USA300TCH1516_ALE 695,604 C→T 5.5% Q51* (CAA→TAA)  xerD_2 → Tyrosine recombinase XerD
RA USA300TCH1516_ALE 695,607 G→C 5.4% V52L (GTT→CTT)  xerD_2 → Tyrosine recombinase XerD
RA USA300TCH1516_ALE 695,610 A→G 5.3% K53E (AAG→GAG)  xerD_2 → Tyrosine recombinase XerD
RA USA300TCH1516_ALE 702,553 T→A 6.7% F116I (TTT→ATT)  nhaK_1 → Sodium, potassium, lithium and rubidium/H(+) antiporter
RA USA300TCH1516_ALE 707,909 A→T 100% M1M (TTG→ATG) † znuC_1 ← High‑affinity zinc uptake system ATP‑binding protein ZnuC
RA USA300TCH1516_ALE 722,987 C→T 9.9% T42I (ACA→ATA)  feuB → Iron‑uptake system permease protein FeuB
RA USA300TCH1516_ALE 724,452 G→A 5.9% E197K (GAA→AAA)  feuC_1 → Iron‑uptake system permease protein FeuC
RA USA300TCH1516_ALE 739,247 T→A 8.0% V161D (GTT→GAT)  pitA_1 → Low‑affinity inorganic phosphate transporter 1
RA USA300TCH1516_ALE 739,250 T→A 7.8% I162N (ATC→AAC)  pitA_1 → Low‑affinity inorganic phosphate transporter 1
RA USA300TCH1516_ALE 740,315 Δ1 bp 9.0% intergenic (+542/+46) pitA_1 → / ← sle1_2 Low‑affinity inorganic phosphate transporter 1/N‑acetylmuramoyl‑L‑alanine amidase sle1
RA USA300TCH1516_ALE 740,322 G→C 12.4% intergenic (+549/+39) pitA_1 → / ← sle1_2 Low‑affinity inorganic phosphate transporter 1/N‑acetylmuramoyl‑L‑alanine amidase sle1
RA USA300TCH1516_ALE 740,328:1 +G 10.5% intergenic (+555/+33) pitA_1 → / ← sle1_2 Low‑affinity inorganic phosphate transporter 1/N‑acetylmuramoyl‑L‑alanine amidase sle1
RA USA300TCH1516_ALE 747,521 A→T 5.5% I92I (ATA→ATT)  USA300HOU_RS03630 → hypothetical protein
RA USA300TCH1516_ALE 747,522 A→T 5.4% N93Y (AAT→TAT)  USA300HOU_RS03630 → hypothetical protein
RA USA300TCH1516_ALE 770,855 A→G 6.1% intergenic (+41/‑209) ybaK → / → glcR Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR
RA USA300TCH1516_ALE 770,860 G→A 9.0% intergenic (+46/‑204) ybaK → / → glcR Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR
RA USA300TCH1516_ALE 770,866 A→T 9.3% intergenic (+52/‑198) ybaK → / → glcR Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR
RA USA300TCH1516_ALE 770,870 T→A 9.3% intergenic (+56/‑194) ybaK → / → glcR Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR
RA USA300TCH1516_ALE 770,877 A→T 9.5% intergenic (+63/‑187) ybaK → / → glcR Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR
RA USA300TCH1516_ALE 770,883 T→C 9.8% intergenic (+69/‑181) ybaK → / → glcR Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR
RA USA300TCH1516_ALE 770,888 C→T 6.3% intergenic (+74/‑176) ybaK → / → glcR Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR
RA USA300TCH1516_ALE 779,959 C→T 9.2% intergenic (+15/+57) csbB → / ← saeS Putative glycosyltransferase CsbB/Histidine protein kinase SaeS
RA USA300TCH1516_ALE 779,970 G→A 5.4% intergenic (+26/+46) csbB → / ← saeS Putative glycosyltransferase CsbB/Histidine protein kinase SaeS
RA USA300TCH1516_ALE 803,528 C→T 13.0% intergenic (‑228/+42) USA300HOU_RS03920 ← / ← dtpT Putative lipid kinase/Di‑/tripeptide transporter
RA USA300TCH1516_ALE 803,539 A→G 17.2% intergenic (‑239/+31) USA300HOU_RS03920 ← / ← dtpT Putative lipid kinase/Di‑/tripeptide transporter
RA USA300TCH1516_ALE 837,540:1 +T 11.3% intergenic (+34/‑235) USA300HOU_RS04100 → / → uvrB hypothetical protein/UvrABC system protein B
RA USA300TCH1516_ALE 868,373 A→T 5.5% intergenic (+56/+1266) smpB → / ← USA300HOU_RS04240 SsrA‑binding protein/hypothetical protein
RA USA300TCH1516_ALE 875,946 A→T 8.1% intergenic (+49/‑172) clfA → / → USA300HOU_RS04275 Clumping factor A/Staphylocoagulase
RA USA300TCH1516_ALE 875,947 A→T 7.9% intergenic (+50/‑171) clfA → / → USA300HOU_RS04275 Clumping factor A/Staphylocoagulase
RA USA300TCH1516_ALE 890,015 T→G 5.6% intergenic (+28/‑130) mgsR → / → gcvH Regulatory protein MgsR/Glycine cleavage system H protein
RA USA300TCH1516_ALE 890,016 C→A 5.4% intergenic (+29/‑129) mgsR → / → gcvH Regulatory protein MgsR/Glycine cleavage system H protein
RA USA300TCH1516_ALE 890,542 T→C 10.7% intergenic (+17/‑47) gcvH → / → USA300TCH1516_00820 Glycine cleavage system H protein/hypothetical protein
RA USA300TCH1516_ALE 890,548 A→T 11.3% intergenic (+23/‑41) gcvH → / → USA300TCH1516_00820 Glycine cleavage system H protein/hypothetical protein
RA USA300TCH1516_ALE 895,932 G→A 9.7% intergenic (+131/+12) metQ_2 → / ← Int‑Tn_1 Methionine‑binding lipoprotein MetQ/Transposase from transposon Tn916
RA USA300TCH1516_ALE 895,935 T→C 9.4% intergenic (+134/+9) metQ_2 → / ← Int‑Tn_1 Methionine‑binding lipoprotein MetQ/Transposase from transposon Tn916
RA USA300TCH1516_ALE 897,213:1 +C 5.7% intergenic (‑49/+39) Int‑Tn_1 ← / ← entA_1 Transposase from transposon Tn916/Enterotoxin type A
RA USA300TCH1516_ALE 917,327 T→G 7.6% intergenic (+86/+244) sufB_2 → / ← USA300HOU_RS04545 FeS cluster assembly protein SufB/hypothetical protein
RA USA300TCH1516_ALE 917,330 C→A 7.8% intergenic (+89/+241) sufB_2 → / ← USA300HOU_RS04545 FeS cluster assembly protein SufB/hypothetical protein
RA USA300TCH1516_ALE 927,944 A→T 6.1% intergenic (+164/‑248) ghrB_1 → / → USA300HOU_RS04615 Glyoxylate/hydroxypyruvate reductase B/hypothetical protein
RA USA300TCH1516_ALE 927,945 A→T 6.0% intergenic (+165/‑247) ghrB_1 → / → USA300HOU_RS04615 Glyoxylate/hydroxypyruvate reductase B/hypothetical protein
RA USA300TCH1516_ALE 937,158 T→A 13.8% intergenic (+65/‑66) USA300HOU_RS04665 → / → pepA_1 NADH dehydrogenase‑like protein/Cytosol aminopeptidase
RA USA300TCH1516_ALE 937,168 G→A 6.4% intergenic (+75/‑56) USA300HOU_RS04665 → / → pepA_1 NADH dehydrogenase‑like protein/Cytosol aminopeptidase
RA USA300TCH1516_ALE 940,872 T→C 5.3% intergenic (+53/+3) USA300HOU_RS04680 → / ← ptlE Putative esterase/Neopentalenolactone D synthase
RA USA300TCH1516_ALE 942,207 A→G 7.3% intergenic (‑178/+71) ptlE ← / ← mnhG1 Neopentalenolactone D synthase/Na(+)/H(+) antiporter subunit G1
RA USA300TCH1516_ALE 942,210 C→G 7.0% intergenic (‑181/+68) ptlE ← / ← mnhG1 Neopentalenolactone D synthase/Na(+)/H(+) antiporter subunit G1
RA USA300TCH1516_ALE 942,216 T→A 8.0% intergenic (‑187/+62) ptlE ← / ← mnhG1 Neopentalenolactone D synthase/Na(+)/H(+) antiporter subunit G1
RA USA300TCH1516_ALE 942,221 T→A 8.0% intergenic (‑192/+57) ptlE ← / ← mnhG1 Neopentalenolactone D synthase/Na(+)/H(+) antiporter subunit G1
RA USA300TCH1516_ALE 942,227 C→G 8.0% intergenic (‑198/+51) ptlE ← / ← mnhG1 Neopentalenolactone D synthase/Na(+)/H(+) antiporter subunit G1
RA USA300TCH1516_ALE 942,230 C→T 8.0% intergenic (‑201/+48) ptlE ← / ← mnhG1 Neopentalenolactone D synthase/Na(+)/H(+) antiporter subunit G1
RA USA300TCH1516_ALE 950,088 T→A 14.4% intergenic (+82/‑280) yugI_2 → / → USA300HOU_RS04740 General stress protein 13/putative oxidoreductase
RA USA300TCH1516_ALE 950,093 T→A 16.8% intergenic (+87/‑275) yugI_2 → / → USA300HOU_RS04740 General stress protein 13/putative oxidoreductase
RA USA300TCH1516_ALE 950,098 T→A 16.2% intergenic (+92/‑270) yugI_2 → / → USA300HOU_RS04740 General stress protein 13/putative oxidoreductase
RA USA300TCH1516_ALE 954,763 G→A 6.0% intergenic (+417/+86) gluD → / ← glpQ_1 NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase
RA USA300TCH1516_ALE 954,768 A→T 5.7% intergenic (+422/+81) gluD → / ← glpQ_1 NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase
RA USA300TCH1516_ALE 954,771 T→C 5.5% intergenic (+425/+78) gluD → / ← glpQ_1 NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase
RA USA300TCH1516_ALE 954,775 T→A 5.4% intergenic (+429/+74) gluD → / ← glpQ_1 NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase
RA USA300TCH1516_ALE 954,779 G→A 5.4% intergenic (+433/+70) gluD → / ← glpQ_1 NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase
RA USA300TCH1516_ALE 954,782 A→T 5.3% intergenic (+436/+67) gluD → / ← glpQ_1 NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase
RA USA300TCH1516_ALE 954,787 T→C 5.3% intergenic (+441/+62) gluD → / ← glpQ_1 NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase
RA USA300TCH1516_ALE 970,677 G→A 12.4% intergenic (+23/‑306) USA300HOU_RS04805 → / → USA300HOU_RS04810 Ureidoglycolate lyase/hypothetical protein
RA USA300TCH1516_ALE 970,681 T→A 12.2% intergenic (+27/‑302) USA300HOU_RS04805 → / → USA300HOU_RS04810 Ureidoglycolate lyase/hypothetical protein
RA USA300TCH1516_ALE 970,686 T→A 12.3% intergenic (+32/‑297) USA300HOU_RS04805 → / → USA300HOU_RS04810 Ureidoglycolate lyase/hypothetical protein
RA USA300TCH1516_ALE 970,690 T→C 11.5% intergenic (+36/‑293) USA300HOU_RS04805 → / → USA300HOU_RS04810 Ureidoglycolate lyase/hypothetical protein
RA USA300TCH1516_ALE 973,213 C→A 6.6% E175* (GAG→TAG)  yitU_1 ← 5‑amino‑6‑(5‑phospho‑D‑ribitylamino)uracil phosphatase YitU
RA USA300TCH1516_ALE 977,289 T→A 5.2% I190N (ATT→AAT)  clpB_1 → Chaperone protein ClpB
RA USA300TCH1516_ALE 979,347 T→C 5.2% intergenic (+17/+42) clpB_1 → / ← ampR Chaperone protein ClpB/HTH‑type transcriptional activator AmpR
RA USA300TCH1516_ALE 979,351 G→T 5.2% intergenic (+21/+38) clpB_1 → / ← ampR Chaperone protein ClpB/HTH‑type transcriptional activator AmpR
RA USA300TCH1516_ALE 979,353 T→A 5.2% intergenic (+23/+36) clpB_1 → / ← ampR Chaperone protein ClpB/HTH‑type transcriptional activator AmpR
RA USA300TCH1516_ALE 979,355 A→C 5.3% intergenic (+25/+34) clpB_1 → / ← ampR Chaperone protein ClpB/HTH‑type transcriptional activator AmpR
RA USA300TCH1516_ALE 979,359 G→A 5.9% intergenic (+29/+30) clpB_1 → / ← ampR Chaperone protein ClpB/HTH‑type transcriptional activator AmpR
RA USA300TCH1516_ALE 1,032,588 G→T 5.1% intergenic (+61/+118) yfkN_2 → / ← USA300TCH1516_00957 Trifunctional nucleotide phosphoesterase protein YfkN/tRNA‑Ser
RA USA300TCH1516_ALE 1,042,789 T→C 14.2% intergenic (+19/+70) tagE_3 → / ← catD Poly(glycerol‑phosphate) alpha‑glucosyltransferase/Putative oxidoreductase CatD
RA USA300TCH1516_ALE 1,042,796 G→A 16.6% intergenic (+26/+63) tagE_3 → / ← catD Poly(glycerol‑phosphate) alpha‑glucosyltransferase/Putative oxidoreductase CatD
RA USA300TCH1516_ALE 1,044,663 T→C 9.6% intergenic (+12/+34) yfmC_1 → / ← USA300HOU_RS05165 Fe(3+)‑citrate‑binding protein YfmC/hypothetical protein
RA USA300TCH1516_ALE 1,044,668 G→T 9.5% intergenic (+17/+29) yfmC_1 → / ← USA300HOU_RS05165 Fe(3+)‑citrate‑binding protein YfmC/hypothetical protein
RA USA300TCH1516_ALE 1,044,671 A→T 9.7% intergenic (+20/+26) yfmC_1 → / ← USA300HOU_RS05165 Fe(3+)‑citrate‑binding protein YfmC/hypothetical protein
RA USA300TCH1516_ALE 1,044,674 C→G 9.4% intergenic (+23/+23) yfmC_1 → / ← USA300HOU_RS05165 Fe(3+)‑citrate‑binding protein YfmC/hypothetical protein
RA USA300TCH1516_ALE 1,044,677 A→T 9.6% intergenic (+26/+20) yfmC_1 → / ← USA300HOU_RS05165 Fe(3+)‑citrate‑binding protein YfmC/hypothetical protein
RA USA300TCH1516_ALE 1,044,680 A→C 9.5% intergenic (+29/+17) yfmC_1 → / ← USA300HOU_RS05165 Fe(3+)‑citrate‑binding protein YfmC/hypothetical protein
RA USA300TCH1516_ALE 1,044,685 G→A 9.1% intergenic (+34/+12) yfmC_1 → / ← USA300HOU_RS05165 Fe(3+)‑citrate‑binding protein YfmC/hypothetical protein
RA USA300TCH1516_ALE 1,049,713 G→T 5.1% Q457H (CAG→CAT)  menD → 2‑succinyl‑5‑enolpyruvyl‑6‑hydroxy‑3‑ cyclohexene‑1‑carboxylate synthase
RA USA300TCH1516_ALE 1,049,714 A→C 5.3% M458L (ATG→CTG)  menD → 2‑succinyl‑5‑enolpyruvyl‑6‑hydroxy‑3‑ cyclohexene‑1‑carboxylate synthase
RA USA300TCH1516_ALE 1,055,119 C→A 5.6% G355C (GGT→TGT)  patA_2 ← Putative N‑acetyl‑LL‑diaminopimelate aminotransferase
RA USA300TCH1516_ALE 1,055,126 T→G 11.2% T352T (ACA→ACC)  patA_2 ← Putative N‑acetyl‑LL‑diaminopimelate aminotransferase
RA USA300TCH1516_ALE 1,060,234 T→A 10.1% K568I (AAA→ATA) ‡ atl_1 ← Bifunctional autolysin
RA USA300TCH1516_ALE 1,060,235 T→A 10.1% K568* (AAA→TAA) ‡ atl_1 ← Bifunctional autolysin
RA USA300TCH1516_ALE 1,078,152 A→T 13.1% Q510L (CAG→CTG)  purL → Phosphoribosylformylglycinamidine synthase subunit PurL
RA USA300TCH1516_ALE 1,089,908 T→G 5.5% intergenic (+61/‑364) USA300HOU_RS05380 → / → rlmI hypothetical protein/Ribosomal RNA large subunit methyltransferase I
RA USA300TCH1516_ALE 1,089,913 C→A 5.7% intergenic (+66/‑359) USA300HOU_RS05380 → / → rlmI hypothetical protein/Ribosomal RNA large subunit methyltransferase I
RA USA300TCH1516_ALE 1,104,520 T→A 11.2% L309* (TTA→TAA)  pdhB → Pyruvate dehydrogenase E1 component subunit beta
RA USA300TCH1516_ALE 1,105,994 T→C 100% T12T (ACT→ACC)  pdhD → Dihydrolipoyl dehydrogenase
RA USA300TCH1516_ALE 1,107,402 T→C 12.7% intergenic (+37/‑131) pdhD → / → USA300HOU_RS05475 Dihydrolipoyl dehydrogenase/hypothetical protein
RA USA300TCH1516_ALE 1,107,417 G→A 9.1% intergenic (+52/‑116) pdhD → / → USA300HOU_RS05475 Dihydrolipoyl dehydrogenase/hypothetical protein
RA USA300TCH1516_ALE 1,128,680 T→A 5.8% Y286N (TAT→AAT)  ctaB2 → Protoheme IX farnesyltransferase 2
RA USA300TCH1516_ALE 1,137,594 G→A 6.6% Y214Y (TAC→TAT)  isdB ← Iron‑regulated surface determinant protein B
RA USA300TCH1516_ALE 1,137,597 T→C 5.8% S213S (TCA→TCG)  isdB ← Iron‑regulated surface determinant protein B
RA USA300TCH1516_ALE 1,155,991 G→C 8.0% intergenic (+167/‑6) mutS2 → / → trxA_2 Endonuclease MutS2/Thioredoxin
RA USA300TCH1516_ALE 1,156,333 G→A 6.2% intergenic (+22/‑302) trxA_2 → / → uvrC Thioredoxin/UvrABC system protein C
RA USA300TCH1516_ALE 1,156,337 T→A 6.6% intergenic (+26/‑298) trxA_2 → / → uvrC Thioredoxin/UvrABC system protein C
RA USA300TCH1516_ALE 1,156,341 T→A 6.6% intergenic (+30/‑294) trxA_2 → / → uvrC Thioredoxin/UvrABC system protein C
RA USA300TCH1516_ALE 1,156,346 T→A 5.8% intergenic (+35/‑289) trxA_2 → / → uvrC Thioredoxin/UvrABC system protein C
RA USA300TCH1516_ALE 1,156,350 T→A 5.1% intergenic (+39/‑285) trxA_2 → / → uvrC Thioredoxin/UvrABC system protein C
RA USA300TCH1516_ALE 1,158,427 G→A 9.0% intergenic (+11/‑313) uvrC → / → sdhC UvrABC system protein C/Succinate dehydrogenase cytochrome b558 subunit
RA USA300TCH1516_ALE 1,158,443 T→C 5.2% intergenic (+27/‑297) uvrC → / → sdhC UvrABC system protein C/Succinate dehydrogenase cytochrome b558 subunit
RA USA300TCH1516_ALE 1,177,493 C→A 5.1% intergenic (+12/‑160) arcC1_2 → / → USA300HOU_RS05870 Carbamate kinase 1/hypothetical protein
RA USA300TCH1516_ALE 1,177,496 T→G 5.1% intergenic (+15/‑157) arcC1_2 → / → USA300HOU_RS05870 Carbamate kinase 1/hypothetical protein
RA USA300TCH1516_ALE 1,218,730 G→T 7.1% intergenic (+221/+42) USA300HOU_RS06065 → / ← USA300HOU_RS06070 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 1,218,732 C→G 7.5% intergenic (+223/+40) USA300HOU_RS06065 → / ← USA300HOU_RS06070 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 1,218,734 A→C 7.4% intergenic (+225/+38) USA300HOU_RS06065 → / ← USA300HOU_RS06070 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 1,219,566 A→T 5.6% Y302N (TAC→AAC)  USA300HOU_RS06070 ← hypothetical protein
RA USA300TCH1516_ALE 1,219,571 T→A 7.6% Q300L (CAG→CTG)  USA300HOU_RS06070 ← hypothetical protein
RA USA300TCH1516_ALE 1,219,574 T→A 7.5% Q299L (CAG→CTG)  USA300HOU_RS06070 ← hypothetical protein
RA USA300TCH1516_ALE 1,219,579 A→T 6.2% V297V (GTT→GTA)  USA300HOU_RS06070 ← hypothetical protein
RA USA300TCH1516_ALE 1,221,653 G→A 7.1% intergenic (+68/‑148) rpoZ → / → coaBC DNA‑directed RNA polymerase subunit omega/Coenzyme A biosynthesis bifunctional protein CoaBC
RA USA300TCH1516_ALE 1,239,557:1 +C 7.9% intergenic (+24/‑166) USA300HOU_RS06160 → / → recG hypothetical protein/ATP‑dependent DNA helicase RecG
RA USA300TCH1516_ALE 1,239,562 A→G 7.9% intergenic (+29/‑161) USA300HOU_RS06160 → / → recG hypothetical protein/ATP‑dependent DNA helicase RecG
RA USA300TCH1516_ALE 1,239,564 A→T 7.7% intergenic (+31/‑159) USA300HOU_RS06160 → / → recG hypothetical protein/ATP‑dependent DNA helicase RecG
RA USA300TCH1516_ALE 1,239,566 C→T 7.8% intergenic (+33/‑157) USA300HOU_RS06160 → / → recG hypothetical protein/ATP‑dependent DNA helicase RecG
RA USA300TCH1516_ALE 1,239,571 Δ1 bp 7.3% intergenic (+38/‑152) USA300HOU_RS06160 → / → recG hypothetical protein/ATP‑dependent DNA helicase RecG
RA USA300TCH1516_ALE 1,245,330 A→T 8.0% intergenic (+135/‑108) fabG → / → acpP 3‑oxoacyl‑[acyl‑carrier‑protein] reductase FabG/Acyl carrier protein
RA USA300TCH1516_ALE 1,245,337 A→T 8.5% intergenic (+142/‑101) fabG → / → acpP 3‑oxoacyl‑[acyl‑carrier‑protein] reductase FabG/Acyl carrier protein
RA USA300TCH1516_ALE 1,245,338 A→T 8.5% intergenic (+143/‑100) fabG → / → acpP 3‑oxoacyl‑[acyl‑carrier‑protein] reductase FabG/Acyl carrier protein
RA USA300TCH1516_ALE 1,245,345 A→T 7.0% intergenic (+150/‑93) fabG → / → acpP 3‑oxoacyl‑[acyl‑carrier‑protein] reductase FabG/Acyl carrier protein
RA USA300TCH1516_ALE 1,254,017 A→T 6.9% intergenic (+114/‑74) rpsP → / → rimM 30S ribosomal protein S16/Ribosome maturation factor RimM
RA USA300TCH1516_ALE 1,270,460 C→G 7.4% intergenic (+211/‑206) trmFO → / → xerC_1 Methylenetetrahydrofolate‑‑tRNA‑(uracil‑5‑)‑ methyltransferase TrmFO/Tyrosine recombinase XerC
RA USA300TCH1516_ALE 1,273,925 C→T 9.3% R110C (CGT→TGT)  codY → GTP‑sensing transcriptional pleiotropic repressor CodY
RA USA300TCH1516_ALE 1,273,930 A→G 11.7% T111T (ACA→ACG)  codY → GTP‑sensing transcriptional pleiotropic repressor CodY
RA USA300TCH1516_ALE 1,313,113 A→T 9.9% intergenic (+17/+280) rny_1 → / ← USA300HOU_RS06485 Ribonuclease Y/hypothetical protein
RA USA300TCH1516_ALE 1,331,236 T→A 8.9% S189T (TCT→ACT)  USA300HOU_RS06555 → Monoacylglycerol lipase
RA USA300TCH1516_ALE 1,331,241 T→A 9.5% S190R (AGT→AGA)  USA300HOU_RS06555 → Monoacylglycerol lipase
RA USA300TCH1516_ALE 1,343,619 A→C 10.3% intergenic (+32/‑98) USA300HOU_RS06640 → / → USA300TCH1516_01248 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 1,343,622 G→T 10.3% intergenic (+35/‑95) USA300HOU_RS06640 → / → USA300TCH1516_01248 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 1,360,384 T→A 5.5% H233Q (CAT→CAA)  thrB_2 → Homoserine kinase
RA USA300TCH1516_ALE 1,362,249 A→T 5.8% intergenic (‑181/+37) USA300TCH1516_01271 ← / ← lysP_1 hypothetical protein/Lysine‑specific permease
RA USA300TCH1516_ALE 1,362,255 A→T 8.6% intergenic (‑187/+31) USA300TCH1516_01271 ← / ← lysP_1 hypothetical protein/Lysine‑specific permease
RA USA300TCH1516_ALE 1,362,261 A→T 9.3% intergenic (‑193/+25) USA300TCH1516_01271 ← / ← lysP_1 hypothetical protein/Lysine‑specific permease
RA USA300TCH1516_ALE 1,362,267 C→T 6.6% intergenic (‑199/+19) USA300TCH1516_01271 ← / ← lysP_1 hypothetical protein/Lysine‑specific permease
RA USA300TCH1516_ALE 1,366,121 A→T 12.2% intergenic (+420/‑34) rpmG2_1 → / → rpsN2 50S ribosomal protein L33 2/Alternate 30S ribosomal protein S14
RA USA300TCH1516_ALE 1,368,899 C→A 5.3% intergenic (+303/+77) USA300TCH1516_01277 → / ← lexA_1 hypothetical protein/LexA repressor
RA USA300TCH1516_ALE 1,368,902 A→T 5.5% intergenic (+306/+74) USA300TCH1516_01277 → / ← lexA_1 hypothetical protein/LexA repressor
RA USA300TCH1516_ALE 1,373,008 G→T 5.1% intergenic (+29/‑150) USA300HOU_RS06835 → / → USA300TCH1516_01283 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 1,373,011 A→C 5.2% intergenic (+32/‑147) USA300HOU_RS06835 → / → USA300TCH1516_01283 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 1,394,305 A→G 7.9% T178T (ACA→ACG)  tqsA → AI‑2 transport protein TqsA
RA USA300TCH1516_ALE 1,415,013 C→G 5.6% intergenic (+24/+24) yitU_2 → / ← mqo 5‑amino‑6‑(5‑phospho‑D‑ribitylamino)uracil phosphatase YitU/malate:quinone oxidoreductase
RA USA300TCH1516_ALE 1,416,458 A→T 100% I216N (ATT→AAT)  oppD_4 ← Oligopeptide transport ATP‑binding protein OppD
RA USA300TCH1516_ALE 1,421,606 T→C 6.1% intergenic (+42/+98) pepF1_2 → / ← phoU Oligoendopeptidase F, plasmid/Phosphate‑specific transport system accessory protein PhoU
RA USA300TCH1516_ALE 1,421,610:1 +A 6.1% intergenic (+46/+94) pepF1_2 → / ← phoU Oligoendopeptidase F, plasmid/Phosphate‑specific transport system accessory protein PhoU
RA USA300TCH1516_ALE 1,421,615 C→G 6.3% intergenic (+51/+89) pepF1_2 → / ← phoU Oligoendopeptidase F, plasmid/Phosphate‑specific transport system accessory protein PhoU
RA USA300TCH1516_ALE 1,421,619 Δ1 bp 5.7% intergenic (+55/+85) pepF1_2 → / ← phoU Oligoendopeptidase F, plasmid/Phosphate‑specific transport system accessory protein PhoU
RA USA300TCH1516_ALE 1,421,625 G→A 6.3% intergenic (+61/+79) pepF1_2 → / ← phoU Oligoendopeptidase F, plasmid/Phosphate‑specific transport system accessory protein PhoU
RA USA300TCH1516_ALE 1,430,691 C→G 6.7% intergenic (+800/‑60) ybiT → / → lysC putative ABC transporter ATP‑binding protein YbiT/Aspartokinase
RA USA300TCH1516_ALE 1,430,693 T→A 6.7% intergenic (+802/‑58) ybiT → / → lysC putative ABC transporter ATP‑binding protein YbiT/Aspartokinase
RA USA300TCH1516_ALE 1,430,695 C→G 6.7% intergenic (+804/‑56) ybiT → / → lysC putative ABC transporter ATP‑binding protein YbiT/Aspartokinase
RA USA300TCH1516_ALE 1,435,075 T→A 9.6% G144G (GGT→GGA)  dapH → 2,3,4,5‑tetrahydropyridine‑2,6‑dicarboxylate N‑acetyltransferase
RA USA300TCH1516_ALE 1,447,040 T→A 6.0% E65D (GAA→GAT)  cobT ← Aerobic cobaltochelatase subunit CobT
RA USA300TCH1516_ALE 1,447,045 T→A 6.1% I64F (ATC→TTC)  cobT ← Aerobic cobaltochelatase subunit CobT
RA USA300TCH1516_ALE 1,452,976 G→C 7.8% H316D (CAC→GAC)  odhA ← 2‑oxoglutarate dehydrogenase E1 component
RA USA300TCH1516_ALE 1,465,105 C→G 7.8% E18Q (GAA→CAA)  folA ← Dihydrofolate reductase
RA USA300TCH1516_ALE 1,465,110 C→T 7.4% G16D (GGT→GAT)  folA ← Dihydrofolate reductase
RA USA300TCH1516_ALE 1,487,340 T→A 7.3% H4895L (CAT→CTT)  ebh_1 ← Extracellular matrix‑binding protein ebh
RA USA300TCH1516_ALE 1,487,343 T→A 7.4% K4894M (AAG→ATG)  ebh_1 ← Extracellular matrix‑binding protein ebh
RA USA300TCH1516_ALE 1,502,422 C→G 5.6% *464S (TGA→TCA)  norB_4 ← Quinolone resistance protein NorB
RA USA300TCH1516_ALE 1,513,930 A→T 100% L413F (TTA→TTT)  USA300HOU_RS07375 → hypothetical protein
RA USA300TCH1516_ALE 1,526,532 T→A 7.2% K471* (AAA→TAA)  dinG_1 ← putative ATP‑dependent helicase DinG
RA USA300TCH1516_ALE 1,537,428 A→T 6.5% I94I (ATT→ATA)  aroB ← 3‑dehydroquinate synthase
RA USA300TCH1516_ALE 1,539,250 C→G 100% intergenic (‑349/+37) aroC ← / ← USA300HOU_RS07505 Chorismate synthase/hypothetical protein
RA USA300TCH1516_ALE 1,540,018 T→A 7.8% E43V (GAA→GTA)  ndk ← Nucleoside diphosphate kinase
RA USA300TCH1516_ALE 1,540,022 T→A 7.6% M42L (ATG→TTG)  ndk ← Nucleoside diphosphate kinase
RA USA300TCH1516_ALE 1,540,026 T→A 5.5% V40V (GTA→GTT)  ndk ← Nucleoside diphosphate kinase
RA USA300TCH1516_ALE 1,582,474 G→A 8.6% H107H (CAC→CAT)  clpP1 ← ATP‑dependent Clp protease proteolytic subunit 1
RA USA300TCH1516_ALE 1,582,479 T→C 9.3% M106V (ATG→GTG)  clpP1 ← ATP‑dependent Clp protease proteolytic subunit 1
RA USA300TCH1516_ALE 1,646,189 G→C 100% A155G (GCA→GGA)  ypdF ← Aminopeptidase YpdF
RA USA300TCH1516_ALE 1,653,040 A→C 5.6% L86V (TTA→GTA)  gcvT ← Aminomethyltransferase
RA USA300TCH1516_ALE 1,653,327 A→G 8.8% intergenic (‑32/+127) gcvT ← / ← aroK Aminomethyltransferase/Shikimate kinase
RA USA300TCH1516_ALE 1,653,332 A→G 9.3% intergenic (‑37/+122) gcvT ← / ← aroK Aminomethyltransferase/Shikimate kinase
RA USA300TCH1516_ALE 1,653,335 C→T 8.9% intergenic (‑40/+119) gcvT ← / ← aroK Aminomethyltransferase/Shikimate kinase
RA USA300TCH1516_ALE 1,653,340 C→T 8.0% intergenic (‑45/+114) gcvT ← / ← aroK Aminomethyltransferase/Shikimate kinase
RA USA300TCH1516_ALE 1,674,892 C→G 6.3% D42H (GAT→CAT)  dnaG ← DNA primase
RA USA300TCH1516_ALE 1,685,129 T→A 7.9% intergenic (‑141/+79) USA300HOU_RS08395 ← / ← rpsU hypothetical protein/30S ribosomal protein S21
RA USA300TCH1516_ALE 1,685,130 A→G 7.5% intergenic (‑142/+78) USA300HOU_RS08395 ← / ← rpsU hypothetical protein/30S ribosomal protein S21
RA USA300TCH1516_ALE 1,685,139 A→T 8.4% intergenic (‑151/+69) USA300HOU_RS08395 ← / ← rpsU hypothetical protein/30S ribosomal protein S21
RA USA300TCH1516_ALE 1,685,148 C→T 7.0% intergenic (‑160/+60) USA300HOU_RS08395 ← / ← rpsU hypothetical protein/30S ribosomal protein S21
RA USA300TCH1516_ALE 1,685,149 T→A 7.1% intergenic (‑161/+59) USA300HOU_RS08395 ← / ← rpsU hypothetical protein/30S ribosomal protein S21
RA USA300TCH1516_ALE 1,695,087 C→T 6.0% intergenic (‑293/+237) hemN_1 ← / ← lepA Oxygen‑independent coproporphyrinogen‑III oxidase‑like protein YqeR/Elongation factor 4
RA USA300TCH1516_ALE 1,702,671 G→C 7.1% I117M (ATC→ATG)  tylM1 ← dTDP‑3‑amino‑3,6‑dideoxy‑alpha‑D‑glucopyranose N,N‑dimethyltransferase
RA USA300TCH1516_ALE 1,702,674 G→C 6.1% F116L (TTC→TTG)  tylM1 ← dTDP‑3‑amino‑3,6‑dideoxy‑alpha‑D‑glucopyranose N,N‑dimethyltransferase
RA USA300TCH1516_ALE 1,711,515 T→C 5.2% M383V (ATG→GTG)  mntH_2 ← Divalent metal cation transporter MntH
RA USA300TCH1516_ALE 1,722,313 G→A 7.8% Q3* (CAA→TAA)  yrrK ← Putative pre‑16S rRNA nuclease
RA USA300TCH1516_ALE 1,722,314 T→C 7.7% L2L (TTA→TTG)  yrrK ← Putative pre‑16S rRNA nuclease
RA USA300TCH1516_ALE 1,725,379 T→A 5.6% intergenic (‑100/+240) alaS ← / ← recD2 Alanine‑‑tRNA ligase/ATP‑dependent RecD‑like DNA helicase
RA USA300TCH1516_ALE 1,725,382 T→A 5.6% intergenic (‑103/+237) alaS ← / ← recD2 Alanine‑‑tRNA ligase/ATP‑dependent RecD‑like DNA helicase
RA USA300TCH1516_ALE 1,733,445 T→A 5.6% intergenic (‑26/+74) csbD_2 ← / ← cymR Stress response protein CsbD/HTH‑type transcriptional regulator CymR
RA USA300TCH1516_ALE 1,733,446 T→A 5.7% intergenic (‑27/+73) csbD_2 ← / ← cymR Stress response protein CsbD/HTH‑type transcriptional regulator CymR
RA USA300TCH1516_ALE 1,744,473 C→T 100% A67T (GCT→ACT)  apt ← Adenine phosphoribosyltransferase
RA USA300TCH1516_ALE 1,758,213 T→A 5.3% K72I (AAA→ATA)  mreC ← Cell shape‑determining protein MreC
RA USA300TCH1516_ALE 1,779,807 A→G 6.2% intergenic (‑113/+29) USA300TCH1516_01664 ← / ← rplT hypothetical protein/50S ribosomal protein L20
RA USA300TCH1516_ALE 1,779,810 A→T 6.2% intergenic (‑116/+26) USA300TCH1516_01664 ← / ← rplT hypothetical protein/50S ribosomal protein L20
RA USA300TCH1516_ALE 1,779,813 C→T 6.0% intergenic (‑119/+23) USA300TCH1516_01664 ← / ← rplT hypothetical protein/50S ribosomal protein L20
RA USA300TCH1516_ALE 1,794,352 A→T 12.4% Y426N (TAT→AAT)  USA300HOU_RS08960 ← hypothetical protein
RA USA300TCH1516_ALE 1,808,248 C→T 5.4% intergenic (‑148/+121) pfkA ← / ← accA ATP‑dependent 6‑phosphofructokinase/Acetyl‑coenzyme A carboxylase carboxyl transferase subunit alpha
RA USA300TCH1516_ALE 1,808,251 C→A 6.1% intergenic (‑151/+118) pfkA ← / ← accA ATP‑dependent 6‑phosphofructokinase/Acetyl‑coenzyme A carboxylase carboxyl transferase subunit alpha
RA USA300TCH1516_ALE 1,808,256 T→G 5.3% intergenic (‑156/+113) pfkA ← / ← accA ATP‑dependent 6‑phosphofructokinase/Acetyl‑coenzyme A carboxylase carboxyl transferase subunit alpha
RA USA300TCH1516_ALE 1,829,661 T→A 5.2% T487S (ACA→TCA)  ezrA ← Septation ring formation regulator EzrA
RA USA300TCH1516_ALE 1,837,960 A→T 10.8% D79E (GAT→GAA)  gph_2 ← Phosphoglycolate phosphatase
RA USA300TCH1516_ALE 1,839,436 C→G 6.0% E112Q (GAA→CAA)  nagE ← PTS system N‑acetylglucosamine‑specific EIICBA component
RA USA300TCH1516_ALE 1,845,292 C→T 7.8% M734I (ATG→ATA)  isdH ← Iron‑regulated surface determinant protein H
RA USA300TCH1516_ALE 1,845,295 A→G 8.1% D733D (GAT→GAC)  isdH ← Iron‑regulated surface determinant protein H
RA USA300TCH1516_ALE 1,850,922 T→A 6.9% Q227H (CAA→CAT)  acsA_1 ← Acetyl‑coenzyme A synthetase
RA USA300TCH1516_ALE 1,850,927 G→C 6.9% Q226E (CAA→GAA)  acsA_1 ← Acetyl‑coenzyme A synthetase
RA USA300TCH1516_ALE 1,850,932 T→A 6.2% H224L (CAT→CTT)  acsA_1 ← Acetyl‑coenzyme A synthetase
RA USA300TCH1516_ALE 1,869,034 T→G 5.3% intergenic (‑441/+29) ytnP ← / ← trmB putative quorum‑quenching lactonase YtnP/tRNA (guanine‑N(7)‑)‑methyltransferase
RA USA300TCH1516_ALE 1,869,035 T→G 5.6% intergenic (‑442/+28) ytnP ← / ← trmB putative quorum‑quenching lactonase YtnP/tRNA (guanine‑N(7)‑)‑methyltransferase
RA USA300TCH1516_ALE 1,869,042 G→A 6.5% intergenic (‑449/+21) ytnP ← / ← trmB putative quorum‑quenching lactonase YtnP/tRNA (guanine‑N(7)‑)‑methyltransferase
RA USA300TCH1516_ALE 1,869,043 T→C 6.7% intergenic (‑450/+20) ytnP ← / ← trmB putative quorum‑quenching lactonase YtnP/tRNA (guanine‑N(7)‑)‑methyltransferase
RA USA300TCH1516_ALE 1,869,050 C→A 5.5% intergenic (‑457/+13) ytnP ← / ← trmB putative quorum‑quenching lactonase YtnP/tRNA (guanine‑N(7)‑)‑methyltransferase
RA USA300TCH1516_ALE 1,869,051 C→A 5.5% intergenic (‑458/+12) ytnP ← / ← trmB putative quorum‑quenching lactonase YtnP/tRNA (guanine‑N(7)‑)‑methyltransferase
RA USA300TCH1516_ALE 1,870,863 C→T 7.0% intergenic (‑350/+200) srkA ← / ← dat Stress response kinase A/D‑alanine aminotransferase
RA USA300TCH1516_ALE 1,870,864 A→G 7.0% intergenic (‑351/+199) srkA ← / ← dat Stress response kinase A/D‑alanine aminotransferase
RA USA300TCH1516_ALE 1,885,368 G→A 5.9% intergenic (‑150/+176) ebh_2 ← / ← moeZ_2 Extracellular matrix‑binding protein ebh/putative adenylyltransferase/sulfurtransferase MoeZ
RA USA300TCH1516_ALE 1,885,369 T→C 5.3% intergenic (‑151/+175) ebh_2 ← / ← moeZ_2 Extracellular matrix‑binding protein ebh/putative adenylyltransferase/sulfurtransferase MoeZ
RA USA300TCH1516_ALE 1,905,775 G→C 5.1% E128Q (GAA→CAA)  sigS → RNA polymerase sigma factor SigS
RA USA300TCH1516_ALE 1,909,134 T→A 7.6% intergenic (‑200/‑60) tal ← / → USA300HOU_RS09460 Transaldolase/hypothetical protein
RA USA300TCH1516_ALE 1,909,137 T→A 7.6% intergenic (‑203/‑57) tal ← / → USA300HOU_RS09460 Transaldolase/hypothetical protein
RA USA300TCH1516_ALE 1,918,555 G→A 5.3% intergenic (‑273/+225) USA300HOU_RS07235 ← / ← USA300HOU_RS09510 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 1,929,565 C→T 5.6% D34N (GAT→AAT)  USA300TCH1516_01793 ← hypothetical protein
RA USA300TCH1516_ALE 1,929,570 T→G 5.2% E32A (GAG→GCG)  USA300TCH1516_01793 ← hypothetical protein
RA USA300TCH1516_ALE 1,929,573 C→A 5.3% R31L (CGC→CTC)  USA300TCH1516_01793 ← hypothetical protein
RA USA300TCH1516_ALE 1,929,578 A→G 5.5% I29I (ATT→ATC)  USA300TCH1516_01793 ← hypothetical protein
RA USA300TCH1516_ALE 1,931,599 A→T 9.1% L1217I (TTA→ATA)  USA300HOU_RS09605 ← hypothetical protein
RA USA300TCH1516_ALE 1,934,780 A→T 6.8% N156K (AAT→AAA)  USA300HOU_RS09605 ← hypothetical protein
RA USA300TCH1516_ALE 1,962,391 A→C 5.1% intergenic (‑280/+192) USA300TCH1516_01825 ← / ← ydeN tRNA‑Met/Putative hydrolase YdeN
RA USA300TCH1516_ALE 1,962,395 A→G 5.3% intergenic (‑284/+188) USA300TCH1516_01825 ← / ← ydeN tRNA‑Met/Putative hydrolase YdeN
RA USA300TCH1516_ALE 1,972,372 G→A 6.5% A23T (GCT→ACT)  prsA → Foldase protein PrsA
RA USA300TCH1516_ALE 1,972,377 T→C 9.0% S24S (AGT→AGC)  prsA → Foldase protein PrsA
RA USA300TCH1516_ALE 1,985,405 T→A 7.0% P314P (CCA→CCT)  fumC ← Fumarate hydratase class II
RA USA300TCH1516_ALE 1,997,236 C→G 5.2% noncoding (53/92 nt) USA300TCH1516_01871 ← tRNA‑Ser
RA USA300TCH1516_ALE 2,010,363 C→T 100% C146Y (TGT→TAT)  USA300HOU_RS10125 ← Putative multidrug export ATP‑binding/permease protein
RA USA300TCH1516_ALE 2,042,100 T→A 8.4% K338N (AAA→AAT)  gatB_2 ← Aspartyl/glutamyl‑tRNA(Asn/Gln) amidotransferase subunit B
RA USA300TCH1516_ALE 2,046,831 A→G 8.2% intergenic (+39/+50) putP → / ← USA300HOU_RS10335 Sodium/proline symporter/hypothetical protein
RA USA300TCH1516_ALE 2,046,835 A→T 8.2% intergenic (+43/+46) putP → / ← USA300HOU_RS10335 Sodium/proline symporter/hypothetical protein
RA USA300TCH1516_ALE 2,046,840 A→T 8.1% intergenic (+48/+41) putP → / ← USA300HOU_RS10335 Sodium/proline symporter/hypothetical protein
RA USA300TCH1516_ALE 2,046,844 C→T 7.5% intergenic (+52/+37) putP → / ← USA300HOU_RS10335 Sodium/proline symporter/hypothetical protein
RA USA300TCH1516_ALE 2,077,620 T→G 6.5% L174L (CTA→CTC)  yxlF_3 ← putative ABC transporter ATP‑binding protein YxlF
RA USA300TCH1516_ALE 2,077,629 C→A 8.5% M171I (ATG→ATT)  yxlF_3 ← putative ABC transporter ATP‑binding protein YxlF
RA USA300TCH1516_ALE 2,084,859 C→G 6.5% intergenic (‑121/‑265) USA300HOU_RS10525 ← / → hlb_1 65 kDa membrane protein/Phospholipase C
RA USA300TCH1516_ALE 2,123,544 T→A 6.9% N66I (AAT→ATT)  USA300HOU_RS10825 ← hypothetical protein
RA USA300TCH1516_ALE 2,123,779 T→A 5.8% intergenic (‑39/‑94) USA300HOU_RS10825 ← / → lexA_2 hypothetical protein/LexA repressor
RA USA300TCH1516_ALE 2,133,485 Δ1 bp 6.3% intergenic (+329/+43) dapE → / ← USA300HOU_RS10885 putative succinyl‑diaminopimelate desuccinylase/hypothetical protein
RA USA300TCH1516_ALE 2,133,490 A→T 6.6% intergenic (+334/+38) dapE → / ← USA300HOU_RS10885 putative succinyl‑diaminopimelate desuccinylase/hypothetical protein
RA USA300TCH1516_ALE 2,133,494:1 +G 5.6% intergenic (+338/+34) dapE → / ← USA300HOU_RS10885 putative succinyl‑diaminopimelate desuccinylase/hypothetical protein
RA USA300TCH1516_ALE 2,135,944 A→T 5.4% K146N (AAA→AAT)  ktrB_2 → Ktr system potassium uptake protein B
RA USA300TCH1516_ALE 2,138,306 A→T 5.2% F104Y (TTT→TAT) ‡ USA300HOU_RS10905 ← hypothetical protein
RA USA300TCH1516_ALE 2,138,307 A→T 5.2% F104I (TTT→ATT) ‡ USA300HOU_RS10905 ← hypothetical protein
RA USA300TCH1516_ALE 2,139,620 T→A 9.3% intergenic (‑60/+851) USA300HOU_RS10910 ← / ← groL hypothetical protein/60 kDa chaperonin
RA USA300TCH1516_ALE 2,145,549 T→G 5.6% intergenic (+83/‑278) USA300HOU_RS10945 → / → USA300HOU_RS10950 hypothetical protein/2‑oxoglutaramate amidase
RA USA300TCH1516_ALE 2,165,416 A→T 8.5% intergenic (‑384/‑94) tsaE ← / → ilvD tRNA threonylcarbamoyladenosine biosynthesis protein TsaE/Dihydroxy‑acid dehydratase
RA USA300TCH1516_ALE 2,172,067:1 +G 6.7% coding (116/1047 nt) leuB → 3‑isopropylmalate dehydrogenase
RA USA300TCH1516_ALE 2,172,075 G→C 9.0% E42Q (GAA→CAA)  leuB → 3‑isopropylmalate dehydrogenase
RA USA300TCH1516_ALE 2,172,078 T→A 9.2% F43I (TTT→ATT)  leuB → 3‑isopropylmalate dehydrogenase
RA USA300TCH1516_ALE 2,172,081 G→C 9.8% G44R (GGT→CGT)  leuB → 3‑isopropylmalate dehydrogenase
RA USA300TCH1516_ALE 2,184,883 G→A 8.4% T21I (ACA→ATA)  rpsA_2 ← 30S ribosomal protein S1
RA USA300TCH1516_ALE 2,184,888 T→C 6.6% V19V (GTA→GTG)  rpsA_2 ← 30S ribosomal protein S1
RA USA300TCH1516_ALE 2,211,673 T→G 5.8% intergenic (+666/+147) USA300HOU_RS11275 → / ← yidC hypothetical protein/Membrane protein insertase YidC
RA USA300TCH1516_ALE 2,211,678:1 +G 6.3% intergenic (+671/+142) USA300HOU_RS11275 → / ← yidC hypothetical protein/Membrane protein insertase YidC
RA USA300TCH1516_ALE 2,211,684 T→C 5.9% intergenic (+677/+136) USA300HOU_RS11275 → / ← yidC hypothetical protein/Membrane protein insertase YidC
RA USA300TCH1516_ALE 2,224,417 C→A 6.1% G253V (GGT→GTT)  atpA ← ATP synthase subunit alpha
RA USA300TCH1516_ALE 2,224,420 T→G 5.6% N252T (AAC→ACC)  atpA ← ATP synthase subunit alpha
RA USA300TCH1516_ALE 2,231,527 A→T 6.8% F17I (TTT→ATT)  USA300HOU_RS11415 ← hypothetical protein
RA USA300TCH1516_ALE 2,243,494 A→T 7.5% intergenic (+72/+37) USA300HOU_RS11475 → / ← pyrG hypothetical protein/CTP synthase
RA USA300TCH1516_ALE 2,243,499 T→A 12.4% intergenic (+77/+32) USA300HOU_RS11475 → / ← pyrG hypothetical protein/CTP synthase
RA USA300TCH1516_ALE 2,243,504 A→T 8.5% intergenic (+82/+27) USA300HOU_RS11475 → / ← pyrG hypothetical protein/CTP synthase
RA USA300TCH1516_ALE 2,268,572 A→T 6.6% intergenic (‑1008/+78) USA300HOU_RS11605 ← / ← ywpJ_2 hypothetical protein/Phosphatase YwpJ
RA USA300TCH1516_ALE 2,273,482 T→A 6.4% F136L (TTT→TTA)  mtlA → PTS system mannitol‑specific EIICB component
RA USA300TCH1516_ALE 2,273,489 T→A 5.6% F139I (TTT→ATT)  mtlA → PTS system mannitol‑specific EIICB component
RA USA300TCH1516_ALE 2,275,552 C→T 5.4% T302I (ACA→ATA)  mtlR → Transcriptional regulator MtlR
RA USA300TCH1516_ALE 2,279,705 G→A 100% A943V (GCA→GTA)  ebh_3 ← Extracellular matrix‑binding protein ebh
RA USA300TCH1516_ALE 2,287,474 T→A 5.6% P82P (CCA→CCT)  glmM ← Phosphoglucosamine mutase
RA USA300TCH1516_ALE 2,309,787:1 +C 9.3% coding (82/1032 nt) yfiZ_2 ← putative siderophore transport system permease protein YfiZ
RA USA300TCH1516_ALE 2,309,793:1 +G 9.1% coding (76/1032 nt) yfiZ_2 ← putative siderophore transport system permease protein YfiZ
RA USA300TCH1516_ALE 2,309,800 Δ1 bp 7.5% coding (69/1032 nt) yfiZ_2 ← putative siderophore transport system permease protein YfiZ
RA USA300TCH1516_ALE 2,309,807 Δ1 bp 6.1% coding (62/1032 nt) yfiZ_2 ← putative siderophore transport system permease protein YfiZ
RA USA300TCH1516_ALE 2,328,872 G→C 12.0% F264L (TTC→TTG)  lacE ← PTS system lactose‑specific EIICB component
RA USA300TCH1516_ALE 2,346,305 C→A 9.2% intergenic (‑212/+978) alsS ← / ← USA300HOU_RS11980 Acetolactate synthase/hypothetical protein
RA USA300TCH1516_ALE 2,359,112 A→T 6.2% G90G (GGT→GGA)  rpsK ← 30S ribosomal protein S11
RA USA300TCH1516_ALE 2,372,407 A→G 11.2% intergenic (+158/+34) USA300TCH1516_02262 → / ← pbuG hypothetical protein/Guanine/hypoxanthine permease PbuG
RA USA300TCH1516_ALE 2,372,413 C→G 15.2% intergenic (+164/+28) USA300TCH1516_02262 → / ← pbuG hypothetical protein/Guanine/hypoxanthine permease PbuG
RA USA300TCH1516_ALE 2,372,419 C→T 14.8% intergenic (+170/+22) USA300TCH1516_02262 → / ← pbuG hypothetical protein/Guanine/hypoxanthine permease PbuG
RA USA300TCH1516_ALE 2,375,929 T→C 6.3% N32S (AAT→AGT)  topB ← DNA topoisomerase 3
RA USA300TCH1516_ALE 2,375,933 C→G 6.1% E31Q (GAA→CAA)  topB ← DNA topoisomerase 3
RA USA300TCH1516_ALE 2,375,937 G→A 5.5% Y29Y (TAC→TAT)  topB ← DNA topoisomerase 3
RA USA300TCH1516_ALE 2,386,589 A→T 5.2% intergenic (‑130/‑32) USA300HOU_RS12250 ← / → USA300HOU_RS12255 hypothetical protein/putative HTH‑type transcriptional regulator
RA USA300TCH1516_ALE 2,399,036 T→C 10.8% intergenic (+110/+62) fdhD → / ← USA300HOU_RS12350 Sulfurtransferase FdhD/hypothetical protein
RA USA300TCH1516_ALE 2,399,039 A→G 10.9% intergenic (+113/+59) fdhD → / ← USA300HOU_RS12350 Sulfurtransferase FdhD/hypothetical protein
RA USA300TCH1516_ALE 2,399,044 T→G 10.4% intergenic (+118/+54) fdhD → / ← USA300HOU_RS12350 Sulfurtransferase FdhD/hypothetical protein
RA USA300TCH1516_ALE 2,399,046 C→G 10.4% intergenic (+120/+52) fdhD → / ← USA300HOU_RS12350 Sulfurtransferase FdhD/hypothetical protein
RA USA300TCH1516_ALE 2,399,048 C→A 10.5% intergenic (+122/+50) fdhD → / ← USA300HOU_RS12350 Sulfurtransferase FdhD/hypothetical protein
RA USA300TCH1516_ALE 2,399,053 C→T 11.2% intergenic (+127/+45) fdhD → / ← USA300HOU_RS12350 Sulfurtransferase FdhD/hypothetical protein
RA USA300TCH1516_ALE 2,399,056 G→A 10.7% intergenic (+130/+42) fdhD → / ← USA300HOU_RS12350 Sulfurtransferase FdhD/hypothetical protein
RA USA300TCH1516_ALE 2,405,147 A→T 8.3% F69L (TTT→TTA)  USA300HOU_RS12375 ← Urea transporter
RA USA300TCH1516_ALE 2,424,608 A→G 6.4% intergenic (‑166/+62) USA300HOU_RS12490 ← / ← USA300HOU_RS12495 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 2,424,609 C→T 6.8% intergenic (‑167/+61) USA300HOU_RS12490 ← / ← USA300HOU_RS12495 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 2,430,685 Δ1 bp 6.9% intergenic (‑109/‑276) suhB_2 ← / → birA_2 Inositol‑1‑monophosphatase/Bifunctional ligase/repressor BirA
RA USA300TCH1516_ALE 2,430,691:1 +A 7.5% intergenic (‑115/‑270) suhB_2 ← / → birA_2 Inositol‑1‑monophosphatase/Bifunctional ligase/repressor BirA
RA USA300TCH1516_ALE 2,432,237 C→T 8.1% intergenic (+584/+63) birA_2 → / ← USA300HOU_RS12525 Bifunctional ligase/repressor BirA/hypothetical protein
RA USA300TCH1516_ALE 2,432,240 A→T 8.5% intergenic (+587/+60) birA_2 → / ← USA300HOU_RS12525 Bifunctional ligase/repressor BirA/hypothetical protein
RA USA300TCH1516_ALE 2,432,243 A→T 8.9% intergenic (+590/+57) birA_2 → / ← USA300HOU_RS12525 Bifunctional ligase/repressor BirA/hypothetical protein
RA USA300TCH1516_ALE 2,432,246 A→G 8.9% intergenic (+593/+54) birA_2 → / ← USA300HOU_RS12525 Bifunctional ligase/repressor BirA/hypothetical protein
RA USA300TCH1516_ALE 2,448,479 A→G 8.2% intergenic (‑238/+39) yxeP_4 ← / ← hutI putative hydrolase YxeP/Imidazolonepropionase
RA USA300TCH1516_ALE 2,448,484 A→G 7.9% intergenic (‑243/+34) yxeP_4 ← / ← hutI putative hydrolase YxeP/Imidazolonepropionase
RA USA300TCH1516_ALE 2,448,493 C→T 9.9% intergenic (‑252/+25) yxeP_4 ← / ← hutI putative hydrolase YxeP/Imidazolonepropionase
RA USA300TCH1516_ALE 2,448,498 C→T 9.0% intergenic (‑257/+20) yxeP_4 ← / ← hutI putative hydrolase YxeP/Imidazolonepropionase
RA USA300TCH1516_ALE 2,449,468 A→T 10.3% S97T (TCT→ACT)  hutI ← Imidazolonepropionase
RA USA300TCH1516_ALE 2,455,692 Δ1 bp 100% coding (1210/1260 nt) lyrA → Lysostaphin resistance protein A
RA USA300TCH1516_ALE 2,455,698 2 bp→AT 100% coding (1216‑1217/1260 nt) lyrA → Lysostaphin resistance protein A
RA USA300TCH1516_ALE 2,478,130 T→A 6.6% intergenic (+17/‑558) USA300HOU_RS12760 → / → USA300HOU_RS12765 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 2,478,133 T→A 6.7% intergenic (+20/‑555) USA300HOU_RS12760 → / → USA300HOU_RS12765 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 2,479,038 C→T 8.7% I486I (ATC→ATT)  USA300HOU_RS12765 → hypothetical protein
RA USA300TCH1516_ALE 2,479,041 A→T 9.3% K487N (AAA→AAT)  USA300HOU_RS12765 → hypothetical protein
RA USA300TCH1516_ALE 2,479,044 A→T 9.7% *488Y (TAA→TAT)  USA300HOU_RS12765 → hypothetical protein
RA USA300TCH1516_ALE 2,479,047 A→G 9.6% intergenic (+3/+137) USA300HOU_RS12765 → / ← hrtA_2 hypothetical protein/Putative hemin import ATP‑binding protein HrtA
RA USA300TCH1516_ALE 2,497,391 C→G 14.1% N147K (AAC→AAG)  USA300HOU_RS12865 → hypothetical protein
RA USA300TCH1516_ALE 2,503,387 T→C 6.3% N637N (AAT→AAC)  melR_2 → Melibiose operon regulatory protein
RA USA300TCH1516_ALE 2,503,398 G→A 5.4% G641D (GGT→GAT)  melR_2 → Melibiose operon regulatory protein
RA USA300TCH1516_ALE 2,504,989 T→C 6.3% intergenic (+293/+111) USA300HOU_RS12890 → / ← gltT hypothetical protein/Proton/sodium‑glutamate symport protein
RA USA300TCH1516_ALE 2,509,782 T→A 6.5% intergenic (‑94/‑276) narT ← / → USA300HOU_RS12920 putative nitrate transporter NarT/hypothetical protein
RA USA300TCH1516_ALE 2,509,785 T→A 6.7% intergenic (‑97/‑273) narT ← / → USA300HOU_RS12920 putative nitrate transporter NarT/hypothetical protein
RA USA300TCH1516_ALE 2,509,792 A→G 6.3% intergenic (‑104/‑266) narT ← / → USA300HOU_RS12920 putative nitrate transporter NarT/hypothetical protein
RA USA300TCH1516_ALE 2,513,966 A→G 5.1% L57S (TTG→TCG)  USA300HOU_RS12940 ← hypothetical protein
RA USA300TCH1516_ALE 2,513,975 C→T 6.5% R54Q (CGA→CAA)  USA300HOU_RS12940 ← hypothetical protein
RA USA300TCH1516_ALE 2,517,770 A→T 7.3% S954S (TCT→TCA)  narG ← Respiratory nitrate reductase 1 alpha chain
RA USA300TCH1516_ALE 2,517,775 A→C 11.1% S953A (TCA→GCA)  narG ← Respiratory nitrate reductase 1 alpha chain
RA USA300TCH1516_ALE 2,517,782 T→A 11.2% L950L (CTA→CTT)  narG ← Respiratory nitrate reductase 1 alpha chain
RA USA300TCH1516_ALE 2,517,789 G→T 9.6% A948E (GCA→GAA)  narG ← Respiratory nitrate reductase 1 alpha chain
RA USA300TCH1516_ALE 2,517,794 A→T 7.0% A946A (GCT→GCA)  narG ← Respiratory nitrate reductase 1 alpha chain
RA USA300TCH1516_ALE 2,519,951 T→G 13.5% P227P (CCA→CCC)  narG ← Respiratory nitrate reductase 1 alpha chain
RA USA300TCH1516_ALE 2,528,345 T→C 5.9% intergenic (‑144/+42) USA300TCH1516_02412 ← / ← zinT hypothetical protein/Metal‑binding protein ZinT
RA USA300TCH1516_ALE 2,528,349 G→A 6.5% intergenic (‑148/+38) USA300TCH1516_02412 ← / ← zinT hypothetical protein/Metal‑binding protein ZinT
RA USA300TCH1516_ALE 2,528,352 A→G 6.0% intergenic (‑151/+35) USA300TCH1516_02412 ← / ← zinT hypothetical protein/Metal‑binding protein ZinT
RA USA300TCH1516_ALE 2,528,357 C→T 6.0% intergenic (‑156/+30) USA300TCH1516_02412 ← / ← zinT hypothetical protein/Metal‑binding protein ZinT
RA USA300TCH1516_ALE 2,528,360 T→C 6.0% intergenic (‑159/+27) USA300TCH1516_02412 ← / ← zinT hypothetical protein/Metal‑binding protein ZinT
RA USA300TCH1516_ALE 2,528,364 G→A 5.9% intergenic (‑163/+23) USA300TCH1516_02412 ← / ← zinT hypothetical protein/Metal‑binding protein ZinT
RA USA300TCH1516_ALE 2,530,786 A→G 8.6% intergenic (‑37/+236) yefM ← / ← bdbD Antitoxin YefM/Disulfide bond formation protein D
RA USA300TCH1516_ALE 2,530,791 C→T 6.4% intergenic (‑42/+231) yefM ← / ← bdbD Antitoxin YefM/Disulfide bond formation protein D
RA USA300TCH1516_ALE 2,532,298 A→T 100% T15T (ACA→ACT)  femA_3 → Aminoacyltransferase FemA
RA USA300TCH1516_ALE 2,538,743 A→T 6.0% intergenic (‑257/+70) gpmA_2 ← / ← fieF 2,3‑bisphosphoglycerate‑dependent phosphoglycerate mutase/Ferrous‑iron efflux pump FieF
RA USA300TCH1516_ALE 2,538,744 A→T 6.3% intergenic (‑258/+69) gpmA_2 ← / ← fieF 2,3‑bisphosphoglycerate‑dependent phosphoglycerate mutase/Ferrous‑iron efflux pump FieF
RA USA300TCH1516_ALE 2,552,027 Δ1 bp 7.7% coding (1215/1734 nt) USA300HOU_RS13150 ← putative ABC transporter ATP‑binding protein
RA USA300TCH1516_ALE 2,552,031:1 +G 7.9% coding (1211/1734 nt) USA300HOU_RS13150 ← putative ABC transporter ATP‑binding protein
RA USA300TCH1516_ALE 2,559,830 A→G 8.9% intergenic (+24/+99) bcr_2 → / ← USA300HOU_RS13190 Bicyclomycin resistance protein/hypothetical protein
RA USA300TCH1516_ALE 2,559,831 G→A 9.1% intergenic (+25/+98) bcr_2 → / ← USA300HOU_RS13190 Bicyclomycin resistance protein/hypothetical protein
RA USA300TCH1516_ALE 2,559,840 T→G 13.5% intergenic (+34/+89) bcr_2 → / ← USA300HOU_RS13190 Bicyclomycin resistance protein/hypothetical protein
RA USA300TCH1516_ALE 2,559,841 C→A 14.0% intergenic (+35/+88) bcr_2 → / ← USA300HOU_RS13190 Bicyclomycin resistance protein/hypothetical protein
RA USA300TCH1516_ALE 2,559,850 T→C 8.9% intergenic (+44/+79) bcr_2 → / ← USA300HOU_RS13190 Bicyclomycin resistance protein/hypothetical protein
RA USA300TCH1516_ALE 2,559,851 C→T 9.0% intergenic (+45/+78) bcr_2 → / ← USA300HOU_RS13190 Bicyclomycin resistance protein/hypothetical protein
RA USA300TCH1516_ALE 2,563,759 A→G 10.7% intergenic (+24/‑114) cycA_2 → / → nhaK_2 D‑serine/D‑alanine/glycine transporter/Sodium, potassium, lithium and rubidium/H(+) antiporter
RA USA300TCH1516_ALE 2,563,763 C→G 10.9% intergenic (+28/‑110) cycA_2 → / → nhaK_2 D‑serine/D‑alanine/glycine transporter/Sodium, potassium, lithium and rubidium/H(+) antiporter
RA USA300TCH1516_ALE 2,563,767 C→T 5.5% intergenic (+32/‑106) cycA_2 → / → nhaK_2 D‑serine/D‑alanine/glycine transporter/Sodium, potassium, lithium and rubidium/H(+) antiporter
RA USA300TCH1516_ALE 2,566,052 A→G 7.6% intergenic (+101/+39) nhaK_2 → / ← plaP Sodium, potassium, lithium and rubidium/H(+) antiporter/Low‑affinity putrescine importer PlaP
RA USA300TCH1516_ALE 2,566,055 A→T 7.8% intergenic (+104/+36) nhaK_2 → / ← plaP Sodium, potassium, lithium and rubidium/H(+) antiporter/Low‑affinity putrescine importer PlaP
RA USA300TCH1516_ALE 2,566,057 A→T 7.5% intergenic (+106/+34) nhaK_2 → / ← plaP Sodium, potassium, lithium and rubidium/H(+) antiporter/Low‑affinity putrescine importer PlaP
RA USA300TCH1516_ALE 2,566,059 A→T 7.4% intergenic (+108/+32) nhaK_2 → / ← plaP Sodium, potassium, lithium and rubidium/H(+) antiporter/Low‑affinity putrescine importer PlaP
RA USA300TCH1516_ALE 2,566,062 C→T 7.6% intergenic (+111/+29) nhaK_2 → / ← plaP Sodium, potassium, lithium and rubidium/H(+) antiporter/Low‑affinity putrescine importer PlaP
RA USA300TCH1516_ALE 2,566,074 C→T 5.5% intergenic (+123/+17) nhaK_2 → / ← plaP Sodium, potassium, lithium and rubidium/H(+) antiporter/Low‑affinity putrescine importer PlaP
RA USA300TCH1516_ALE 2,582,141 Δ1 bp 10.3% coding (1169/1353 nt) pnbA → Para‑nitrobenzyl esterase
RA USA300TCH1516_ALE 2,582,146:1 +A 10.6% coding (1174/1353 nt) pnbA → Para‑nitrobenzyl esterase
RA USA300TCH1516_ALE 2,608,409 G→A 5.6% intergenic (‑260/‑29) USA300HOU_RS13435 ← / → USA300TCH1516_02485 putative oxidoreductase/hypothetical protein
RA USA300TCH1516_ALE 2,608,412 T→C 5.7% intergenic (‑263/‑26) USA300HOU_RS13435 ← / → USA300TCH1516_02485 putative oxidoreductase/hypothetical protein
RA USA300TCH1516_ALE 2,608,816 A→G 6.3% intergenic (+97/+163) USA300TCH1516_02485 → / ← USA300HOU_RS13450 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 2,608,820 A→T 6.1% intergenic (+101/+159) USA300TCH1516_02485 → / ← USA300HOU_RS13450 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 2,608,825 A→T 10.1% intergenic (+106/+154) USA300TCH1516_02485 → / ← USA300HOU_RS13450 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 2,611,882 T→G 5.8% intergenic (‑205/+7) USA300HOU_RS13465 ← / ← USA300TCH1516_02490 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 2,611,883 C→A 5.7% intergenic (‑206/+6) USA300HOU_RS13465 ← / ← USA300TCH1516_02490 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 2,653,200 A→G 5.1% M591V (ATG→GTG)  fbp → Fructose‑1,6‑bisphosphatase class 3
RA USA300TCH1516_ALE 2,654,131 C→G 8.1% L132V (CTG→GTG)  USA300HOU_RS13650 → hypothetical protein
RA USA300TCH1516_ALE 2,654,136 T→G 7.4% F133L (TTT→TTG)  USA300HOU_RS13650 → hypothetical protein
RA USA300TCH1516_ALE 2,668,300 G→T 5.1% intergenic (‑109/‑442) USA300HOU_RS13735 ← / → USA300TCH1516_02539 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 2,669,453 C→T 5.5% A118V (GCT→GTT)  yicL → putative inner membrane transporter YicL
RA USA300TCH1516_ALE 2,669,457 G→A 5.4% A119A (GCG→GCA)  yicL → putative inner membrane transporter YicL
RA USA300TCH1516_ALE 2,669,460 T→C 5.5% I120I (ATT→ATC)  yicL → putative inner membrane transporter YicL
RA USA300TCH1516_ALE 2,704,428 G→C 6.1% Q81E (CAA→GAA)  crtM ← Dehydrosqualene synthase
RA USA300TCH1516_ALE 2,725,352 A→T 19.9% intergenic (‑58/+276) USA300HOU_RS14015 ← / ← USA300HOU_RS14020 Baeyer‑Villiger flavin‑containing monooxygenase/hypothetical protein
RA USA300TCH1516_ALE 2,744,200 G→A 8.2% intergenic (+137/+56) fda → / ← mqo2 Fructose‑bisphosphate aldolase class 1/putative malate:quinone oxidoreductase 2
RA USA300TCH1516_ALE 2,744,205 A→G 10.8% intergenic (+142/+51) fda → / ← mqo2 Fructose‑bisphosphate aldolase class 1/putative malate:quinone oxidoreductase 2
RA USA300TCH1516_ALE 2,744,213 T→A 14.8% intergenic (+150/+43) fda → / ← mqo2 Fructose‑bisphosphate aldolase class 1/putative malate:quinone oxidoreductase 2
RA USA300TCH1516_ALE 2,744,226 T→C 7.6% intergenic (+163/+30) fda → / ← mqo2 Fructose‑bisphosphate aldolase class 1/putative malate:quinone oxidoreductase 2
RA USA300TCH1516_ALE 2,745,325 T→A 7.8% N143I (AAT→ATT)  mqo2 ← putative malate:quinone oxidoreductase 2
RA USA300TCH1516_ALE 2,774,463 A→T 5.0% intergenic (‑93/+23) USA300HOU_RS14290 ← / ← clfB S‑formylglutathione hydrolase/Clumping factor B
RA USA300TCH1516_ALE 2,774,846 A→G 5.4% S780S (AGT→AGC)  clfB ← Clumping factor B
RA USA300TCH1516_ALE 2,775,053 A→G 5.5% D711D (GAT→GAC)  clfB ← Clumping factor B
RA USA300TCH1516_ALE 2,833,387 G→C 10.3% intergenic (‑723/+367) lipA_2 ← / ← hisI Lipase 1/Phosphoribosyl‑AMP cyclohydrolase
RA USA300TCH1516_ALE 2,840,841 T→A 5.4% intergenic (‑162/+143) hisZ ← / ← USA300HOU_RS14555 ATP phosphoribosyltransferase regulatory subunit/hypothetical protein

Unassigned new junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? CP000731 = 64411 (0.740)34 (0.100)
+33 bp		 16/94 NT 22.1% intergenic (–/‑168) –/repA –/replication protein A
?CP000731 = 27041 0 (0.000)intergenic (‑194/–) USA300HOU_pUSA300HOUMR0033/– partitioning protein/–
* ? CP000731 3772 =382 (0.690)48 (0.100) 17/140 NT 12.3% intergenic (+388/‑96) USA300HOU_pUSA300HOUMR0005/USA300HOU_pUSA300HOUMR0006 hypothetical protein/hypothetical protein
?CP000731 3805 = 353 (0.730)intergenic (+421/‑63) USA300HOU_pUSA300HOUMR0005/USA300HOU_pUSA300HOUMR0006 hypothetical protein/hypothetical protein
* ? CP000731 = 3781387 (0.700)42 (0.090) 16/140 NT 10.8% intergenic (+397/‑87) USA300HOU_pUSA300HOUMR0005/USA300HOU_pUSA300HOUMR0006 hypothetical protein/hypothetical protein
?CP000731 = 3794 353 (0.730)intergenic (+410/‑74) USA300HOU_pUSA300HOUMR0005/USA300HOU_pUSA300HOUMR0006 hypothetical protein/hypothetical protein
* ? CP000731 7662 =457 (0.820)55 (0.110) 14/138 NT 12.0% intergenic (+272/+254) USA300HOU_pUSA300HOUMR0010/blaZ MarR family transcriptional regulator/beta‑lactamase
?CP000731 7700 = 413 (0.860)intergenic (+310/+216) USA300HOU_pUSA300HOUMR0010/blaZ MarR family transcriptional regulator/beta‑lactamase
* ? CP000731 = 7672441 (0.790)65 (0.140) 19/138 NT 14.1% intergenic (+282/+244) USA300HOU_pUSA300HOUMR0010/blaZ MarR family transcriptional regulator/beta‑lactamase
?CP000731 = 7688 413 (0.860)intergenic (+298/+228) USA300HOU_pUSA300HOUMR0010/blaZ MarR family transcriptional regulator/beta‑lactamase
* ? CP000731 11093 =571 (1.030)64 (0.130) 28/146 NT 11.5% intergenic (+98/‑166) blaI/USA300HOU_pUSA300HOUMR0014 beta‑lactamase regulator BlaI/recombinase
?CP000731 11129 = 465 (0.920)intergenic (+134/‑130) blaI/USA300HOU_pUSA300HOUMR0014 beta‑lactamase regulator BlaI/recombinase
* ? CP000731 11951 =542 (0.970)46 (0.100) 18/134 NT 9.9% intergenic (+114/+109) USA300HOU_pUSA300HOUMR0014/USA300HOU_pUSA300HOUMR0015 recombinase/hypothetical protein
?CP000731 11987 = 386 (0.830)intergenic (+150/+73) USA300HOU_pUSA300HOUMR0014/USA300HOU_pUSA300HOUMR0015 recombinase/hypothetical protein
* ? CP000731 12561 =NA (NA)30 (0.060) 6/148 NT NA coding (55/675 nt) USA300HOU_pUSA300HOUMR0016 IS257 transposase
?CP000731 = 17010 NA (NA)coding (52/675 nt) USA300HOU_pUSA300HOUMR0021 IS431 mec transposase
* ? CP000731 = 17001NA (NA)32 (0.060) 16/148 NT 100% coding (61/675 nt) USA300HOU_pUSA300HOUMR0021 IS431 mec transposase
?CP000731 = 17016 0 (0.000)coding (46/675 nt) USA300HOU_pUSA300HOUMR0021 IS431 mec transposase
* ? CP000731 17189 =357 (0.640)32 (0.070) 13/138 NT 9.3% intergenic (‑128/+119) USA300HOU_pUSA300HOUMR0021/USA300HOU_pUSA300HOUMR0023 IS431 mec transposase/bacitracin ABC ATP binding cassette transporter, membrane protein
?CP000731 17225 = 319 (0.670)intergenic (‑164/+83) USA300HOU_pUSA300HOUMR0021/USA300HOU_pUSA300HOUMR0023 IS431 mec transposase/bacitracin ABC ATP binding cassette transporter, membrane protein
* ? CP000731 = 17199350 (0.630)20 (0.040) 10/138 NT 6.1% intergenic (‑138/+109) USA300HOU_pUSA300HOUMR0021/USA300HOU_pUSA300HOUMR0023 IS431 mec transposase/bacitracin ABC ATP binding cassette transporter, membrane protein
?CP000731 = 17213 319 (0.670)intergenic (‑152/+95) USA300HOU_pUSA300HOUMR0021/USA300HOU_pUSA300HOUMR0023 IS431 mec transposase/bacitracin ABC ATP binding cassette transporter, membrane protein
* ? CP000731 20439 =547 (0.980)63 (0.120) 19/148 NT 11.6% coding (632/675 nt) USA300HOU_pUSA300HOUMR0027 IS431mec transposase
?CP000731 20463 = 457 (0.890)coding (608/675 nt) USA300HOU_pUSA300HOUMR0027 IS431mec transposase
* ? CP000731 = 22941475 (0.850)23 (0.050) 13/146 NT 5.0% coding (1398/1467 nt) USA300HOU_pUSA300HOUMR0028 macrolide transporter
?CP000731 = 22955 440 (0.870)coding (1412/1467 nt) USA300HOU_pUSA300HOUMR0028 macrolide transporter
* ? CP000731 25265 =344 (0.620)19 (0.050) 13/114 NT 6.8% intergenic (+163/‑83) USA300HOU_pUSA300HOUMR0030/USA300HOU_pUSA300HOUMR0031 Sin recombinase/hypothetical protein
?CP000731 25334 = 275 (0.700)intergenic (+232/‑14) USA300HOU_pUSA300HOUMR0030/USA300HOU_pUSA300HOUMR0031 Sin recombinase/hypothetical protein
* ? CP000731 = 25287319 (0.570)24 (0.060) 15/114 NT 8.7% intergenic (+185/‑61) USA300HOU_pUSA300HOUMR0030/USA300HOU_pUSA300HOUMR0031 Sin recombinase/hypothetical protein
?CP000731 = 25310 275 (0.700)intergenic (+208/‑38) USA300HOU_pUSA300HOUMR0030/USA300HOU_pUSA300HOUMR0031 Sin recombinase/hypothetical protein
* ? CP000731 25306 =268 (0.480)42 (0.090) 16/138 NT 15.9% intergenic (+204/‑42) USA300HOU_pUSA300HOUMR0030/USA300HOU_pUSA300HOUMR0031 Sin recombinase/hypothetical protein
?CP000731 25340 = 213 (0.440)intergenic (+238/‑8) USA300HOU_pUSA300HOUMR0030/USA300HOU_pUSA300HOUMR0031 Sin recombinase/hypothetical protein
* ? NC_012417 = 5009402 (0.790)465 (0.040) 32/148 NT 5.1% pseudogene (221/709 nt) USA300HOU_RS14890 replication protein
?NC_012417 = 511 8702 (0.790)pseudogene (232/709 nt) USA300HOU_RS14890 replication protein
* ? NC_012417 987 =5283 (0.440)1068 (0.100) 42/138 NT 20.4% pseudogene (708/709 nt) USA300HOU_RS14890 replication protein
?NC_012417 1013 = 3792 (0.370)coding (182/192 nt) USA300HOU_RS15665 hypothetical protein
* ? NC_012417 = 9974675 (0.390)627 (0.060) 57/138 NT 13.8% intergenic (+9/+6) USA300HOU_RS14890/USA300HOU_RS15665 replication protein/hypothetical protein
?NC_012417 = 1001 3792 (0.370)intergenic (+13/+2) USA300HOU_RS14890/USA300HOU_RS15665 replication protein/hypothetical protein
* ? NC_012417 1040 =1454 (0.120)291 (0.030) 36/124 NT 15.8% coding (155/192 nt) USA300HOU_RS15665 hypothetical protein
?NC_012417 1090 = 1977 (0.210)coding (105/192 nt) USA300HOU_RS15665 hypothetical protein
* ? NC_012417 = 10571423 (0.120)488 (0.050) 49/124 NT 24.1% coding (138/192 nt) USA300HOU_RS15665 hypothetical protein
?NC_012417 = 1071 1977 (0.210)coding (124/192 nt) USA300HOU_RS15665 hypothetical protein
* ? NC_012417 = 11957491 (0.630)676 (0.060) 40/144 NT 8.4% intergenic (‑1/‑384) USA300HOU_RS15665/USA300HOU_RS14895 hypothetical protein/hypothetical protein
?NC_012417 = 1199 8040 (0.750)intergenic (‑5/‑380) USA300HOU_RS15665/USA300HOU_RS14895 hypothetical protein/hypothetical protein
* ? NC_012417 = 19743470 (0.290)227 (0.020) 23/138 NT 7.1% intergenic (+207/+119) USA300HOU_RS14895/USA300HOU_RS14900 hypothetical protein/hypothetical protein
?NC_012417 = 2041 NA (NA)intergenic (+274/+52) USA300HOU_RS14895/USA300HOU_RS14900 hypothetical protein/hypothetical protein
* ? NC_012417 1975 =NA (NA)504 (0.050) 23/138 NT 14.9% intergenic (+208/+118) USA300HOU_RS14895/USA300HOU_RS14900 hypothetical protein/hypothetical protein
?NC_012417 2042 = 3344 (0.280)intergenic (+275/+51) USA300HOU_RS14895/USA300HOU_RS14900 hypothetical protein/hypothetical protein
* ? NC_012417 = 19822634 (0.220)334 (0.030) 32/146 NT 11.1% intergenic (+215/+111) USA300HOU_RS14895/USA300HOU_RS14900 hypothetical protein/hypothetical protein
?NC_012417 = 2027 2928 (0.270)intergenic (+260/+66) USA300HOU_RS14895/USA300HOU_RS14900 hypothetical protein/hypothetical protein
* ? NC_012417 = 19832631 (0.220)172 (0.010) 26/154 NT 6.3% intergenic (+216/+110) USA300HOU_RS14895/USA300HOU_RS14900 hypothetical protein/hypothetical protein
?NC_012417 = 1995 2596 (0.230)intergenic (+228/+98) USA300HOU_RS14895/USA300HOU_RS14900 hypothetical protein/hypothetical protein
* ? NC_012417 1983 =NA (NA)277 (0.030) 25/146 NT 9.4% intergenic (+216/+110) USA300HOU_RS14895/USA300HOU_RS14900 hypothetical protein/hypothetical protein
?NC_012417 2028 = 2928 (0.240)intergenic (+261/+65) USA300HOU_RS14895/USA300HOU_RS14900 hypothetical protein/hypothetical protein
* ? NC_012417 = 19972604 (0.220)132 (0.010) 20/148 NT 5.8% intergenic (+230/+96) USA300HOU_RS14895/USA300HOU_RS14900 hypothetical protein/hypothetical protein
?NC_012417 = 2014 1871 (0.170)intergenic (+247/+79) USA300HOU_RS14895/USA300HOU_RS14900 hypothetical protein/hypothetical protein
* ? NC_012417 2133 =7289 (0.610)380 (0.030) 41/148 NT 5.2% coding (542/582 nt) USA300HOU_RS14900 hypothetical protein
?NC_012417 2167 = 7181 (0.650)coding (508/582 nt) USA300HOU_RS14900 hypothetical protein
* ? NC_012417 = 21487684 (0.640)417 (0.040) 29/148 NT 5.5% coding (527/582 nt) USA300HOU_RS14900 hypothetical protein
?NC_012417 = 2154 7365 (0.670)coding (521/582 nt) USA300HOU_RS14900 hypothetical protein
* ? NC_012417 = 29379008 (0.750)1313 (0.120) 59/150 NT 13.3% intergenic (‑263/–) USA300HOU_RS14900/– hypothetical protein/–
?NC_012417 = 2949 8679 (0.770)intergenic (‑275/–) USA300HOU_RS14900/– hypothetical protein/–
* ? NC_012417 = 30773566 (0.300)189 (0.020) 21/146 NT 8.7% intergenic (‑403/–) USA300HOU_RS14900/– hypothetical protein/–
?NC_012417 = 3108 716 (0.070)intergenic (‑434/–) USA300HOU_RS14900/– hypothetical protein/–
* ? USA300TCH1516_ALE = 2161198 (1.040)23 (0.130) 14/152 NT 10.3% intergenic (+256/‑22) dnaA/dnaN Chromosomal replication initiator protein DnaA/DNA polymerase III subunit beta
?USA300TCH1516_ALE = 2172 214 (1.180)intergenic (+267/‑11) dnaA/dnaN Chromosomal replication initiator protein DnaA/DNA polymerase III subunit beta
* ? USA300TCH1516_ALE = 29630182 (0.960)22 (0.130) 13/142 NT 11.4% intergenic (+22/‑368) yycI/yycJ Two‑component system WalR/WalK regulatory protein YycI/Putative metallo‑hydrolase YycJ
?USA300TCH1516_ALE = 29658 182 (1.080)intergenic (+50/‑340) yycI/yycJ Two‑component system WalR/WalK regulatory protein YycI/Putative metallo‑hydrolase YycJ
* ? USA300TCH1516_ALE 42499 =208 (1.090)18 (0.120) 13/124 NT 12.3% coding (1467/1524 nt) USA300TCH1516_00035 hypothetical protein
?USA300TCH1516_ALE 42544 = 97 (0.660)coding (1422/1524 nt) USA300TCH1516_00035 hypothetical protein
* ? USA300TCH1516_ALE 42564 =92 (0.480)70 (0.490)
+TACATTATAAAATACATATC		 13/120 NT 50.5% coding (1402/1524 nt) USA300TCH1516_00035 hypothetical protein
?USA300TCH1516_ALE 1803072 = NA (NA)coding (796/807 nt) USA300HOU_RS12765 hypothetical protein
* ? USA300TCH1516_ALE = 46314204 (1.070)12 (0.060) 9/156 NT 5.3% coding (1207/1629 nt) hin_1 DNA‑invertase hin
?USA300TCH1516_ALE = 46361 228 (1.230)coding (1160/1629 nt) hin_1 DNA‑invertase hin
* ? USA300TCH1516_ALE 68500 =NA (NA)7 (0.040) 7/154 NT 5.7% coding (616/852 nt) USA300TCH1516_00061 hypothetical protein
?USA300TCH1516_ALE 68542 = 120 (0.630)coding (658/852 nt) USA300TCH1516_00061 hypothetical protein
* ? USA300TCH1516_ALE 75971 =237 (1.240)25 (0.160) 12/128 NT 13.3% intergenic (+29/‑244) USA300HOU_RS00335/USA300HOU_RS00140 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 76020 = 136 (0.900)intergenic (+78/‑195) USA300HOU_RS00335/USA300HOU_RS00140 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 77142208 (1.090)12 (0.070) 10/140 NT 5.9% coding (67/816 nt) USA300HOU_RS00350 Monoacylglycerol lipase
?USA300TCH1516_ALE = 77155 203 (1.220)coding (80/816 nt) USA300HOU_RS00350 Monoacylglycerol lipase
* ? USA300TCH1516_ALE 88662 =238 (1.250)10 (0.070) 6/126 NT 5.7% intergenic (+35/‑730) nusG_1/USA300TCH1516_00080 Transcription termination/antitermination protein NusG/hypothetical protein
?USA300TCH1516_ALE 88722 = 143 (0.960)intergenic (+95/‑670) nusG_1/USA300TCH1516_00080 Transcription termination/antitermination protein NusG/hypothetical protein
* ? USA300TCH1516_ALE 102238 =191 (1.000)10 (0.060) 8/142 NT 5.6% intergenic (+224/+131) gltR/USA300HOU_RS00485 HTH‑type transcriptional regulator GltR/hypothetical protein
?USA300TCH1516_ALE 102291 = 169 (1.000)intergenic (+277/+78) gltR/USA300HOU_RS00485 HTH‑type transcriptional regulator GltR/hypothetical protein
* ? USA300TCH1516_ALE = 110682232 (1.220)17 (0.100) 8/150 NT 6.6% coding (541/771 nt) USA300HOU_RS00515 putative lipoprotein
?USA300TCH1516_ALE = 110687 260 (1.460)coding (546/771 nt) USA300HOU_RS00515 putative lipoprotein
* ? USA300TCH1516_ALE = 110692280 (1.470)13 (0.070) 5/150 NT 5.4% coding (551/771 nt) USA300HOU_RS00515 putative lipoprotein
?USA300TCH1516_ALE = 112333 192 (1.080)coding (536/771 nt) USA300HOU_RS00525 putative lipoprotein
* ? USA300TCH1516_ALE = 127847137 (0.720)17 (0.100) 11/138 NT 11.3% intergenic (+67/+262) lctP_1/spa L‑lactate permease/Immunoglobulin G‑binding protein A
?USA300TCH1516_ALE = 127871 149 (0.910)intergenic (+91/+238) lctP_1/spa L‑lactate permease/Immunoglobulin G‑binding protein A
* ? USA300TCH1516_ALE 141111 =158 (0.830)22 (0.130) 9/146 NT 14.5% coding (36/1779 nt) iucC_2 Aerobactin synthase
?USA300TCH1516_ALE 141138 = 116 (0.670)coding (63/1779 nt) iucC_2 Aerobactin synthase
* ? USA300TCH1516_ALE = 145658178 (0.930)9 (0.050) 6/140 NT 5.3% intergenic (+83/‑113) noc_1/USA300HOU_RS00655 Nucleoid occlusion protein/hypothetical protein
?USA300TCH1516_ALE = 145678 165 (0.990)intergenic (+103/‑93) noc_1/USA300HOU_RS00655 Nucleoid occlusion protein/hypothetical protein
* ? USA300TCH1516_ALE = 147873148 (0.780)10 (0.060) 6/142 NT 6.5% intergenic (+31/‑314) butA/wbgU Diacetyl reductase [(S)‑acetoin forming]/UDP‑N‑acetylglucosamine 4‑epimerase
?USA300TCH1516_ALE = 147897 158 (0.940)intergenic (+55/‑290) butA/wbgU Diacetyl reductase [(S)‑acetoin forming]/UDP‑N‑acetylglucosamine 4‑epimerase
* ? USA300TCH1516_ALE 161003 =186 (0.980)18 (0.120) 10/124 NT 12.3% intergenic (+17/+114) deoB/phnE_1 Phosphopentomutase/Phosphate‑import permease protein PhnE
?USA300TCH1516_ALE 161059 = 113 (0.770)intergenic (+73/+58) deoB/phnE_1 Phosphopentomutase/Phosphate‑import permease protein PhnE
* ? USA300TCH1516_ALE 181969 =199 (1.040)16 (0.090) 10/150 NT 8.1% coding (32/1110 nt) glgA Glycogen synthase
?USA300TCH1516_ALE 181998 = 178 (1.000)coding (61/1110 nt) glgA Glycogen synthase
* ? USA300TCH1516_ALE 260284 =171 (0.900)10 (0.060) 9/138 NT 6.8% intergenic (‑398/‑190) potD_1/pflB Spermidine/putrescine‑binding periplasmic protein/Formate acetyltransferase
?USA300TCH1516_ALE 260324 = 129 (0.790)intergenic (‑438/‑150) potD_1/pflB Spermidine/putrescine‑binding periplasmic protein/Formate acetyltransferase
* ? USA300TCH1516_ALE 278631 =206 (1.080)30 (0.180) 15/140 NT 16.5% intergenic (+226/+88) USA300HOU_RS01215/gsiB hypothetical protein/Glutathione‑binding protein GsiB
?USA300TCH1516_ALE 278672 = 124 (0.750)intergenic (+267/+47) USA300HOU_RS01215/gsiB hypothetical protein/Glutathione‑binding protein GsiB
* ? USA300TCH1516_ALE = 280894202 (1.060)18 (0.110)
+TTAATTGGGAGTA		 7/134 NT 10.5% intergenic (‑146/+11) USA300HOU_RS01225/USA300HOU_RS01230 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 855632 = 165 (0.870)intergenic (+163/‑597) zipA_1/cggR Cell division protein ZipA/Central glycolytic genes regulator
* ? USA300TCH1516_ALE = 282679139 (0.730)13 (0.080) 9/140 NT 8.7% intergenic (‑430/‑143) hmp/ldh1 Flavohemoprotein/L‑lactate dehydrogenase 1
?USA300TCH1516_ALE = 282694 150 (0.900)intergenic (‑445/‑128) hmp/ldh1 Flavohemoprotein/L‑lactate dehydrogenase 1
* ? USA300TCH1516_ALE 309797 =182 (0.960)10 (0.060) 9/134 NT 7.8% intergenic (+54/+54) lrgB/yydK Antiholin‑like protein LrgB/putative HTH‑type transcriptional regulator YydK
?USA300TCH1516_ALE 309842 = 86 (0.540)intergenic (+99/+9) lrgB/yydK Antiholin‑like protein LrgB/putative HTH‑type transcriptional regulator YydK
* ? USA300TCH1516_ALE = 311196163 (0.860)15 (0.090) 9/148 NT 8.8% coding (493/792 nt) ptsG_3 PTS system glucose‑specific EIICBA component
?USA300TCH1516_ALE = 311222 159 (0.900)coding (519/792 nt) ptsG_3 PTS system glucose‑specific EIICBA component
* ? USA300TCH1516_ALE 326015 =176 (0.920)20 (0.120) 13/142 NT 11.8% intergenic (‑19/+49) USA300HOU_RS01460/USA300HOU_RS01465 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 326051 = 143 (0.850)intergenic (‑55/+13) USA300HOU_RS01460/USA300HOU_RS01465 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 329202 =181 (0.950)28 (0.170) 13/140 NT 15.1% intergenic (+70/+73) USA300HOU_RS01475/ssaA2_1 hypothetical protein/Staphylococcal secretory antigen ssaA2
?USA300TCH1516_ALE 329255 = 158 (0.950)intergenic (+123/+20) USA300HOU_RS01475/ssaA2_1 hypothetical protein/Staphylococcal secretory antigen ssaA2
* ? USA300TCH1516_ALE = 329211183 (0.960)30 (0.180) 17/140 NT 15.9% intergenic (+79/+64) USA300HOU_RS01475/ssaA2_1 hypothetical protein/Staphylococcal secretory antigen ssaA2
?USA300TCH1516_ALE = 329244 158 (0.950)intergenic (+112/+31) USA300HOU_RS01475/ssaA2_1 hypothetical protein/Staphylococcal secretory antigen ssaA2
* ? USA300TCH1516_ALE = 344445212 (1.110)20 (0.130)
+ACATTAAGATAGTTTA		 8/128 NT 10.7% intergenic (+44/‑164) yezG_1/USA300HOU_RS01545 putative antitoxin YezG/hypothetical protein
?USA300TCH1516_ALE = 348041 206 (1.080)coding (288/300 nt) yezG_1 putative antitoxin YezG
* ? USA300TCH1516_ALE 349720 =193 (1.010)12 (0.070) 8/142 NT 7.5% intergenic (+272/‑314) USA300HOU_RS01580/yezG_6 hypothetical protein/putative antitoxin YezG
?USA300TCH1516_ALE 349754 = 125 (0.740)intergenic (+306/‑280) USA300HOU_RS01580/yezG_6 hypothetical protein/putative antitoxin YezG
* ? USA300TCH1516_ALE = 356004159 (0.830)16 (0.090) 10/148 NT 9.4% coding (696/1308 nt) brnQ_2 Branched‑chain amino acid transport system 2 carrier protein
?USA300TCH1516_ALE = 356029 160 (0.910)coding (671/1308 nt) brnQ_2 Branched‑chain amino acid transport system 2 carrier protein
* ? USA300TCH1516_ALE 365029 =140 (0.730)19 (0.120) 13/136 NT 13.3% intergenic (+39/+66) nupC_1/sglT Nucleoside permease NupC/Sodium/glucose cotransporter
?USA300TCH1516_ALE 365083 = 128 (0.790)intergenic (+93/+12) nupC_1/sglT Nucleoside permease NupC/Sodium/glucose cotransporter
* ? USA300TCH1516_ALE = 365040144 (0.760)15 (0.090) 11/136 NT 10.7% intergenic (+50/+55) nupC_1/sglT Nucleoside permease NupC/Sodium/glucose cotransporter
?USA300TCH1516_ALE = 365070 128 (0.790)intergenic (+80/+25) nupC_1/sglT Nucleoside permease NupC/Sodium/glucose cotransporter
* ? USA300TCH1516_ALE = 371234159 (0.830)28 (0.160) 14/150 NT 14.9% coding (707/1362 nt) ylbJ Sporulation integral membrane protein YlbJ
?USA300TCH1516_ALE = 371261 171 (0.960)coding (680/1362 nt) ylbJ Sporulation integral membrane protein YlbJ
* ? USA300TCH1516_ALE 374491 =136 (0.710)16 (0.090) 11/144 NT 11.1% intergenic (+109/+133) lip2/USA300HOU_RS01705 Lipase 2/hypothetical protein
?USA300TCH1516_ALE 374527 = 135 (0.790)intergenic (+145/+97) lip2/USA300HOU_RS01705 Lipase 2/hypothetical protein
* ? USA300TCH1516_ALE = 374498141 (0.740)27 (0.160) 14/144 NT 17.1% intergenic (+116/+126) lip2/USA300HOU_RS01705 Lipase 2/hypothetical protein
?USA300TCH1516_ALE = 374518 135 (0.790)intergenic (+136/+106) lip2/USA300HOU_RS01705 Lipase 2/hypothetical protein
* ? USA300TCH1516_ALE 393589 =139 (0.730)21 (0.120) 12/142 NT 14.0% intergenic (+12/+48) USA300HOU_RS01800/USA300HOU_RS01805 NAD(P)H‑dependent FAD/FMN reductase/hypothetical protein
?USA300TCH1516_ALE 393631 = 135 (0.800)intergenic (+54/+6) USA300HOU_RS01800/USA300HOU_RS01805 NAD(P)H‑dependent FAD/FMN reductase/hypothetical protein
* ? USA300TCH1516_ALE = 393597136 (0.710)11 (0.070) 6/142 NT 7.9% intergenic (+20/+40) USA300HOU_RS01800/USA300HOU_RS01805 NAD(P)H‑dependent FAD/FMN reductase/hypothetical protein
?USA300TCH1516_ALE = 393621 135 (0.800)intergenic (+44/+16) USA300HOU_RS01800/USA300HOU_RS01805 NAD(P)H‑dependent FAD/FMN reductase/hypothetical protein
* ? USA300TCH1516_ALE 412131 =181 (0.950)13 (0.080) 8/144 NT 7.6% coding (1028/1161 nt) metC Cystathionine beta‑lyase MetC
?USA300TCH1516_ALE 412165 = 152 (0.890)coding (994/1161 nt) metC Cystathionine beta‑lyase MetC
* ? USA300TCH1516_ALE 414290 =183 (0.960)16 (0.090) 8/148 NT 8.4% intergenic (‑32/‑632) metI/spo0C Cystathionine gamma‑synthase/O‑acetylhomoserine (thiol)‑lyase/Chromosome‑partitioning protein Spo0J
?USA300TCH1516_ALE 414341 = 181 (1.030)intergenic (‑83/‑581) metI/spo0C Cystathionine gamma‑synthase/O‑acetylhomoserine (thiol)‑lyase/Chromosome‑partitioning protein Spo0J
* ? USA300TCH1516_ALE = 422512181 (0.950)21 (0.130) 8/136 NT 11.4% coding (581/612 nt) USA300HOU_RS01965 hypothetical protein
?USA300TCH1516_ALE = 422533 174 (1.080)coding (602/612 nt) USA300HOU_RS01965 hypothetical protein
* ? USA300TCH1516_ALE = 425019204 (1.070)14 (0.080) 10/146 NT 6.7% intergenic (+34/‑392) USA300HOU_RS01985/gpmA_1 hypothetical protein/2,3‑bisphosphoglycerate‑dependent phosphoglycerate mutase
?USA300TCH1516_ALE = 425031 207 (1.190)intergenic (+46/‑380) USA300HOU_RS01985/gpmA_1 hypothetical protein/2,3‑bisphosphoglycerate‑dependent phosphoglycerate mutase
* ? USA300TCH1516_ALE 426001 =221 (1.160)12 (0.070) 7/140 NT 6.1% intergenic (+9/+57) gpmA_1/USA300HOU_RS02000 2,3‑bisphosphoglycerate‑dependent phosphoglycerate mutase/hypothetical protein
?USA300TCH1516_ALE 426042 = 177 (1.060)intergenic (+50/+16) gpmA_1/USA300HOU_RS02000 2,3‑bisphosphoglycerate‑dependent phosphoglycerate mutase/hypothetical protein
* ? USA300TCH1516_ALE 435390 =184 (0.970)18 (0.110) 12/144 NT 10.9% intergenic (‑86/+57) USA300HOU_RS02045/USA300HOU_RS02050 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 435420 = 130 (0.760)intergenic (‑116/+27) USA300HOU_RS02045/USA300HOU_RS02050 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 441303165 (0.870)24 (0.140) 17/142 NT 13.8% intergenic (+20/+93) guaA/USA300HOU_RS02075 GMP synthase [glutamine‑hydrolyzing]/hypothetical protein
?USA300TCH1516_ALE = 441313 154 (0.910)intergenic (+30/+83) guaA/USA300HOU_RS02075 GMP synthase [glutamine‑hydrolyzing]/hypothetical protein
* ? USA300TCH1516_ALE = 478764134 (0.700)7 (0.040) 6/140 NT 5.3% coding (1288/1485 nt) nuoL NADH‑quinone oxidoreductase subunit L
?USA300TCH1516_ALE = 478800 132 (0.790)coding (1324/1485 nt) nuoL NADH‑quinone oxidoreductase subunit L
* ? USA300TCH1516_ALE = 482264125 (0.660)19 (0.110) 8/146 NT 14.0% intergenic (+61/‑622) USA300HOU_RS02285/USA300HOU_RS02295 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 482286 119 (0.690)intergenic (+83/‑600) USA300HOU_RS02285/USA300HOU_RS02295 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 492708 =102 (0.540)23 (0.150) 10/128 NT 20.6% intergenic (+130/+55) sle1_1/USA300HOU_RS02345 N‑acetylmuramoyl‑L‑alanine amidase sle1/hypothetical protein
?USA300TCH1516_ALE 492758 = 96 (0.630)intergenic (+180/+5) sle1_1/USA300HOU_RS02345 N‑acetylmuramoyl‑L‑alanine amidase sle1/hypothetical protein
* ? USA300TCH1516_ALE = 49272399 (0.520)29 (0.190) 16/128 NT 24.9% intergenic (+145/+40) sle1_1/USA300HOU_RS02345 N‑acetylmuramoyl‑L‑alanine amidase sle1/hypothetical protein
?USA300TCH1516_ALE = 492741 96 (0.630)intergenic (+163/+22) sle1_1/USA300HOU_RS02345 N‑acetylmuramoyl‑L‑alanine amidase sle1/hypothetical protein
* ? USA300TCH1516_ALE 494152 =175 (0.920)22 (0.130) 11/142 NT 13.3% intergenic (+101/+68) bltD_1/USA300HOU_RS02360 Spermine/spermidine acetyltransferase/hypothetical protein
?USA300TCH1516_ALE 494194 = 133 (0.790)intergenic (+143/+26) bltD_1/USA300HOU_RS02360 Spermine/spermidine acetyltransferase/hypothetical protein
* ? USA300TCH1516_ALE 511377 =165 (0.870)12 (0.070) 10/146 NT 7.6% coding (42/597 nt) recR Recombination protein RecR
?USA300TCH1516_ALE 511430 = 143 (0.820)coding (95/597 nt) recR Recombination protein RecR
* ? USA300TCH1516_ALE = 511978156 (0.820)19 (0.110) 13/150 NT 11.4% intergenic (+46/‑6717) recR/speA_2 Recombination protein RecR/Arginine decarboxylase
?USA300TCH1516_ALE = 511998 150 (0.840)intergenic (+66/‑6697) recR/speA_2 Recombination protein RecR/Arginine decarboxylase
* ? USA300TCH1516_ALE = 515946NA (NA)12 (0.070) 8/146 NT NA intergenic (+4014/‑2749) recR/speA_2 Recombination protein RecR/Arginine decarboxylase
?USA300TCH1516_ALE = 515981 NA (NA)intergenic (+4049/‑2714) recR/speA_2 Recombination protein RecR/Arginine decarboxylase
* ? USA300TCH1516_ALE = 518607161 (0.850)14 (0.080) 8/142 NT 8.0% intergenic (+6675/‑88) recR/speA_2 Recombination protein RecR/Arginine decarboxylase
?USA300TCH1516_ALE = 518622 180 (1.070)intergenic (+6690/‑73) recR/speA_2 Recombination protein RecR/Arginine decarboxylase
* ? USA300TCH1516_ALE 553211 =179 (0.940)10 (0.060) 5/138 NT 6.7% coding (182/477 nt) folK 2‑amino‑4‑hydroxy‑6‑ hydroxymethyldihydropteridine pyrophosphokinase
?USA300TCH1516_ALE 553257 = 124 (0.760)coding (228/477 nt) folK 2‑amino‑4‑hydroxy‑6‑ hydroxymethyldihydropteridine pyrophosphokinase
* ? USA300TCH1516_ALE = 557240NA (NA)19 (0.110) 9/152 NT NA intergenic (+298/‑1471) USA300TCH1516_00504/USA300TCH1516_00505 tRNA‑Ala/tRNA‑Ile
?USA300TCH1516_ALE = 557277 NA (NA)intergenic (+335/‑1434) USA300TCH1516_00504/USA300TCH1516_00505 tRNA‑Ala/tRNA‑Ile
* ? USA300TCH1516_ALE 598632 =200 (1.050)12 (0.080) 8/124 NT 8.4% intergenic (+181/+101) tuf/yxeP_2 Elongation factor Tu/putative hydrolase YxeP
?USA300TCH1516_ALE 598687 = 107 (0.730)intergenic (+236/+46) tuf/yxeP_2 Elongation factor Tu/putative hydrolase YxeP
* ? USA300TCH1516_ALE 598636 =202 (1.060)20 (0.130) 8/132 NT 11.5% intergenic (+185/+97) tuf/yxeP_2 Elongation factor Tu/putative hydrolase YxeP
?USA300TCH1516_ALE = 974254 143 (0.910)intergenic (+97/‑450) mrp/oatA_1 Iron‑sulfur cluster carrier protein/O‑acetyltransferase OatA
* ? USA300TCH1516_ALE 633311 =143 (0.750)16 (0.100) 12/134 NT 10.8% intergenic (+35/‑509) proP/yhfT Proline/betaine transporter/putative acyl‑‑CoA ligase YhfT
?USA300TCH1516_ALE 633354 = 146 (0.920)intergenic (+78/‑466) proP/yhfT Proline/betaine transporter/putative acyl‑‑CoA ligase YhfT
* ? USA300TCH1516_ALE = 633323138 (0.720)17 (0.110) 11/134 NT 11.5% intergenic (+47/‑497) proP/yhfT Proline/betaine transporter/putative acyl‑‑CoA ligase YhfT
?USA300TCH1516_ALE = 633340 146 (0.920)intergenic (+64/‑480) proP/yhfT Proline/betaine transporter/putative acyl‑‑CoA ligase YhfT
* ? USA300TCH1516_ALE 641988 =198 (1.040)17 (0.100) 13/144 NT 9.2% intergenic (+7/+135) yhdG_1/USA300HOU_RS03060 putative amino acid permease YhdG/hypothetical protein
?USA300TCH1516_ALE 642033 = 157 (0.920)intergenic (+52/+90) yhdG_1/USA300HOU_RS03060 putative amino acid permease YhdG/hypothetical protein
* ? USA300TCH1516_ALE 646656 =224 (1.180)23 (0.140) 10/140 NT 11.5% intergenic (+10/‑577) lipL/galK Octanoyl‑[GcvH]:protein N‑octanoyltransferase/Galactokinase
?USA300TCH1516_ALE 646692 = 159 (0.960)intergenic (+46/‑541) lipL/galK Octanoyl‑[GcvH]:protein N‑octanoyltransferase/Galactokinase
* ? USA300TCH1516_ALE 650751 =209 (1.100)27 (0.150) 15/152 NT 13.3% intergenic (+3/+49) USA300HOU_RS03100/rclA hypothetical protein/putative pyridine nucleotide‑disulfide oxidoreductase RclA
?USA300TCH1516_ALE 650786 = 155 (0.860)intergenic (+38/+14) USA300HOU_RS03100/rclA hypothetical protein/putative pyridine nucleotide‑disulfide oxidoreductase RclA
* ? USA300TCH1516_ALE 668580 =197 (1.030)15 (0.080) 9/152 NT 7.7% coding (565/1011 nt) adh Alcohol dehydrogenase
?USA300TCH1516_ALE 668601 = 172 (0.950)coding (586/1011 nt) adh Alcohol dehydrogenase
* ? USA300TCH1516_ALE = 669094189 (0.990)28 (0.170) 15/142 NT 12.6% intergenic (+68/‑7) adh/USA300TCH1516_00602 Alcohol dehydrogenase/hypothetical protein
?USA300TCH1516_ALE = 669118 222 (1.320)coding (18/108 nt) USA300TCH1516_00602 hypothetical protein
* ? USA300TCH1516_ALE 671388 =211 (1.110)11 (0.070) 8/140 NT 6.1% intergenic (+13/‑375) argS/nth_1 Arginine‑‑tRNA ligase/Endonuclease III
?USA300TCH1516_ALE 671434 = 152 (0.910)intergenic (+59/‑329) argS/nth_1 Arginine‑‑tRNA ligase/Endonuclease III
* ? USA300TCH1516_ALE 671631 =107 (0.560)19 (0.110) 6/152 NT 13.4% intergenic (+256/‑132) argS/nth_1 Arginine‑‑tRNA ligase/Endonuclease III
?USA300TCH1516_ALE = 801042 145 (0.800)intergenic (+176/‑175) hisC_1/USA300HOU_RS03915 Histidinol‑phosphate aminotransferase/Putative 5'(3')‑deoxyribonucleotidase
* ? USA300TCH1516_ALE = 672729217 (1.140)16 (0.090) 8/148 NT 7.0% intergenic (+331/‑48) nth_1/btuF Endonuclease III/Vitamin B12‑binding protein
?USA300TCH1516_ALE = 672751 224 (1.270)intergenic (+353/‑26) nth_1/btuF Endonuclease III/Vitamin B12‑binding protein
* ? USA300TCH1516_ALE 678842 =147 (0.770)25 (0.150) 15/136 NT 16.6% intergenic (+45/+206) pip/sarA Proline iminopeptidase/Transcriptional regulator SarA
?USA300TCH1516_ALE 678886 = 127 (0.790)intergenic (+89/+162) pip/sarA Proline iminopeptidase/Transcriptional regulator SarA
* ? USA300TCH1516_ALE = 678853143 (0.750)25 (0.150) 13/136 NT 16.8% intergenic (+56/+195) pip/sarA Proline iminopeptidase/Transcriptional regulator SarA
?USA300TCH1516_ALE = 678873 127 (0.790)intergenic (+76/+175) pip/sarA Proline iminopeptidase/Transcriptional regulator SarA
* ? USA300TCH1516_ALE 681130 =171 (0.900)34 (0.210) 18/136 NT 20.7% intergenic (‑200/+8) USA300HOU_RS03280/USA300TCH1516_00615 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 681182 = 115 (0.710)coding (310/354 nt) USA300TCH1516_00615 hypothetical protein
* ? USA300TCH1516_ALE 682222 =178 (0.930)11 (0.070) 9/140 NT 6.1% intergenic (‑64/+45) USA300TCH1516_00616/rcsF_2 hypothetical protein/Outer membrane lipoprotein RcsF
?USA300TCH1516_ALE 682264 = 186 (1.120)intergenic (‑106/+3) USA300TCH1516_00616/rcsF_2 hypothetical protein/Outer membrane lipoprotein RcsF
* ? USA300TCH1516_ALE = 682231188 (0.990)24 (0.140) 14/140 NT 12.1% intergenic (‑73/+36) USA300TCH1516_00616/rcsF_2 hypothetical protein/Outer membrane lipoprotein RcsF
?USA300TCH1516_ALE = 682253 186 (1.120)intergenic (‑95/+14) USA300TCH1516_00616/rcsF_2 hypothetical protein/Outer membrane lipoprotein RcsF
* ? USA300TCH1516_ALE = 705329171 (0.900)19 (0.110) 10/142 NT 10.3% intergenic (+1079/+81) nhaK_1/mntA Sodium, potassium, lithium and rubidium/H(+) antiporter/Manganese‑binding lipoprotein MntA
?USA300TCH1516_ALE = 705368 180 (1.070)intergenic (+1118/+42) nhaK_1/mntA Sodium, potassium, lithium and rubidium/H(+) antiporter/Manganese‑binding lipoprotein MntA
* ? USA300TCH1516_ALE = 710532187 (0.980)32 (0.190) 12/142 NT 15.3% intergenic (+25/+36) tarA/tagH_1 N‑acetylglucosaminyldiphosphoundecaprenol N‑acetyl‑beta‑D‑mannosaminyltransferase/Teichoic acids export ATP‑binding protein TagH
?USA300TCH1516_ALE = 710552 189 (1.120)intergenic (+45/+16) tarA/tagH_1 N‑acetylglucosaminyldiphosphoundecaprenol N‑acetyl‑beta‑D‑mannosaminyltransferase/Teichoic acids export ATP‑binding protein TagH
* ? USA300TCH1516_ALE = 712543147 (0.770)23 (0.130) 12/148 NT 13.7% intergenic (+22/‑77) tagG/tarB Teichoic acid translocation permease protein TagG/Teichoic acid glycerol‑phosphate primase
?USA300TCH1516_ALE = 712566 153 (0.870)intergenic (+45/‑54) tagG/tarB Teichoic acid translocation permease protein TagG/Teichoic acid glycerol‑phosphate primase
* ? USA300TCH1516_ALE 715303 =139 (0.730)16 (0.100) 8/132 NT 11.3% intergenic (+61/+56) tarD/dacA Glycerol‑3‑phosphate cytidylyltransferase/D‑alanyl‑D‑alanine carboxypeptidase DacA
?USA300TCH1516_ALE 715350 = 138 (0.880)intergenic (+108/+9) tarD/dacA Glycerol‑3‑phosphate cytidylyltransferase/D‑alanyl‑D‑alanine carboxypeptidase DacA
* ? USA300TCH1516_ALE = 715316155 (0.810)15 (0.100) 10/132 NT 10.2% intergenic (+74/+43) tarD/dacA Glycerol‑3‑phosphate cytidylyltransferase/D‑alanyl‑D‑alanine carboxypeptidase DacA
?USA300TCH1516_ALE = 715335 138 (0.880)intergenic (+93/+24) tarD/dacA Glycerol‑3‑phosphate cytidylyltransferase/D‑alanyl‑D‑alanine carboxypeptidase DacA
* ? USA300TCH1516_ALE 720538 =154 (0.810)18 (0.100) 12/148 NT 11.1% intergenic (+148/‑377) nupG/USA300HOU_RS03495 Purine nucleoside transport protein NupG/hypothetical protein
?USA300TCH1516_ALE 720578 = 147 (0.830)intergenic (+188/‑337) nupG/USA300HOU_RS03495 Purine nucleoside transport protein NupG/hypothetical protein
* ? USA300TCH1516_ALE = 724910169 (0.890)16 (0.100) 11/140 NT 9.4% intergenic (+30/‑204) feuC_1/dhaK Iron‑uptake system permease protein FeuC/PTS‑dependent dihydroxyacetone kinase, dihydroxyacetone‑binding subunit DhaK
?USA300TCH1516_ALE = 724929 160 (0.960)intergenic (+49/‑185) feuC_1/dhaK Iron‑uptake system permease protein FeuC/PTS‑dependent dihydroxyacetone kinase, dihydroxyacetone‑binding subunit DhaK
* ? USA300TCH1516_ALE 729254 =175 (0.920)19 (0.120) 11/136 NT 12.3% intergenic (+55/‑96) USA300HOU_RS03535/aes hypothetical protein/Acetyl esterase
?USA300TCH1516_ALE 729295 = 122 (0.760)intergenic (+96/‑55) USA300HOU_RS03535/aes hypothetical protein/Acetyl esterase
* ? USA300TCH1516_ALE = 739800182 (0.960)21 (0.130) 10/134 NT 10.9% intergenic (+27/+561) pitA_1/sle1_2 Low‑affinity inorganic phosphate transporter 1/N‑acetylmuramoyl‑L‑alanine amidase sle1
?USA300TCH1516_ALE = 739823 192 (1.210)intergenic (+50/+538) pitA_1/sle1_2 Low‑affinity inorganic phosphate transporter 1/N‑acetylmuramoyl‑L‑alanine amidase sle1
* ? USA300TCH1516_ALE = 744697190 (1.000)16 (0.090) 10/152 NT 7.9% coding (1838/1980 nt) melR_1 Melibiose operon regulatory protein
?USA300TCH1516_ALE = 744717 192 (1.060)coding (1858/1980 nt) melR_1 Melibiose operon regulatory protein
* ? USA300TCH1516_ALE 750720 =201 (1.050)26 (0.160) 14/140 NT 14.1% coding (431/489 nt) USA300HOU_RS03650 hypothetical protein
?USA300TCH1516_ALE 750744 = 140 (0.840)coding (455/489 nt) USA300HOU_RS03650 hypothetical protein
* ? USA300TCH1516_ALE 753677 =167 (0.880)18 (0.120) 12/130 NT 13.5% intergenic (+20/+76) USA300HOU_RS03675/yvdD hypothetical protein/LOG family protein YvdD
?USA300TCH1516_ALE 753732 = 96 (0.620)intergenic (+75/+21) USA300HOU_RS03675/yvdD hypothetical protein/LOG family protein YvdD
* ? USA300TCH1516_ALE 760026 =140 (0.730)31 (0.200) 17/132 NT 21.3% coding (1674/1674 nt) USA300HOU_RS03705 Putative multidrug export ATP‑binding/permease protein
?USA300TCH1516_ALE 760070 = 114 (0.730)intergenic (+44/+83) USA300HOU_RS03705/mgrA Putative multidrug export ATP‑binding/permease protein/HTH‑type transcriptional regulator MgrA
* ? USA300TCH1516_ALE = 760039135 (0.710)15 (0.100) 8/132 NT 11.8% intergenic (+13/+114) USA300HOU_RS03705/mgrA Putative multidrug export ATP‑binding/permease protein/HTH‑type transcriptional regulator MgrA
?USA300TCH1516_ALE = 760055 114 (0.730)intergenic (+29/+98) USA300HOU_RS03705/mgrA Putative multidrug export ATP‑binding/permease protein/HTH‑type transcriptional regulator MgrA
* ? USA300TCH1516_ALE = 761262168 (0.880)13 (0.070) 9/148 NT 7.4% coding (440/927 nt) yciC_2 Putative metal chaperone YciC
?USA300TCH1516_ALE = 761280 168 (0.950)coding (458/927 nt) yciC_2 Putative metal chaperone YciC
* ? USA300TCH1516_ALE 768843 =213 (1.120)13 (0.070) 8/146 NT 6.7% coding (597/1167 nt) tetA_3 Tetracycline resistance protein, class B
?USA300TCH1516_ALE 768872 = 168 (0.970)coding (626/1167 nt) tetA_3 Tetracycline resistance protein, class B
* ? USA300TCH1516_ALE = 769784151 (0.790)10 (0.060) 8/146 NT 6.2% coding (91/465 nt) USA300HOU_RS03760 hypothetical protein
?USA300TCH1516_ALE = 769799 165 (0.950)coding (106/465 nt) USA300HOU_RS03760 hypothetical protein
* ? USA300TCH1516_ALE = 774511156 (0.820)9 (0.050) 6/144 NT 5.8% coding (1761/1959 nt) fruA PTS system fructose‑specific EIIABC component
?USA300TCH1516_ALE = 774540 152 (0.890)coding (1790/1959 nt) fruA PTS system fructose‑specific EIIABC component
* ? USA300TCH1516_ALE = 782423166 (0.870)11 (0.070) 9/140 NT 6.5% intergenic (‑218/+124) USA300HOU_RS03820/USA300HOU_RS03825 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 782442 169 (1.020)intergenic (‑237/+105) USA300HOU_RS03820/USA300HOU_RS03825 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 799573 =172 (0.900)20 (0.130) 7/128 NT 13.8% intergenic (+5/‑235) opuBB/hisC_1 Choline transport system permease protein OpuBB/Histidinol‑phosphate aminotransferase
?USA300TCH1516_ALE 799622 = 113 (0.740)intergenic (+54/‑186) opuBB/hisC_1 Choline transport system permease protein OpuBB/Histidinol‑phosphate aminotransferase
* ? USA300TCH1516_ALE 801949 =216 (1.130)14 (0.080) 7/156 NT 6.5% intergenic (+190/+434) USA300HOU_RS03915/USA300HOU_RS03920 Putative 5'(3')‑deoxyribonucleotidase/Putative lipid kinase
?USA300TCH1516_ALE = 848322 190 (1.020)intergenic (+327/‑553) trxB/USA300HOU_RS04145 Thioredoxin reductase/Nucleotide‑binding protein
* ? USA300TCH1516_ALE 802131 =131 (0.690)9 (0.050) 7/138 NT 6.7% intergenic (+372/+252) USA300HOU_RS03915/USA300HOU_RS03920 Putative 5'(3')‑deoxyribonucleotidase/Putative lipid kinase
?USA300TCH1516_ALE 802180 = 139 (0.850)intergenic (+421/+203) USA300HOU_RS03915/USA300HOU_RS03920 Putative 5'(3')‑deoxyribonucleotidase/Putative lipid kinase
* ? USA300TCH1516_ALE = 802141128 (0.670)14 (0.090) 8/138 NT 10.1% intergenic (+382/+242) USA300HOU_RS03915/USA300HOU_RS03920 Putative 5'(3')‑deoxyribonucleotidase/Putative lipid kinase
?USA300TCH1516_ALE = 802168 139 (0.850)intergenic (+409/+215) USA300HOU_RS03915/USA300HOU_RS03920 Putative 5'(3')‑deoxyribonucleotidase/Putative lipid kinase
* ? USA300TCH1516_ALE 811545 =153 (0.800)11 (0.060)
+CAT		 9/154 NT 7.4% intergenic (+387/‑279) nrdF/fecD_1 Ribonucleoside‑diphosphate reductase subunit beta/Fe(3+) dicitrate transport system permease protein FecD
?USA300TCH1516_ALE = 2665005 134 (0.700)intergenic (+240/+198) pitA_2/USA300TCH1516_02535 L‑methionine sulfoximine/L‑methionine sulfone acetyltransferase/hypothetical protein
* ? USA300TCH1516_ALE 842619 =189 (0.990)15 (0.090) 13/144 NT 8.6% intergenic (+5/‑657) uvrA/hprK UvrABC system protein A/HPr kinase/phosphorylase
?USA300TCH1516_ALE 842662 = 147 (0.860)intergenic (+48/‑614) uvrA/hprK UvrABC system protein A/HPr kinase/phosphorylase
* ? USA300TCH1516_ALE 858374 =153 (0.800)14 (0.080) 12/146 NT 8.9% intergenic (+69/‑70) gapA1/pgk Glyceraldehyde‑3‑phosphate dehydrogenase 1/Phosphoglycerate kinase
?USA300TCH1516_ALE 858405 = 148 (0.850)intergenic (+100/‑39) gapA1/pgk Glyceraldehyde‑3‑phosphate dehydrogenase 1/Phosphoglycerate kinase
* ? USA300TCH1516_ALE = 868310166 (0.870)15 (0.090) 7/148 NT 8.6% coding (458/465 nt) smpB SsrA‑binding protein
?USA300TCH1516_ALE = 868335 165 (0.940)intergenic (+18/+1304) smpB/USA300HOU_RS04240 SsrA‑binding protein/hypothetical protein
* ? USA300TCH1516_ALE 869579 =220 (1.150)25 (0.150) 16/140 NT 12.4% intergenic (+1262/+60) smpB/USA300HOU_RS04240 SsrA‑binding protein/hypothetical protein
?USA300TCH1516_ALE 869621 = 162 (0.970)intergenic (+1304/+18) smpB/USA300HOU_RS04240 SsrA‑binding protein/hypothetical protein
* ? USA300TCH1516_ALE 885377 =157 (0.820)31 (0.190) 13/134 NT 19.5% intergenic (+6/+67) pspB/argO Putative phosphoserine phosphatase 2/Arginine exporter protein ArgO
?USA300TCH1516_ALE 885422 = 124 (0.780)intergenic (+51/+22) pspB/argO Putative phosphoserine phosphatase 2/Arginine exporter protein ArgO
* ? USA300TCH1516_ALE = 885389151 (0.790)13 (0.080) 9/134 NT 9.4% intergenic (+18/+55) pspB/argO Putative phosphoserine phosphatase 2/Arginine exporter protein ArgO
?USA300TCH1516_ALE = 885408 124 (0.780)intergenic (+37/+36) pspB/argO Putative phosphoserine phosphatase 2/Arginine exporter protein ArgO
* ? USA300TCH1516_ALE = 891727133 (0.700)15 (0.080) 8/152 NT 8.7% intergenic (+145/‑594) USA300HOU_RS04385/rnmV_2 hypothetical protein/Ribonuclease M5
?USA300TCH1516_ALE = 1695091 190 (1.050)intergenic (‑297/+233) hemN_1/lepA Oxygen‑independent coproporphyrinogen‑III oxidase‑like protein YqeR/Elongation factor 4
* ? USA300TCH1516_ALE 893176 =213 (1.120)13 (0.080) 9/136 NT 7.2% intergenic (+177/‑73) trxA_1/metN2 Thioredoxin/Methionine import ATP‑binding protein MetN 2
?USA300TCH1516_ALE 893212 = 153 (0.950)intergenic (+213/‑37) trxA_1/metN2 Thioredoxin/Methionine import ATP‑binding protein MetN 2
* ? USA300TCH1516_ALE 909572 =175 (0.920)11 (0.060) 9/144 NT 6.6% intergenic (‑495/‑539) USA300HOU_RS04500/csbD_1 hypothetical protein/Stress response protein CsbD
?USA300TCH1516_ALE 909605 = 155 (0.910)intergenic (‑528/‑506) USA300HOU_RS04500/csbD_1 hypothetical protein/Stress response protein CsbD
* ? USA300TCH1516_ALE 920377 =124 (0.650)14 (0.090) 9/132 NT 11.7% intergenic (+6/‑207) USA300HOU_RS04555/USA300HOU_RS04565 Putative monooxygenase/hypothetical protein
?USA300TCH1516_ALE 920443 = 109 (0.700)intergenic (+72/‑141) USA300HOU_RS04555/USA300HOU_RS04565 Putative monooxygenase/hypothetical protein
* ? USA300TCH1516_ALE = 920390123 (0.650)12 (0.080) 6/132 NT 10.2% intergenic (+19/‑194) USA300HOU_RS04555/USA300HOU_RS04565 Putative monooxygenase/hypothetical protein
?USA300TCH1516_ALE = 920428 109 (0.700)intergenic (+57/‑156) USA300HOU_RS04555/USA300HOU_RS04565 Putative monooxygenase/hypothetical protein
* ? USA300TCH1516_ALE 932460 =154 (0.810)17 (0.110) 13/136 NT 10.6% intergenic (+6/+257) USA300HOU_RS04635/nfuA hypothetical protein/Fe/S biogenesis protein NfuA
?USA300TCH1516_ALE 932506 = 155 (0.960)intergenic (+52/+211) USA300HOU_RS04635/nfuA hypothetical protein/Fe/S biogenesis protein NfuA
* ? USA300TCH1516_ALE = 932471154 (0.810)17 (0.110) 15/136 NT 10.6% intergenic (+17/+246) USA300HOU_RS04635/nfuA hypothetical protein/Fe/S biogenesis protein NfuA
?USA300TCH1516_ALE = 932493 155 (0.960)intergenic (+39/+224) USA300HOU_RS04635/nfuA hypothetical protein/Fe/S biogenesis protein NfuA
* ? USA300TCH1516_ALE 932628 =220 (1.150)24 (0.140) 14/142 NT 12.1% intergenic (+174/+89) USA300HOU_RS04635/nfuA hypothetical protein/Fe/S biogenesis protein NfuA
?USA300TCH1516_ALE 932675 = 154 (0.910)intergenic (+221/+42) USA300HOU_RS04635/nfuA hypothetical protein/Fe/S biogenesis protein NfuA
* ? USA300TCH1516_ALE = 940821169 (0.890)30 (0.170) 13/148 NT 17.5% intergenic (+2/+54) USA300HOU_RS04680/ptlE Putative esterase/Neopentalenolactone D synthase
?USA300TCH1516_ALE = 940872 126 (0.720)intergenic (+53/+3) USA300HOU_RS04680/ptlE Putative esterase/Neopentalenolactone D synthase
* ? USA300TCH1516_ALE 940823 =172 (0.900)12 (0.070) 8/140 NT 7.7% intergenic (+4/+52) USA300HOU_RS04680/ptlE Putative esterase/Neopentalenolactone D synthase
?USA300TCH1516_ALE 940872 = 137 (0.820)intergenic (+53/+3) USA300HOU_RS04680/ptlE Putative esterase/Neopentalenolactone D synthase
* ? USA300TCH1516_ALE 954365 =103 (0.540)16 (0.100) 8/138 NT 13.9% intergenic (+19/+484) gluD/glpQ_1 NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase
?USA300TCH1516_ALE 954407 = 109 (0.660)intergenic (+61/+442) gluD/glpQ_1 NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase
* ? USA300TCH1516_ALE = 954375107 (0.560)9 (0.050) 6/138 NT 8.2% intergenic (+29/+474) gluD/glpQ_1 NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase
?USA300TCH1516_ALE = 954395 109 (0.660)intergenic (+49/+454) gluD/glpQ_1 NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase
* ? USA300TCH1516_ALE 954695 =155 (0.810)51 (0.290)
+GGCAAG		 11/148 NT 24.7% intergenic (+349/+154) gluD/glpQ_1 NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase
?USA300TCH1516_ALE 1873938 = 181 (0.950)intergenic (‑614/+136) USA300HOU_RS09300/USA300HOU_RS09305 Putative dipeptidase/hypothetical protein
* ? USA300TCH1516_ALE 971394 =154 (0.810)25 (0.150) 14/142 NT 16.1% intergenic (+22/+149) USA300HOU_RS04810/cdr hypothetical protein/Coenzyme A disulfide reductase
?USA300TCH1516_ALE 971435 = 125 (0.740)intergenic (+63/+108) USA300HOU_RS04810/cdr hypothetical protein/Coenzyme A disulfide reductase
* ? USA300TCH1516_ALE = 971402149 (0.780)9 (0.050) 8/142 NT 6.5% intergenic (+30/+141) USA300HOU_RS04810/cdr hypothetical protein/Coenzyme A disulfide reductase
?USA300TCH1516_ALE = 971425 125 (0.740)intergenic (+53/+118) USA300HOU_RS04810/cdr hypothetical protein/Coenzyme A disulfide reductase
* ? USA300TCH1516_ALE = 987447117 (0.610)27 (0.180) 18/128 NT 20.4% intergenic (+20/+35) fabF/USA300HOU_RS04885 3‑oxoacyl‑[acyl‑carrier‑protein] synthase 2/hypothetical protein
?USA300TCH1516_ALE = 987456 118 (0.780)intergenic (+29/+26) fabF/USA300HOU_RS04885 3‑oxoacyl‑[acyl‑carrier‑protein] synthase 2/hypothetical protein
* ? USA300TCH1516_ALE 1005781 =204 (1.070)29 (0.180) 13/138 NT 15.4% intergenic (+417/+43) pepF1_1/USA300HOU_RS04965 Oligoendopeptidase F, plasmid/hypothetical protein
?USA300TCH1516_ALE 1005817 = 142 (0.870)intergenic (+453/+7) pepF1_1/USA300HOU_RS04965 Oligoendopeptidase F, plasmid/hypothetical protein
* ? USA300TCH1516_ALE 1021264 =173 (0.910)9 (0.050) 6/144 NT 6.2% coding (871/1176 nt) ugtP Processive diacylglycerol beta‑glucosyltransferase
?USA300TCH1516_ALE 1021300 = 118 (0.690)coding (835/1176 nt) ugtP Processive diacylglycerol beta‑glucosyltransferase
* ? USA300TCH1516_ALE 1036446 =211 (1.110)14 (0.090) 6/138 NT 7.7% intergenic (+376/‑968) USA300TCH1516_00963/USA300TCH1516_00964 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 1036485 = 152 (0.930)intergenic (+415/‑929) USA300TCH1516_00963/USA300TCH1516_00964 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 1040357 =218 (1.140)18 (0.110) 12/132 NT 9.6% intergenic (+18/+70) USA300TCH1516_00966/USA300TCH1516_00967 putative ABC transporter ATP‑binding protein/hypothetical protein
?USA300TCH1516_ALE 1040412 = 160 (1.020)intergenic (+73/+15) USA300TCH1516_00966/USA300TCH1516_00967 putative ABC transporter ATP‑binding protein/hypothetical protein
* ? USA300TCH1516_ALE = 1046453164 (0.860)16 (0.090) 12/144 NT 9.2% coding (361/939 nt) menA 1,4‑dihydroxy‑2‑naphthoate octaprenyltransferase
?USA300TCH1516_ALE = 1046472 167 (0.980)coding (342/939 nt) menA 1,4‑dihydroxy‑2‑naphthoate octaprenyltransferase
* ? USA300TCH1516_ALE 1061336 =181 (0.950)12 (0.070) 6/144 NT 7.4% coding (601/3771 nt) atl_1 Bifunctional autolysin
?USA300TCH1516_ALE 1061375 = 136 (0.790)coding (562/3771 nt) atl_1 Bifunctional autolysin
* ? USA300TCH1516_ALE = 1071475158 (0.830)10 (0.060) 7/148 NT 6.1% coding (54/318 nt) USA300HOU_RS05290 Pesticidal crystal protein Cry22Aa
?USA300TCH1516_ALE = 1071489 164 (0.930)coding (40/318 nt) USA300HOU_RS05290 Pesticidal crystal protein Cry22Aa
* ? USA300TCH1516_ALE 1072018 =174 (0.910)11 (0.070) 6/126 NT 7.7% intergenic (‑490/+315) USA300HOU_RS05290/folD Pesticidal crystal protein Cry22Aa/Bifunctional protein FolD protein
?USA300TCH1516_ALE 1072073 = 129 (0.860)intergenic (‑545/+260) USA300HOU_RS05290/folD Pesticidal crystal protein Cry22Aa/Bifunctional protein FolD protein
* ? USA300TCH1516_ALE 1073608 =171 (0.900)11 (0.060) 8/152 NT 6.4% coding (215/483 nt) purE N5‑carboxyaminoimidazole ribonucleotide mutase
?USA300TCH1516_ALE 1073634 = 160 (0.880)coding (241/483 nt) purE N5‑carboxyaminoimidazole ribonucleotide mutase
* ? USA300TCH1516_ALE 1084754 =154 (0.810)17 (0.100) 13/140 NT 11.5% intergenic (+126/+139) purD/ykoC_1 Phosphoribosylamine‑‑glycine ligase/Putative HMP/thiamine permease protein YkoC
?USA300TCH1516_ALE 1084817 = 126 (0.760)intergenic (+189/+76) purD/ykoC_1 Phosphoribosylamine‑‑glycine ligase/Putative HMP/thiamine permease protein YkoC
* ? USA300TCH1516_ALE = 1084763151 (0.790)12 (0.070) 9/140 NT 8.5% intergenic (+135/+130) purD/ykoC_1 Phosphoribosylamine‑‑glycine ligase/Putative HMP/thiamine permease protein YkoC
?USA300TCH1516_ALE = 1084806 126 (0.760)intergenic (+178/+87) purD/ykoC_1 Phosphoribosylamine‑‑glycine ligase/Putative HMP/thiamine permease protein YkoC
* ? USA300TCH1516_ALE = 1086971157 (0.820)23 (0.140) 12/140 NT 13.3% coding (122/1401 nt) ykoD_1 Putative HMP/thiamine import ATP‑binding protein YkoD
?USA300TCH1516_ALE = 1086989 162 (0.970)coding (104/1401 nt) ykoD_1 Putative HMP/thiamine import ATP‑binding protein YkoD
* ? USA300TCH1516_ALE 1114090 =129 (0.680)12 (0.080) 9/126 NT 10.5% intergenic (+19/+63) USA300HOU_RS05510/mntH_1 hypothetical protein/Divalent metal cation transporter MntH
?USA300TCH1516_ALE 1114149 = 104 (0.700)intergenic (+78/+4) USA300HOU_RS05510/mntH_1 hypothetical protein/Divalent metal cation transporter MntH
* ? USA300TCH1516_ALE = 1114106137 (0.720)17 (0.110) 11/126 NT 13.8% intergenic (+35/+47) USA300HOU_RS05510/mntH_1 hypothetical protein/Divalent metal cation transporter MntH
?USA300TCH1516_ALE = 1114131 104 (0.700)intergenic (+60/+22) USA300HOU_RS05510/mntH_1 hypothetical protein/Divalent metal cation transporter MntH
* ? USA300TCH1516_ALE = 1115642170 (0.890)17 (0.100) 11/146 NT 10.3% intergenic (‑137/+47) mntH_1/USA300TCH1516_01038 Divalent metal cation transporter MntH/hypothetical protein
?USA300TCH1516_ALE = 1115662 142 (0.820)intergenic (‑157/+27) mntH_1/USA300TCH1516_01038 Divalent metal cation transporter MntH/hypothetical protein
* ? USA300TCH1516_ALE 1117293 =171 (0.900)15 (0.100) 9/130 NT 10.7% intergenic (+6/+148) suhB_1/USA300TCH1516_01040 Inositol‑1‑monophosphatase/hypothetical protein
?USA300TCH1516_ALE 1117341 = 112 (0.730)intergenic (+54/+100) suhB_1/USA300TCH1516_01040 Inositol‑1‑monophosphatase/hypothetical protein
* ? USA300TCH1516_ALE 1119593 =164 (0.860)19 (0.120) 9/136 NT 11.8% intergenic (+12/+297) typA/USA300HOU_RS05545 GTP‑binding protein TypA/BipA/hypothetical protein
?USA300TCH1516_ALE 1119635 = 144 (0.890)intergenic (+54/+255) typA/USA300HOU_RS05545 GTP‑binding protein TypA/BipA/hypothetical protein
* ? USA300TCH1516_ALE = 1119604153 (0.800)34 (0.210) 16/136 NT 19.9% intergenic (+23/+286) typA/USA300HOU_RS05545 GTP‑binding protein TypA/BipA/hypothetical protein
?USA300TCH1516_ALE = 1119622 144 (0.890)intergenic (+41/+268) typA/USA300HOU_RS05545 GTP‑binding protein TypA/BipA/hypothetical protein
* ? USA300TCH1516_ALE 1119914 =190 (1.000)14 (0.080) 7/148 NT 7.6% coding (459/483 nt) USA300HOU_RS05545 hypothetical protein
?USA300TCH1516_ALE 1119940 = 165 (0.940)coding (433/483 nt) USA300HOU_RS05545 hypothetical protein
* ? USA300TCH1516_ALE 1129293 =184 (0.970)13 (0.080) 10/144 NT 7.6% intergenic (+71/‑256) USA300HOU_RS05575/USA300HOU_RS05585 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 1129331 = 149 (0.870)intergenic (+109/‑218) USA300HOU_RS05575/USA300HOU_RS05585 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 1129920179 (0.940)14 (0.080) 9/148 NT 7.3% coding (372/1038 nt) USA300HOU_RS05585 hypothetical protein
?USA300TCH1516_ALE = 1129939 188 (1.070)coding (391/1038 nt) USA300HOU_RS05585 hypothetical protein
* ? USA300TCH1516_ALE 1131036 =188 (0.990)11 (0.070) 10/126 NT 7.6% coding (435/435 nt) USA300HOU_RS05590 hypothetical protein
?USA300TCH1516_ALE 1131101 = 120 (0.800)coding (925/927 nt) glpQ1 putative glycerophosphodiester phosphodiesterase 1
* ? USA300TCH1516_ALE 1134014 =231 (1.210)12 (0.080) 5/132 NT 6.6% intergenic (+8/+54) coaD/USA300HOU_RS05620 Phosphopantetheine adenylyltransferase/Nicotinamide‑nucleotide adenylyltransferase
?USA300TCH1516_ALE 1134060 = 147 (0.940)intergenic (+54/+8) coaD/USA300HOU_RS05620 Phosphopantetheine adenylyltransferase/Nicotinamide‑nucleotide adenylyltransferase
* ? USA300TCH1516_ALE = 1138356191 (1.000)18 (0.110) 15/140 NT 9.2% intergenic (‑121/+82) isdB/isdA Iron‑regulated surface determinant protein B/Iron‑regulated surface determinant protein A
?USA300TCH1516_ALE = 1138378 190 (1.140)intergenic (‑143/+60) isdB/isdA Iron‑regulated surface determinant protein B/Iron‑regulated surface determinant protein A
* ? USA300TCH1516_ALE 1140472 =196 (1.030)18 (0.110) 10/140 NT 10.3% coding (91/1077 nt) USA300HOU_RS05655 hypothetical protein
?USA300TCH1516_ALE 1140504 = 144 (0.870)coding (123/1077 nt) USA300HOU_RS05655 hypothetical protein
* ? USA300TCH1516_ALE 1149564 =166 (0.870)10 (0.060) 7/142 NT 6.5% intergenic (+150/+21) pheT_1/rnhC Phenylalanine‑‑tRNA ligase beta subunit/Ribonuclease HIII
?USA300TCH1516_ALE 1149598 = 139 (0.820)coding (926/939 nt) rnhC Ribonuclease HIII
* ? USA300TCH1516_ALE = 1164949200 (1.050)15 (0.090) 10/148 NT 6.9% intergenic (+13/+356) fib_1/flr_1 Fibrinogen‑binding protein/FPRL1 inhibitory protein
?USA300TCH1516_ALE = 1164961 219 (1.240)intergenic (+25/+344) fib_1/flr_1 Fibrinogen‑binding protein/FPRL1 inhibitory protein
* ? USA300TCH1516_ALE 1165242 =229 (1.200)33 (0.190) 18/146 NT 14.1% intergenic (+306/+63) fib_1/flr_1 Fibrinogen‑binding protein/FPRL1 inhibitory protein
?USA300TCH1516_ALE 1165280 = 193 (1.110)intergenic (+344/+25) fib_1/flr_1 Fibrinogen‑binding protein/FPRL1 inhibitory protein
* ? USA300TCH1516_ALE = 1168159177 (0.930)38 (0.230) 24/140 NT 18.2% intergenic (+15/+638) scn_2/USA300HOU_RS05810 Staphylococcal complement inhibitor/hypothetical protein
?USA300TCH1516_ALE = 1168177 186 (1.120)intergenic (+33/+620) scn_2/USA300HOU_RS05810 Staphylococcal complement inhibitor/hypothetical protein
* ? USA300TCH1516_ALE = 1168751165 (0.870)20 (0.140) 9/124 NT 11.6% intergenic (+607/+46) scn_2/USA300HOU_RS05810 Staphylococcal complement inhibitor/hypothetical protein
?USA300TCH1516_ALE = 1168764 176 (1.200)intergenic (+620/+33) scn_2/USA300HOU_RS05810 Staphylococcal complement inhibitor/hypothetical protein
* ? USA300TCH1516_ALE = 1168782226 (1.190)9 (0.060) 4/124 NT 5.3% intergenic (+638/+15) scn_2/USA300HOU_RS05810 Staphylococcal complement inhibitor/hypothetical protein
?USA300TCH1516_ALE = 2220770 146 (0.990)intergenic (‑421/+141) USA300HOU_RS11345/atpC hypothetical protein/ATP synthase epsilon chain
* ? USA300TCH1516_ALE 1181842 =189 (0.990)18 (0.110) 13/144 NT 10.7% intergenic (+409/+65) USA300HOU_RS05885/USA300TCH1516_01103 hypothetical protein/tRNA‑Arg
?USA300TCH1516_ALE 1181881 = 130 (0.760)intergenic (+448/+26) USA300HOU_RS05885/USA300TCH1516_01103 hypothetical protein/tRNA‑Arg
* ? USA300TCH1516_ALE 1182136 =210 (1.100)12 (0.070) 8/140 NT 6.6% intergenic (‑154/‑209) USA300TCH1516_01103/USA300HOU_RS05895 tRNA‑Arg/Antibacterial protein 3
?USA300TCH1516_ALE 1182166 = 156 (0.940)intergenic (‑184/‑179) USA300TCH1516_01103/USA300HOU_RS05895 tRNA‑Arg/Antibacterial protein 3
* ? USA300TCH1516_ALE 1182690 =233 (1.220)18 (0.110) 10/136 NT 8.7% intergenic (+20/‑113) USA300HOU_RS05900/yfnB Antibacterial protein 3/Putative HAD‑hydrolase YfnB
?USA300TCH1516_ALE 1182741 = 179 (1.110)intergenic (+71/‑62) USA300HOU_RS05900/yfnB Antibacterial protein 3/Putative HAD‑hydrolase YfnB
* ? USA300TCH1516_ALE 1183547 =196 (1.030)13 (0.080) 10/140 NT 7.1% intergenic (+58/+51) yfnB/USA300HOU_RS05910 Putative HAD‑hydrolase YfnB/putative N‑acetyltransferase
?USA300TCH1516_ALE 1183585 = 168 (1.010)intergenic (+96/+13) yfnB/USA300HOU_RS05910 Putative HAD‑hydrolase YfnB/putative N‑acetyltransferase
* ? USA300TCH1516_ALE = 1183556188 (0.990)13 (0.080) 8/140 NT 7.3% intergenic (+67/+42) yfnB/USA300HOU_RS05910 Putative HAD‑hydrolase YfnB/putative N‑acetyltransferase
?USA300TCH1516_ALE = 1183574 168 (1.010)intergenic (+85/+24) yfnB/USA300HOU_RS05910 Putative HAD‑hydrolase YfnB/putative N‑acetyltransferase
* ? USA300TCH1516_ALE = 1199293128 (0.670)14 (0.080) 9/144 NT 9.7% intergenic (+20/‑63) USA300HOU_RS05980/USA300HOU_RS05985 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 1199312 147 (0.860)intergenic (+39/‑44) USA300HOU_RS05980/USA300HOU_RS05985 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 1242672149 (0.780)13 (0.080) 8/138 NT 8.5% coding (110/987 nt) plsX Phosphate acyltransferase
?USA300TCH1516_ALE = 1242683 151 (0.920)coding (121/987 nt) plsX Phosphate acyltransferase
* ? USA300TCH1516_ALE = 1255843197 (1.030)13 (0.080) 11/138 NT 6.8% intergenic (+59/+185) rplS/USA300HOU_RS06250 50S ribosomal protein L19/hypothetical protein
?USA300TCH1516_ALE = 1255864 189 (1.150)intergenic (+80/+164) rplS/USA300HOU_RS06250 50S ribosomal protein L19/hypothetical protein
* ? USA300TCH1516_ALE 1255967 =131 (0.690)21 (0.130) 17/134 NT 16.6% intergenic (+183/+61) rplS/USA300HOU_RS06250 50S ribosomal protein L19/hypothetical protein
?USA300TCH1516_ALE 1256006 = 102 (0.640)intergenic (+222/+22) rplS/USA300HOU_RS06250 50S ribosomal protein L19/hypothetical protein
* ? USA300TCH1516_ALE = 1255979129 (0.680)26 (0.160) 14/134 NT 19.9% intergenic (+195/+49) rplS/USA300HOU_RS06250 50S ribosomal protein L19/hypothetical protein
?USA300TCH1516_ALE = 1255992 102 (0.640)intergenic (+208/+36) rplS/USA300HOU_RS06250 50S ribosomal protein L19/hypothetical protein
* ? USA300TCH1516_ALE 1262900 =146 (0.770)13 (0.080) 7/140 NT 9.1% intergenic (+25/‑202) sucD/lytN_1 Succinate‑‑CoA ligase [ADP‑forming] subunit alpha/putative cell wall hydrolase LytN
?USA300TCH1516_ALE 1262943 = 132 (0.790)intergenic (+68/‑159) sucD/lytN_1 Succinate‑‑CoA ligase [ADP‑forming] subunit alpha/putative cell wall hydrolase LytN
* ? USA300TCH1516_ALE = 1262909146 (0.770)27 (0.160) 10/140 NT 17.2% intergenic (+34/‑193) sucD/lytN_1 Succinate‑‑CoA ligase [ADP‑forming] subunit alpha/putative cell wall hydrolase LytN
?USA300TCH1516_ALE = 1262932 132 (0.790)intergenic (+57/‑170) sucD/lytN_1 Succinate‑‑CoA ligase [ADP‑forming] subunit alpha/putative cell wall hydrolase LytN
* ? USA300TCH1516_ALE = 1265511171 (0.900)21 (0.140) 14/130 NT 12.3% intergenic (+19/‑154) femA_1/dprA Aminoacyltransferase FemA/DNA processing protein DprA
?USA300TCH1516_ALE = 1265527 160 (1.040)intergenic (+35/‑138) femA_1/dprA Aminoacyltransferase FemA/DNA processing protein DprA
* ? USA300TCH1516_ALE = 1267714156 (0.820)13 (0.070) 9/150 NT 7.6% coding (1004/2076 nt) topA DNA topoisomerase 1
?USA300TCH1516_ALE = 1267733 170 (0.950)coding (1023/2076 nt) topA DNA topoisomerase 1
* ? USA300TCH1516_ALE 1278212 =183 (0.960)23 (0.140) 11/140 NT 13.9% intergenic (+237/‑136) frr/uppS Ribosome‑recycling factor/Isoprenyl transferase
?USA300TCH1516_ALE 1278244 = 124 (0.750)intergenic (+269/‑104) frr/uppS Ribosome‑recycling factor/Isoprenyl transferase
* ? USA300TCH1516_ALE 1279936 =200 (1.050)20 (0.150)
+25 bp		 9/110 NT 13.4% intergenic (+29/‑233) cdsA/USA300HOU_RS06360 Phosphatidate cytidylyltransferase/Putative zinc metalloprotease
?USA300TCH1516_ALE 1279975 = 177 (0.930)intergenic (+68/‑194) cdsA/USA300HOU_RS06360 Phosphatidate cytidylyltransferase/Putative zinc metalloprotease
* ? USA300TCH1516_ALE = 1283492181 (0.950)17 (0.100) 8/138 NT 9.1% coding (57/4317 nt) polC_1 DNA polymerase III PolC‑type
?USA300TCH1516_ALE = 1283506 184 (1.120)coding (71/4317 nt) polC_1 DNA polymerase III PolC‑type
* ? USA300TCH1516_ALE 1292484 =124 (0.650)16 (0.110) 11/128 NT 13.4% intergenic (+38/‑348) infB/rbfA Translation initiation factor IF‑2/Ribosome‑binding factor A
?USA300TCH1516_ALE 1292539 = 108 (0.710)intergenic (+93/‑293) infB/rbfA Translation initiation factor IF‑2/Ribosome‑binding factor A
* ? USA300TCH1516_ALE = 1292499124 (0.650)13 (0.090) 6/128 NT 11.2% intergenic (+53/‑333) infB/rbfA Translation initiation factor IF‑2/Ribosome‑binding factor A
?USA300TCH1516_ALE = 1292522 108 (0.710)intergenic (+76/‑310) infB/rbfA Translation initiation factor IF‑2/Ribosome‑binding factor A
* ? USA300TCH1516_ALE = 1314645184 (0.970)24 (0.130) 15/150 NT 11.7% intergenic (+66/‑74) USA300HOU_RS06490/korA hypothetical protein/2‑oxoglutarate oxidoreductase subunit KorA
?USA300TCH1516_ALE = 1314663 190 (1.060)intergenic (+84/‑56) USA300HOU_RS06490/korA hypothetical protein/2‑oxoglutarate oxidoreductase subunit KorA
* ? USA300TCH1516_ALE = 1330548182 (0.960)25 (0.140) 13/148 NT 12.4% intergenic (+23/‑124) glpD/USA300HOU_RS06555 Aerobic glycerol‑3‑phosphate dehydrogenase/Monoacylglycerol lipase
?USA300TCH1516_ALE = 1330568 185 (1.050)intergenic (+43/‑104) glpD/USA300HOU_RS06555 Aerobic glycerol‑3‑phosphate dehydrogenase/Monoacylglycerol lipase
* ? USA300TCH1516_ALE = 1332949156 (0.820)21 (0.140) 12/124 NT 13.4% intergenic (+159/+63) hfq/bsaA_1 RNA‑binding protein Hfq/Glutathione peroxidase BsaA
?USA300TCH1516_ALE = 1332971 152 (1.030)intergenic (+181/+41) hfq/bsaA_1 RNA‑binding protein Hfq/Glutathione peroxidase BsaA
* ? USA300TCH1516_ALE 1341822 =270 (1.420)17 (0.100) 9/148 NT 7.0% intergenic (+230/‑282) USA300HOU_RS06615/USA300TCH1516_01244 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 1341877 = 202 (1.150)intergenic (+285/‑227) USA300HOU_RS06615/USA300TCH1516_01244 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 1353894 =166 (0.870)12 (0.080) 8/134 NT 8.2% intergenic (+87/+56) nucH/USA300HOU_RS06735 Thermonuclease/hypothetical protein
?USA300TCH1516_ALE 1353946 = 131 (0.820)intergenic (+139/+4) nucH/USA300HOU_RS06735 Thermonuclease/hypothetical protein
* ? USA300TCH1516_ALE = 1353906170 (0.890)15 (0.090) 12/134 NT 9.9% intergenic (+99/+44) nucH/USA300HOU_RS06735 Thermonuclease/hypothetical protein
?USA300TCH1516_ALE = 1353932 131 (0.820)intergenic (+125/+18) nucH/USA300HOU_RS06735 Thermonuclease/hypothetical protein
* ? USA300TCH1516_ALE 1355713 =213 (1.120)18 (0.110) 12/138 NT 9.9% intergenic (+3/+51) USA300HOU_RS06740/yclM hypothetical protein/Aspartokinase 3
?USA300TCH1516_ALE 1355761 = 143 (0.870)intergenic (+51/+3) USA300HOU_RS06740/yclM hypothetical protein/Aspartokinase 3
* ? USA300TCH1516_ALE = 1361481142 (0.750)22 (0.130) 12/140 NT 12.8% intergenic (+20/+273) USA300HOU_RS06765/USA300TCH1516_01271 Putative phosphatase/hypothetical protein
?USA300TCH1516_ALE = 1361509 176 (1.060)intergenic (+48/+245) USA300HOU_RS06765/USA300TCH1516_01271 Putative phosphatase/hypothetical protein
* ? USA300TCH1516_ALE = 1365739186 (0.980)25 (0.140) 10/148 NT 12.5% intergenic (+38/‑416) rpmG2_1/rpsN2 50S ribosomal protein L33 2/Alternate 30S ribosomal protein S14
?USA300TCH1516_ALE = 1365764 177 (1.010)intergenic (+63/‑391) rpmG2_1/rpsN2 50S ribosomal protein L33 2/Alternate 30S ribosomal protein S14
* ? USA300TCH1516_ALE = 1366496163 (0.860)12 (0.070) 7/152 NT 6.8% intergenic (+72/‑85) rpsN2/guaC Alternate 30S ribosomal protein S14/GMP reductase
?USA300TCH1516_ALE = 1366530 175 (0.970)intergenic (+106/‑51) rpsN2/guaC Alternate 30S ribosomal protein S14/GMP reductase
* ? USA300TCH1516_ALE = 1380306150 (0.790)18 (0.110) 10/144 NT 10.7% intergenic (+120/‑772) opuD_1/acnA Glycine betaine transporter OpuD/Aconitate hydratase A
?USA300TCH1516_ALE = 1380322 166 (0.970)intergenic (+136/‑756) opuD_1/acnA Glycine betaine transporter OpuD/Aconitate hydratase A
* ? USA300TCH1516_ALE 1392266 =136 (0.710)19 (0.110) 9/140 NT 12.9% intergenic (+40/‑460) alsT/glcT Amino‑acid carrier protein AlsT/GlcA/glcB genes antiterminator
?USA300TCH1516_ALE 1392308 = 137 (0.820)intergenic (+82/‑418) alsT/glcT Amino‑acid carrier protein AlsT/GlcA/glcB genes antiterminator
* ? USA300TCH1516_ALE = 1392275139 (0.730)22 (0.130) 11/140 NT 14.6% intergenic (+49/‑451) alsT/glcT Amino‑acid carrier protein AlsT/GlcA/glcB genes antiterminator
?USA300TCH1516_ALE = 1392297 137 (0.820)intergenic (+71/‑429) alsT/glcT Amino‑acid carrier protein AlsT/GlcA/glcB genes antiterminator
* ? USA300TCH1516_ALE = 1394937170 (0.890)26 (0.170) 14/132 NT 14.1% intergenic (+17/‑464) tqsA/mprF AI‑2 transport protein TqsA/Phosphatidylglycerol lysyltransferase
?USA300TCH1516_ALE = 1394951 176 (1.120)intergenic (+31/‑450) tqsA/mprF AI‑2 transport protein TqsA/Phosphatidylglycerol lysyltransferase
* ? USA300TCH1516_ALE 1404075 =167 (0.880)18 (0.100) 13/148 NT 11.2% intergenic (+213/‑279) ysdC_1/trpE Putative aminopeptidase YsdC/Anthranilate synthase component 1
?USA300TCH1516_ALE 1404118 = 132 (0.750)intergenic (+256/‑236) ysdC_1/trpE Putative aminopeptidase YsdC/Anthranilate synthase component 1
* ? USA300TCH1516_ALE = 1404080172 (0.900)15 (0.090) 9/148 NT 9.3% intergenic (+218/‑274) ysdC_1/trpE Putative aminopeptidase YsdC/Anthranilate synthase component 1
?USA300TCH1516_ALE = 1404111 132 (0.750)intergenic (+249/‑243) ysdC_1/trpE Putative aminopeptidase YsdC/Anthranilate synthase component 1
* ? USA300TCH1516_ALE 1425261 =204 (1.070)15 (0.080) 10/150 NT 7.8% intergenic (‑166/+25) pstC1/pstS Phosphate transport system permease protein PstC 1/Phosphate‑binding protein PstS
?USA300TCH1516_ALE 1425285 = 164 (0.920)intergenic (‑190/+1) pstC1/pstS Phosphate transport system permease protein PstC 1/Phosphate‑binding protein PstS
* ? USA300TCH1516_ALE = 142668910 (0.050)11 (0.060) 7/146 NT 54.7% intergenic (‑420/+552) pstS/cvfB Phosphate‑binding protein PstS/Conserved virulence factor B
?USA300TCH1516_ALE = 1426728 NA (NA)intergenic (‑459/+513) pstS/cvfB Phosphate‑binding protein PstS/Conserved virulence factor B
* ? USA300TCH1516_ALE 1439018 =172 (0.900)22 (0.130) 13/146 NT 11.9% intergenic (+16/+224) lysA/USA300HOU_RS07135 Diaminopimelate decarboxylase/hypothetical protein
?USA300TCH1516_ALE 1439055 = 168 (0.970)intergenic (+53/+187) lysA/USA300HOU_RS07135 Diaminopimelate decarboxylase/hypothetical protein
* ? USA300TCH1516_ALE = 1439024182 (0.960)21 (0.120) 12/146 NT 11.2% intergenic (+22/+218) lysA/USA300HOU_RS07135 Diaminopimelate decarboxylase/hypothetical protein
?USA300TCH1516_ALE = 1439047 168 (0.970)intergenic (+45/+195) lysA/USA300HOU_RS07135 Diaminopimelate decarboxylase/hypothetical protein
* ? USA300TCH1516_ALE = 1442468193 (1.010)14 (0.080) 9/148 NT 7.2% coding (838/1137 nt) USA300HOU_RS07165 TelA‑like protein
?USA300TCH1516_ALE = 1442491 182 (1.030)coding (861/1137 nt) USA300HOU_RS07165 TelA‑like protein
* ? USA300TCH1516_ALE = 144362075 (0.390)26 (0.150) 6/150 NT 27.0% intergenic (‑193/+160) USA300TCH1516_01342/brnQ_3 hypothetical protein/Branched‑chain amino acid transport system 2 carrier protein
?USA300TCH1516_ALE = 1804927 NA (NA)intergenic (‑215/+426) USA300TCH1516_01684/pyk hypothetical protein/Pyruvate kinase
* ? USA300TCH1516_ALE = 144362172 (0.380)21 (0.120) 4/152 NT 22.7% intergenic (‑194/+159) USA300TCH1516_01342/brnQ_3 hypothetical protein/Branched‑chain amino acid transport system 2 carrier protein
?USA300TCH1516_ALE 1910815 = 75 (0.410)intergenic (+348/‑207) crcB_2/USA300TCH1516_01771 Putative fluoride ion transporter CrcB/hypothetical protein
* ? USA300TCH1516_ALE 1456948 =216 (1.130)38 (0.210)
+GTTTT		 14/150 NT 16.8% intergenic (‑62/‑182) USA300HOU_RS07230/USA300HOU_RS07235 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 1918540 187 (0.980)intergenic (‑258/+240) USA300HOU_RS07235/USA300HOU_RS09510 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 1494261146 (0.770)18 (0.100) 11/150 NT 12.0% coding (7763/31266 nt) ebh_1 Extracellular matrix‑binding protein ebh
?USA300TCH1516_ALE = 1494291 128 (0.720)coding (7733/31266 nt) ebh_1 Extracellular matrix‑binding protein ebh
* ? USA300TCH1516_ALE 1507967 =183 (0.960)25 (0.160) 15/128 NT 17.2% intergenic (‑392/+83) ald1/ypcP Alanine dehydrogenase 1/5'‑3' exonuclease
?USA300TCH1516_ALE 1508010 = 95 (0.630)intergenic (‑435/+40) ald1/ypcP Alanine dehydrogenase 1/5'‑3' exonuclease
* ? USA300TCH1516_ALE 1525192 =179 (0.940)11 (0.070) 7/138 NT 6.8% intergenic (‑265/+57) asnS/dinG_1 Asparagine‑‑tRNA ligase/putative ATP‑dependent helicase DinG
?USA300TCH1516_ALE 1525239 = 149 (0.910)intergenic (‑312/+10) asnS/dinG_1 Asparagine‑‑tRNA ligase/putative ATP‑dependent helicase DinG
* ? USA300TCH1516_ALE 1532094 =214 (1.120)14 (0.080) 9/146 NT 7.0% intergenic (‑263/+74) USA300HOU_RS07465/USA300HOU_RS07470 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 1532129 = 179 (1.030)intergenic (‑298/+39) USA300HOU_RS07465/USA300HOU_RS07470 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 1533866 =159 (0.830)35 (0.210) 15/138 NT 21.4% coding (219/588 nt) USA300HOU_RS07480 hypothetical protein
?USA300TCH1516_ALE 1533900 = 120 (0.730)coding (185/588 nt) USA300HOU_RS07480 hypothetical protein
* ? USA300TCH1516_ALE = 1535925175 (0.920)9 (0.050) 8/144 NT 5.3% coding (711/1299 nt) aroA 3‑phosphoshikimate 1‑carboxyvinyltransferase
?USA300TCH1516_ALE = 1535948 163 (0.950)coding (688/1299 nt) aroA 3‑phosphoshikimate 1‑carboxyvinyltransferase
* ? USA300TCH1516_ALE = 1539773162 (0.850)10 (0.060) 8/148 NT 5.8% coding (373/450 nt) ndk Nucleoside diphosphate kinase
?USA300TCH1516_ALE = 1539799 177 (1.010)coding (347/450 nt) ndk Nucleoside diphosphate kinase
* ? USA300TCH1516_ALE 1555332 =194 (1.020)20 (0.120) 13/140 NT 11.5% intergenic (+28/+78) USA300HOU_RS07605/ribU Ferredoxin/Riboflavin transporter RibU
?USA300TCH1516_ALE 1555376 = 139 (0.840)intergenic (+72/+34) USA300HOU_RS07605/ribU Ferredoxin/Riboflavin transporter RibU
* ? USA300TCH1516_ALE 1572911 =154 (0.810)14 (0.080) 7/148 NT 9.7% coding (4606/6201 nt) USA300HOU_RS07705 Glycyl‑glycine endopeptidase ALE‑1
?USA300TCH1516_ALE 1572951 = 118 (0.670)coding (4566/6201 nt) USA300HOU_RS07705 Glycyl‑glycine endopeptidase ALE‑1
* ? USA300TCH1516_ALE 1574495 =207 (1.090)20 (0.110) 9/150 NT 9.8% coding (3022/6201 nt) USA300HOU_RS07705 Glycyl‑glycine endopeptidase ALE‑1
?USA300TCH1516_ALE 1574518 = 176 (0.990)coding (2999/6201 nt) USA300HOU_RS07705 Glycyl‑glycine endopeptidase ALE‑1
* ? USA300TCH1516_ALE = 1586059238 (1.250)16 (0.090) 5/148 NT 6.6% intergenic (‑52/+75) USA300HOU_RS07770/USA300TCH1516_01451 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 1586098 235 (1.330)intergenic (‑91/+36) USA300HOU_RS07770/USA300TCH1516_01451 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 1611382 =181 (0.950)10 (0.060) 5/148 NT 5.7% coding (197/726 nt) srrA Transcriptional regulatory protein SrrA
?USA300TCH1516_ALE 1611415 = 166 (0.940)coding (164/726 nt) srrA Transcriptional regulatory protein SrrA
* ? USA300TCH1516_ALE = 1611738154 (0.810)17 (0.100) 14/148 NT 10.5% coding (711/738 nt) rluB Ribosomal large subunit pseudouridine synthase B
?USA300TCH1516_ALE = 1611757 146 (0.830)coding (692/738 nt) rluB Ribosomal large subunit pseudouridine synthase B
* ? USA300TCH1516_ALE 1614319 =184 (0.970)17 (0.100) 9/150 NT 8.3% intergenic (+14/+64) USA300HOU_RS08000/xerD_3 hypothetical protein/Tyrosine recombinase XerD
?USA300TCH1516_ALE 1614368 = 202 (1.130)intergenic (+63/+15) USA300HOU_RS08000/xerD_3 hypothetical protein/Tyrosine recombinase XerD
* ? USA300TCH1516_ALE 1634329 =161 (0.850)18 (0.100) 8/150 NT 10.7% coding (958/993 nt) bfmBAA 2‑oxoisovalerate dehydrogenase subunit alpha
?USA300TCH1516_ALE 1634371 = 149 (0.830)coding (916/993 nt) bfmBAA 2‑oxoisovalerate dehydrogenase subunit alpha
* ? USA300TCH1516_ALE 1647574 =198 (1.040)24 (0.140) 13/148 NT 11.5% intergenic (+4/+60) USA300HOU_RS08180/lipM hypothetical protein/Octanoyltransferase LipM
?USA300TCH1516_ALE 1647624 = 188 (1.070)intergenic (+54/+10) USA300HOU_RS08180/lipM hypothetical protein/Octanoyltransferase LipM
* ? USA300TCH1516_ALE = 1647578197 (1.030)19 (0.110) 13/144 NT 9.5% intergenic (+8/+56) USA300HOU_RS08180/lipM hypothetical protein/Octanoyltransferase LipM
?USA300TCH1516_ALE = 1647617 186 (1.090)intergenic (+47/+17) USA300HOU_RS08180/lipM hypothetical protein/Octanoyltransferase LipM
* ? USA300TCH1516_ALE 1660749 =221 (1.160)12 (0.070) 11/142 NT 6.2% coding (560/1464 nt) gluP Rhomboid protease GluP
?USA300TCH1516_ALE 1660775 = 166 (0.980)coding (534/1464 nt) gluP Rhomboid protease GluP
* ? USA300TCH1516_ALE 1662000 =222 (1.170)28 (0.170) 19/136 NT 14.3% intergenic (‑87/+68) USA300HOU_RS08275/rpmG2_2 5‑formyltetrahydrofolate cyclo‑ligase/50S ribosomal protein L33 2
?USA300TCH1516_ALE 1662039 = 146 (0.900)intergenic (‑126/+29) USA300HOU_RS08275/rpmG2_2 5‑formyltetrahydrofolate cyclo‑ligase/50S ribosomal protein L33 2
* ? USA300TCH1516_ALE 1665337 =78 (0.410)17 (0.130) 14/108 NT 24.2% intergenic (‑212/+65) sodA/zur Superoxide dismutase [Mn] 1/Zinc‑specific metallo‑regulatory protein
?USA300TCH1516_ALE 1665405 = 54 (0.420)coding (408/411 nt) zur Zinc‑specific metallo‑regulatory protein
* ? USA300TCH1516_ALE = 166536281 (0.430)14 (0.110) 10/108 NT 20.5% intergenic (‑237/+40) sodA/zur Superoxide dismutase [Mn] 1/Zinc‑specific metallo‑regulatory protein
?USA300TCH1516_ALE = 1665378 54 (0.420)intergenic (‑253/+24) sodA/zur Superoxide dismutase [Mn] 1/Zinc‑specific metallo‑regulatory protein
* ? USA300TCH1516_ALE 1671778 =208 (1.090)19 (0.110) 10/146 NT 9.5% intergenic (‑23/+108) trmK/sigA tRNA (adenine(22)‑N(1))‑methyltransferase/RNA polymerase sigma factor SigA
?USA300TCH1516_ALE 1671809 = 171 (0.980)intergenic (‑54/+77) trmK/sigA tRNA (adenine(22)‑N(1))‑methyltransferase/RNA polymerase sigma factor SigA
* ? USA300TCH1516_ALE = 1676788181 (0.950)24 (0.130) 14/156 NT 11.7% intergenic (‑344/‑75) ccpN/glyQS Transcriptional repressor CcpN/Glycine‑‑tRNA ligase
?USA300TCH1516_ALE = 1676835 186 (1.000)intergenic (‑391/‑28) ccpN/glyQS Transcriptional repressor CcpN/Glycine‑‑tRNA ligase
* ? USA300TCH1516_ALE 1682514 =141 (0.740)25 (0.150) 13/140 NT 16.9% intergenic (‑259/+45) USA300HOU_RS08380/USA300HOU_RS08385 PhoH‑like protein/hypothetical protein
?USA300TCH1516_ALE 1682550 = 122 (0.730)intergenic (‑295/+9) USA300HOU_RS08380/USA300HOU_RS08385 PhoH‑like protein/hypothetical protein
* ? USA300TCH1516_ALE = 1682523145 (0.760)34 (0.200) 16/140 NT 21.5% intergenic (‑268/+36) USA300HOU_RS08380/USA300HOU_RS08385 PhoH‑like protein/hypothetical protein
?USA300TCH1516_ALE = 1682539 122 (0.730)intergenic (‑284/+20) USA300HOU_RS08380/USA300HOU_RS08385 PhoH‑like protein/hypothetical protein
* ? USA300TCH1516_ALE 1693755 =192 (1.010)12 (0.070) 5/140 NT 7.0% coding (1040/1158 nt) hemN_1 Oxygen‑independent coproporphyrinogen‑III oxidase‑like protein YqeR
?USA300TCH1516_ALE 1693791 = 153 (0.920)coding (1004/1158 nt) hemN_1 Oxygen‑independent coproporphyrinogen‑III oxidase‑like protein YqeR
* ? USA300TCH1516_ALE = 1695186163 (0.860)21 (0.120) 13/142 NT 11.7% intergenic (‑392/+138) hemN_1/lepA Oxygen‑independent coproporphyrinogen‑III oxidase‑like protein YqeR/Elongation factor 4
?USA300TCH1516_ALE 1873591 = 173 (1.020)intergenic (‑267/+483) USA300HOU_RS09300/USA300HOU_RS09305 Putative dipeptidase/hypothetical protein
* ? USA300TCH1516_ALE 1702257 =142 (0.750)17 (0.100) 12/138 NT 11.4% intergenic (‑1/+48) comEA/tylM1 ComE operon protein 1/dTDP‑3‑amino‑3,6‑dideoxy‑alpha‑D‑glucopyranose N,N‑dimethyltransferase
?USA300TCH1516_ALE 1702302 = 141 (0.860)intergenic (‑46/+3) comEA/tylM1 ComE operon protein 1/dTDP‑3‑amino‑3,6‑dideoxy‑alpha‑D‑glucopyranose N,N‑dimethyltransferase
* ? USA300TCH1516_ALE = 1702267144 (0.760)16 (0.100) 10/138 NT 10.8% intergenic (‑11/+38) comEA/tylM1 ComE operon protein 1/dTDP‑3‑amino‑3,6‑dideoxy‑alpha‑D‑glucopyranose N,N‑dimethyltransferase
?USA300TCH1516_ALE = 1702290 141 (0.860)intergenic (‑34/+15) comEA/tylM1 ComE operon protein 1/dTDP‑3‑amino‑3,6‑dideoxy‑alpha‑D‑glucopyranose N,N‑dimethyltransferase
* ? USA300TCH1516_ALE 1708636 =227 (1.190)18 (0.110) 11/132 NT 9.9% intergenic (+81/+121) USA300HOU_RS08530/entA_3 hypothetical protein/Enterotoxin type A
?USA300TCH1516_ALE 1708685 = 141 (0.900)intergenic (+130/+72) USA300HOU_RS08530/entA_3 hypothetical protein/Enterotoxin type A
* ? USA300TCH1516_ALE 1721519 =196 (1.030)19 (0.110) 14/142 NT 10.4% intergenic (‑236/+49) USA300HOU_RS08595/USA300HOU_RS08600 Putative O‑methyltransferase/MSMEI_4947/hypothetical protein
?USA300TCH1516_ALE 1721556 = 155 (0.920)intergenic (‑273/+12) USA300HOU_RS08595/USA300HOU_RS08600 Putative O‑methyltransferase/MSMEI_4947/hypothetical protein
* ? USA300TCH1516_ALE 1732959 =126 (0.660)11 (0.070) 7/136 NT 8.2% intergenic (+145/+92) limB_2/USA300HOU_RS08645 Limonene 1,2‑monooxygenase/hypothetical protein
?USA300TCH1516_ALE 1733016 = 139 (0.860)intergenic (+202/+35) limB_2/USA300HOU_RS08645 Limonene 1,2‑monooxygenase/hypothetical protein
* ? USA300TCH1516_ALE = 1732970117 (0.610)19 (0.120) 11/136 NT 13.8% intergenic (+156/+81) limB_2/USA300HOU_RS08645 Limonene 1,2‑monooxygenase/hypothetical protein
?USA300TCH1516_ALE = 1733003 139 (0.860)intergenic (+189/+48) limB_2/USA300HOU_RS08645 Limonene 1,2‑monooxygenase/hypothetical protein
* ? USA300TCH1516_ALE = 1747135151 (0.790)16 (0.100) 11/132 NT 10.2% intergenic (‑169/+34) recJ/USA300HOU_RS08710 Single‑stranded‑DNA‑specific exonuclease RecJ/Heme uptake protein MmpL11
?USA300TCH1516_ALE = 1747146 157 (1.000)intergenic (‑180/+23) recJ/USA300HOU_RS08710 Single‑stranded‑DNA‑specific exonuclease RecJ/Heme uptake protein MmpL11
* ? USA300TCH1516_ALE 1759667 =202 (1.060)13 (0.080) 7/132 NT 8.5% intergenic (‑374/+100) USA300HOU_RS08780/USA300HOU_RS08785 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 1759723 = 114 (0.730)intergenic (‑430/+44) USA300HOU_RS08780/USA300HOU_RS08785 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 1766678 =153 (0.800)14 (0.080) 6/140 NT 8.9% intergenic (+22/+201) tag/USA300HOU_RS08820 DNA‑3‑methyladenine glycosylase 1/hypothetical protein
?USA300TCH1516_ALE 1766721 = 154 (0.930)intergenic (+65/+158) tag/USA300HOU_RS08820 DNA‑3‑methyladenine glycosylase 1/hypothetical protein
* ? USA300TCH1516_ALE = 1766687153 (0.800)15 (0.090) 9/140 NT 9.4% intergenic (+31/+192) tag/USA300HOU_RS08820 DNA‑3‑methyladenine glycosylase 1/hypothetical protein
?USA300TCH1516_ALE = 1766710 154 (0.930)intergenic (+54/+169) tag/USA300HOU_RS08820 DNA‑3‑methyladenine glycosylase 1/hypothetical protein
* ? USA300TCH1516_ALE 1775185 =160 (0.840)10 (0.060) 7/142 NT 6.9% intergenic (‑78/+76) engB/clpX putative GTP‑binding protein EngB/ATP‑dependent Clp protease ATP‑binding subunit ClpX
?USA300TCH1516_ALE 1775239 = 129 (0.760)intergenic (‑132/+22) engB/clpX putative GTP‑binding protein EngB/ATP‑dependent Clp protease ATP‑binding subunit ClpX
* ? USA300TCH1516_ALE = 1775193151 (0.790)13 (0.080) 8/142 NT 9.0% intergenic (‑86/+68) engB/clpX putative GTP‑binding protein EngB/ATP‑dependent Clp protease ATP‑binding subunit ClpX
?USA300TCH1516_ALE = 1775229 129 (0.760)intergenic (‑122/+32) engB/clpX putative GTP‑binding protein EngB/ATP‑dependent Clp protease ATP‑binding subunit ClpX
* ? USA300TCH1516_ALE 1789630 =195 (1.020)18 (0.110) 12/138 NT 11.0% intergenic (‑111/+59) gapA2/coaE Glyceraldehyde‑3‑phosphate dehydrogenase 2/Dephospho‑CoA kinase
?USA300TCH1516_ALE 1789673 = 123 (0.750)intergenic (‑154/+16) gapA2/coaE Glyceraldehyde‑3‑phosphate dehydrogenase 2/Dephospho‑CoA kinase
* ? USA300TCH1516_ALE = 1797508171 (0.900)22 (0.130) 15/146 NT 11.7% coding (283/1665 nt) phoR Alkaline phosphatase synthesis sensor protein PhoR
?USA300TCH1516_ALE = 1797517 176 (1.010)coding (274/1665 nt) phoR Alkaline phosphatase synthesis sensor protein PhoR
* ? USA300TCH1516_ALE 1810695 =202 (1.060)10 (0.060) 6/150 NT 5.0% coding (900/1230 nt) USA300HOU_RS09025 NAD‑dependent malic enzyme
?USA300TCH1516_ALE 1810720 = 187 (1.050)coding (875/1230 nt) USA300HOU_RS09025 NAD‑dependent malic enzyme
* ? USA300TCH1516_ALE = 1822873129 (0.680)12 (0.070) 10/142 NT 8.3% intergenic (+194/+52) USA300HOU_RS09070/ackA Putative universal stress protein/Acetate kinase
?USA300TCH1516_ALE = 1822899 151 (0.890)intergenic (+220/+26) USA300HOU_RS09070/ackA Putative universal stress protein/Acetate kinase
* ? USA300TCH1516_ALE 1836934 =131 (0.690)31 (0.200) 12/132 NT 22.1% intergenic (+18/+132) serA/gph_2 D‑3‑phosphoglycerate dehydrogenase/Phosphoglycolate phosphatase
?USA300TCH1516_ALE 1836982 = 111 (0.710)intergenic (+66/+84) serA/gph_2 D‑3‑phosphoglycerate dehydrogenase/Phosphoglycolate phosphatase
* ? USA300TCH1516_ALE = 1836947130 (0.680)17 (0.110) 10/132 NT 13.5% intergenic (+31/+119) serA/gph_2 D‑3‑phosphoglycerate dehydrogenase/Phosphoglycolate phosphatase
?USA300TCH1516_ALE = 1836967 111 (0.710)intergenic (+51/+99) serA/gph_2 D‑3‑phosphoglycerate dehydrogenase/Phosphoglycolate phosphatase
* ? USA300TCH1516_ALE = 1838263188 (0.990)17 (0.100) 9/140 NT 8.7% intergenic (‑67/+40) gph_2/nagE Phosphoglycolate phosphatase/PTS system N‑acetylglucosamine‑specific EIICBA component
?USA300TCH1516_ALE = 1838279 193 (1.160)intergenic (‑83/+24) gph_2/nagE Phosphoglycolate phosphatase/PTS system N‑acetylglucosamine‑specific EIICBA component
* ? USA300TCH1516_ALE 1841984 =192 (1.010)16 (0.100) 11/134 NT 10.1% intergenic (+24/+70) htrA/tyrS Serine protease Do‑like HtrA/Tyrosine‑‑tRNA ligase
?USA300TCH1516_ALE 1842029 = 123 (0.770)intergenic (+69/+25) htrA/tyrS Serine protease Do‑like HtrA/Tyrosine‑‑tRNA ligase
* ? USA300TCH1516_ALE 1844653 =241 (1.260)19 (0.110) 11/142 NT 8.7% intergenic (+50/+153) mrcA/isdH Penicillin‑binding protein 1A/Iron‑regulated surface determinant protein H
?USA300TCH1516_ALE 1844699 = 186 (1.100)intergenic (+96/+107) mrcA/isdH Penicillin‑binding protein 1A/Iron‑regulated surface determinant protein H
* ? USA300TCH1516_ALE 1853635 =205 (1.080)17 (0.100) 10/144 NT 8.9% intergenic (+38/+60) acuC/ccpA Acetoin utilization protein AcuC/Catabolite control protein A
?USA300TCH1516_ALE 1853683 = 162 (0.950)intergenic (+86/+12) acuC/ccpA Acetoin utilization protein AcuC/Catabolite control protein A
* ? USA300TCH1516_ALE 1858390 =128 (0.670)23 (0.150) 13/126 NT 16.8% intergenic (‑17/+57) USA300HOU_RS09235/USA300HOU_RS09240 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 1858437 = 127 (0.850)intergenic (‑64/+10) USA300HOU_RS09235/USA300HOU_RS09240 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 1858406132 (0.690)16 (0.110) 10/126 NT 12.2% intergenic (‑33/+41) USA300HOU_RS09235/USA300HOU_RS09240 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 1858419 127 (0.850)intergenic (‑46/+28) USA300HOU_RS09235/USA300HOU_RS09240 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 1868935 =162 (0.850)29 (0.170) 18/142 NT 16.2% intergenic (‑342/+128) ytnP/trmB putative quorum‑quenching lactonase YtnP/tRNA (guanine‑N(7)‑)‑methyltransferase
?USA300TCH1516_ALE 1868982 = 156 (0.920)intergenic (‑389/+81) ytnP/trmB putative quorum‑quenching lactonase YtnP/tRNA (guanine‑N(7)‑)‑methyltransferase
* ? USA300TCH1516_ALE = 1868943170 (0.890)17 (0.100) 10/142 NT 10.0% intergenic (‑350/+120) ytnP/trmB putative quorum‑quenching lactonase YtnP/tRNA (guanine‑N(7)‑)‑methyltransferase
?USA300TCH1516_ALE = 1868972 156 (0.920)intergenic (‑379/+91) ytnP/trmB putative quorum‑quenching lactonase YtnP/tRNA (guanine‑N(7)‑)‑methyltransferase
* ? USA300TCH1516_ALE 1870432 =192 (1.010)11 (0.060) 7/150 NT 5.7% coding (82/792 nt) srkA Stress response kinase A
?USA300TCH1516_ALE 1870465 = 183 (1.030)coding (49/792 nt) srkA Stress response kinase A
* ? USA300TCH1516_ALE 1878597 =176 (0.920)18 (0.120) 10/124 NT 13.8% intergenic (+56/+61) USA300HOU_RS09320/ebh_2 Ferredoxin‑‑NADP reductase/Extracellular matrix‑binding protein ebh
?USA300TCH1516_ALE 1878652 = 89 (0.600)intergenic (+111/+6) USA300HOU_RS09320/ebh_2 Ferredoxin‑‑NADP reductase/Extracellular matrix‑binding protein ebh
* ? USA300TCH1516_ALE 1901310 =184 (0.970)17 (0.100) 12/142 NT 10.9% intergenic (‑306/‑217) USA300HOU_RS09405/sdpR hypothetical protein/Transcriptional repressor SdpR
?USA300TCH1516_ALE 1901351 = 115 (0.680)intergenic (‑347/‑176) USA300HOU_RS09405/sdpR hypothetical protein/Transcriptional repressor SdpR
* ? USA300TCH1516_ALE 1908173 =190 (1.000)26 (0.150) 24/148 NT 13.7% intergenic (+392/+48) USA300HOU_RS09450/tal hypothetical protein/Transaldolase
?USA300TCH1516_ALE 1908206 = 152 (0.860)intergenic (+425/+15) USA300HOU_RS09450/tal hypothetical protein/Transaldolase
* ? USA300TCH1516_ALE 1928287 =180 (0.940)25 (0.150) 13/140 NT 14.0% intergenic (‑241/+60) USA300HOU_RS09565/USA300HOU_RS09575 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 1928329 = 151 (0.910)intergenic (‑283/+18) USA300HOU_RS09565/USA300HOU_RS09575 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 1928296177 (0.930)18 (0.110) 8/140 NT 10.5% intergenic (‑250/+51) USA300HOU_RS09565/USA300HOU_RS09575 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 1928318 151 (0.910)intergenic (‑272/+29) USA300HOU_RS09565/USA300HOU_RS09575 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 1933839 =213 (1.120)10 (0.060) 7/142 NT 5.5% coding (1409/3816 nt) USA300HOU_RS09605 hypothetical protein
?USA300TCH1516_ALE 1933862 = 158 (0.940)coding (1386/3816 nt) USA300HOU_RS09605 hypothetical protein
* ? USA300TCH1516_ALE 1939370 =204 (1.070)15 (0.080) 8/154 NT 7.4% intergenic (‑229/+134) hsdM_2/splF Type I restriction enzyme EcoKI M protein/Serine protease SplF
?USA300TCH1516_ALE 1939419 = 178 (0.970)intergenic (‑278/+85) hsdM_2/splF Type I restriction enzyme EcoKI M protein/Serine protease SplF
* ? USA300TCH1516_ALE = 1939372197 (1.030)15 (0.080) 9/154 NT 7.5% intergenic (‑231/+132) hsdM_2/splF Type I restriction enzyme EcoKI M protein/Serine protease SplF
?USA300TCH1516_ALE = 1939415 178 (0.970)intergenic (‑274/+89) hsdM_2/splF Type I restriction enzyme EcoKI M protein/Serine protease SplF
* ? USA300TCH1516_ALE = 1945259231 (1.210)16 (0.090) 11/144 NT 6.8% intergenic (‑840/‑124) splA/USA300HOU_RS09665 Serine protease SplA/hypothetical protein
?USA300TCH1516_ALE = 1945265 229 (1.340)intergenic (‑846/‑118) splA/USA300HOU_RS09665 Serine protease SplA/hypothetical protein
* ? USA300TCH1516_ALE 1946068 =205 (1.080)15 (0.090) 9/142 NT 8.0% intergenic (+119/+355) USA300HOU_RS09665/USA300HOU_RS15380 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 1946105 = 164 (0.970)intergenic (+156/+318) USA300HOU_RS09665/USA300HOU_RS15380 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 1954420 =246 (1.290)18 (0.100) 11/152 NT 7.5% coding (319/2994 nt) nisB Nisin biosynthesis protein NisB
?USA300TCH1516_ALE 1954445 = 209 (1.160)coding (294/2994 nt) nisB Nisin biosynthesis protein NisB
* ? USA300TCH1516_ALE = 1963219180 (0.940)14 (0.080) 11/152 NT 7.5% intergenic (‑82/+241) ydeN/hemY Putative hydrolase YdeN/Protoporphyrinogen oxidase
?USA300TCH1516_ALE = 1963263 176 (0.970)intergenic (‑126/+197) ydeN/hemY Putative hydrolase YdeN/Protoporphyrinogen oxidase
* ? USA300TCH1516_ALE 1967716 =166 (0.870)14 (0.080) 10/146 NT 9.1% intergenic (+48/+76) traP/USA300HOU_RS09810 Signal transduction protein TRAP/hypothetical protein
?USA300TCH1516_ALE 1967758 = 129 (0.740)intergenic (+90/+34) traP/USA300HOU_RS09810 Signal transduction protein TRAP/hypothetical protein
* ? USA300TCH1516_ALE 1970888 =156 (0.820)22 (0.130) 10/142 NT 13.0% intergenic (+77/‑656) USA300HOU_RS09825/USA300HOU_RS09830 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 1970925 = 155 (0.920)intergenic (+114/‑619) USA300HOU_RS09825/USA300HOU_RS09830 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 1970896158 (0.830)19 (0.110) 11/142 NT 11.4% intergenic (+85/‑648) USA300HOU_RS09825/USA300HOU_RS09830 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 1970915 155 (0.920)intergenic (+104/‑629) USA300HOU_RS09825/USA300HOU_RS09830 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 1980867 =134 (0.700)19 (0.110) 13/140 NT 15.0% intergenic (‑109/+70) USA300HOU_RS09865/USA300HOU_RS09870 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 1980913 = 98 (0.590)intergenic (‑155/+24) USA300HOU_RS09865/USA300HOU_RS09870 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 1980876132 (0.690)17 (0.100) 8/140 NT 13.7% intergenic (‑118/+61) USA300HOU_RS09865/USA300HOU_RS09870 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 1980902 98 (0.590)intergenic (‑144/+35) USA300HOU_RS09865/USA300HOU_RS09870 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 1990358136 (0.710)22 (0.150) 14/124 NT 14.8% intergenic (‑107/+44) queG/tcyC_1 Epoxyqueuosine reductase/L‑cystine import ATP‑binding protein TcyC
?USA300TCH1516_ALE = 1990373 149 (1.010)intergenic (‑122/+29) queG/tcyC_1 Epoxyqueuosine reductase/L‑cystine import ATP‑binding protein TcyC
* ? USA300TCH1516_ALE 2008942 =127 (0.670)12 (0.080) 7/132 NT 9.9% intergenic (+70/+121) USA300HOU_RS10115/USA300HOU_RS10125 hypothetical protein/Putative multidrug export ATP‑binding/permease protein
?USA300TCH1516_ALE 2008991 = 115 (0.730)intergenic (+119/+72) USA300HOU_RS10115/USA300HOU_RS10125 hypothetical protein/Putative multidrug export ATP‑binding/permease protein
* ? USA300TCH1516_ALE = 2008955126 (0.660)21 (0.130) 11/132 NT 16.1% intergenic (+83/+108) USA300HOU_RS10115/USA300HOU_RS10125 hypothetical protein/Putative multidrug export ATP‑binding/permease protein
?USA300TCH1516_ALE = 2008976 115 (0.730)intergenic (+104/+87) USA300HOU_RS10115/USA300HOU_RS10125 hypothetical protein/Putative multidrug export ATP‑binding/permease protein
* ? USA300TCH1516_ALE = 2014149193 (1.010)15 (0.090) 11/148 NT 7.5% intergenic (+49/+212) USA300HOU_RS10140/USA300HOU_RS10150 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 2014182 192 (1.090)intergenic (+82/+179) USA300HOU_RS10140/USA300HOU_RS10150 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 2021453 =138 (0.720)13 (0.080) 6/140 NT 9.2% intergenic (+12/+248) queE_2/USA300HOU_RS10190 7‑carboxy‑7‑deazaguanine synthase/putative acyl‑CoA thioester hydrolase
?USA300TCH1516_ALE 2021493 = 136 (0.820)intergenic (+52/+208) queE_2/USA300HOU_RS10190 7‑carboxy‑7‑deazaguanine synthase/putative acyl‑CoA thioester hydrolase
* ? USA300TCH1516_ALE = 2021462141 (0.740)31 (0.190) 14/140 NT 19.3% intergenic (+21/+239) queE_2/USA300HOU_RS10190 7‑carboxy‑7‑deazaguanine synthase/putative acyl‑CoA thioester hydrolase
?USA300TCH1516_ALE = 2021482 136 (0.820)intergenic (+41/+219) queE_2/USA300HOU_RS10190 7‑carboxy‑7‑deazaguanine synthase/putative acyl‑CoA thioester hydrolase
* ? USA300TCH1516_ALE = 2031959156 (0.820)22 (0.130) 12/146 NT 12.8% intergenic (+425/+65) USA300HOU_RS10250/USA300HOU_RS10255 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 2031978 157 (0.900)intergenic (+444/+46) USA300HOU_RS10250/USA300HOU_RS10255 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 2032547 =202 (1.060)14 (0.080) 11/144 NT 7.4% intergenic (‑110/+115) USA300HOU_RS10255/cobQ hypothetical protein/Cobyric acid synthase
?USA300TCH1516_ALE 2032589 = 169 (0.990)intergenic (‑152/+73) USA300HOU_RS10255/cobQ hypothetical protein/Cobyric acid synthase
* ? USA300TCH1516_ALE 2055574 =186 (0.980)10 (0.060) 8/142 NT 5.9% intergenic (‑715/‑146) purB/sspP Adenylosuccinate lyase/Staphopain A
?USA300TCH1516_ALE 2055599 = 152 (0.900)intergenic (‑740/‑121) purB/sspP Adenylosuccinate lyase/Staphopain A
* ? USA300TCH1516_ALE = 2057471169 (0.890)26 (0.170) 10/132 NT 14.5% intergenic (+228/+64) USA300HOU_RS10370/USA300HOU_RS10375 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 2057483 167 (1.070)intergenic (+240/+52) USA300HOU_RS10370/USA300HOU_RS10375 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 2062972153 (0.800)34 (0.220) 16/132 NT 19.0% intergenic (+53/+137) pheA/sdcS P‑protein/Sodium‑dependent dicarboxylate transporter SdcS
?USA300TCH1516_ALE = 2062986 164 (1.050)intergenic (+67/+123) pheA/sdcS P‑protein/Sodium‑dependent dicarboxylate transporter SdcS
* ? USA300TCH1516_ALE = 2073758170 (0.890)17 (0.110) 9/136 NT 9.4% intergenic (+16/+41) USA300HOU_RS10455/USA300HOU_RS10460 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 2073772 182 (1.130)intergenic (+30/+27) USA300HOU_RS10455/USA300HOU_RS10460 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 2082368 =165 (0.870)22 (0.130) 12/138 NT 12.4% intergenic (+9/+315) aspC/USA300HOU_RS10520 Aspartate aminotransferase/65 kDa membrane protein
?USA300TCH1516_ALE 2082406 = 170 (1.040)intergenic (+47/+277) aspC/USA300HOU_RS10520 Aspartate aminotransferase/65 kDa membrane protein
* ? USA300TCH1516_ALE = 2082378175 (0.920)21 (0.130) 12/138 NT 11.6% intergenic (+19/+305) aspC/USA300HOU_RS10520 Aspartate aminotransferase/65 kDa membrane protein
?USA300TCH1516_ALE = 2082394 170 (1.040)intergenic (+35/+289) aspC/USA300HOU_RS10520 Aspartate aminotransferase/65 kDa membrane protein
* ? USA300TCH1516_ALE 2082519 =254 (1.330)22 (0.130) 10/142 NT 9.9% intergenic (+160/+164) aspC/USA300HOU_RS10520 Aspartate aminotransferase/65 kDa membrane protein
?USA300TCH1516_ALE 2082566 = 174 (1.030)intergenic (+207/+117) aspC/USA300HOU_RS10520 Aspartate aminotransferase/65 kDa membrane protein
* ? USA300TCH1516_ALE = 2090954170 (0.890)21 (0.120) 12/142 NT 11.6% intergenic (‑188/+350) USA300HOU_RS10575/USA300HOU_RS10590 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 2090971 169 (1.000)intergenic (‑205/+333) USA300HOU_RS10575/USA300HOU_RS10590 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 2091221189 (0.990)10 (0.100)
+37 bp		 5/86 NT 9.2% intergenic (‑455/+83) USA300HOU_RS10575/USA300HOU_RS10590 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 2265802 181 (0.950)intergenic (+665/+364) USA300HOU_RS11590/hin_3 hypothetical protein/DNA‑invertase hin
* ? USA300TCH1516_ALE 2121137 =220 (1.150)15 (0.080) 11/152 NT 7.2% intergenic (‑63/+32) USA300HOU_RS10790/USA300HOU_RS10795 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 2121165 = 180 (1.000)intergenic (‑91/+4) USA300HOU_RS10790/USA300HOU_RS10795 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 2141638 =169 (0.890)16 (0.090) 9/148 NT 9.5% coding (450/1617 nt) groL 60 kDa chaperonin
?USA300TCH1516_ALE 2141666 = 147 (0.830)coding (422/1617 nt) groL 60 kDa chaperonin
* ? USA300TCH1516_ALE 2141814 =175 (0.920)15 (0.080) 8/152 NT 8.3% coding (274/1617 nt) groL 60 kDa chaperonin
?USA300TCH1516_ALE 2141841 = 165 (0.910)coding (247/1617 nt) groL 60 kDa chaperonin
* ? USA300TCH1516_ALE 2142773 =188 (0.990)15 (0.090) 12/148 NT 8.6% coding (152/744 nt) USA300HOU_RS10935 hypothetical protein
?USA300TCH1516_ALE 2142794 = 146 (0.830)coding (173/744 nt) USA300HOU_RS10935 hypothetical protein
* ? USA300TCH1516_ALE 2143370 =217 (1.140)12 (0.080) 11/132 NT 7.2% intergenic (+5/+20) USA300HOU_RS10935/USA300HOU_RS10940 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 2143414 = 131 (0.840)coding (1230/1254 nt) USA300HOU_RS10940 hypothetical protein
* ? USA300TCH1516_ALE 2150647 =195 (1.020)18 (0.110) 13/136 NT 11.1% intergenic (+310/+57) agrA/scrK Accessory gene regulator A/Fructokinase
?USA300TCH1516_ALE 2150691 = 124 (0.770)intergenic (+354/+13) agrA/scrK Accessory gene regulator A/Fructokinase
* ? USA300TCH1516_ALE 2154654 =166 (0.870)9 (0.050) 6/146 NT 5.7% coding (1023/1251 nt) nrgA Ammonium transporter NrgA
?USA300TCH1516_ALE 2154684 = 149 (0.860)coding (993/1251 nt) nrgA Ammonium transporter NrgA
* ? USA300TCH1516_ALE 2160376 =157 (0.820)13 (0.080) 10/136 NT 8.5% intergenic (+9/‑352) yheS/mutS_2 putative ABC transporter ATP‑binding protein YheS/DNA mismatch repair protein MutS
?USA300TCH1516_ALE 2160413 = 148 (0.920)intergenic (+46/‑315) yheS/mutS_2 putative ABC transporter ATP‑binding protein YheS/DNA mismatch repair protein MutS
* ? USA300TCH1516_ALE = 2160387150 (0.790)21 (0.130) 14/136 NT 13.2% intergenic (+20/‑341) yheS/mutS_2 putative ABC transporter ATP‑binding protein YheS/DNA mismatch repair protein MutS
?USA300TCH1516_ALE = 2160400 148 (0.920)intergenic (+33/‑328) yheS/mutS_2 putative ABC transporter ATP‑binding protein YheS/DNA mismatch repair protein MutS
* ? USA300TCH1516_ALE 2186610 =206 (1.080)9 (0.050) 7/142 NT 5.5% coding (5/480 nt) rsbW Serine‑protein kinase RsbW
?USA300TCH1516_ALE 2186648 = 128 (0.760)coding (295/327 nt) rsbV Anti‑sigma‑B factor antagonist
* ? USA300TCH1516_ALE 2201275 =141 (0.740)17 (0.110) 10/136 NT 11.5% intergenic (+5/+364) kdpE/cshA KDP operon transcriptional regulatory protein KdpE/DEAD‑box ATP‑dependent RNA helicase CshA
?USA300TCH1516_ALE 2201326 = 141 (0.870)intergenic (+56/+313) kdpE/cshA KDP operon transcriptional regulatory protein KdpE/DEAD‑box ATP‑dependent RNA helicase CshA
* ? USA300TCH1516_ALE = 2201286152 (0.800)30 (0.190) 16/136 NT 18.2% intergenic (+16/+353) kdpE/cshA KDP operon transcriptional regulatory protein KdpE/DEAD‑box ATP‑dependent RNA helicase CshA
?USA300TCH1516_ALE = 2201313 141 (0.870)intergenic (+43/+326) kdpE/cshA KDP operon transcriptional regulatory protein KdpE/DEAD‑box ATP‑dependent RNA helicase CshA
* ? USA300TCH1516_ALE = 2211758190 (1.000)24 (0.150) 11/138 NT 12.5% intergenic (+751/+62) USA300HOU_RS11275/yidC hypothetical protein/Membrane protein insertase YidC
?USA300TCH1516_ALE = 2211795 172 (1.050)intergenic (+788/+25) USA300HOU_RS11275/yidC hypothetical protein/Membrane protein insertase YidC
* ? USA300TCH1516_ALE 2218211 =208 (1.090)16 (0.110) 11/124 NT 10.4% intergenic (+4/+55) USA300HOU_RS11330/fabZ hypothetical protein/3‑hydroxyacyl‑[acyl‑carrier‑protein] dehydratase FabZ
?USA300TCH1516_ALE 2218261 = 116 (0.790)intergenic (+54/+5) USA300HOU_RS11330/fabZ hypothetical protein/3‑hydroxyacyl‑[acyl‑carrier‑protein] dehydratase FabZ
* ? USA300TCH1516_ALE 2236023 =155 (0.810)18 (0.110) 9/142 NT 11.9% intergenic (‑296/+51) tdk/rpmE2 Thymidine kinase/50S ribosomal protein L31 type B
?USA300TCH1516_ALE 2236061 = 130 (0.770)intergenic (‑334/+13) tdk/rpmE2 Thymidine kinase/50S ribosomal protein L31 type B
* ? USA300TCH1516_ALE = 2245371175 (0.920)32 (0.190) 16/144 NT 16.7% intergenic (‑230/+106) pyrG/rpoE CTP synthase/putative DNA‑directed RNA polymerase subunit delta
?USA300TCH1516_ALE = 2245389 163 (0.950)intergenic (‑248/+88) pyrG/rpoE CTP synthase/putative DNA‑directed RNA polymerase subunit delta
* ? USA300TCH1516_ALE 2252589 =178 (0.930)15 (0.090) 10/142 NT 9.5% intergenic (+25/+127) luxS/USA300HOU_RS11525 S‑ribosylhomocysteine lyase/hypothetical protein
?USA300TCH1516_ALE 2252638 = 128 (0.760)intergenic (+74/+78) luxS/USA300HOU_RS11525 S‑ribosylhomocysteine lyase/hypothetical protein
* ? USA300TCH1516_ALE = 2252663137 (0.720)13 (0.070) 7/148 NT 8.4% intergenic (+99/+53) luxS/USA300HOU_RS11525 S‑ribosylhomocysteine lyase/hypothetical protein
?USA300TCH1516_ALE = 2252697 158 (0.900)intergenic (+133/+19) luxS/USA300HOU_RS11525 S‑ribosylhomocysteine lyase/hypothetical protein
* ? USA300TCH1516_ALE 2256396 =114 (0.600)24 (0.150) 12/132 NT 18.6% intergenic (+49/+72) deoD1/dps Purine nucleoside phosphorylase DeoD‑type 1/General stress protein 20U
?USA300TCH1516_ALE 2256443 = 116 (0.740)intergenic (+96/+25) deoD1/dps Purine nucleoside phosphorylase DeoD‑type 1/General stress protein 20U
* ? USA300TCH1516_ALE = 2256409114 (0.600)28 (0.180) 13/132 NT 21.1% intergenic (+62/+59) deoD1/dps Purine nucleoside phosphorylase DeoD‑type 1/General stress protein 20U
?USA300TCH1516_ALE = 2256428 116 (0.740)intergenic (+81/+40) deoD1/dps Purine nucleoside phosphorylase DeoD‑type 1/General stress protein 20U
* ? USA300TCH1516_ALE = 2259599156 (0.820)19 (0.110) 9/142 NT 11.3% intergenic (‑244/+428) USA300HOU_RS11560/USA300HOU_RS11565 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 2259613 159 (0.940)intergenic (‑258/+414) USA300HOU_RS11560/USA300HOU_RS11565 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 2270512 =168 (0.880)14 (0.080) 9/144 NT 9.0% intergenic (‑155/+77) ylmA/glmS putative ABC transporter ATP‑binding protein YlmA/Glutamine‑‑fructose‑6‑phosphate aminotransferase [isomerizing]
?USA300TCH1516_ALE 2270545 = 133 (0.780)intergenic (‑188/+44) ylmA/glmS putative ABC transporter ATP‑binding protein YlmA/Glutamine‑‑fructose‑6‑phosphate aminotransferase [isomerizing]
* ? USA300TCH1516_ALE 2306141 =172 (0.900)25 (0.170) 15/126 NT 17.1% intergenic (+7/+125) USA300HOU_RS11765/USA300HOU_RS11770 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 2306185 = 107 (0.720)intergenic (+51/+81) USA300HOU_RS11765/USA300HOU_RS11770 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 2326404 =168 (0.880)24 (0.140) 17/146 NT 13.9% intergenic (‑149/+117) USA300HOU_RS11860/lacG hypothetical protein/6‑phospho‑beta‑galactosidase
?USA300TCH1516_ALE 2326426 = 143 (0.820)intergenic (‑171/+95) USA300HOU_RS11860/lacG hypothetical protein/6‑phospho‑beta‑galactosidase
* ? USA300TCH1516_ALE = 2349040176 (0.920)22 (0.130) 15/146 NT 11.2% coding (915/1137 nt) clpB_3 Chaperone protein ClpB
?USA300TCH1516_ALE = 2349060 189 (1.090)coding (895/1137 nt) clpB_3 Chaperone protein ClpB
* ? USA300TCH1516_ALE 2357381 =144 (0.760)23 (0.140) 11/140 NT 15.4% intergenic (‑331/+207) ecfA1/rplQ Energy‑coupling factor transporter ATP‑binding protein EcfA1/50S ribosomal protein L17
?USA300TCH1516_ALE 2357417 = 126 (0.760)intergenic (‑367/+171) ecfA1/rplQ Energy‑coupling factor transporter ATP‑binding protein EcfA1/50S ribosomal protein L17
* ? USA300TCH1516_ALE = 2357390140 (0.730)19 (0.110) 10/140 NT 13.3% intergenic (‑340/+198) ecfA1/rplQ Energy‑coupling factor transporter ATP‑binding protein EcfA1/50S ribosomal protein L17
?USA300TCH1516_ALE = 2357406 126 (0.760)intergenic (‑356/+182) ecfA1/rplQ Energy‑coupling factor transporter ATP‑binding protein EcfA1/50S ribosomal protein L17
* ? USA300TCH1516_ALE 2368663 =153 (0.800)20 (0.110) 12/148 NT 12.8% intergenic (‑16/+51) rpsS/rplB 30S ribosomal protein S19/50S ribosomal protein L2
?USA300TCH1516_ALE 2368705 = 131 (0.740)intergenic (‑58/+9) rpsS/rplB 30S ribosomal protein S19/50S ribosomal protein L2
* ? USA300TCH1516_ALE 2377221 =166 (0.870)30 (0.180) 14/142 NT 18.1% intergenic (+124/‑57) USA300HOU_RS12205/glcU_2 hypothetical protein/putative glucose uptake protein GlcU
?USA300TCH1516_ALE 2377253 = 124 (0.730)intergenic (+156/‑25) USA300HOU_RS12205/glcU_2 hypothetical protein/putative glucose uptake protein GlcU
* ? USA300TCH1516_ALE 2380461 =161 (0.850)22 (0.140) 17/132 NT 13.7% intergenic (+134/+53) USA300HOU_RS12230/swrC hypothetical protein/Swarming motility protein SwrC
?USA300TCH1516_ALE 2380507 = 145 (0.920)intergenic (+180/+7) USA300HOU_RS12230/swrC hypothetical protein/Swarming motility protein SwrC
* ? USA300TCH1516_ALE = 2380474170 (0.890)36 (0.230) 13/132 NT 20.2% intergenic (+147/+40) USA300HOU_RS12230/swrC hypothetical protein/Swarming motility protein SwrC
?USA300TCH1516_ALE = 2380492 145 (0.920)intergenic (+165/+22) USA300HOU_RS12230/swrC hypothetical protein/Swarming motility protein SwrC
* ? USA300TCH1516_ALE 2383746 =125 (0.660)17 (0.110) 9/136 NT 12.7% intergenic (‑65/+52) swrC/femX Swarming motility protein SwrC/Lipid II:glycine glycyltransferase
?USA300TCH1516_ALE 2383787 = 128 (0.790)intergenic (‑106/+11) swrC/femX Swarming motility protein SwrC/Lipid II:glycine glycyltransferase
* ? USA300TCH1516_ALE = 2383757136 (0.710)28 (0.170) 15/136 NT 18.7% intergenic (‑76/+41) swrC/femX Swarming motility protein SwrC/Lipid II:glycine glycyltransferase
?USA300TCH1516_ALE = 2383774 128 (0.790)intergenic (‑93/+24) swrC/femX Swarming motility protein SwrC/Lipid II:glycine glycyltransferase
* ? USA300TCH1516_ALE = 2388299158 (0.830)15 (0.100) 8/126 NT 9.6% intergenic (+34/+68) ribZ_1/sarV Riboflavin transporter RibZ/HTH‑type transcriptional regulator SarV
?USA300TCH1516_ALE = 2388344 158 (1.060)intergenic (+79/+23) ribZ_1/sarV Riboflavin transporter RibZ/HTH‑type transcriptional regulator SarV
* ? USA300TCH1516_ALE 2421921 =155 (0.810)16 (0.090) 9/146 NT 10.1% intergenic (+37/+55) USA300HOU_RS12475/hpxO Putative 2‑hydroxyacid dehydrogenase/FAD‑dependent urate hydroxylase
?USA300TCH1516_ALE 2421962 = 145 (0.840)intergenic (+78/+14) USA300HOU_RS12475/hpxO Putative 2‑hydroxyacid dehydrogenase/FAD‑dependent urate hydroxylase
* ? USA300TCH1516_ALE = 2421927149 (0.780)35 (0.200) 18/146 NT 20.0% intergenic (+43/+49) USA300HOU_RS12475/hpxO Putative 2‑hydroxyacid dehydrogenase/FAD‑dependent urate hydroxylase
?USA300TCH1516_ALE = 2421954 145 (0.840)intergenic (+70/+22) USA300HOU_RS12475/hpxO Putative 2‑hydroxyacid dehydrogenase/FAD‑dependent urate hydroxylase
* ? USA300TCH1516_ALE = 2434877165 (0.870)11 (0.070) 8/140 NT 6.3% intergenic (+145/+242) ybbH_3/yifK putative HTH‑type transcriptional regulator YbbH/putative transport protein YifK
?USA300TCH1516_ALE = 2434908 183 (1.100)intergenic (+176/+211) ybbH_3/yifK putative HTH‑type transcriptional regulator YbbH/putative transport protein YifK
* ? USA300TCH1516_ALE = 2440052166 (0.870)16 (0.100) 10/136 NT 9.2% intergenic (+13/+53) USA300HOU_RS12570/malP hypothetical protein/PTS system maltose‑specific EIICB component
?USA300TCH1516_ALE = 2440086 176 (1.090)intergenic (+47/+19) USA300HOU_RS12570/malP hypothetical protein/PTS system maltose‑specific EIICB component
* ? USA300TCH1516_ALE 2442806 =127 (0.670)19 (0.130) 14/128 NT 16.9% intergenic (+3/+55) glvR/USA300HOU_RS12585 HTH‑type transcriptional regulator GlvR/hypothetical protein
?USA300TCH1516_ALE 2442855 = 86 (0.570)intergenic (+52/+6) glvR/USA300HOU_RS12585 HTH‑type transcriptional regulator GlvR/hypothetical protein
* ? USA300TCH1516_ALE = 2442821131 (0.690)10 (0.070) 8/128 NT 9.5% intergenic (+18/+40) glvR/USA300HOU_RS12585 HTH‑type transcriptional regulator GlvR/hypothetical protein
?USA300TCH1516_ALE = 2442838 86 (0.570)intergenic (+35/+23) glvR/USA300HOU_RS12585 HTH‑type transcriptional regulator GlvR/hypothetical protein
* ? USA300TCH1516_ALE = 244288094 (0.490)12 (0.070) 9/142 NT 10.4% coding (488/507 nt) USA300HOU_RS12585 hypothetical protein
?USA300TCH1516_ALE = 2442902 123 (0.730)coding (466/507 nt) USA300HOU_RS12585 hypothetical protein
* ? USA300TCH1516_ALE = 2444885173 (0.910)23 (0.140) 14/140 NT 12.4% intergenic (‑38/+187) mleN_2/USA300HOU_RS12595 Malate‑2H(+)/Na(+)‑lactate antiporter/hypothetical protein
?USA300TCH1516_ALE = 2444897 174 (1.050)intergenic (‑50/+175) mleN_2/USA300HOU_RS12595 Malate‑2H(+)/Na(+)‑lactate antiporter/hypothetical protein
* ? USA300TCH1516_ALE 2455747 =166 (0.870)10 (0.060) 5/132 NT 7.2% intergenic (+5/+61) lyrA/rpiA Lysostaphin resistance protein A/Ribose‑5‑phosphate isomerase A
?USA300TCH1516_ALE 2455795 = 121 (0.770)intergenic (+53/+13) lyrA/rpiA Lysostaphin resistance protein A/Ribose‑5‑phosphate isomerase A
* ? USA300TCH1516_ALE 2467825 =221 (1.160)20 (0.110) 14/150 NT 9.3% intergenic (+42/+66) USA300HOU_RS12705/lipY hypothetical protein/Triacylglycerol lipase
?USA300TCH1516_ALE 2467878 = 185 (1.040)intergenic (+95/+13) USA300HOU_RS12705/lipY hypothetical protein/Triacylglycerol lipase
* ? USA300TCH1516_ALE 2469808 =176 (0.920)13 (0.080) 9/142 NT 8.2% intergenic (+151/+95) USA300HOU_RS12715/emrB hypothetical protein/Multidrug export protein EmrB
?USA300TCH1516_ALE 2469843 = 134 (0.790)intergenic (+186/+60) USA300HOU_RS12715/emrB hypothetical protein/Multidrug export protein EmrB
* ? USA300TCH1516_ALE 2483085 =181 (0.950)23 (0.140) 12/136 NT 13.3% intergenic (+5/‑158) hssS/USA300HOU_RS12790 Heme sensor protein HssS/putative HTH‑type transcriptional regulator
?USA300TCH1516_ALE 2483126 = 146 (0.900)intergenic (+46/‑117) hssS/USA300HOU_RS12790 Heme sensor protein HssS/putative HTH‑type transcriptional regulator
* ? USA300TCH1516_ALE = 2483096184 (0.970)24 (0.150) 12/136 NT 13.7% intergenic (+16/‑147) hssS/USA300HOU_RS12790 Heme sensor protein HssS/putative HTH‑type transcriptional regulator
?USA300TCH1516_ALE = 2483113 146 (0.900)intergenic (+33/‑130) hssS/USA300HOU_RS12790 Heme sensor protein HssS/putative HTH‑type transcriptional regulator
* ? USA300TCH1516_ALE = 2484170151 (0.790)20 (0.130) 11/132 NT 12.2% intergenic (+32/+34) USA300HOU_RS12795/mqo1 hypothetical protein/putative malate:quinone oxidoreductase 1
?USA300TCH1516_ALE = 2484183 163 (1.040)intergenic (+45/+21) USA300HOU_RS12795/mqo1 hypothetical protein/putative malate:quinone oxidoreductase 1
* ? USA300TCH1516_ALE 2493152 =220 (1.150)11 (0.060) 6/146 NT 5.5% coding (823/1035 nt) USA300HOU_RS12835 Ferredoxin‑‑NADP reductase
?USA300TCH1516_ALE 2493184 = 176 (1.010)coding (791/1035 nt) USA300HOU_RS12835 Ferredoxin‑‑NADP reductase
* ? USA300TCH1516_ALE 2494782 =188 (0.990)20 (0.120) 13/138 NT 12.0% intergenic (‑145/+62) USA300HOU_RS12845/mnmC_2 hypothetical protein/tRNA 5‑methylaminomethyl‑2‑thiouridine biosynthesis bifunctional protein MnmC
?USA300TCH1516_ALE 2494828 = 131 (0.800)intergenic (‑191/+16) USA300HOU_RS12845/mnmC_2 hypothetical protein/tRNA 5‑methylaminomethyl‑2‑thiouridine biosynthesis bifunctional protein MnmC
* ? USA300TCH1516_ALE 2499443 =176 (0.920)16 (0.090) 6/142 NT 10.1% intergenic (‑20/‑163) treP_2/USA300HOU_RS12875 PTS system trehalose‑specific EIIBC component/hypothetical protein
?USA300TCH1516_ALE 2499482 = 129 (0.760)intergenic (‑59/‑124) treP_2/USA300HOU_RS12875 PTS system trehalose‑specific EIIBC component/hypothetical protein
* ? USA300TCH1516_ALE 2508438 =213 (1.120)30 (0.180) 14/138 NT 16.0% intergenic (+26/+81) USA300TCH1516_02393/narT Acid shock protein/putative nitrate transporter NarT
?USA300TCH1516_ALE 2508486 = 132 (0.800)intergenic (+74/+33) USA300TCH1516_02393/narT Acid shock protein/putative nitrate transporter NarT
* ? USA300TCH1516_ALE 2511885 =194 (1.020)17 (0.100) 6/144 NT 9.4% intergenic (+194/+64) mta/nreC HTH‑type transcriptional activator mta/Oxygen regulatory protein NreC
?USA300TCH1516_ALE 2511923 = 152 (0.890)intergenic (+232/+26) mta/nreC HTH‑type transcriptional activator mta/Oxygen regulatory protein NreC
* ? USA300TCH1516_ALE 2520876 =151 (0.790)15 (0.080) 10/150 NT 9.5% intergenic (‑245/+64) narG/nasF Respiratory nitrate reductase 1 alpha chain/Uroporphyrinogen‑III C‑methyltransferase
?USA300TCH1516_ALE 2520917 = 144 (0.810)intergenic (‑286/+23) narG/nasF Respiratory nitrate reductase 1 alpha chain/Uroporphyrinogen‑III C‑methyltransferase
* ? USA300TCH1516_ALE 2525159 =214 (1.120)11 (0.060) 7/148 NT 5.5% coding (270/732 nt) sirB Sirohydrochlorin ferrochelatase
?USA300TCH1516_ALE 2525195 = 181 (1.030)coding (234/732 nt) sirB Sirohydrochlorin ferrochelatase
* ? USA300TCH1516_ALE = 2525589160 (0.840)12 (0.080) 7/130 NT 7.7% intergenic (‑161/+69) sirB/ytmI Sirohydrochlorin ferrochelatase/putative N‑acetyltransferase YtmI
?USA300TCH1516_ALE = 2525624 157 (1.020)intergenic (‑196/+34) sirB/ytmI Sirohydrochlorin ferrochelatase/putative N‑acetyltransferase YtmI
* ? USA300TCH1516_ALE 2533537 =156 (0.820)25 (0.150) 17/142 NT 14.7% intergenic (+33/+64) femA_3/tcyC_2 Aminoacyltransferase FemA/L‑cystine import ATP‑binding protein TcyC
?USA300TCH1516_ALE 2533595 = 153 (0.910)intergenic (+91/+6) femA_3/tcyC_2 Aminoacyltransferase FemA/L‑cystine import ATP‑binding protein TcyC
* ? USA300TCH1516_ALE = 2533545159 (0.830)16 (0.090) 11/142 NT 9.8% intergenic (+41/+56) femA_3/tcyC_2 Aminoacyltransferase FemA/L‑cystine import ATP‑binding protein TcyC
?USA300TCH1516_ALE = 2533585 153 (0.910)intergenic (+81/+16) femA_3/tcyC_2 Aminoacyltransferase FemA/L‑cystine import ATP‑binding protein TcyC
* ? USA300TCH1516_ALE = 2537764149 (0.780)22 (0.130) 14/138 NT 13.0% intergenic (+118/+36) USA300TCH1516_02423/gpmA_2 hypothetical protein/2,3‑bisphosphoglycerate‑dependent phosphoglycerate mutase
?USA300TCH1516_ALE = 2537785 166 (1.010)intergenic (+139/+15) USA300TCH1516_02423/gpmA_2 hypothetical protein/2,3‑bisphosphoglycerate‑dependent phosphoglycerate mutase
* ? USA300TCH1516_ALE 2541808 =202 (1.060)27 (0.170) 18/136 NT 15.4% intergenic (+67/‑433) sbi/hlgA Immunoglobulin‑binding protein sbi/Gamma‑hemolysin component A
?USA300TCH1516_ALE 2541850 = 126 (0.780)intergenic (+109/‑391) sbi/hlgA Immunoglobulin‑binding protein sbi/Gamma‑hemolysin component A
* ? USA300TCH1516_ALE 2561162 =172 (0.900)18 (0.100) 9/146 NT 10.6% coding (648/657 nt) USA300HOU_RS13195 hypothetical protein
?USA300TCH1516_ALE 2561195 = 147 (0.850)intergenic (+24/+39) USA300HOU_RS13195/cpdA hypothetical protein/3',5'‑cyclic adenosine monophosphate phosphodiesterase CpdA
* ? USA300TCH1516_ALE 2573677 =160 (0.840)19 (0.120) 11/138 NT 13.1% intergenic (‑203/+91) norB_5/opuCD Quinolone resistance protein NorB/Carnitine transport permease protein OpuCD
?USA300TCH1516_ALE 2573715 = 115 (0.700)intergenic (‑241/+53) norB_5/opuCD Quinolone resistance protein NorB/Carnitine transport permease protein OpuCD
* ? USA300TCH1516_ALE = 2577878151 (0.790)24 (0.140) 11/140 NT 14.5% intergenic (‑599/+71) opuCA/USA300HOU_RS13285 Carnitine transport ATP‑binding protein OpuCA/hypothetical protein
?USA300TCH1516_ALE = 2577890 152 (0.910)intergenic (‑611/+59) opuCA/USA300HOU_RS13285 Carnitine transport ATP‑binding protein OpuCA/hypothetical protein
* ? USA300TCH1516_ALE 2580412 =187 (0.980)30 (0.180) 16/142 NT 17.3% intergenic (+47/‑561) yveA/pnbA Aspartate‑proton symporter/Para‑nitrobenzyl esterase
?USA300TCH1516_ALE 2580445 = 122 (0.720)intergenic (+80/‑528) yveA/pnbA Aspartate‑proton symporter/Para‑nitrobenzyl esterase
* ? USA300TCH1516_ALE = 2582348153 (0.800)23 (0.130) 10/144 NT 13.3% intergenic (+23/+39) pnbA/pbuE Para‑nitrobenzyl esterase/Purine efflux pump PbuE
?USA300TCH1516_ALE = 2582368 163 (0.950)intergenic (+43/+19) pnbA/pbuE Para‑nitrobenzyl esterase/Purine efflux pump PbuE
* ? USA300TCH1516_ALE 2588434 =219 (1.150)17 (0.100) 8/142 NT 8.3% intergenic (+17/+151) yehR/gltB_2 putative lipoprotein YehR/Glutamate synthase [NADPH] large chain
?USA300TCH1516_ALE 2588483 = 184 (1.090)intergenic (+66/+102) yehR/gltB_2 putative lipoprotein YehR/Glutamate synthase [NADPH] large chain
* ? USA300TCH1516_ALE 2600614 =171 (0.900)14 (0.080) 10/148 NT 7.7% intergenic (‑26/+841) dapF/USA300HOU_RS13395 Diaminopimelate epimerase/hypothetical protein
?USA300TCH1516_ALE 2600771 = 178 (1.010)intergenic (‑183/+684) dapF/USA300HOU_RS13395 Diaminopimelate epimerase/hypothetical protein
* ? USA300TCH1516_ALE = 2622931177 (0.930)14 (0.080) 10/142 NT 8.1% intergenic (‑261/+123) USA300HOU_RS13520/USA300TCH1516_02501 hypothetical protein/Putative surface protein
?USA300TCH1516_ALE = 2622960 162 (0.960)intergenic (‑290/+94) USA300HOU_RS13520/USA300TCH1516_02501 hypothetical protein/Putative surface protein
* ? USA300TCH1516_ALE 2626696 =206 (1.080)15 (0.090) 14/144 NT 7.7% intergenic (‑296/+10) sasG/sarT Surface protein G/HTH‑type transcriptional regulator SarT
?USA300TCH1516_ALE 2626715 = 172 (1.000)coding (348/357 nt) sarT HTH‑type transcriptional regulator SarT
* ? USA300TCH1516_ALE 2632646 =169 (0.890)9 (0.050) 8/146 NT 5.7% intergenic (‑437/+245) fnbA_1/fnbA_2 Fibronectin‑binding protein A/Fibronectin‑binding protein A
?USA300TCH1516_ALE 2632670 = 144 (0.830)intergenic (‑461/+221) fnbA_1/fnbA_2 Fibronectin‑binding protein A/Fibronectin‑binding protein A
* ? USA300TCH1516_ALE 2636356 =194 (1.020)9 (0.050) 7/138 NT 6.1% intergenic (‑409/+60) fnbA_2/gntT Fibronectin‑binding protein A/High‑affinity gluconate transporter
?USA300TCH1516_ALE 2636404 = 112 (0.680)intergenic (‑457/+12) fnbA_2/gntT Fibronectin‑binding protein A/High‑affinity gluconate transporter
* ? USA300TCH1516_ALE 2646130 =219 (1.150)12 (0.070) 8/152 NT 5.4% coding (158/1278 nt) sauU putative sulfoacetate transporter SauU
?USA300TCH1516_ALE 2646163 = 209 (1.160)coding (125/1278 nt) sauU putative sulfoacetate transporter SauU
* ? USA300TCH1516_ALE 2651119 =166 (0.870)9 (0.050) 6/146 NT 5.3% intergenic (+62/‑311) USA300HOU_RS13635/fbp hypothetical protein/Fructose‑1,6‑bisphosphatase class 3
?USA300TCH1516_ALE 2651153 = 170 (0.980)intergenic (+96/‑277) USA300HOU_RS13635/fbp hypothetical protein/Fructose‑1,6‑bisphosphatase class 3
* ? USA300TCH1516_ALE = 2651125169 (0.890)16 (0.090) 10/146 NT 9.0% intergenic (+68/‑305) USA300HOU_RS13635/fbp hypothetical protein/Fructose‑1,6‑bisphosphatase class 3
?USA300TCH1516_ALE = 2651145 170 (0.980)intergenic (+88/‑285) USA300HOU_RS13635/fbp hypothetical protein/Fructose‑1,6‑bisphosphatase class 3
* ? USA300TCH1516_ALE 2654865 =197 (1.030)25 (0.140) 10/148 NT 12.3% intergenic (+48/+57) USA300HOU_RS13650/mhqD hypothetical protein/Putative hydrolase MhqD
?USA300TCH1516_ALE 2654909 = 174 (0.990)intergenic (+92/+13) USA300HOU_RS13650/mhqD hypothetical protein/Putative hydrolase MhqD
* ? USA300TCH1516_ALE = 2661803153 (0.800)13 (0.090) 10/128 NT 8.5% intergenic (‑196/‑125) ybiV/yydI Sugar phosphatase YbiV/putative peptide export ATP‑binding protein YydI
?USA300TCH1516_ALE = 2661815 157 (1.030)intergenic (‑208/‑113) ybiV/yydI Sugar phosphatase YbiV/putative peptide export ATP‑binding protein YydI
* ? USA300TCH1516_ALE 2665481 =153 (0.800)21 (0.130) 15/138 NT 14.2% intergenic (‑108/+71) USA300TCH1516_02535/sdhA hypothetical protein/L‑serine dehydratase, alpha chain
?USA300TCH1516_ALE 2665525 = 122 (0.740)intergenic (‑152/+27) USA300TCH1516_02535/sdhA hypothetical protein/L‑serine dehydratase, alpha chain
* ? USA300TCH1516_ALE 2674533 =202 (1.060)17 (0.100) 8/140 NT 10.0% intergenic (‑45/+256) glcB/ydaP PTS system glucoside‑specific EIICBA component/Putative thiamine pyrophosphate‑containing protein YdaP
?USA300TCH1516_ALE 2674588 = 131 (0.790)intergenic (‑100/+201) glcB/ydaP PTS system glucoside‑specific EIICBA component/Putative thiamine pyrophosphate‑containing protein YdaP
* ? USA300TCH1516_ALE = 2679966214 (1.120)16 (0.100) 8/130 NT 10.1% intergenic (+18/+742) ssaA2_4/USA300HOU_RS13810 Staphylococcal secretory antigen ssaA2/hypothetical protein
?USA300TCH1516_ALE = 2681449 113 (0.730)intergenic (‑484/+95) USA300HOU_RS13810/mvaA hypothetical protein/3‑hydroxy‑3‑methylglutaryl‑coenzyme A reductase
* ? USA300TCH1516_ALE 2681410 =133 (0.700)12 (0.080) 8/130 NT 9.8% intergenic (‑445/+134) USA300HOU_RS13810/mvaA hypothetical protein/3‑hydroxy‑3‑methylglutaryl‑coenzyme A reductase
?USA300TCH1516_ALE 2681465 = 113 (0.730)intergenic (‑500/+79) USA300HOU_RS13810/mvaA hypothetical protein/3‑hydroxy‑3‑methylglutaryl‑coenzyme A reductase
* ? USA300TCH1516_ALE = 2681424138 (0.720)16 (0.100) 7/130 NT 12.5% intergenic (‑459/+120) USA300HOU_RS13810/mvaA hypothetical protein/3‑hydroxy‑3‑methylglutaryl‑coenzyme A reductase
?USA300TCH1516_ALE = 2681449 113 (0.730)intergenic (‑484/+95) USA300HOU_RS13810/mvaA hypothetical protein/3‑hydroxy‑3‑methylglutaryl‑coenzyme A reductase
* ? USA300TCH1516_ALE 2681949 =177 (0.930)9 (0.050) 7/150 NT 5.9% coding (873/1278 nt) mvaA 3‑hydroxy‑3‑methylglutaryl‑coenzyme A reductase
?USA300TCH1516_ALE 2681984 = 121 (0.680)coding (838/1278 nt) mvaA 3‑hydroxy‑3‑methylglutaryl‑coenzyme A reductase
* ? USA300TCH1516_ALE 2687471 =169 (0.890)17 (0.100) 12/138 NT 11.5% intergenic (+25/+44) clpL/USA300HOU_RS13835 ATP‑dependent Clp protease ATP‑binding subunit ClpL/hypothetical protein
?USA300TCH1516_ALE 2687511 = 116 (0.710)intergenic (+65/+4) clpL/USA300HOU_RS13835 ATP‑dependent Clp protease ATP‑binding subunit ClpL/hypothetical protein
* ? USA300TCH1516_ALE 2693368 =153 (0.800)20 (0.120) 11/136 NT 14.2% intergenic (+39/+317) mtrR/rocA HTH‑type transcriptional regulator MtrR/1‑pyrroline‑5‑carboxylate dehydrogenase
?USA300TCH1516_ALE 2693417 = 112 (0.690)intergenic (+88/+268) mtrR/rocA HTH‑type transcriptional regulator MtrR/1‑pyrroline‑5‑carboxylate dehydrogenase
* ? USA300TCH1516_ALE = 2693372153 (0.800)22 (0.130) 13/144 NT 15.1% intergenic (+43/+313) mtrR/rocA HTH‑type transcriptional regulator MtrR/1‑pyrroline‑5‑carboxylate dehydrogenase
?USA300TCH1516_ALE = 2693412 110 (0.640)intergenic (+83/+273) mtrR/rocA HTH‑type transcriptional regulator MtrR/1‑pyrroline‑5‑carboxylate dehydrogenase
* ? USA300TCH1516_ALE 2696548 =172 (0.900)20 (0.120) 10/140 NT 12.6% intergenic (+100/‑140) USA300HOU_RS13875/copA hypothetical protein/Copper‑exporting P‑type ATPase A
?USA300TCH1516_ALE 2696587 = 128 (0.770)intergenic (+139/‑101) USA300HOU_RS13875/copA hypothetical protein/Copper‑exporting P‑type ATPase A
* ? USA300TCH1516_ALE = 2716752146 (0.770)9 (0.050) 8/138 NT 5.6% intergenic (+60/+90) USA300HOU_RS13965/USA300HOU_RS13970 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 2716804 177 (1.080)intergenic (+112/+38) USA300HOU_RS13965/USA300HOU_RS13970 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 2721747162 (0.850)16 (0.090) 12/146 NT 9.4% intergenic (+28/+119) USA300HOU_RS14000/yciC_3 putative hydrolase/Putative metal chaperone YciC
?USA300TCH1516_ALE = 2721776 159 (0.920)intergenic (+57/+90) USA300HOU_RS14000/yciC_3 putative hydrolase/Putative metal chaperone YciC
* ? USA300TCH1516_ALE = 2740979148 (0.780)18 (0.110) 13/132 NT 12.6% intergenic (+21/+60) yhdG_2/USA300HOU_RS14115 putative amino acid permease YhdG/Isoleucine 2‑epimerase
?USA300TCH1516_ALE = 2741001 127 (0.810)intergenic (+43/+38) yhdG_2/USA300HOU_RS14115 putative amino acid permease YhdG/Isoleucine 2‑epimerase
* ? USA300TCH1516_ALE = 2751374159 (0.830)24 (0.140) 12/146 NT 13.9% intergenic (‑222/+39) betA/gbsA Oxygen‑dependent choline dehydrogenase/Betaine aldehyde dehydrogenase
?USA300TCH1516_ALE = 2751393 153 (0.880)intergenic (‑241/+20) betA/gbsA Oxygen‑dependent choline dehydrogenase/Betaine aldehyde dehydrogenase
* ? USA300TCH1516_ALE 2756955 =176 (0.920)20 (0.110) 10/150 NT 10.8% intergenic (‑476/+43) opuD_3/nrdG Glycine betaine transporter OpuD/Anaerobic ribonucleoside‑triphosphate reductase‑activating protein
?USA300TCH1516_ALE 2756989 = 167 (0.940)intergenic (‑510/+9) opuD_3/nrdG Glycine betaine transporter OpuD/Anaerobic ribonucleoside‑triphosphate reductase‑activating protein
* ? USA300TCH1516_ALE 2787502 =220 (1.150)20 (0.120) 14/142 NT 10.0% intergenic (+48/‑192) zipA_3/manR_2 Cell division protein ZipA/Transcriptional regulator ManR
?USA300TCH1516_ALE 2787547 = 165 (0.980)intergenic (+93/‑147) zipA_3/manR_2 Cell division protein ZipA/Transcriptional regulator ManR
* ? USA300TCH1516_ALE = 2792627131 (0.690)23 (0.150) 13/132 NT 16.1% intergenic (+78/+34) yvyI/yueB Putative mannose‑6‑phosphate isomerase YvyI/ESX secretion system protein YueB
?USA300TCH1516_ALE = 2792641 132 (0.840)intergenic (+92/+20) yvyI/yueB Putative mannose‑6‑phosphate isomerase YvyI/ESX secretion system protein YueB
* ? USA300TCH1516_ALE 2829245 =179 (0.940)19 (0.110) 11/150 NT 10.7% coding (126/1053 nt) icaC putative poly‑beta‑1,6‑N‑acetyl‑D‑glucosamine export protein
?USA300TCH1516_ALE 2829269 = 151 (0.850)coding (150/1053 nt) icaC putative poly‑beta‑1,6‑N‑acetyl‑D‑glucosamine export protein
* ? USA300TCH1516_ALE 2830190 =151 (0.790)15 (0.090) 10/138 NT 11.0% intergenic (+18/+429) icaC/lipA_2 putative poly‑beta‑1,6‑N‑acetyl‑D‑glucosamine export protein/Lipase 1
?USA300TCH1516_ALE 2830247 = 112 (0.680)intergenic (+75/+372) icaC/lipA_2 putative poly‑beta‑1,6‑N‑acetyl‑D‑glucosamine export protein/Lipase 1
* ? USA300TCH1516_ALE = 2830200148 (0.780)12 (0.070) 8/138 NT 9.1% intergenic (+28/+419) icaC/lipA_2 putative poly‑beta‑1,6‑N‑acetyl‑D‑glucosamine export protein/Lipase 1
?USA300TCH1516_ALE = 2830235 112 (0.680)intergenic (+63/+384) icaC/lipA_2 putative poly‑beta‑1,6‑N‑acetyl‑D‑glucosamine export protein/Lipase 1
* ? USA300TCH1516_ALE 2850817 =116 (0.610)25 (0.160) 9/132 NT 19.0% intergenic (+16/+103) pcp/USA300HOU_RS14605 Pyrrolidone‑carboxylate peptidase/hypothetical protein
?USA300TCH1516_ALE 2850866 = 118 (0.750)intergenic (+65/+54) pcp/USA300HOU_RS14605 Pyrrolidone‑carboxylate peptidase/hypothetical protein
* ? USA300TCH1516_ALE = 2850830117 (0.610)16 (0.100) 10/132 NT 13.0% intergenic (+29/+90) pcp/USA300HOU_RS14605 Pyrrolidone‑carboxylate peptidase/hypothetical protein
?USA300TCH1516_ALE = 2850851 118 (0.750)intergenic (+50/+69) pcp/USA300HOU_RS14605 Pyrrolidone‑carboxylate peptidase/hypothetical protein
* ? USA300TCH1516_ALE = 2854319190 (1.000)25 (0.140) 14/150 NT 11.5% intergenic (+17/+396) yflS/USA300HOU_RS14625 Putative malate transporter YflS/hypothetical protein
?USA300TCH1516_ALE = 2854338 208 (1.170)intergenic (+36/+377) yflS/USA300HOU_RS14625 Putative malate transporter YflS/hypothetical protein
* ? USA300TCH1516_ALE = 2863074179 (0.940)17 (0.100) 10/150 NT 9.2% intergenic (+44/+16) USA300TCH1516_02707/USA300HOU_RS14670 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 2864026 NA (NA)intergenic (‑439/‑19) USA300HOU_RS14670/USA300HOU_RS14675 hypothetical protein/hypothetical protein