![]() |
breseq version 0.33.1 revision 8505477f25b3
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Predicted mutations | |||||||
|---|---|---|---|---|---|---|---|
| evidence | seq id | position | mutation | freq | annotation | gene | description |
| RA | CP000731 | 81 | N→G | 100% | intergenic (–/‑151) | – / → repA | –/replication protein A |
| RA | CP000731 | 5,779 | C→T | 11.1% | intergenic (+296/‑1192) | cadX → / → USA300HOU_pUSA300HOUMR0010 | cadmium efflux regulator/MarR family transcriptional regulator |
| RA | CP000731 | 5,784 | A→G | 12.5% | intergenic (+301/‑1187) | cadX → / → USA300HOU_pUSA300HOUMR0010 | cadmium efflux regulator/MarR family transcriptional regulator |
| JC | CP000731 | 6,552 | +28 bp | 100% | intergenic (+1069/‑419) | cadX → / → USA300HOU_pUSA300HOUMR0010 | cadmium efflux regulator/MarR family transcriptional regulator |
| RA | CP000731 | 11,100 | C→A | 5.9% | intergenic (+105/‑159) | blaI → / → USA300HOU_pUSA300HOUMR0014 | beta‑lactamase regulator BlaI/recombinase |
| RA | CP000731 | 12,012 | A→G | 14.0% | intergenic (+175/+48) | USA300HOU_pUSA300HOUMR0014 → / ← USA300HOU_pUSA300HOUMR0015 | recombinase/hypothetical protein |
| RA | CP000731 | 12,017 | C→T | 17.6% | intergenic (+180/+43) | USA300HOU_pUSA300HOUMR0014 → / ← USA300HOU_pUSA300HOUMR0015 | recombinase/hypothetical protein |
| RA | CP000731 | 25,663 | Δ1 bp | 100% | coding (316/333 nt) | USA300HOU_pUSA300HOUMR0031 → | hypothetical protein |
| RA | USA300TCH1516_ALE | 3,343 | Δ1 bp | 7.6% | intergenic (+27/‑363) | dnaN → / → USA300HOU_RS00015 | DNA polymerase III subunit beta/hypothetical protein |
| RA | USA300TCH1516_ALE | 3,344 | A→T | 15.6% | intergenic (+28/‑362) | dnaN → / → USA300HOU_RS00015 | DNA polymerase III subunit beta/hypothetical protein |
| RA | USA300TCH1516_ALE | 9,710 | T→C | 20.6% | intergenic (+15/+72) | gyrA → / ← nnrD | DNA gyrase subunit A/ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase |
| RA | USA300TCH1516_ALE | 9,716 | T→C | 22.6% | intergenic (+21/+66) | gyrA → / ← nnrD | DNA gyrase subunit A/ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase |
| RA | USA300TCH1516_ALE | 9,719 | G→A | 21.4% | intergenic (+24/+63) | gyrA → / ← nnrD | DNA gyrase subunit A/ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase |
| RA | USA300TCH1516_ALE | 9,725 | G→A | 19.4% | intergenic (+30/+57) | gyrA → / ← nnrD | DNA gyrase subunit A/ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase |
| RA | USA300TCH1516_ALE | 33,661 | A→T | 6.1% | intergenic (+317/‑51) | mggB_1 → / → rlmH | Mannosylglucosyl‑3‑phosphoglycerate phosphatase/Ribosomal RNA large subunit methyltransferase H |
| RA | USA300TCH1516_ALE | 41,166 | G→A | 9.7% | intergenic (‑33/‑67) | pbp ← / → mecR1 | Beta‑lactam‑inducible penicillin‑binding protein/Methicillin resistance mecR1 protein |
| RA | USA300TCH1516_ALE | 41,171 | T→C | 6.7% | intergenic (‑38/‑62) | pbp ← / → mecR1 | Beta‑lactam‑inducible penicillin‑binding protein/Methicillin resistance mecR1 protein |
| RA | USA300TCH1516_ALE | 53,905 | C→G | 8.1% | S281R (AGC→AGG) | USA300HOU_RS00220 → | hypothetical protein |
| RA | USA300TCH1516_ALE | 76,969 | G→A | 53.3% | intergenic (+509/‑107) | USA300HOU_RS00140 → / → USA300HOU_RS00350 | hypothetical protein/Monoacylglycerol lipase |
| RA | USA300TCH1516_ALE | 79,612 | A→T | 8.4% | intergenic (+221/‑39) | USA300HOU_RS00355 → / → cmoB | hypothetical protein/tRNA U34 carboxymethyltransferase |
| RA | USA300TCH1516_ALE | 79,619 | T→A | 9.1% | intergenic (+228/‑32) | USA300HOU_RS00355 → / → cmoB | hypothetical protein/tRNA U34 carboxymethyltransferase |
| RA | USA300TCH1516_ALE | 79,626 | A→T | 6.9% | intergenic (+235/‑25) | USA300HOU_RS00355 → / → cmoB | hypothetical protein/tRNA U34 carboxymethyltransferase |
| RA | USA300TCH1516_ALE | 92,987 | A→G | 15.7% | intergenic (‑72/‑65) | ricR_1 ← / → glpE | Copper‑sensing transcriptional repressor RicR/Thiosulfate sulfurtransferase GlpE |
| RA | USA300TCH1516_ALE | 96,897 | A→G | 6.1% | intergenic (+201/+466) | USA300TCH1516_00088 → / ← dus_2 | hypothetical protein/putative tRNA‑dihydrouridine synthase |
| RA | USA300TCH1516_ALE | 96,901:1 | +G | 5.9% | intergenic (+205/+462) | USA300TCH1516_00088 → / ← dus_2 | hypothetical protein/putative tRNA‑dihydrouridine synthase |
| RA | USA300TCH1516_ALE | 99,276 | G→C | 18.1% | intergenic (+70/+2) | USA300HOU_RS00465 → / ← tetA_1 | hypothetical protein/Tetracycline resistance protein, class C |
| RA | USA300TCH1516_ALE | 109,949:1 | +G | 5.2% | intergenic (+28/‑193) | plc → / → USA300HOU_RS00515 | 1‑phosphatidylinositol phosphodiesterase/putative lipoprotein |
| RA | USA300TCH1516_ALE | 109,958 | G→A | 5.8% | intergenic (+37/‑184) | plc → / → USA300HOU_RS00515 | 1‑phosphatidylinositol phosphodiesterase/putative lipoprotein |
| RA | USA300TCH1516_ALE | 109,964 | T→A | 7.1% | intergenic (+43/‑178) | plc → / → USA300HOU_RS00515 | 1‑phosphatidylinositol phosphodiesterase/putative lipoprotein |
| RA | USA300TCH1516_ALE | 109,970 | T→C | 7.6% | intergenic (+49/‑172) | plc → / → USA300HOU_RS00515 | 1‑phosphatidylinositol phosphodiesterase/putative lipoprotein |
| RA | USA300TCH1516_ALE | 110,660 | T→A | 23.1% | I173I (ATT→ATA) | USA300HOU_RS00515 → | putative lipoprotein |
| RA | USA300TCH1516_ALE | 111,512 | A→G | 32.1% | S194S (TCA→TCG) | USA300HOU_RS00520 → | putative lipoprotein |
| RA | USA300TCH1516_ALE | 111,516 | C→A | 31.2% | Q196K (CAA→AAA) | USA300HOU_RS00520 → | putative lipoprotein |
| RA | USA300TCH1516_ALE | 163,523 | A→T | 7.5% | intergenic (‑19/+195) | glnQ ← / ← phnD | Glutamine transport ATP‑binding protein GlnQ/Phosphate‑import protein PhnD |
| RA | USA300TCH1516_ALE | 164,586 | T→A | 14.4% | Q30L (CAA→CTA) | phnD ← | Phosphate‑import protein PhnD |
| RA | USA300TCH1516_ALE | 164,590 | T→A | 13.5% | N29Y (AAT→TAT) | phnD ← | Phosphate‑import protein PhnD |
| RA | USA300TCH1516_ALE | 168,343 | G→A | 7.1% | intergenic (+310/+38) | yfkN_1 → / ← USA300TCH1516_00148 | Trifunctional nucleotide phosphoesterase protein YfkN/hypothetical protein |
| RA | USA300TCH1516_ALE | 168,350 | A→T | 7.9% | intergenic (+317/+31) | yfkN_1 → / ← USA300TCH1516_00148 | Trifunctional nucleotide phosphoesterase protein YfkN/hypothetical protein |
| RA | USA300TCH1516_ALE | 168,354 | C→G | 7.2% | intergenic (+321/+27) | yfkN_1 → / ← USA300TCH1516_00148 | Trifunctional nucleotide phosphoesterase protein YfkN/hypothetical protein |
| RA | USA300TCH1516_ALE | 168,358 | A→T | 5.6% | intergenic (+325/+23) | yfkN_1 → / ← USA300TCH1516_00148 | Trifunctional nucleotide phosphoesterase protein YfkN/hypothetical protein |
| RA | USA300TCH1516_ALE | 186,459 | A→G | 9.0% | Q345R (CAA→CGA) | USA300HOU_RS00855 → | hypothetical protein |
| RA | USA300TCH1516_ALE | 195,286 | T→A | 53.1% | intergenic (‑97/‑82) | USA300HOU_RS00900 ← / → USA300HOU_RS00905 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 216,795 | G→C | 8.8% | I4M (ATC→ATG) | rocD2_1 ← | Ornithine aminotransferase 2 |
| RA | USA300TCH1516_ALE | 217,036 | T→A | 13.5% | intergenic (‑230/+23) | rocD2_1 ← / ← brnQ_1 | Ornithine aminotransferase 2/Branched‑chain amino acid transport system 2 carrier protein |
| RA | USA300TCH1516_ALE | 217,045 | A→C | 9.5% | intergenic (‑239/+14) | rocD2_1 ← / ← brnQ_1 | Ornithine aminotransferase 2/Branched‑chain amino acid transport system 2 carrier protein |
| RA | USA300TCH1516_ALE | 217,046 | C→T | 9.4% | intergenic (‑240/+13) | rocD2_1 ← / ← brnQ_1 | Ornithine aminotransferase 2/Branched‑chain amino acid transport system 2 carrier protein |
| RA | USA300TCH1516_ALE | 290,156 | A→T | 12.2% | intergenic (+47/‑180) | gatB_1 → / → gatC_1 | PTS system galactitol‑specific EIIB component/PTS system galactitol‑specific EIIC component |
| RA | USA300TCH1516_ALE | 308,137 | A→C | 5.4% | I129L (ATT→CTT) | lytR_1 → | Sensory transduction protein LytR |
| RA | USA300TCH1516_ALE | 341,450 | G→C | 17.3% | D134H (GAT→CAT) | USA300HOU_RS01525 → | hypothetical protein |
| RA | USA300TCH1516_ALE | 346,350 | C→T | 5.0% | I55I (ATC→ATT) | sotB → | sugar efflux transporter |
| RA | USA300TCH1516_ALE | 346,353 | A→T | 5.2% | V56V (GTA→GTT) | sotB → | sugar efflux transporter |
| RA | USA300TCH1516_ALE | 346,356 | A→G | 5.0% | T57T (ACA→ACG) | sotB → | sugar efflux transporter |
| RA | USA300TCH1516_ALE | 372,106 | T→A | 14.7% | intergenic (‑166/‑204) | ylbJ ← / → lip2 | Sporulation integral membrane protein YlbJ/Lipase 2 |
| RA | USA300TCH1516_ALE | 396,540 | G→A | 41.7% | A208T (GCA→ACA) | efeM → | putative iron uptake system component EfeM |
| RA | USA300TCH1516_ALE | 401,399 | A→C | 11.4% | intergenic (‑184/‑57) | USA300HOU_RS01845 ← / → sutR | hypothetical protein/HTH‑type transcriptional regulator SutR |
| RA | USA300TCH1516_ALE | 401,404 | G→T | 11.5% | intergenic (‑189/‑52) | USA300HOU_RS01845 ← / → sutR | hypothetical protein/HTH‑type transcriptional regulator SutR |
| RA | USA300TCH1516_ALE | 410,464 | A→T | 6.9% | I522I (ATT→ATA) | yitJ ← | Bifunctional homocysteine S‑methyltransferase/5,10‑methylenetetrahydrofolate reductase |
| RA | USA300TCH1516_ALE | 413,758 | G→A | 5.8% | I167I (ATC→ATT) | metI ← | Cystathionine gamma‑synthase/O‑acetylhomoserine (thiol)‑lyase |
| RA | USA300TCH1516_ALE | 413,761 | A→T | 5.8% | I166I (ATT→ATA) | metI ← | Cystathionine gamma‑synthase/O‑acetylhomoserine (thiol)‑lyase |
| RA | USA300TCH1516_ALE | 413,764 | T→C | 5.7% | S165S (TCA→TCG) | metI ← | Cystathionine gamma‑synthase/O‑acetylhomoserine (thiol)‑lyase |
| RA | USA300TCH1516_ALE | 418,825 | A→T | 10.9% | N53I (AAT→ATT) | rpsF → | 30S ribosomal protein S6 |
| RA | USA300TCH1516_ALE | 419,964 | A→T | 7.1% | intergenic (+182/+84) | rpsR → / ← USA300HOU_RS01950 | 30S ribosomal protein S18/hypothetical protein |
| RA | USA300TCH1516_ALE | 419,965 | A→T | 7.0% | intergenic (+183/+83) | rpsR → / ← USA300HOU_RS01950 | 30S ribosomal protein S18/hypothetical protein |
| RA | USA300TCH1516_ALE | 462,826 | T→A | 6.2% | intergenic (+85/+18) | USA300HOU_RS02185 → / ← USA300HOU_RS02190 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 512,643 | A→G | 11.3% | intergenic (+711/‑6052) | recR → / → speA_2 | Recombination protein RecR/Arginine decarboxylase |
| RA | USA300TCH1516_ALE | 536,863 | T→A | 7.9% | intergenic (+56/‑255) | rplY → / → pth | 50S ribosomal protein L25/Peptidyl‑tRNA hydrolase |
| RA | USA300TCH1516_ALE | 576,915 | C→G | 11.7% | intergenic (+338/‑52) | gltX → / → cysE | Glutamate‑‑tRNA ligase/Serine acetyltransferase |
| RA | USA300TCH1516_ALE | 576,920:1 | +T | 6.1% | intergenic (+343/‑47) | gltX → / → cysE | Glutamate‑‑tRNA ligase/Serine acetyltransferase |
| RA | USA300TCH1516_ALE | 581,901 | G→C | 10.8% | V13L (GTG→CTG) | nusG_2 → | Transcription termination/antitermination protein NusG |
| RA | USA300TCH1516_ALE | 593,430 | T→A | 10.2% | intergenic (+22/‑115) | rpoC → / → rplGB | DNA‑directed RNA polymerase subunit beta'/Ribosome‑associated protein L7Ae‑like protein |
| RA | USA300TCH1516_ALE | 593,433 | T→A | 10.4% | intergenic (+25/‑112) | rpoC → / → rplGB | DNA‑directed RNA polymerase subunit beta'/Ribosome‑associated protein L7Ae‑like protein |
| RA | USA300TCH1516_ALE | 597,160 | G→T | 10.8% | intergenic (+110/‑107) | fusA → / → tuf | Elongation factor G/Elongation factor Tu |
| RA | USA300TCH1516_ALE | 597,163 | A→C | 11.5% | intergenic (+113/‑104) | fusA → / → tuf | Elongation factor G/Elongation factor Tu |
| RA | USA300TCH1516_ALE | 598,486 | T→C | 13.0% | intergenic (+35/+247) | tuf → / ← yxeP_2 | Elongation factor Tu/putative hydrolase YxeP |
| RA | USA300TCH1516_ALE | 598,492 | A→G | 14.5% | intergenic (+41/+241) | tuf → / ← yxeP_2 | Elongation factor Tu/putative hydrolase YxeP |
| RA | USA300TCH1516_ALE | 598,495 | C→T | 14.4% | intergenic (+44/+238) | tuf → / ← yxeP_2 | Elongation factor Tu/putative hydrolase YxeP |
| RA | USA300TCH1516_ALE | 598,501 | G→A | 13.3% | intergenic (+50/+232) | tuf → / ← yxeP_2 | Elongation factor Tu/putative hydrolase YxeP |
| RA | USA300TCH1516_ALE | 598,505:1 | +C | 5.0% | intergenic (+54/+228) | tuf → / ← yxeP_2 | Elongation factor Tu/putative hydrolase YxeP |
| RA | USA300TCH1516_ALE | 629,681 | C→A | 16.5% | L84I (CTA→ATA) | USA300HOU_RS02990 → | 3‑hexulose‑6‑phosphate synthase |
| RA | USA300TCH1516_ALE | 631,535 | G→A | 12.2% | intergenic (+161/‑341) | gph_1 → / → proP | Phosphoglycolate phosphatase/Proline/betaine transporter |
| RA | USA300TCH1516_ALE | 631,536 | T→C | 12.4% | intergenic (+162/‑340) | gph_1 → / → proP | Phosphoglycolate phosphatase/Proline/betaine transporter |
| RA | USA300TCH1516_ALE | 639,592 | C→G | 13.5% | A33G (GCC→GGC) | USA300HOU_RS03045 → | hypothetical protein |
| RA | USA300TCH1516_ALE | 665,392 | T→G | 32.2% | L79* (TTA→TGA) | paiA_1 → | Spermidine/spermine N(1)‑acetyltransferase |
| RA | USA300TCH1516_ALE | 667,064 | T→G | 8.1% | D18E (GAT→GAG) | USA300TCH1516_00600 → | hypothetical protein |
| RA | USA300TCH1516_ALE | 690,093 | A→G | 15.6% | intergenic (‑22/+13) | USA300HOU_RS03320 ← / ← USA300HOU_RS03325 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 690,098 | A→T | 15.3% | intergenic (‑27/+8) | USA300HOU_RS03320 ← / ← USA300HOU_RS03325 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 690,101 | A→T | 15.8% | intergenic (‑30/+5) | USA300HOU_RS03320 ← / ← USA300HOU_RS03325 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 690,106 | C→T | 9.2% | *128* (TAG→TAA) | USA300HOU_RS03325 ← | hypothetical protein |
| RA | USA300TCH1516_ALE | 702,553 | T→A | 12.7% | F116I (TTT→ATT) | nhaK_1 → | Sodium, potassium, lithium and rubidium/H(+) antiporter |
| RA | USA300TCH1516_ALE | 707,910 | A→G | 62.6% | intergenic (‑1/‑121) | znuC_1 ← / → ideR | High‑affinity zinc uptake system ATP‑binding protein ZnuC/Iron‑dependent repressor IdeR |
| RA | USA300TCH1516_ALE | 707,911 | C→T | 7.5% | intergenic (‑2/‑120) | znuC_1 ← / → ideR | High‑affinity zinc uptake system ATP‑binding protein ZnuC/Iron‑dependent repressor IdeR |
| RA | USA300TCH1516_ALE | 722,987 | C→T | 19.1% | T42I (ACA→ATA) | feuB → | Iron‑uptake system permease protein FeuB |
| RA | USA300TCH1516_ALE | 722,992 | A→G | 17.0% | I44V (ATA→GTA) | feuB → | Iron‑uptake system permease protein FeuB |
| RA | USA300TCH1516_ALE | 740,322 | G→C | 15.8% | intergenic (+549/+39) | pitA_1 → / ← sle1_2 | Low‑affinity inorganic phosphate transporter 1/N‑acetylmuramoyl‑L‑alanine amidase sle1 |
| RA | USA300TCH1516_ALE | 740,328:1 | +G | 12.5% | intergenic (+555/+33) | pitA_1 → / ← sle1_2 | Low‑affinity inorganic phosphate transporter 1/N‑acetylmuramoyl‑L‑alanine amidase sle1 |
| RA | USA300TCH1516_ALE | 756,705 | T→A | 6.4% | intergenic (‑193/‑20) | uppP ← / → cydD | Undecaprenyl‑diphosphatase/ATP‑binding/permease protein CydD |
| RA | USA300TCH1516_ALE | 770,855 | A→G | 7.4% | intergenic (+41/‑209) | ybaK → / → glcR | Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR |
| RA | USA300TCH1516_ALE | 770,860 | G→A | 8.6% | intergenic (+46/‑204) | ybaK → / → glcR | Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR |
| RA | USA300TCH1516_ALE | 770,866 | A→T | 8.8% | intergenic (+52/‑198) | ybaK → / → glcR | Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR |
| RA | USA300TCH1516_ALE | 770,870 | T→A | 9.1% | intergenic (+56/‑194) | ybaK → / → glcR | Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR |
| RA | USA300TCH1516_ALE | 770,877 | A→T | 7.9% | intergenic (+63/‑187) | ybaK → / → glcR | Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR |
| RA | USA300TCH1516_ALE | 770,883 | T→C | 9.7% | intergenic (+69/‑181) | ybaK → / → glcR | Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR |
| RA | USA300TCH1516_ALE | 770,888 | C→T | 6.3% | intergenic (+74/‑176) | ybaK → / → glcR | Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR |
| RA | USA300TCH1516_ALE | 779,959 | C→T | 7.6% | intergenic (+15/+57) | csbB → / ← saeS | Putative glycosyltransferase CsbB/Histidine protein kinase SaeS |
| RA | USA300TCH1516_ALE | 779,970 | G→A | 10.4% | intergenic (+26/+46) | csbB → / ← saeS | Putative glycosyltransferase CsbB/Histidine protein kinase SaeS |
| RA | USA300TCH1516_ALE | 790,718 | T→A | 6.7% | intergenic (+217/‑257) | kipA_1 → / → ltaS | KipI antagonist/Lipoteichoic acid synthase |
| RA | USA300TCH1516_ALE | 792,942 | A→T | 5.5% | intergenic (+27/‑250) | ltaS → / → ettA | Lipoteichoic acid synthase/Energy‑dependent translational throttle protein EttA |
| RA | USA300TCH1516_ALE | 792,943 | A→T | 5.5% | intergenic (+28/‑249) | ltaS → / → ettA | Lipoteichoic acid synthase/Energy‑dependent translational throttle protein EttA |
| RA | USA300TCH1516_ALE | 792,944 | A→T | 5.8% | intergenic (+29/‑248) | ltaS → / → ettA | Lipoteichoic acid synthase/Energy‑dependent translational throttle protein EttA |
| RA | USA300TCH1516_ALE | 803,528 | C→T | 16.3% | intergenic (‑228/+42) | USA300HOU_RS03920 ← / ← dtpT | Putative lipid kinase/Di‑/tripeptide transporter |
| RA | USA300TCH1516_ALE | 803,539 | A→G | 20.4% | intergenic (‑239/+31) | USA300HOU_RS03920 ← / ← dtpT | Putative lipid kinase/Di‑/tripeptide transporter |
| RA | USA300TCH1516_ALE | 806,422 | T→G | 7.0% | I127I (ATA→ATC) | ribN ← | Riboflavin transporter |
| RA | USA300TCH1516_ALE | 806,425 | C→A | 6.0% | M126I (ATG→ATT) | ribN ← | Riboflavin transporter |
| RA | USA300TCH1516_ALE | 837,540:1 | +T | 15.0% | intergenic (+34/‑235) | USA300HOU_RS04100 → / → uvrB | hypothetical protein/UvrABC system protein B |
| RA | USA300TCH1516_ALE | 875,946 | A→T | 11.1% | intergenic (+49/‑172) | clfA → / → USA300HOU_RS04275 | Clumping factor A/Staphylocoagulase |
| RA | USA300TCH1516_ALE | 875,947 | A→T | 11.1% | intergenic (+50/‑171) | clfA → / → USA300HOU_RS04275 | Clumping factor A/Staphylocoagulase |
| RA | USA300TCH1516_ALE | 890,542 | T→C | 9.5% | intergenic (+17/‑47) | gcvH → / → USA300TCH1516_00820 | Glycine cleavage system H protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 890,548 | A→T | 11.6% | intergenic (+23/‑41) | gcvH → / → USA300TCH1516_00820 | Glycine cleavage system H protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 895,932 | G→A | 11.9% | intergenic (+131/+12) | metQ_2 → / ← Int‑Tn_1 | Methionine‑binding lipoprotein MetQ/Transposase from transposon Tn916 |
| RA | USA300TCH1516_ALE | 895,935 | T→C | 11.8% | intergenic (+134/+9) | metQ_2 → / ← Int‑Tn_1 | Methionine‑binding lipoprotein MetQ/Transposase from transposon Tn916 |
| RA | USA300TCH1516_ALE | 895,942 | C→T | 6.9% | intergenic (+141/+2) | metQ_2 → / ← Int‑Tn_1 | Methionine‑binding lipoprotein MetQ/Transposase from transposon Tn916 |
| RA | USA300TCH1516_ALE | 897,213:1 | +C | 5.0% | intergenic (‑49/+39) | Int‑Tn_1 ← / ← entA_1 | Transposase from transposon Tn916/Enterotoxin type A |
| RA | USA300TCH1516_ALE | 917,327 | T→G | 11.6% | intergenic (+86/+244) | sufB_2 → / ← USA300HOU_RS04545 | FeS cluster assembly protein SufB/hypothetical protein |
| RA | USA300TCH1516_ALE | 917,330 | C→A | 10.8% | intergenic (+89/+241) | sufB_2 → / ← USA300HOU_RS04545 | FeS cluster assembly protein SufB/hypothetical protein |
| RA | USA300TCH1516_ALE | 937,148 | T→C | 6.4% | intergenic (+55/‑76) | USA300HOU_RS04665 → / → pepA_1 | NADH dehydrogenase‑like protein/Cytosol aminopeptidase |
| RA | USA300TCH1516_ALE | 937,158 | T→A | 12.1% | intergenic (+65/‑66) | USA300HOU_RS04665 → / → pepA_1 | NADH dehydrogenase‑like protein/Cytosol aminopeptidase |
| RA | USA300TCH1516_ALE | 942,207 | A→G | 7.8% | intergenic (‑178/+71) | ptlE ← / ← mnhG1 | Neopentalenolactone D synthase/Na(+)/H(+) antiporter subunit G1 |
| RA | USA300TCH1516_ALE | 942,210 | C→G | 7.2% | intergenic (‑181/+68) | ptlE ← / ← mnhG1 | Neopentalenolactone D synthase/Na(+)/H(+) antiporter subunit G1 |
| RA | USA300TCH1516_ALE | 942,216 | T→A | 7.6% | intergenic (‑187/+62) | ptlE ← / ← mnhG1 | Neopentalenolactone D synthase/Na(+)/H(+) antiporter subunit G1 |
| RA | USA300TCH1516_ALE | 942,221 | T→A | 7.9% | intergenic (‑192/+57) | ptlE ← / ← mnhG1 | Neopentalenolactone D synthase/Na(+)/H(+) antiporter subunit G1 |
| RA | USA300TCH1516_ALE | 942,227 | C→G | 8.2% | intergenic (‑198/+51) | ptlE ← / ← mnhG1 | Neopentalenolactone D synthase/Na(+)/H(+) antiporter subunit G1 |
| RA | USA300TCH1516_ALE | 942,230 | C→T | 8.2% | intergenic (‑201/+48) | ptlE ← / ← mnhG1 | Neopentalenolactone D synthase/Na(+)/H(+) antiporter subunit G1 |
| RA | USA300TCH1516_ALE | 950,088 | T→A | 18.7% | intergenic (+82/‑280) | yugI_2 → / → USA300HOU_RS04740 | General stress protein 13/putative oxidoreductase |
| RA | USA300TCH1516_ALE | 950,093 | T→A | 19.6% | intergenic (+87/‑275) | yugI_2 → / → USA300HOU_RS04740 | General stress protein 13/putative oxidoreductase |
| RA | USA300TCH1516_ALE | 950,098 | T→A | 18.1% | intergenic (+92/‑270) | yugI_2 → / → USA300HOU_RS04740 | General stress protein 13/putative oxidoreductase |
| RA | USA300TCH1516_ALE | 962,321 | G→A | 6.9% | intergenic (+25/‑135) | spsB_2 → / → addB | Signal peptidase IB/ATP‑dependent helicase/deoxyribonuclease subunit B |
| RA | USA300TCH1516_ALE | 962,324 | G→A | 7.1% | intergenic (+28/‑132) | spsB_2 → / → addB | Signal peptidase IB/ATP‑dependent helicase/deoxyribonuclease subunit B |
| RA | USA300TCH1516_ALE | 962,327 | T→A | 7.2% | intergenic (+31/‑129) | spsB_2 → / → addB | Signal peptidase IB/ATP‑dependent helicase/deoxyribonuclease subunit B |
| RA | USA300TCH1516_ALE | 962,332 | T→A | 7.1% | intergenic (+36/‑124) | spsB_2 → / → addB | Signal peptidase IB/ATP‑dependent helicase/deoxyribonuclease subunit B |
| RA | USA300TCH1516_ALE | 962,335 | T→C | 6.4% | intergenic (+39/‑121) | spsB_2 → / → addB | Signal peptidase IB/ATP‑dependent helicase/deoxyribonuclease subunit B |
| RA | USA300TCH1516_ALE | 962,338 | T→C | 7.3% | intergenic (+42/‑118) | spsB_2 → / → addB | Signal peptidase IB/ATP‑dependent helicase/deoxyribonuclease subunit B |
| RA | USA300TCH1516_ALE | 970,677 | G→A | 9.9% | intergenic (+23/‑306) | USA300HOU_RS04805 → / → USA300HOU_RS04810 | Ureidoglycolate lyase/hypothetical protein |
| RA | USA300TCH1516_ALE | 970,681 | T→A | 9.1% | intergenic (+27/‑302) | USA300HOU_RS04805 → / → USA300HOU_RS04810 | Ureidoglycolate lyase/hypothetical protein |
| RA | USA300TCH1516_ALE | 970,686 | T→A | 10.2% | intergenic (+32/‑297) | USA300HOU_RS04805 → / → USA300HOU_RS04810 | Ureidoglycolate lyase/hypothetical protein |
| RA | USA300TCH1516_ALE | 970,690 | T→C | 9.1% | intergenic (+36/‑293) | USA300HOU_RS04805 → / → USA300HOU_RS04810 | Ureidoglycolate lyase/hypothetical protein |
| RA | USA300TCH1516_ALE | 977,289 | T→A | 9.0% | I190N (ATT→AAT) | clpB_1 → | Chaperone protein ClpB |
| RA | USA300TCH1516_ALE | 1,019,742 | G→A | 6.5% | intergenic (+64/+49) | USA300HOU_RS05030 → / ← ltaA | Putative phosphoesterase/putative glycolipid permease LtaA |
| RA | USA300TCH1516_ALE | 1,019,743 | A→C | 6.4% | intergenic (+65/+48) | USA300HOU_RS05030 → / ← ltaA | Putative phosphoesterase/putative glycolipid permease LtaA |
| RA | USA300TCH1516_ALE | 1,019,746 | G→T | 6.5% | intergenic (+68/+45) | USA300HOU_RS05030 → / ← ltaA | Putative phosphoesterase/putative glycolipid permease LtaA |
| RA | USA300TCH1516_ALE | 1,019,747 | T→C | 6.7% | intergenic (+69/+44) | USA300HOU_RS05030 → / ← ltaA | Putative phosphoesterase/putative glycolipid permease LtaA |
| RA | USA300TCH1516_ALE | 1,038,119 | A→C | 6.0% | T236P (ACG→CCG) | USA300TCH1516_00964 → | hypothetical protein |
| RA | USA300TCH1516_ALE | 1,038,122 | G→T | 6.0% | G237C (GGT→TGT) | USA300TCH1516_00964 → | hypothetical protein |
| RA | USA300TCH1516_ALE | 1,042,789 | T→C | 12.9% | intergenic (+19/+70) | tagE_3 → / ← catD | Poly(glycerol‑phosphate) alpha‑glucosyltransferase/Putative oxidoreductase CatD |
| RA | USA300TCH1516_ALE | 1,042,796 | G→A | 16.9% | intergenic (+26/+63) | tagE_3 → / ← catD | Poly(glycerol‑phosphate) alpha‑glucosyltransferase/Putative oxidoreductase CatD |
| RA | USA300TCH1516_ALE | 1,054,586 | Δ1 bp | 9.5% | intergenic (‑87/+441) | sspA ← / ← patA_2 | Glutamyl endopeptidase/Putative N‑acetyl‑LL‑diaminopimelate aminotransferase |
| RA | USA300TCH1516_ALE | 1,055,119 | C→A | 7.8% | G355C (GGT→TGT) | patA_2 ← | Putative N‑acetyl‑LL‑diaminopimelate aminotransferase |
| RA | USA300TCH1516_ALE | 1,055,126 | T→G | 13.2% | T352T (ACA→ACC) | patA_2 ← | Putative N‑acetyl‑LL‑diaminopimelate aminotransferase |
| RA | USA300TCH1516_ALE | 1,078,152 | A→T | 11.3% | Q510L (CAG→CTG) | purL → | Phosphoribosylformylglycinamidine synthase subunit PurL |
| RA | USA300TCH1516_ALE | 1,104,520 | T→A | 11.8% | L309* (TTA→TAA) | pdhB → | Pyruvate dehydrogenase E1 component subunit beta |
| RA | USA300TCH1516_ALE | 1,117,393 | C→G | 6.9% | intergenic (+106/+48) | suhB_1 → / ← USA300TCH1516_01040 | Inositol‑1‑monophosphatase/hypothetical protein |
| RA | USA300TCH1516_ALE | 1,200,692 | G→T | 7.6% | L169F (TTG→TTT) | divIVA → | Septum site‑determining protein DivIVA |
| RA | USA300TCH1516_ALE | 1,200,697 | A→C | 7.3% | E171A (GAA→GCA) | divIVA → | Septum site‑determining protein DivIVA |
| RA | USA300TCH1516_ALE | 1,218,719 | Δ1 bp | 8.8% | intergenic (+210/+53) | USA300HOU_RS06065 → / ← USA300HOU_RS06070 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 1,218,722 | T→A | 8.9% | intergenic (+213/+50) | USA300HOU_RS06065 → / ← USA300HOU_RS06070 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 1,218,730 | G→T | 11.4% | intergenic (+221/+42) | USA300HOU_RS06065 → / ← USA300HOU_RS06070 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 1,218,732 | C→G | 11.3% | intergenic (+223/+40) | USA300HOU_RS06065 → / ← USA300HOU_RS06070 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 1,218,734 | A→C | 11.5% | intergenic (+225/+38) | USA300HOU_RS06065 → / ← USA300HOU_RS06070 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 1,221,653 | G→A | 8.8% | intergenic (+68/‑148) | rpoZ → / → coaBC | DNA‑directed RNA polymerase subunit omega/Coenzyme A biosynthesis bifunctional protein CoaBC |
| RA | USA300TCH1516_ALE | 1,231,474 | G→C | 11.0% | G40A (GGT→GCT) | stp → | Serine/threonine phosphatase stp |
| RA | USA300TCH1516_ALE | 1,232,565 | C→A | 5.9% | A157D (GCT→GAT) | prkC → | Serine/threonine‑protein kinase PrkC |
| RA | USA300TCH1516_ALE | 1,233,504 | T→A | 12.1% | V470D (GTT→GAT) | prkC → | Serine/threonine‑protein kinase PrkC |
| RA | USA300TCH1516_ALE | 1,239,557:1 | +C | 5.4% | intergenic (+24/‑166) | USA300HOU_RS06160 → / → recG | hypothetical protein/ATP‑dependent DNA helicase RecG |
| RA | USA300TCH1516_ALE | 1,239,562 | A→G | 5.7% | intergenic (+29/‑161) | USA300HOU_RS06160 → / → recG | hypothetical protein/ATP‑dependent DNA helicase RecG |
| RA | USA300TCH1516_ALE | 1,239,564 | A→T | 5.9% | intergenic (+31/‑159) | USA300HOU_RS06160 → / → recG | hypothetical protein/ATP‑dependent DNA helicase RecG |
| RA | USA300TCH1516_ALE | 1,239,566 | C→T | 5.8% | intergenic (+33/‑157) | USA300HOU_RS06160 → / → recG | hypothetical protein/ATP‑dependent DNA helicase RecG |
| RA | USA300TCH1516_ALE | 1,239,571 | Δ1 bp | 5.4% | intergenic (+38/‑152) | USA300HOU_RS06160 → / → recG | hypothetical protein/ATP‑dependent DNA helicase RecG |
| RA | USA300TCH1516_ALE | 1,245,330 | A→T | 9.4% | intergenic (+135/‑108) | fabG → / → acpP | 3‑oxoacyl‑[acyl‑carrier‑protein] reductase FabG/Acyl carrier protein |
| RA | USA300TCH1516_ALE | 1,245,337 | A→T | 8.8% | intergenic (+142/‑101) | fabG → / → acpP | 3‑oxoacyl‑[acyl‑carrier‑protein] reductase FabG/Acyl carrier protein |
| RA | USA300TCH1516_ALE | 1,245,338 | A→T | 8.5% | intergenic (+143/‑100) | fabG → / → acpP | 3‑oxoacyl‑[acyl‑carrier‑protein] reductase FabG/Acyl carrier protein |
| RA | USA300TCH1516_ALE | 1,245,345 | A→T | 8.7% | intergenic (+150/‑93) | fabG → / → acpP | 3‑oxoacyl‑[acyl‑carrier‑protein] reductase FabG/Acyl carrier protein |
| RA | USA300TCH1516_ALE | 1,254,017 | A→T | 8.4% | intergenic (+114/‑74) | rpsP → / → rimM | 30S ribosomal protein S16/Ribosome maturation factor RimM |
| RA | USA300TCH1516_ALE | 1,255,815 | A→G | 5.5% | intergenic (+31/+213) | rplS → / ← USA300HOU_RS06250 | 50S ribosomal protein L19/hypothetical protein |
| RA | USA300TCH1516_ALE | 1,270,460 | C→G | 5.2% | intergenic (+211/‑206) | trmFO → / → xerC_1 | Methylenetetrahydrofolate‑‑tRNA‑(uracil‑5‑)‑ methyltransferase TrmFO/Tyrosine recombinase XerC |
| RA | USA300TCH1516_ALE | 1,313,113 | A→T | 9.6% | intergenic (+17/+280) | rny_1 → / ← USA300HOU_RS06485 | Ribonuclease Y/hypothetical protein |
| RA | USA300TCH1516_ALE | 1,313,118 | A→T | 5.6% | intergenic (+22/+275) | rny_1 → / ← USA300HOU_RS06485 | Ribonuclease Y/hypothetical protein |
| RA | USA300TCH1516_ALE | 1,313,343 | A→G | 5.3% | intergenic (+247/+50) | rny_1 → / ← USA300HOU_RS06485 | Ribonuclease Y/hypothetical protein |
| RA | USA300TCH1516_ALE | 1,332,110 | G→A | 15.0% | V168V (GTG→GTA) | miaA → | tRNA dimethylallyltransferase |
| RA | USA300TCH1516_ALE | 1,338,468:1 | +G | 8.5% | intergenic (+403/‑872) | glnA → / → USA300TCH1516_01240 | Glutamine synthetase/hypothetical protein |
| RA | USA300TCH1516_ALE | 1,338,473 | Δ1 bp | 5.4% | intergenic (+408/‑867) | glnA → / → USA300TCH1516_01240 | Glutamine synthetase/hypothetical protein |
| RA | USA300TCH1516_ALE | 1,343,619 | A→C | 12.4% | intergenic (+32/‑98) | USA300HOU_RS06640 → / → USA300TCH1516_01248 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 1,343,622 | G→T | 12.1% | intergenic (+35/‑95) | USA300HOU_RS06640 → / → USA300TCH1516_01248 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 1,362,249 | A→T | 9.2% | intergenic (‑181/+37) | USA300TCH1516_01271 ← / ← lysP_1 | hypothetical protein/Lysine‑specific permease |
| RA | USA300TCH1516_ALE | 1,362,255 | A→T | 9.5% | intergenic (‑187/+31) | USA300TCH1516_01271 ← / ← lysP_1 | hypothetical protein/Lysine‑specific permease |
| RA | USA300TCH1516_ALE | 1,362,261 | A→T | 8.5% | intergenic (‑193/+25) | USA300TCH1516_01271 ← / ← lysP_1 | hypothetical protein/Lysine‑specific permease |
| RA | USA300TCH1516_ALE | 1,362,267 | C→T | 7.3% | intergenic (‑199/+19) | USA300TCH1516_01271 ← / ← lysP_1 | hypothetical protein/Lysine‑specific permease |
| RA | USA300TCH1516_ALE | 1,366,121 | A→T | 10.3% | intergenic (+420/‑34) | rpmG2_1 → / → rpsN2 | 50S ribosomal protein L33 2/Alternate 30S ribosomal protein S14 |
| RA | USA300TCH1516_ALE | 1,368,899 | C→A | 7.5% | intergenic (+303/+77) | USA300TCH1516_01277 → / ← lexA_1 | hypothetical protein/LexA repressor |
| RA | USA300TCH1516_ALE | 1,368,902 | A→T | 7.5% | intergenic (+306/+74) | USA300TCH1516_01277 → / ← lexA_1 | hypothetical protein/LexA repressor |
| RA | USA300TCH1516_ALE | 1,368,905 | T→G | 7.0% | intergenic (+309/+71) | USA300TCH1516_01277 → / ← lexA_1 | hypothetical protein/LexA repressor |
| RA | USA300TCH1516_ALE | 1,415,013 | C→G | 5.1% | intergenic (+24/+24) | yitU_2 → / ← mqo | 5‑amino‑6‑(5‑phospho‑D‑ribitylamino)uracil phosphatase YitU/malate:quinone oxidoreductase |
| RA | USA300TCH1516_ALE | 1,416,458 | A→T | 100% | I216N (ATT→AAT) | oppD_4 ← | Oligopeptide transport ATP‑binding protein OppD |
| RA | USA300TCH1516_ALE | 1,421,700 | T→A | 5.8% | intergenic (+136/+4) | pepF1_2 → / ← phoU | Oligoendopeptidase F, plasmid/Phosphate‑specific transport system accessory protein PhoU |
| RA | USA300TCH1516_ALE | 1,430,691 | C→G | 8.6% | intergenic (+800/‑60) | ybiT → / → lysC | putative ABC transporter ATP‑binding protein YbiT/Aspartokinase |
| RA | USA300TCH1516_ALE | 1,430,693 | T→A | 8.8% | intergenic (+802/‑58) | ybiT → / → lysC | putative ABC transporter ATP‑binding protein YbiT/Aspartokinase |
| RA | USA300TCH1516_ALE | 1,430,695 | C→G | 9.0% | intergenic (+804/‑56) | ybiT → / → lysC | putative ABC transporter ATP‑binding protein YbiT/Aspartokinase |
| RA | USA300TCH1516_ALE | 1,439,789 | C→A | 5.4% | intergenic (‑146/+51) | USA300HOU_RS07135 ← / ← cspA_2 | hypothetical protein/Cold shock protein CspA |
| RA | USA300TCH1516_ALE | 1,439,806 | G→C | 13.3% | intergenic (‑163/+34) | USA300HOU_RS07135 ← / ← cspA_2 | hypothetical protein/Cold shock protein CspA |
| RA | USA300TCH1516_ALE | 1,440,085 | G→T | 22.1% | intergenic (‑45/+126) | cspA_2 ← / ← USA300TCH1516_01338 | Cold shock protein CspA/hypothetical protein |
| RA | USA300TCH1516_ALE | 1,476,681 | T→A | 11.5% | H8448L (CAT→CTT) | ebh_1 ← | Extracellular matrix‑binding protein ebh |
| RA | USA300TCH1516_ALE | 1,476,685 | T→A | 12.2% | M8447L (ATG→TTG) | ebh_1 ← | Extracellular matrix‑binding protein ebh |
| RA | USA300TCH1516_ALE | 1,487,340 | T→A | 7.1% | H4895L (CAT→CTT) | ebh_1 ← | Extracellular matrix‑binding protein ebh |
| RA | USA300TCH1516_ALE | 1,487,343 | T→A | 5.8% | K4894M (AAG→ATG) | ebh_1 ← | Extracellular matrix‑binding protein ebh |
| RA | USA300TCH1516_ALE | 1,500,743 | T→G | 5.6% | V427V (GTA→GTC) | ebh_1 ← | Extracellular matrix‑binding protein ebh |
| RA | USA300TCH1516_ALE | 1,502,422 | C→G | 6.1% | *464S (TGA→TCA) | norB_4 ← | Quinolone resistance protein NorB |
| RA | USA300TCH1516_ALE | 1,513,930 | A→T | 100% | L413F (TTA→TTT) | USA300HOU_RS07375 → | hypothetical protein |
| RA | USA300TCH1516_ALE | 1,516,445 | A→G | 5.5% | intergenic (‑96/+5) | USA300TCH1516_01381 ← / ← gpsB | hypothetical protein/Cell cycle protein GpsB |
| RA | USA300TCH1516_ALE | 1,516,450 | T→A | 6.4% | *115Y (TAA→TAT) | gpsB ← | Cell cycle protein GpsB |
| RA | USA300TCH1516_ALE | 1,516,453 | T→A | 6.3% | K114N (AAA→AAT) | gpsB ← | Cell cycle protein GpsB |
| RA | USA300TCH1516_ALE | 1,526,532 | T→A | 7.0% | K471* (AAA→TAA) | dinG_1 ← | putative ATP‑dependent helicase DinG |
| RA | USA300TCH1516_ALE | 1,537,428 | A→T | 10.0% | I94I (ATT→ATA) | aroB ← | 3‑dehydroquinate synthase |
| RA | USA300TCH1516_ALE | 1,582,474 | G→A | 9.3% | H107H (CAC→CAT) | clpP1 ← | ATP‑dependent Clp protease proteolytic subunit 1 |
| RA | USA300TCH1516_ALE | 1,582,479 | T→C | 15.1% | M106V (ATG→GTG) | clpP1 ← | ATP‑dependent Clp protease proteolytic subunit 1 |
| RA | USA300TCH1516_ALE | 1,615,301 | T→A | 7.3% | intergenic (‑31/+18) | xerD_3 ← / ← fur | Tyrosine recombinase XerD/Ferric uptake regulation protein |
| RA | USA300TCH1516_ALE | 1,615,309 | A→T | 5.2% | intergenic (‑39/+10) | xerD_3 ← / ← fur | Tyrosine recombinase XerD/Ferric uptake regulation protein |
| RA | USA300TCH1516_ALE | 1,622,775 | A→T | 9.5% | K43* (AAA→TAA) | marA → | Multiple antibiotic resistance protein MarA |
| RA | USA300TCH1516_ALE | 1,646,189 | G→C | 100% | A155G (GCA→GGA) | ypdF ← | Aminopeptidase YpdF |
| RA | USA300TCH1516_ALE | 1,653,327 | A→G | 8.3% | intergenic (‑32/+127) | gcvT ← / ← aroK | Aminomethyltransferase/Shikimate kinase |
| RA | USA300TCH1516_ALE | 1,653,332 | A→G | 10.7% | intergenic (‑37/+122) | gcvT ← / ← aroK | Aminomethyltransferase/Shikimate kinase |
| RA | USA300TCH1516_ALE | 1,653,335 | C→T | 9.8% | intergenic (‑40/+119) | gcvT ← / ← aroK | Aminomethyltransferase/Shikimate kinase |
| RA | USA300TCH1516_ALE | 1,653,340 | C→T | 8.7% | intergenic (‑45/+114) | gcvT ← / ← aroK | Aminomethyltransferase/Shikimate kinase |
| RA | USA300TCH1516_ALE | 1,662,039 | T→A | 7.0% | intergenic (‑126/+29) | USA300HOU_RS08275 ← / ← rpmG2_2 | 5‑formyltetrahydrofolate cyclo‑ligase/50S ribosomal protein L33 2 |
| RA | USA300TCH1516_ALE | 1,678,274 | T→C | 6.3% | intergenic (+20/+130) | glyQS → / ← recO | Glycine‑‑tRNA ligase/DNA repair protein RecO |
| RA | USA300TCH1516_ALE | 1,678,277 | G→A | 6.4% | intergenic (+23/+127) | glyQS → / ← recO | Glycine‑‑tRNA ligase/DNA repair protein RecO |
| RA | USA300TCH1516_ALE | 1,678,358 | A→G | 5.5% | intergenic (+104/+46) | glyQS → / ← recO | Glycine‑‑tRNA ligase/DNA repair protein RecO |
| RA | USA300TCH1516_ALE | 1,678,362 | A→C | 5.1% | intergenic (+108/+42) | glyQS → / ← recO | Glycine‑‑tRNA ligase/DNA repair protein RecO |
| RA | USA300TCH1516_ALE | 1,678,369 | T→G | 5.1% | intergenic (+115/+35) | glyQS → / ← recO | Glycine‑‑tRNA ligase/DNA repair protein RecO |
| RA | USA300TCH1516_ALE | 1,685,148 | C→T | 6.3% | intergenic (‑160/+60) | USA300HOU_RS08395 ← / ← rpsU | hypothetical protein/30S ribosomal protein S21 |
| RA | USA300TCH1516_ALE | 1,685,149 | T→A | 6.5% | intergenic (‑161/+59) | USA300HOU_RS08395 ← / ← rpsU | hypothetical protein/30S ribosomal protein S21 |
| RA | USA300TCH1516_ALE | 1,702,671 | G→C | 10.2% | I117M (ATC→ATG) | tylM1 ← | dTDP‑3‑amino‑3,6‑dideoxy‑alpha‑D‑glucopyranose N,N‑dimethyltransferase |
| RA | USA300TCH1516_ALE | 1,702,674 | G→C | 10.2% | F116L (TTC→TTG) | tylM1 ← | dTDP‑3‑amino‑3,6‑dideoxy‑alpha‑D‑glucopyranose N,N‑dimethyltransferase |
| RA | USA300TCH1516_ALE | 1,722,313 | G→A | 9.2% | Q3* (CAA→TAA) | yrrK ← | Putative pre‑16S rRNA nuclease |
| RA | USA300TCH1516_ALE | 1,722,314 | T→C | 9.7% | L2L (TTA→TTG) | yrrK ← | Putative pre‑16S rRNA nuclease |
| RA | USA300TCH1516_ALE | 1,744,362 | G→A | 57.0% | H104Y (CAC→TAC) | apt ← | Adenine phosphoribosyltransferase |
| RA | USA300TCH1516_ALE | 1,744,476 | C→G | 21.1% | V66L (GTA→CTA) | apt ← | Adenine phosphoribosyltransferase |
| RA | USA300TCH1516_ALE | 1,761,889 | C→A | 57.4% | D388Y (GAT→TAT) | fpgS ← | Folylpolyglutamate synthase |
| RA | USA300TCH1516_ALE | 1,776,634 | C→T | 6.7% | intergenic (‑111/+40) | clpX ← / ← tig | ATP‑dependent Clp protease ATP‑binding subunit ClpX/Trigger factor |
| RA | USA300TCH1516_ALE | 1,779,807 | A→G | 15.5% | intergenic (‑113/+29) | USA300TCH1516_01664 ← / ← rplT | hypothetical protein/50S ribosomal protein L20 |
| RA | USA300TCH1516_ALE | 1,779,810 | A→T | 14.8% | intergenic (‑116/+26) | USA300TCH1516_01664 ← / ← rplT | hypothetical protein/50S ribosomal protein L20 |
| RA | USA300TCH1516_ALE | 1,779,813 | C→T | 16.2% | intergenic (‑119/+23) | USA300TCH1516_01664 ← / ← rplT | hypothetical protein/50S ribosomal protein L20 |
| RA | USA300TCH1516_ALE | 1,789,551 | C→T | 9.2% | intergenic (‑32/+138) | gapA2 ← / ← coaE | Glyceraldehyde‑3‑phosphate dehydrogenase 2/Dephospho‑CoA kinase |
| RA | USA300TCH1516_ALE | 1,794,352 | A→T | 6.1% | Y426N (TAT→AAT) | USA300HOU_RS08960 ← | hypothetical protein |
| RA | USA300TCH1516_ALE | 1,805,818 | T→A | 6.9% | L431F (TTA→TTT) | pyk ← | Pyruvate kinase |
| RA | USA300TCH1516_ALE | 1,870,863 | C→T | 5.6% | intergenic (‑350/+200) | srkA ← / ← dat | Stress response kinase A/D‑alanine aminotransferase |
| RA | USA300TCH1516_ALE | 1,870,864 | A→G | 5.6% | intergenic (‑351/+199) | srkA ← / ← dat | Stress response kinase A/D‑alanine aminotransferase |
| RA | USA300TCH1516_ALE | 1,885,368 | G→A | 7.0% | intergenic (‑150/+176) | ebh_2 ← / ← moeZ_2 | Extracellular matrix‑binding protein ebh/putative adenylyltransferase/sulfurtransferase MoeZ |
| RA | USA300TCH1516_ALE | 1,885,369 | T→C | 5.3% | intergenic (‑151/+175) | ebh_2 ← / ← moeZ_2 | Extracellular matrix‑binding protein ebh/putative adenylyltransferase/sulfurtransferase MoeZ |
| RA | USA300TCH1516_ALE | 1,899,097 | C→G | 6.3% | intergenic (‑88/+405) | ribD ← / ← USA300HOU_RS09405 | Riboflavin biosynthesis protein RibD/hypothetical protein |
| RA | USA300TCH1516_ALE | 1,904,152 | C→A | 11.4% | A182S (GCC→TCC) | atl_2 ← | Bifunctional autolysin |
| RA | USA300TCH1516_ALE | 1,905,775 | G→C | 12.3% | E128Q (GAA→CAA) | sigS → | RNA polymerase sigma factor SigS |
| RA | USA300TCH1516_ALE | 1,934,773 | T→A | 6.0% | K159* (AAA→TAA) | USA300HOU_RS09605 ← | hypothetical protein |
| RA | USA300TCH1516_ALE | 1,934,780 | A→T | 6.0% | N156K (AAT→AAA) | USA300HOU_RS09605 ← | hypothetical protein |
| RA | USA300TCH1516_ALE | 1,962,395 | A→G | 5.0% | intergenic (‑284/+188) | USA300TCH1516_01825 ← / ← ydeN | tRNA‑Met/Putative hydrolase YdeN |
| RA | USA300TCH1516_ALE | 1,962,405 | C→T | 5.5% | intergenic (‑294/+178) | USA300TCH1516_01825 ← / ← ydeN | tRNA‑Met/Putative hydrolase YdeN |
| RA | USA300TCH1516_ALE | 1,963,768 | C→G | 53.7% | V365L (GTA→CTA) | hemY ← | Protoporphyrinogen oxidase |
| RA | USA300TCH1516_ALE | 1,984,315 | A→T | 5.4% | E213D (GAA→GAT) | rluD_3 → | Ribosomal large subunit pseudouridine synthase D |
| RA | USA300TCH1516_ALE | 1,984,316 | A→T | 5.4% | I214F (ATC→TTC) | rluD_3 → | Ribosomal large subunit pseudouridine synthase D |
| RA | USA300TCH1516_ALE | 2,010,363 | C→T | 100% | C146Y (TGT→TAT) | USA300HOU_RS10125 ← | Putative multidrug export ATP‑binding/permease protein |
| RA | USA300TCH1516_ALE | 2,033,564 | C→T | 6.1% | R382Q (CGA→CAA) | murF_1 ← | UDP‑N‑acetylmuramoyl‑tripeptide‑‑D‑alanyl‑D‑ alanine ligase |
| RA | USA300TCH1516_ALE | 2,033,567 | A→G | 6.3% | L381S (TTG→TCG) | murF_1 ← | UDP‑N‑acetylmuramoyl‑tripeptide‑‑D‑alanyl‑D‑ alanine ligase |
| RA | USA300TCH1516_ALE | 2,042,100 | T→A | 6.5% | K338N (AAA→AAT) | gatB_2 ← | Aspartyl/glutamyl‑tRNA(Asn/Gln) amidotransferase subunit B |
| RA | USA300TCH1516_ALE | 2,046,831 | A→G | 5.8% | intergenic (+39/+50) | putP → / ← USA300HOU_RS10335 | Sodium/proline symporter/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,046,835 | A→T | 5.9% | intergenic (+43/+46) | putP → / ← USA300HOU_RS10335 | Sodium/proline symporter/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,046,840 | A→T | 5.9% | intergenic (+48/+41) | putP → / ← USA300HOU_RS10335 | Sodium/proline symporter/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,046,844 | C→T | 6.0% | intergenic (+52/+37) | putP → / ← USA300HOU_RS10335 | Sodium/proline symporter/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,049,164 | C→A | 8.8% | E311D (GAG→GAT) | ligA ← | DNA ligase |
| RA | USA300TCH1516_ALE | 2,050,876 | A→G | 5.0% | L473L (TTA→CTA) | pcrA ← | ATP‑dependent DNA helicase PcrA |
| RA | USA300TCH1516_ALE | 2,072,011:1 | +A | 6.6% | intergenic (+506/+67) | USA300HOU_RS10445 → / ← USA300HOU_RS10450 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,072,028 | Δ1 bp | 5.8% | intergenic (+523/+50) | USA300HOU_RS10445 → / ← USA300HOU_RS10450 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,077,620 | T→G | 7.9% | L174L (CTA→CTC) | yxlF_3 ← | putative ABC transporter ATP‑binding protein YxlF |
| RA | USA300TCH1516_ALE | 2,077,629 | C→A | 6.8% | M171I (ATG→ATT) | yxlF_3 ← | putative ABC transporter ATP‑binding protein YxlF |
| RA | USA300TCH1516_ALE | 2,123,544 | T→A | 6.2% | N66I (AAT→ATT) | USA300HOU_RS10825 ← | hypothetical protein |
| RA | USA300TCH1516_ALE | 2,123,779 | T→A | 9.9% | intergenic (‑39/‑94) | USA300HOU_RS10825 ← / → lexA_2 | hypothetical protein/LexA repressor |
| RA | USA300TCH1516_ALE | 2,129,368 | A→G | 5.7% | intergenic (+201/+37) | hlb_2 → / ← USA300HOU_RS10870 | Phospholipase C/putative leukocidin‑like protein 1 |
| RA | USA300TCH1516_ALE | 2,129,372 | A→G | 5.4% | intergenic (+205/+33) | hlb_2 → / ← USA300HOU_RS10870 | Phospholipase C/putative leukocidin‑like protein 1 |
| RA | USA300TCH1516_ALE | 2,165,416 | A→T | 7.8% | intergenic (‑384/‑94) | tsaE ← / → ilvD | tRNA threonylcarbamoyladenosine biosynthesis protein TsaE/Dihydroxy‑acid dehydratase |
| RA | USA300TCH1516_ALE | 2,172,067:1 | +G | 14.4% | coding (116/1047 nt) | leuB → | 3‑isopropylmalate dehydrogenase |
| RA | USA300TCH1516_ALE | 2,172,075 | G→C | 15.3% | E42Q (GAA→CAA) | leuB → | 3‑isopropylmalate dehydrogenase |
| RA | USA300TCH1516_ALE | 2,172,078 | T→A | 14.7% | F43I (TTT→ATT) | leuB → | 3‑isopropylmalate dehydrogenase |
| RA | USA300TCH1516_ALE | 2,172,081 | G→C | 12.7% | G44R (GGT→CGT) | leuB → | 3‑isopropylmalate dehydrogenase |
| RA | USA300TCH1516_ALE | 2,172,088 | Δ1 bp | 10.9% | coding (137/1047 nt) | leuB → | 3‑isopropylmalate dehydrogenase |
| RA | USA300TCH1516_ALE | 2,243,494 | A→T | 12.7% | intergenic (+72/+37) | USA300HOU_RS11475 → / ← pyrG | hypothetical protein/CTP synthase |
| RA | USA300TCH1516_ALE | 2,243,499 | T→A | 19.3% | intergenic (+77/+32) | USA300HOU_RS11475 → / ← pyrG | hypothetical protein/CTP synthase |
| RA | USA300TCH1516_ALE | 2,243,504 | A→T | 17.6% | intergenic (+82/+27) | USA300HOU_RS11475 → / ← pyrG | hypothetical protein/CTP synthase |
| RA | USA300TCH1516_ALE | 2,256,968 | T→A | 9.7% | intergenic (‑57/+143) | dps ← / ← USA300HOU_RS11555 | General stress protein 20U/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,273,758 | A→T | 5.2% | G228G (GGA→GGT) | mtlA → | PTS system mannitol‑specific EIICB component |
| RA | USA300TCH1516_ALE | 2,273,764 | T→G | 6.0% | G230G (GGT→GGG) | mtlA → | PTS system mannitol‑specific EIICB component |
| RA | USA300TCH1516_ALE | 2,275,551 | A→G | 7.8% | T302A (ACA→GCA) ‡ | mtlR → | Transcriptional regulator MtlR |
| RA | USA300TCH1516_ALE | 2,275,552 | C→T | 8.0% | T302I (ACA→ATA) ‡ | mtlR → | Transcriptional regulator MtlR |
| RA | USA300TCH1516_ALE | 2,279,705 | G→A | 100% | A943V (GCA→GTA) | ebh_3 ← | Extracellular matrix‑binding protein ebh |
| RA | USA300TCH1516_ALE | 2,309,793:1 | +G | 8.6% | coding (76/1032 nt) | yfiZ_2 ← | putative siderophore transport system permease protein YfiZ |
| RA | USA300TCH1516_ALE | 2,309,800 | Δ1 bp | 12.0% | coding (69/1032 nt) | yfiZ_2 ← | putative siderophore transport system permease protein YfiZ |
| RA | USA300TCH1516_ALE | 2,309,807 | Δ1 bp | 10.0% | coding (62/1032 nt) | yfiZ_2 ← | putative siderophore transport system permease protein YfiZ |
| RA | USA300TCH1516_ALE | 2,328,872 | G→C | 6.6% | F264L (TTC→TTG) | lacE ← | PTS system lactose‑specific EIICB component |
| RA | USA300TCH1516_ALE | 2,352,654 | C→T | 6.5% | intergenic (‑508/+37) | USA300HOU_RS12000 ← / ← rpsI | hypothetical protein/30S ribosomal protein S9 |
| RA | USA300TCH1516_ALE | 2,352,657 | A→T | 7.0% | intergenic (‑511/+34) | USA300HOU_RS12000 ← / ← rpsI | hypothetical protein/30S ribosomal protein S9 |
| RA | USA300TCH1516_ALE | 2,352,660 | A→G | 7.2% | intergenic (‑514/+31) | USA300HOU_RS12000 ← / ← rpsI | hypothetical protein/30S ribosomal protein S9 |
| RA | USA300TCH1516_ALE | 2,352,815 | G→A | 53.0% | A92V (GCA→GTA) | rpsI ← | 30S ribosomal protein S9 |
| RA | USA300TCH1516_ALE | 2,372,407 | A→G | 16.9% | intergenic (+158/+34) | USA300TCH1516_02262 → / ← pbuG | hypothetical protein/Guanine/hypoxanthine permease PbuG |
| RA | USA300TCH1516_ALE | 2,372,413 | C→G | 20.7% | intergenic (+164/+28) | USA300TCH1516_02262 → / ← pbuG | hypothetical protein/Guanine/hypoxanthine permease PbuG |
| RA | USA300TCH1516_ALE | 2,372,419 | C→T | 20.8% | intergenic (+170/+22) | USA300TCH1516_02262 → / ← pbuG | hypothetical protein/Guanine/hypoxanthine permease PbuG |
| RA | USA300TCH1516_ALE | 2,378,334 | T→G | 5.4% | intergenic (+193/+226) | glcU_2 → / ← USA300HOU_RS12220 | putative glucose uptake protein GlcU/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,378,337 | G→T | 6.4% | intergenic (+196/+223) | glcU_2 → / ← USA300HOU_RS12220 | putative glucose uptake protein GlcU/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,387,416 | G→C | 5.8% | V121V (GTG→GTC) | ribZ_1 → | Riboflavin transporter RibZ |
| RA | USA300TCH1516_ALE | 2,424,608 | A→G | 8.1% | intergenic (‑166/+62) | USA300HOU_RS12490 ← / ← USA300HOU_RS12495 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,424,609 | C→T | 7.9% | intergenic (‑167/+61) | USA300HOU_RS12490 ← / ← USA300HOU_RS12495 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,429,717 | T→A | 13.5% | intergenic (‑71/+62) | lytR_2 ← / ← suhB_2 | Transcriptional regulator LytR/Inositol‑1‑monophosphatase |
| RA | USA300TCH1516_ALE | 2,430,691:1 | +A | 9.7% | intergenic (‑115/‑270) | suhB_2 ← / → birA_2 | Inositol‑1‑monophosphatase/Bifunctional ligase/repressor BirA |
| RA | USA300TCH1516_ALE | 2,432,237 | C→T | 5.3% | intergenic (+584/+63) | birA_2 → / ← USA300HOU_RS12525 | Bifunctional ligase/repressor BirA/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,432,240 | A→T | 5.7% | intergenic (+587/+60) | birA_2 → / ← USA300HOU_RS12525 | Bifunctional ligase/repressor BirA/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,432,243 | A→T | 5.8% | intergenic (+590/+57) | birA_2 → / ← USA300HOU_RS12525 | Bifunctional ligase/repressor BirA/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,432,246 | A→G | 5.7% | intergenic (+593/+54) | birA_2 → / ← USA300HOU_RS12525 | Bifunctional ligase/repressor BirA/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,435,507 | A→C | 9.3% | L331W (TTG→TGG) | yifK ← | putative transport protein YifK |
| RA | USA300TCH1516_ALE | 2,435,510 | G→T | 9.0% | P330Q (CCA→CAA) | yifK ← | putative transport protein YifK |
| RA | USA300TCH1516_ALE | 2,448,484 | A→G | 12.5% | intergenic (‑243/+34) | yxeP_4 ← / ← hutI | putative hydrolase YxeP/Imidazolonepropionase |
| RA | USA300TCH1516_ALE | 2,448,493 | C→T | 16.6% | intergenic (‑252/+25) | yxeP_4 ← / ← hutI | putative hydrolase YxeP/Imidazolonepropionase |
| RA | USA300TCH1516_ALE | 2,448,498 | C→T | 15.2% | intergenic (‑257/+20) | yxeP_4 ← / ← hutI | putative hydrolase YxeP/Imidazolonepropionase |
| RA | USA300TCH1516_ALE | 2,454,626 | A→T | 44.3% | L48L (CTA→CTT) | lyrA → | Lysostaphin resistance protein A |
| RA | USA300TCH1516_ALE | 2,494,035 | T→A | 5.9% | intergenic (‑61/+171) | USA300HOU_RS12835 ← / ← USA300HOU_RS12845 | Ferredoxin‑‑NADP reductase/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,497,391 | C→G | 9.1% | N147K (AAC→AAG) | USA300HOU_RS12865 → | hypothetical protein |
| RA | USA300TCH1516_ALE | 2,513,975 | C→T | 5.7% | R54Q (CGA→CAA) | USA300HOU_RS12940 ← | hypothetical protein |
| RA | USA300TCH1516_ALE | 2,517,775 | A→C | 12.9% | S953A (TCA→GCA) | narG ← | Respiratory nitrate reductase 1 alpha chain |
| RA | USA300TCH1516_ALE | 2,517,782 | T→A | 15.2% | L950L (CTA→CTT) | narG ← | Respiratory nitrate reductase 1 alpha chain |
| RA | USA300TCH1516_ALE | 2,517,789 | G→T | 10.4% | A948E (GCA→GAA) | narG ← | Respiratory nitrate reductase 1 alpha chain |
| RA | USA300TCH1516_ALE | 2,530,786 | A→G | 11.1% | intergenic (‑37/+236) | yefM ← / ← bdbD | Antitoxin YefM/Disulfide bond formation protein D |
| RA | USA300TCH1516_ALE | 2,530,791 | C→T | 8.5% | intergenic (‑42/+231) | yefM ← / ← bdbD | Antitoxin YefM/Disulfide bond formation protein D |
| RA | USA300TCH1516_ALE | 2,532,298 | A→T | 100% | T15T (ACA→ACT) | femA_3 → | Aminoacyltransferase FemA |
| RA | USA300TCH1516_ALE | 2,552,027 | Δ1 bp | 5.8% | coding (1215/1734 nt) | USA300HOU_RS13150 ← | putative ABC transporter ATP‑binding protein |
| RA | USA300TCH1516_ALE | 2,552,031:1 | +G | 6.2% | coding (1211/1734 nt) | USA300HOU_RS13150 ← | putative ABC transporter ATP‑binding protein |
| RA | USA300TCH1516_ALE | 2,559,830 | A→G | 5.7% | intergenic (+24/+99) | bcr_2 → / ← USA300HOU_RS13190 | Bicyclomycin resistance protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,559,831 | G→A | 6.3% | intergenic (+25/+98) | bcr_2 → / ← USA300HOU_RS13190 | Bicyclomycin resistance protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,559,840 | T→G | 7.1% | intergenic (+34/+89) | bcr_2 → / ← USA300HOU_RS13190 | Bicyclomycin resistance protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,559,841 | C→A | 7.1% | intergenic (+35/+88) | bcr_2 → / ← USA300HOU_RS13190 | Bicyclomycin resistance protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,563,759 | A→G | 10.2% | intergenic (+24/‑114) | cycA_2 → / → nhaK_2 | D‑serine/D‑alanine/glycine transporter/Sodium, potassium, lithium and rubidium/H(+) antiporter |
| RA | USA300TCH1516_ALE | 2,563,763 | C→G | 8.1% | intergenic (+28/‑110) | cycA_2 → / → nhaK_2 | D‑serine/D‑alanine/glycine transporter/Sodium, potassium, lithium and rubidium/H(+) antiporter |
| RA | USA300TCH1516_ALE | 2,582,141 | Δ1 bp | 7.7% | coding (1169/1353 nt) | pnbA → | Para‑nitrobenzyl esterase |
| RA | USA300TCH1516_ALE | 2,582,146:1 | +A | 14.7% | coding (1174/1353 nt) | pnbA → | Para‑nitrobenzyl esterase |
| RA | USA300TCH1516_ALE | 2,600,622:1 | +A | 8.8% | intergenic (‑34/+833) | dapF ← / ← USA300HOU_RS13395 | Diaminopimelate epimerase/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,600,629 | T→A | 5.9% | intergenic (‑41/+826) | dapF ← / ← USA300HOU_RS13395 | Diaminopimelate epimerase/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,600,630 | T→A | 5.9% | intergenic (‑42/+825) | dapF ← / ← USA300HOU_RS13395 | Diaminopimelate epimerase/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,608,825 | A→T | 11.7% | intergenic (+106/+154) | USA300TCH1516_02485 → / ← USA300HOU_RS13450 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,656,546 | A→T | 5.2% | intergenic (‑41/+37) | mhqA_3 ← / ← mhqR | Putative ring‑cleaving dioxygenase MhqA/HTH‑type transcriptional regulator MhqR |
| RA | USA300TCH1516_ALE | 2,656,547 | A→T | 5.2% | intergenic (‑42/+36) | mhqA_3 ← / ← mhqR | Putative ring‑cleaving dioxygenase MhqA/HTH‑type transcriptional regulator MhqR |
| RA | USA300TCH1516_ALE | 2,668,296 | A→C | 5.3% | intergenic (‑105/‑446) | USA300HOU_RS13735 ← / → USA300TCH1516_02539 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,668,298 | G→C | 5.3% | intergenic (‑107/‑444) | USA300HOU_RS13735 ← / → USA300TCH1516_02539 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,668,300 | G→T | 5.3% | intergenic (‑109/‑442) | USA300HOU_RS13735 ← / → USA300TCH1516_02539 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,725,352 | A→T | 11.3% | intergenic (‑58/+276) | USA300HOU_RS14015 ← / ← USA300HOU_RS14020 | Baeyer‑Villiger flavin‑containing monooxygenase/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,744,200 | G→A | 9.7% | intergenic (+137/+56) | fda → / ← mqo2 | Fructose‑bisphosphate aldolase class 1/putative malate:quinone oxidoreductase 2 |
| RA | USA300TCH1516_ALE | 2,744,205 | A→G | 13.8% | intergenic (+142/+51) | fda → / ← mqo2 | Fructose‑bisphosphate aldolase class 1/putative malate:quinone oxidoreductase 2 |
| RA | USA300TCH1516_ALE | 2,744,213 | T→A | 15.3% | intergenic (+150/+43) | fda → / ← mqo2 | Fructose‑bisphosphate aldolase class 1/putative malate:quinone oxidoreductase 2 |
| RA | USA300TCH1516_ALE | 2,745,325 | T→A | 5.6% | N143I (AAT→ATT) | mqo2 ← | putative malate:quinone oxidoreductase 2 |
| RA | USA300TCH1516_ALE | 2,754,728 | A→G | 5.4% | intergenic (‑135/+129) | gloB ← / ← opuD_3 | Hydroxyacylglutathione hydrolase/Glycine betaine transporter OpuD |
| RA | USA300TCH1516_ALE | 2,754,732 | A→T | 5.7% | intergenic (‑139/+125) | gloB ← / ← opuD_3 | Hydroxyacylglutathione hydrolase/Glycine betaine transporter OpuD |
| RA | USA300TCH1516_ALE | 2,783,163 | T→A | 9.0% | intergenic (‑68/+279) | arcA_2 ← / ← argR_3 | Arginine deiminase/Arginine repressor |
| RA | USA300TCH1516_ALE | 2,783,168 | T→A | 5.6% | intergenic (‑73/+274) | arcA_2 ← / ← argR_3 | Arginine deiminase/Arginine repressor |
| RA | USA300TCH1516_ALE | 2,817,612 | G→A | 5.4% | R239R (CGC→CGT) | sraP ← | Serine‑rich adhesin for platelets |
| RA | USA300TCH1516_ALE | 2,825,587 | C→T | 6.1% | intergenic (‑402/+446) | cap8A_2 ← / ← icaR | Capsular polysaccharide type 8 biosynthesis protein cap8A/Biofilm operon icaADBC HTH‑type negative transcriptional regulator IcaR |
| RA | USA300TCH1516_ALE | 2,833,387 | G→C | 9.9% | intergenic (‑723/+367) | lipA_2 ← / ← hisI | Lipase 1/Phosphoribosyl‑AMP cyclohydrolase |
| RA | USA300TCH1516_ALE | 2,840,323 | T→A | 6.5% | L119F (TTA→TTT) | hisZ ← | ATP phosphoribosyltransferase regulatory subunit |
| RA | USA300TCH1516_ALE | 2,847,006 | G→C | 15.1% | intergenic (‑210/‑170) | salL ← / → yceI | Adenosyl‑chloride synthase/Protein YceI |
| RA | USA300TCH1516_ALE | 2,852,974:1 | +T | 11.4% | coding (91/1419 nt) | yflS → | Putative malate transporter YflS |
| RA | USA300TCH1516_ALE | 2,861,759 | C→T | 10.8% | A481V (GCA→GTA) | bceB_3 → | Bacitracin export permease protein BceB |
| Unassigned new junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | CP000731 | 1 = | 0 (0.000) | 6 (0.020) +25 bp |
5/110 | NT | 6.6% | intergenic (–/‑231) | –/repA | –/replication protein A |
| ? | CP000731 | 26987 = | 249 (0.710) | intergenic (‑140/–) | USA300HOU_pUSA300HOUMR0033/– | partitioning protein/– | |||||
| * | ? | CP000731 | = 64 | 267 (0.760) | 36 (0.170) +33 bp |
12/94 | NT | 31.5% | intergenic (–/‑168) | –/repA | –/replication protein A |
| ? | CP000731 | = 27041 | 0 (0.000) | intergenic (‑194/–) | USA300HOU_pUSA300HOUMR0033/– | partitioning protein/– | |||||
| * | ? | CP000731 | = 198 | 386 (1.100) | 24 (0.070) | 7/146 | NT | 6.1% | intergenic (–/‑34) | –/repA | –/replication protein A |
| ? | CP000731 | = 216 | 393 (1.230) | intergenic (–/‑16) | –/repA | –/replication protein A | |||||
| * | ? | CP000731 | = 648 | 447 (1.270) | 22 (0.070) | 12/148 | NT | 5.1% | coding (417/984 nt) | repA | replication protein A |
| ? | CP000731 | = 720 | 404 (1.250) | coding (489/984 nt) | repA | replication protein A | |||||
| * | ? | CP000731 | 1668 = | 288 (0.820) | 17 (0.050) | 7/160 | NT | 5.0% | intergenic (+453/‑403) | repA/USA300HOU_pUSA300HOUMR0003 | replication protein A/hypothetical protein |
| ? | CP000731 | 1685 = | 356 (1.020) | intergenic (+470/‑386) | repA/USA300HOU_pUSA300HOUMR0003 | replication protein A/hypothetical protein | |||||
| * | ? | CP000731 | = 1692 | 388 (1.110) | 21 (0.070) | 7/144 | NT | 5.4% | intergenic (+477/‑379) | repA/USA300HOU_pUSA300HOUMR0003 | replication protein A/hypothetical protein |
| ? | CP000731 | = 1696 | 387 (1.230) | intergenic (+481/‑375) | repA/USA300HOU_pUSA300HOUMR0003 | replication protein A/hypothetical protein | |||||
| * | ? | CP000731 | 3772 = | 213 (0.610) | 40 (0.130) | 14/140 | NT | 17.3% | intergenic (+388/‑96) | USA300HOU_pUSA300HOUMR0005/USA300HOU_pUSA300HOUMR0006 | hypothetical protein/hypothetical protein |
| ? | CP000731 | 3805 = | 195 (0.640) | intergenic (+421/‑63) | USA300HOU_pUSA300HOUMR0005/USA300HOU_pUSA300HOUMR0006 | hypothetical protein/hypothetical protein | |||||
| * | ? | CP000731 | = 3781 | 215 (0.610) | 35 (0.110) | 13/140 | NT | 15.4% | intergenic (+397/‑87) | USA300HOU_pUSA300HOUMR0005/USA300HOU_pUSA300HOUMR0006 | hypothetical protein/hypothetical protein |
| ? | CP000731 | = 3794 | 195 (0.640) | intergenic (+410/‑74) | USA300HOU_pUSA300HOUMR0005/USA300HOU_pUSA300HOUMR0006 | hypothetical protein/hypothetical protein | |||||
| * | ? | CP000731 | = 7672 | 331 (0.940) | 42 (0.140) | 13/138 | NT | 12.0% | intergenic (+282/+244) | USA300HOU_pUSA300HOUMR0010/blaZ | MarR family transcriptional regulator/beta‑lactamase |
| ? | CP000731 | = 7688 | 331 (1.090) | intergenic (+298/+228) | USA300HOU_pUSA300HOUMR0010/blaZ | MarR family transcriptional regulator/beta‑lactamase | |||||
| * | ? | CP000731 | 11093 = | 374 (1.070) | 58 (0.180) | 13/146 | NT | 15.9% | intergenic (+98/‑166) | blaI/USA300HOU_pUSA300HOUMR0014 | beta‑lactamase regulator BlaI/recombinase |
| ? | CP000731 | 11129 = | 270 (0.840) | intergenic (+134/‑130) | blaI/USA300HOU_pUSA300HOUMR0014 | beta‑lactamase regulator BlaI/recombinase | |||||
| * | ? | CP000731 | 11951 = | 356 (1.020) | 33 (0.110) | 12/134 | NT | 10.7% | intergenic (+114/+109) | USA300HOU_pUSA300HOUMR0014/USA300HOU_pUSA300HOUMR0015 | recombinase/hypothetical protein |
| ? | CP000731 | 11987 = | 254 (0.860) | intergenic (+150/+73) | USA300HOU_pUSA300HOUMR0014/USA300HOU_pUSA300HOUMR0015 | recombinase/hypothetical protein | |||||
| * | ? | CP000731 | = 12646 | 80 (0.230) | 13 (0.040) | 8/146 | NT | 15.1% | coding (140/675 nt) | USA300HOU_pUSA300HOUMR0016 | IS257 transposase |
| ? | CP000731 | = 12648 | NA (NA) | coding (142/675 nt) | USA300HOU_pUSA300HOUMR0016 | IS257 transposase | |||||
| * | ? | CP000731 | = 12916 | NA (NA) | 24 (0.070) | 11/148 | NT | NA | coding (410/675 nt) | USA300HOU_pUSA300HOUMR0016 | IS257 transposase |
| ? | CP000731 | = 12919 | NA (NA) | coding (413/675 nt) | USA300HOU_pUSA300HOUMR0016 | IS257 transposase | |||||
| * | ? | CP000731 | 16918 = | NA (NA) | 8 (0.020) | 3/150 | NT | 100% | coding (144/675 nt) | USA300HOU_pUSA300HOUMR0021 | IS431 mec transposase |
| ? | CP000731 | 16924 = | 0 (0.000) | coding (138/675 nt) | USA300HOU_pUSA300HOUMR0021 | IS431 mec transposase | |||||
| * | ? | CP000731 | 17008 = | NA (NA) | 27 (0.080) | 14/148 | NT | 100% | coding (54/675 nt) | USA300HOU_pUSA300HOUMR0021 | IS431 mec transposase |
| ? | CP000731 | 17011 = | 0 (0.000) | coding (51/675 nt) | USA300HOU_pUSA300HOUMR0021 | IS431 mec transposase | |||||
| * | ? | CP000731 | = 17199 | 253 (0.720) | 20 (0.070) | 11/138 | NT | 7.8% | intergenic (‑138/+109) | USA300HOU_pUSA300HOUMR0021/USA300HOU_pUSA300HOUMR0023 | IS431 mec transposase/bacitracin ABC ATP binding cassette transporter, membrane protein |
| ? | CP000731 | = 17213 | 254 (0.840) | intergenic (‑152/+95) | USA300HOU_pUSA300HOUMR0021/USA300HOU_pUSA300HOUMR0023 | IS431 mec transposase/bacitracin ABC ATP binding cassette transporter, membrane protein | |||||
| * | ? | CP000731 | = 17565 | 310 (0.880) | 16 (0.050) | 10/146 | NT | 5.5% | coding (481/738 nt) | USA300HOU_pUSA300HOUMR0023 | bacitracin ABC ATP binding cassette transporter, membrane protein |
| ? | CP000731 | = 17593 | 265 (0.830) | coding (453/738 nt) | USA300HOU_pUSA300HOUMR0023 | bacitracin ABC ATP binding cassette transporter, membrane protein | |||||
| * | ? | CP000731 | 20439 = | 327 (0.930) | 32 (0.100) | 14/148 | NT | 10.1% | coding (632/675 nt) | USA300HOU_pUSA300HOUMR0027 | IS431mec transposase |
| ? | CP000731 | 20463 = | 269 (0.830) | coding (608/675 nt) | USA300HOU_pUSA300HOUMR0027 | IS431mec transposase | |||||
| * | ? | CP000731 | = 21325 | 275 (0.780) | 14 (0.050) | 8/138 | NT | 5.1% | intergenic (‑255/‑219) | USA300HOU_pUSA300HOUMR0027/USA300HOU_pUSA300HOUMR0028 | IS431mec transposase/macrolide transporter |
| ? | CP000731 | = 21339 | 279 (0.920) | intergenic (‑269/‑205) | USA300HOU_pUSA300HOUMR0027/USA300HOU_pUSA300HOUMR0028 | IS431mec transposase/macrolide transporter | |||||
| * | ? | CP000731 | 22935 = | 341 (0.970) | 20 (0.060) | 10/146 | NT | 6.6% | coding (1392/1467 nt) | USA300HOU_pUSA300HOUMR0028 | macrolide transporter |
| ? | CP000731 | 22963 = | 253 (0.790) | coding (1420/1467 nt) | USA300HOU_pUSA300HOUMR0028 | macrolide transporter | |||||
| * | ? | CP000731 | = 25287 | 184 (0.520) | 12 (0.050) | 8/114 | NT | 7.6% | intergenic (+185/‑61) | USA300HOU_pUSA300HOUMR0030/USA300HOU_pUSA300HOUMR0031 | Sin recombinase/hypothetical protein |
| ? | CP000731 | = 25310 | 159 (0.640) | intergenic (+208/‑38) | USA300HOU_pUSA300HOUMR0030/USA300HOU_pUSA300HOUMR0031 | Sin recombinase/hypothetical protein | |||||
| * | ? | CP000731 | 25306 = | 167 (0.480) | 29 (0.100) | 11/138 | NT | 17.5% | intergenic (+204/‑42) | USA300HOU_pUSA300HOUMR0030/USA300HOU_pUSA300HOUMR0031 | Sin recombinase/hypothetical protein |
| ? | CP000731 | 25340 = | 130 (0.430) | intergenic (+238/‑8) | USA300HOU_pUSA300HOUMR0030/USA300HOU_pUSA300HOUMR0031 | Sin recombinase/hypothetical protein | |||||
| * | ? | NC_012417 | 1 = | 0 (0.000) | 279 (0.030) | 15/160 | NT | 19.7% | intergenic (–/‑279) | –/USA300HOU_RS14890 | –/replication protein |
| ? | NC_012417 | 3063 = | 2269 (0.230) | intergenic (‑389/–) | USA300HOU_RS14900/– | hypothetical protein/– | |||||
| * | ? | NC_012417 | = 500 | 5203 (0.520) | 262 (0.030) | 24/148 | NT | 5.1% | pseudogene (221/709 nt) | USA300HOU_RS14890 | replication protein |
| ? | NC_012417 | = 511 | 4987 (0.540) | pseudogene (232/709 nt) | USA300HOU_RS14890 | replication protein | |||||
| * | ? | NC_012417 | 987 = | 3888 (0.390) | 794 (0.090) | 29/138 | NT | 20.3% | pseudogene (708/709 nt) | USA300HOU_RS14890 | replication protein |
| ? | NC_012417 | 1013 = | 2877 (0.330) | coding (182/192 nt) | USA300HOU_RS15665 | hypothetical protein | |||||
| * | ? | NC_012417 | = 997 | 3489 (0.350) | 632 (0.070) | 58/138 | NT | 17.7% | intergenic (+9/+6) | USA300HOU_RS14890/USA300HOU_RS15665 | replication protein/hypothetical protein |
| ? | NC_012417 | = 1001 | 2877 (0.330) | intergenic (+13/+2) | USA300HOU_RS14890/USA300HOU_RS15665 | replication protein/hypothetical protein | |||||
| * | ? | NC_012417 | 1040 = | 1110 (0.110) | 199 (0.030) | 26/124 | NT | 16.6% | coding (155/192 nt) | USA300HOU_RS15665 | hypothetical protein |
| ? | NC_012417 | 1090 = | 1144 (0.150) | coding (105/192 nt) | USA300HOU_RS15665 | hypothetical protein | |||||
| * | ? | NC_012417 | = 1057 | 545 (0.050) | 427 (0.060) | 37/124 | NT | 35.3% | coding (138/192 nt) | USA300HOU_RS15665 | hypothetical protein |
| ? | NC_012417 | = 1071 | 1144 (0.150) | coding (124/192 nt) | USA300HOU_RS15665 | hypothetical protein | |||||
| * | ? | NC_012417 | = 1057 | 545 (0.050) | 89 (0.010) | 25/116 | NT | 8.9% | coding (138/192 nt) | USA300HOU_RS15665 | hypothetical protein |
| ? | NC_012417 | = 1103 | 1432 (0.200) | coding (92/192 nt) | USA300HOU_RS15665 | hypothetical protein | |||||
| * | ? | NC_012417 | 1172 = | 4257 (0.430) | 335 (0.040) | 38/148 | NT | 7.3% | coding (23/192 nt) | USA300HOU_RS15665 | hypothetical protein |
| ? | NC_012417 | 1187 = | 4514 (0.490) | coding (8/192 nt) | USA300HOU_RS15665 | hypothetical protein | |||||
| * | ? | NC_012417 | = 1195 | 4796 (0.480) | 475 (0.050) | 37/144 | NT | 9.4% | intergenic (‑1/‑384) | USA300HOU_RS15665/USA300HOU_RS14895 | hypothetical protein/hypothetical protein |
| ? | NC_012417 | = 1199 | 4795 (0.530) | intergenic (‑5/‑380) | USA300HOU_RS15665/USA300HOU_RS14895 | hypothetical protein/hypothetical protein | |||||
| * | ? | NC_012417 | = 1974 | 2842 (0.280) | 226 (0.030) | 29/138 | NT | 8.4% | intergenic (+207/+119) | USA300HOU_RS14895/USA300HOU_RS14900 | hypothetical protein/hypothetical protein |
| ? | NC_012417 | = 2041 | NA (NA) | intergenic (+274/+52) | USA300HOU_RS14895/USA300HOU_RS14900 | hypothetical protein/hypothetical protein | |||||
| * | ? | NC_012417 | 1975 = | NA (NA) | 276 (0.030) | 24/138 | NT | 12.3% | intergenic (+208/+118) | USA300HOU_RS14895/USA300HOU_RS14900 | hypothetical protein/hypothetical protein |
| ? | NC_012417 | 2042 = | 2275 (0.230) | intergenic (+275/+51) | USA300HOU_RS14895/USA300HOU_RS14900 | hypothetical protein/hypothetical protein | |||||
| * | ? | NC_012417 | = 1992 | 2238 (0.220) | 1026 (0.110) | 41/148 | NT | 36.5% | intergenic (+225/+101) | USA300HOU_RS14895/USA300HOU_RS14900 | hypothetical protein/hypothetical protein |
| ? | NC_012417 | = 2020 | 1505 (0.160) | intergenic (+253/+73) | USA300HOU_RS14895/USA300HOU_RS14900 | hypothetical protein/hypothetical protein | |||||
| * | ? | NC_012417 | 1993 = | NA (NA) | 542 (0.060) | 27/148 | NT | 28.0% | intergenic (+226/+100) | USA300HOU_RS14895/USA300HOU_RS14900 | hypothetical protein/hypothetical protein |
| ? | NC_012417 | 2021 = | 1505 (0.150) | intergenic (+254/+72) | USA300HOU_RS14895/USA300HOU_RS14900 | hypothetical protein/hypothetical protein | |||||
| * | ? | NC_012417 | 2143 = | 5513 (0.550) | 395 (0.040) | 30/148 | NT | 7.1% | coding (532/582 nt) | USA300HOU_RS14900 | hypothetical protein |
| ? | NC_012417 | 2161 = | 5288 (0.570) | coding (514/582 nt) | USA300HOU_RS14900 | hypothetical protein | |||||
| * | ? | NC_012417 | = 2937 | 5802 (0.580) | 1563 (0.170) | 53/150 | NT | 21.9% | intergenic (‑263/–) | USA300HOU_RS14900/– | hypothetical protein/– |
| ? | NC_012417 | = 2949 | 5721 (0.610) | intergenic (‑275/–) | USA300HOU_RS14900/– | hypothetical protein/– | |||||
| * | ? | NC_012417 | = 3069 | 2218 (0.220) | 315 (0.030) | 24/146 | NT | 23.7% | intergenic (‑395/–) | USA300HOU_RS14900/– | hypothetical protein/– |
| ? | NC_012417 | = 3118 | 0 (0.000) | intergenic (‑444/–) | USA300HOU_RS14900/– | hypothetical protein/– | |||||
| * | ? | USA300TCH1516_ALE | = 2161 | 76 (0.770) | 19 (0.200) | 12/152 | NT | 19.5% | intergenic (+256/‑22) | dnaA/dnaN | Chromosomal replication initiator protein DnaA/DNA polymerase III subunit beta |
| ? | USA300TCH1516_ALE | = 2172 | 85 (0.910) | intergenic (+267/‑11) | dnaA/dnaN | Chromosomal replication initiator protein DnaA/DNA polymerase III subunit beta | |||||
| * | ? | USA300TCH1516_ALE | 10273 = | 82 (0.830) | 4 (0.040) | 4/152 | NT | 5.6% | coding (322/813 nt) | nnrD | ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase |
| ? | USA300TCH1516_ALE | 10302 = | 57 (0.610) | coding (293/813 nt) | nnrD | ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase | |||||
| * | ? | USA300TCH1516_ALE | 12708 = | 103 (1.050) | 20 (0.220) | 17/146 | NT | 18.1% | intergenic (+274/‑105) | hutH/serS_1 | Histidine ammonia‑lyase/Serine‑‑tRNA ligase |
| ? | USA300TCH1516_ALE | 12737 = | 87 (0.970) | intergenic (+303/‑76) | hutH/serS_1 | Histidine ammonia‑lyase/Serine‑‑tRNA ligase | |||||
| * | ? | USA300TCH1516_ALE | = 22206 | 71 (0.720) | 5 (0.060) | 4/142 | NT | 6.8% | intergenic (+19/‑259) | dnaC/purA | Replicative DNA helicase/Adenylosuccinate synthetase |
| ? | USA300TCH1516_ALE | = 22224 | 74 (0.850) | intergenic (+37/‑241) | dnaC/purA | Replicative DNA helicase/Adenylosuccinate synthetase | |||||
| * | ? | USA300TCH1516_ALE | = 22769 | 94 (0.960) | 6 (0.060) | 5/152 | NT | 6.6% | coding (305/1284 nt) | purA | Adenylosuccinate synthetase |
| ? | USA300TCH1516_ALE | = 22794 | 81 (0.870) | coding (330/1284 nt) | purA | Adenylosuccinate synthetase | |||||
| * | ? | USA300TCH1516_ALE | 36113 = | NA (NA) | 7 (0.080) | 4/146 | NT | NA | coding (439/675 nt) | USA300HOU_RS00140 | hypothetical protein |
| ? | USA300TCH1516_ALE | 36164 = | NA (NA) | coding (388/675 nt) | USA300HOU_RS00140 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 42499 = | 102 (1.040) | 10 (0.130) | 8/124 | NT | 13.2% | coding (1467/1524 nt) | USA300TCH1516_00035 | hypothetical protein |
| ? | USA300TCH1516_ALE | 42544 = | 52 (0.680) | coding (1422/1524 nt) | USA300TCH1516_00035 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 42564 = | 51 (0.520) | 35 (0.470) +TACATTATAAAATACATATC |
9/120 | NT | 47.8% | coding (1402/1524 nt) | USA300TCH1516_00035 | hypothetical protein |
| ? | USA300TCH1516_ALE | 1803072 = | NA (NA) | coding (796/807 nt) | USA300HOU_RS12765 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 51234 = | 112 (1.140) | 5 (0.060) | 5/144 | NT | 5.1% | intergenic (‑32/‑107) | USA300HOU_RS00210/USA300HOU_RS00215 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 51274 = | 85 (0.960) | intergenic (‑72/‑67) | USA300HOU_RS00210/USA300HOU_RS00215 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 52489 = | 136 (1.380) | 7 (0.070) | 5/160 | NT | 7.3% | intergenic (+99/‑574) | USA300HOU_RS00215/USA300HOU_RS00220 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 52811 = | 41 (0.420) | intergenic (+421/‑252) | USA300HOU_RS00215/USA300HOU_RS00220 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 52495 = | NA (NA) | 4 (0.040) | 3/156 | NT | NA | intergenic (+105/‑568) | USA300HOU_RS00215/USA300HOU_RS00220 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 52882 = | NA (NA) | intergenic (+492/‑181) | USA300HOU_RS00215/USA300HOU_RS00220 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 57551 = | 118 (1.200) | 12 (0.140) | 10/144 | NT | 11.0% | coding (618/621 nt) | USA300HOU_RS00240 | hypothetical protein |
| ? | USA300TCH1516_ALE | 57600 = | 87 (0.980) | intergenic (+46/+871) | USA300HOU_RS00240/USA300TCH1516_00049 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 61689 | 128 (1.300) | 8 (0.090) | 3/146 | NT | 6.0% | intergenic (‑536/+35) | USA300HOU_RS00260/USA300TCH1516_00053 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 61720 | 136 (1.520) | intergenic (‑567/+4) | USA300HOU_RS00260/USA300TCH1516_00053 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 68692 = | 106 (1.080) | 7 (0.080) | 5/144 | NT | 7.1% | coding (808/852 nt) | USA300TCH1516_00061 | hypothetical protein |
| ? | USA300TCH1516_ALE | 68737 = | 89 (1.010) | intergenic (+1/+99) | USA300TCH1516_00061/arcC1_1 | hypothetical protein/Carbamate kinase 1 | |||||
| * | ? | USA300TCH1516_ALE | 75971 = | 69 (0.700) | 16 (0.200) | 11/128 | NT | 21.3% | intergenic (+29/‑244) | USA300HOU_RS00335/USA300HOU_RS00140 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 76020 = | 63 (0.800) | intergenic (+78/‑195) | USA300HOU_RS00335/USA300HOU_RS00140 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 75986 | 68 (0.690) | 21 (0.270) | 11/128 | NT | 26.3% | intergenic (+44/‑229) | USA300HOU_RS00335/USA300HOU_RS00140 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 76003 | 63 (0.800) | intergenic (+61/‑212) | USA300HOU_RS00335/USA300HOU_RS00140 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 127978 | 80 (0.810) | 20 (0.230) | 14/144 | NT | 20.3% | intergenic (+198/+131) | lctP_1/spa | L‑lactate permease/Immunoglobulin G‑binding protein A |
| ? | USA300TCH1516_ALE | = 128000 | 85 (0.960) | intergenic (+220/+109) | lctP_1/spa | L‑lactate permease/Immunoglobulin G‑binding protein A | |||||
| * | ? | USA300TCH1516_ALE | = 146925 | 95 (0.970) | 7 (0.080) | 5/142 | NT | 7.6% | intergenic (+71/‑141) | USA300HOU_RS00660/butA | hypothetical protein/Diacetyl reductase [(S)‑acetoin forming] |
| ? | USA300TCH1516_ALE | = 146945 | 87 (1.000) | intergenic (+91/‑121) | USA300HOU_RS00660/butA | hypothetical protein/Diacetyl reductase [(S)‑acetoin forming] | |||||
| * | ? | USA300TCH1516_ALE | = 153874 | 111 (1.130) | 6 (0.070) | 5/150 | NT | 5.4% | intergenic (+46/‑222) | rfbX/sodM | Putative O‑antigen transporter/Superoxide dismutase [Mn/Fe] 2 |
| ? | USA300TCH1516_ALE | = 153903 | 106 (1.150) | intergenic (+75/‑193) | rfbX/sodM | Putative O‑antigen transporter/Superoxide dismutase [Mn/Fe] 2 | |||||
| * | ? | USA300TCH1516_ALE | 169889 = | 107 (1.090) | 55 (0.600) | 14/148 | NT | 38.2% | intergenic (+436/‑541) | repE/USA300HOU_RS07235 | Replication initiation protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 848673 | 79 (0.870) | intergenic (+678/‑202) | trxB/USA300HOU_RS04145 | Thioredoxin reductase/Nucleotide‑binding protein | |||||
| * | ? | USA300TCH1516_ALE | 173490 = | 94 (0.960) | 6 (0.070) | 5/146 | NT | 7.1% | coding (2390/2610 nt) | adhE | Aldehyde‑alcohol dehydrogenase |
| ? | USA300TCH1516_ALE | 173521 = | 72 (0.800) | coding (2421/2610 nt) | adhE | Aldehyde‑alcohol dehydrogenase | |||||
| * | ? | USA300TCH1516_ALE | = 211712 | 85 (0.860) | 9 (0.100) | 7/142 | NT | 11.0% | intergenic (+270/+58) | sfp/yagU | 4'‑phosphopantetheinyl transferase sfp/Inner membrane protein YagU |
| ? | USA300TCH1516_ALE | = 211745 | 70 (0.800) | intergenic (+303/+25) | sfp/yagU | 4'‑phosphopantetheinyl transferase sfp/Inner membrane protein YagU | |||||
| * | ? | USA300TCH1516_ALE | 221178 = | 63 (0.640) | 10 (0.110) | 7/146 | NT | 14.4% | intergenic (‑224/+50) | ipdC/ptsG_1 | Indole‑3‑pyruvate decarboxylase/PTS system glucose‑specific EIICBA component |
| ? | USA300TCH1516_ALE | 221218 = | 61 (0.680) | intergenic (‑264/+10) | ipdC/ptsG_1 | Indole‑3‑pyruvate decarboxylase/PTS system glucose‑specific EIICBA component | |||||
| * | ? | USA300TCH1516_ALE | = 221184 | 65 (0.660) | 15 (0.170) | 6/146 | NT | 20.0% | intergenic (‑230/+44) | ipdC/ptsG_1 | Indole‑3‑pyruvate decarboxylase/PTS system glucose‑specific EIICBA component |
| ? | USA300TCH1516_ALE | = 221210 | 61 (0.680) | intergenic (‑256/+18) | ipdC/ptsG_1 | Indole‑3‑pyruvate decarboxylase/PTS system glucose‑specific EIICBA component | |||||
| * | ? | USA300TCH1516_ALE | = 227487 | 79 (0.800) | 6 (0.060) | 5/152 | NT | 7.3% | coding (212/879 nt) | ybbH_1 | putative HTH‑type transcriptional regulator YbbH |
| ? | USA300TCH1516_ALE | = 227515 | 77 (0.820) | coding (240/879 nt) | ybbH_1 | putative HTH‑type transcriptional regulator YbbH | |||||
| * | ? | USA300TCH1516_ALE | 236074 = | 98 (1.000) | 8 (0.090) | 5/152 | NT | 7.4% | coding (486/1593 nt) | gsiA | Glutathione import ATP‑binding protein GsiA |
| ? | USA300TCH1516_ALE | 236115 = | 108 (1.160) | coding (445/1593 nt) | gsiA | Glutathione import ATP‑binding protein GsiA | |||||
| * | ? | USA300TCH1516_ALE | = 257948 | 79 (0.800) | 6 (0.070) | 4/146 | NT | 6.9% | coding (974/1557 nt) | USA300HOU_RS01140 | putative sensor‑like histidine kinase |
| ? | USA300TCH1516_ALE | = 257968 | 89 (0.990) | coding (954/1557 nt) | USA300HOU_RS01140 | putative sensor‑like histidine kinase | |||||
| * | ? | USA300TCH1516_ALE | 260284 = | 65 (0.660) | 8 (0.090) | 7/138 | NT | 12.8% | intergenic (‑398/‑190) | potD_1/pflB | Spermidine/putrescine‑binding periplasmic protein/Formate acetyltransferase |
| ? | USA300TCH1516_ALE | 260324 = | 53 (0.620) | intergenic (‑438/‑150) | potD_1/pflB | Spermidine/putrescine‑binding periplasmic protein/Formate acetyltransferase | |||||
| * | ? | USA300TCH1516_ALE | = 260294 | 68 (0.690) | 11 (0.130) | 6/138 | NT | 16.5% | intergenic (‑408/‑180) | potD_1/pflB | Spermidine/putrescine‑binding periplasmic protein/Formate acetyltransferase |
| ? | USA300TCH1516_ALE | = 260312 | 53 (0.620) | intergenic (‑426/‑162) | potD_1/pflB | Spermidine/putrescine‑binding periplasmic protein/Formate acetyltransferase | |||||
| * | ? | USA300TCH1516_ALE | 263523 = | 91 (0.930) | 9 (0.100) | 6/140 | NT | 11.2% | intergenic (+22/‑314) | pflA/ugpQ_2 | Pyruvate formate‑lyase‑activating enzyme/Glycerophosphodiester phosphodiesterase, cytoplasmic |
| ? | USA300TCH1516_ALE | 263561 = | 63 (0.730) | intergenic (+60/‑276) | pflA/ugpQ_2 | Pyruvate formate‑lyase‑activating enzyme/Glycerophosphodiester phosphodiesterase, cytoplasmic | |||||
| * | ? | USA300TCH1516_ALE | 278631 = | 103 (1.050) | 16 (0.190) | 8/140 | NT | 15.0% | intergenic (+226/+88) | USA300HOU_RS01215/gsiB | hypothetical protein/Glutathione‑binding protein GsiB |
| ? | USA300TCH1516_ALE | 278672 = | 91 (1.060) | intergenic (+267/+47) | USA300HOU_RS01215/gsiB | hypothetical protein/Glutathione‑binding protein GsiB | |||||
| * | ? | USA300TCH1516_ALE | = 278640 | 100 (1.020) | 5 (0.060) | 4/140 | NT | 5.3% | intergenic (+235/+79) | USA300HOU_RS01215/gsiB | hypothetical protein/Glutathione‑binding protein GsiB |
| ? | USA300TCH1516_ALE | = 278661 | 91 (1.060) | intergenic (+256/+58) | USA300HOU_RS01215/gsiB | hypothetical protein/Glutathione‑binding protein GsiB | |||||
| * | ? | USA300TCH1516_ALE | = 280894 | 103 (1.050) | 11 (0.130) +TTAATTGGGAGTA |
7/134 | NT | 11.2% | intergenic (‑146/+11) | USA300HOU_RS01225/USA300HOU_RS01230 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 855632 = | 105 (1.070) | intergenic (+163/‑597) | zipA_1/cggR | Cell division protein ZipA/Central glycolytic genes regulator | |||||
| * | ? | USA300TCH1516_ALE | 298069 = | 80 (0.810) | 8 (0.090) | 8/140 | NT | 11.2% | intergenic (+208/‑220) | tarK/tarF_1 | Teichoic acid ribitol‑phosphate polymerase TarK/Teichoic acid glycerol‑phosphate transferase |
| ? | USA300TCH1516_ALE | 298125 = | 57 (0.660) | intergenic (+264/‑164) | tarK/tarF_1 | Teichoic acid ribitol‑phosphate polymerase TarK/Teichoic acid glycerol‑phosphate transferase | |||||
| * | ? | USA300TCH1516_ALE | = 298078 | 76 (0.770) | 5 (0.060) | 5/140 | NT | 7.5% | intergenic (+217/‑211) | tarK/tarF_1 | Teichoic acid ribitol‑phosphate polymerase TarK/Teichoic acid glycerol‑phosphate transferase |
| ? | USA300TCH1516_ALE | = 298114 | 57 (0.660) | intergenic (+253/‑175) | tarK/tarF_1 | Teichoic acid ribitol‑phosphate polymerase TarK/Teichoic acid glycerol‑phosphate transferase | |||||
| * | ? | USA300TCH1516_ALE | = 303840 | 81 (0.820) | 9 (0.100) | 7/146 | NT | 10.8% | coding (630/1725 nt) | epsJ | putative glycosyltransferase EpsJ |
| ? | USA300TCH1516_ALE | = 303860 | 75 (0.840) | coding (650/1725 nt) | epsJ | putative glycosyltransferase EpsJ | |||||
| * | ? | USA300TCH1516_ALE | 314324 = | 65 (0.660) | 8 (0.090) | 4/148 | NT | 11.3% | intergenic (‑182/+69) | rebM/rbsK_rbiA | Demethylrebeccamycin‑D‑glucose O‑methyltransferase/Bifunctional ribokinase/ribose‑5‑phosphate isomerase A |
| ? | USA300TCH1516_ALE | 314383 = | 65 (0.710) | intergenic (‑241/+10) | rebM/rbsK_rbiA | Demethylrebeccamycin‑D‑glucose O‑methyltransferase/Bifunctional ribokinase/ribose‑5‑phosphate isomerase A | |||||
| * | ? | USA300TCH1516_ALE | = 314329 | 69 (0.700) | 6 (0.070) | 6/148 | NT | 8.5% | intergenic (‑187/+64) | rebM/rbsK_rbiA | Demethylrebeccamycin‑D‑glucose O‑methyltransferase/Bifunctional ribokinase/ribose‑5‑phosphate isomerase A |
| ? | USA300TCH1516_ALE | = 314376 | 65 (0.710) | intergenic (‑234/+17) | rebM/rbsK_rbiA | Demethylrebeccamycin‑D‑glucose O‑methyltransferase/Bifunctional ribokinase/ribose‑5‑phosphate isomerase A | |||||
| * | ? | USA300TCH1516_ALE | 329202 = | 116 (1.180) | 11 (0.130) | 8/140 | NT | 11.3% | intergenic (+70/+73) | USA300HOU_RS01475/ssaA2_1 | hypothetical protein/Staphylococcal secretory antigen ssaA2 |
| ? | USA300TCH1516_ALE | 329255 = | 71 (0.830) | intergenic (+123/+20) | USA300HOU_RS01475/ssaA2_1 | hypothetical protein/Staphylococcal secretory antigen ssaA2 | |||||
| * | ? | USA300TCH1516_ALE | = 344445 | 86 (0.870) | 10 (0.130) +ACATTAAGATAGTTTA |
4/128 | NT | 11.0% | intergenic (+44/‑164) | yezG_1/USA300HOU_RS01545 | putative antitoxin YezG/hypothetical protein |
| ? | USA300TCH1516_ALE | = 348041 | 117 (1.190) | coding (288/300 nt) | yezG_1 | putative antitoxin YezG | |||||
| * | ? | USA300TCH1516_ALE | = 347535 | 94 (0.960) | 6 (0.080) +TAGACAATCTTAATGT |
5/128 | NT | 7.5% | coding (489/501 nt) | yezG_3 | putative antitoxin YezG |
| ? | USA300TCH1516_ALE | = 348599 | 92 (0.940) | intergenic (+44/‑166) | yezG_5/USA300HOU_RS01580 | putative antitoxin YezG/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 349728 | 122 (1.240) | 9 (0.100) | 5/142 | NT | 7.7% | intergenic (+280/‑306) | USA300HOU_RS01580/yezG_6 | hypothetical protein/putative antitoxin YezG |
| ? | USA300TCH1516_ALE | = 349744 | 107 (1.230) | intergenic (+296/‑290) | USA300HOU_RS01580/yezG_6 | hypothetical protein/putative antitoxin YezG | |||||
| * | ? | USA300TCH1516_ALE | 365029 = | 68 (0.690) | 22 (0.260) | 6/136 | NT | 26.9% | intergenic (+39/+66) | nupC_1/sglT | Nucleoside permease NupC/Sodium/glucose cotransporter |
| ? | USA300TCH1516_ALE | 365083 = | 62 (0.740) | intergenic (+93/+12) | nupC_1/sglT | Nucleoside permease NupC/Sodium/glucose cotransporter | |||||
| * | ? | USA300TCH1516_ALE | = 365040 | 64 (0.650) | 9 (0.110) | 6/136 | NT | 13.4% | intergenic (+50/+55) | nupC_1/sglT | Nucleoside permease NupC/Sodium/glucose cotransporter |
| ? | USA300TCH1516_ALE | = 365070 | 62 (0.740) | intergenic (+80/+25) | nupC_1/sglT | Nucleoside permease NupC/Sodium/glucose cotransporter | |||||
| * | ? | USA300TCH1516_ALE | = 374498 | 91 (0.930) | 6 (0.070) | 5/144 | NT | 7.1% | intergenic (+116/+126) | lip2/USA300HOU_RS01705 | Lipase 2/hypothetical protein |
| ? | USA300TCH1516_ALE | = 374518 | 75 (0.850) | intergenic (+136/+106) | lip2/USA300HOU_RS01705 | Lipase 2/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 386667 | 88 (0.890) | 6 (0.070) | 4/140 | NT | 7.4% | intergenic (‑57/‑155) | licR/slyA_1 | putative licABCH operon regulator/Transcriptional regulator SlyA |
| ? | USA300TCH1516_ALE | = 386691 | 73 (0.850) | intergenic (‑81/‑131) | licR/slyA_1 | putative licABCH operon regulator/Transcriptional regulator SlyA | |||||
| * | ? | USA300TCH1516_ALE | 393245 = | 87 (0.880) | 8 (0.090) | 6/142 | NT | 10.0% | coding (235/567 nt) | USA300HOU_RS01800 | NAD(P)H‑dependent FAD/FMN reductase |
| ? | USA300TCH1516_ALE | 393281 = | 66 (0.760) | coding (271/567 nt) | USA300HOU_RS01800 | NAD(P)H‑dependent FAD/FMN reductase | |||||
| * | ? | USA300TCH1516_ALE | 393589 = | 88 (0.890) | 5 (0.060) | 4/142 | NT | 6.8% | intergenic (+12/+48) | USA300HOU_RS01800/USA300HOU_RS01805 | NAD(P)H‑dependent FAD/FMN reductase/hypothetical protein |
| ? | USA300TCH1516_ALE | 393631 = | 58 (0.660) | intergenic (+54/+6) | USA300HOU_RS01800/USA300HOU_RS01805 | NAD(P)H‑dependent FAD/FMN reductase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 412131 = | 79 (0.800) | 8 (0.090) | 6/144 | NT | 11.0% | coding (1028/1161 nt) | metC | Cystathionine beta‑lyase MetC |
| ? | USA300TCH1516_ALE | 412165 = | 59 (0.670) | coding (994/1161 nt) | metC | Cystathionine beta‑lyase MetC | |||||
| * | ? | USA300TCH1516_ALE | 414290 = | 92 (0.940) | 10 (0.110) | 5/148 | NT | 11.0% | intergenic (‑32/‑632) | metI/spo0C | Cystathionine gamma‑synthase/O‑acetylhomoserine (thiol)‑lyase/Chromosome‑partitioning protein Spo0J |
| ? | USA300TCH1516_ALE | 414341 = | 77 (0.850) | intergenic (‑83/‑581) | metI/spo0C | Cystathionine gamma‑synthase/O‑acetylhomoserine (thiol)‑lyase/Chromosome‑partitioning protein Spo0J | |||||
| * | ? | USA300TCH1516_ALE | = 425019 | 103 (1.050) | 17 (0.190) | 9/146 | NT | 15.1% | intergenic (+34/‑392) | USA300HOU_RS01985/gpmA_1 | hypothetical protein/2,3‑bisphosphoglycerate‑dependent phosphoglycerate mutase |
| ? | USA300TCH1516_ALE | = 425031 | 97 (1.080) | intergenic (+46/‑380) | USA300HOU_RS01985/gpmA_1 | hypothetical protein/2,3‑bisphosphoglycerate‑dependent phosphoglycerate mutase | |||||
| * | ? | USA300TCH1516_ALE | 433374 = | 104 (1.060) | 6 (0.070) | 4/132 | NT | 7.6% | intergenic (‑783/+194) | tcyP/USA300HOU_RS02040 | L‑cystine uptake protein TcyP/hypothetical protein |
| ? | USA300TCH1516_ALE | 433453 = | 61 (0.750) | intergenic (‑862/+115) | tcyP/USA300HOU_RS02040 | L‑cystine uptake protein TcyP/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 463683 | 83 (0.840) | 6 (0.070) | 3/146 | NT | 6.9% | coding (194/804 nt) | lpl2_1 | putative lipoprotein |
| ? | USA300TCH1516_ALE | = 463707 | 87 (0.970) | coding (218/804 nt) | lpl2_1 | putative lipoprotein | |||||
| * | ? | USA300TCH1516_ALE | 474042 = | 71 (0.720) | 5 (0.050) | 5/150 | NT | 6.9% | intergenic (+24/+266) | USA300HOU_RS02255/USA300HOU_RS02260 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 474087 = | 68 (0.740) | intergenic (+69/+221) | USA300HOU_RS02255/USA300HOU_RS02260 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 492708 = | 68 (0.690) | 8 (0.100) | 7/128 | NT | 12.4% | intergenic (+130/+55) | sle1_1/USA300HOU_RS02345 | N‑acetylmuramoyl‑L‑alanine amidase sle1/hypothetical protein |
| ? | USA300TCH1516_ALE | 492758 = | 59 (0.750) | intergenic (+180/+5) | sle1_1/USA300HOU_RS02345 | N‑acetylmuramoyl‑L‑alanine amidase sle1/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 492723 | 72 (0.730) | 13 (0.170) | 8/128 | NT | 18.2% | intergenic (+145/+40) | sle1_1/USA300HOU_RS02345 | N‑acetylmuramoyl‑L‑alanine amidase sle1/hypothetical protein |
| ? | USA300TCH1516_ALE | = 492741 | 59 (0.750) | intergenic (+163/+22) | sle1_1/USA300HOU_RS02345 | N‑acetylmuramoyl‑L‑alanine amidase sle1/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 509274 = | 60 (0.610) | 9 (0.100) | 6/150 | NT | 13.3% | coding (50/1698 nt) | dnaX_1 | DNA polymerase III subunit tau |
| ? | USA300TCH1516_ALE | 509307 = | 61 (0.660) | coding (83/1698 nt) | dnaX_1 | DNA polymerase III subunit tau | |||||
| * | ? | USA300TCH1516_ALE | = 512767 | 0 (0.000) | 9 (0.100) | 6/150 | NT | 100% | intergenic (+835/‑5928) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase |
| ? | USA300TCH1516_ALE | = 512806 | NA (NA) | intergenic (+874/‑5889) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase | |||||
| * | ? | USA300TCH1516_ALE | = 513619 | NA (NA) | 7 (0.080) | 5/146 | NT | NA | intergenic (+1687/‑5076) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase |
| ? | USA300TCH1516_ALE | = 513665 | NA (NA) | intergenic (+1733/‑5030) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase | |||||
| * | ? | USA300TCH1516_ALE | 513863 = | NA (NA) | 7 (0.080) | 5/148 | NT | NA | intergenic (+1931/‑4832) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase |
| ? | USA300TCH1516_ALE | 513903 = | NA (NA) | intergenic (+1971/‑4792) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase | |||||
| * | ? | USA300TCH1516_ALE | = 515946 | NA (NA) | 7 (0.080) | 5/146 | NT | NA | intergenic (+4014/‑2749) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase |
| ? | USA300TCH1516_ALE | = 515981 | NA (NA) | intergenic (+4049/‑2714) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase | |||||
| * | ? | USA300TCH1516_ALE | 517191 = | NA (NA) | 4 (0.040) | 4/148 | NT | NA | intergenic (+5259/‑1504) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase |
| ? | USA300TCH1516_ALE | 517220 = | NA (NA) | intergenic (+5288/‑1475) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase | |||||
| * | ? | USA300TCH1516_ALE | = 523911 | 75 (0.760) | 5 (0.060) | 5/130 | NT | 6.4% | coding (322/726 nt) | yfiC | tRNA1(Val) (adenine(37)‑N6)‑methyltransferase |
| ? | USA300TCH1516_ALE | = 523926 | 85 (1.060) | coding (337/726 nt) | yfiC | tRNA1(Val) (adenine(37)‑N6)‑methyltransferase | |||||
| * | ? | USA300TCH1516_ALE | 551684 = | 84 (0.850) | 15 (0.170) | 8/146 | NT | 17.1% | intergenic (+13/‑203) | cysK/folP | Cysteine synthase/Dihydropteroate synthase |
| ? | USA300TCH1516_ALE | 551723 = | 69 (0.770) | intergenic (+52/‑164) | cysK/folP | Cysteine synthase/Dihydropteroate synthase | |||||
| * | ? | USA300TCH1516_ALE | 553211 = | 87 (0.880) | 4 (0.050) | 4/138 | NT | 5.1% | coding (182/477 nt) | folK | 2‑amino‑4‑hydroxy‑6‑ hydroxymethyldihydropteridine pyrophosphokinase |
| ? | USA300TCH1516_ALE | 553257 = | 75 (0.880) | coding (228/477 nt) | folK | 2‑amino‑4‑hydroxy‑6‑ hydroxymethyldihydropteridine pyrophosphokinase | |||||
| * | ? | USA300TCH1516_ALE | 584107 = | 77 (0.780) | 7 (0.080) | 6/142 | NT | 9.6% | intergenic (+191/‑81) | rplA/rplJ | 50S ribosomal protein L1/50S ribosomal protein L10 |
| ? | USA300TCH1516_ALE | 584138 = | 64 (0.730) | intergenic (+222/‑50) | rplA/rplJ | 50S ribosomal protein L1/50S ribosomal protein L10 | |||||
| * | ? | USA300TCH1516_ALE | 584527 = | 96 (0.980) | 6 (0.070) | 4/150 | NT | 6.5% | coding (340/501 nt) | rplJ | 50S ribosomal protein L10 |
| ? | USA300TCH1516_ALE | 584580 = | 82 (0.890) | coding (393/501 nt) | rplJ | 50S ribosomal protein L10 | |||||
| * | ? | USA300TCH1516_ALE | = 587587 | 79 (0.800) | 5 (0.060) | 4/144 | NT | 5.9% | coding (1491/3552 nt) | rpoB | DNA‑directed RNA polymerase subunit beta |
| ? | USA300TCH1516_ALE | = 587606 | 87 (0.980) | coding (1510/3552 nt) | rpoB | DNA‑directed RNA polymerase subunit beta | |||||
| * | ? | USA300TCH1516_ALE | = 595612 | 71 (0.720) | 6 (0.070) | 4/150 | NT | 8.1% | coding (644/2082 nt) | fusA | Elongation factor G |
| ? | USA300TCH1516_ALE | = 595639 | 69 (0.750) | coding (671/2082 nt) | fusA | Elongation factor G | |||||
| * | ? | USA300TCH1516_ALE | = 598649 | 65 (0.660) | 8 (0.100) | 5/124 | NT | 12.1% | intergenic (+198/+84) | tuf/yxeP_2 | Elongation factor Tu/putative hydrolase YxeP |
| ? | USA300TCH1516_ALE | = 598668 | 66 (0.870) | intergenic (+217/+65) | tuf/yxeP_2 | Elongation factor Tu/putative hydrolase YxeP | |||||
| * | ? | USA300TCH1516_ALE | 598774 = | 116 (1.180) | 7 (0.080) | 8/146 | NT | 6.6% | coding (1135/1176 nt) | yxeP_2 | putative hydrolase YxeP |
| ? | USA300TCH1516_ALE | 598797 = | 93 (1.040) | coding (1112/1176 nt) | yxeP_2 | putative hydrolase YxeP | |||||
| * | ? | USA300TCH1516_ALE | 633311 = | 98 (1.000) | 12 (0.150) | 9/134 | NT | 13.0% | intergenic (+35/‑509) | proP/yhfT | Proline/betaine transporter/putative acyl‑‑CoA ligase YhfT |
| ? | USA300TCH1516_ALE | 633354 = | 79 (0.960) | intergenic (+78/‑466) | proP/yhfT | Proline/betaine transporter/putative acyl‑‑CoA ligase YhfT | |||||
| * | ? | USA300TCH1516_ALE | 646656 = | 101 (1.030) | 11 (0.130) | 7/140 | NT | 11.9% | intergenic (+10/‑577) | lipL/galK | Octanoyl‑[GcvH]:protein N‑octanoyltransferase/Galactokinase |
| ? | USA300TCH1516_ALE | 646692 = | 74 (0.860) | intergenic (+46/‑541) | lipL/galK | Octanoyl‑[GcvH]:protein N‑octanoyltransferase/Galactokinase | |||||
| * | ? | USA300TCH1516_ALE | 669086 = | 107 (1.090) | 7 (0.080) | 4/142 | NT | 7.8% | intergenic (+60/‑15) | adh/USA300TCH1516_00602 | Alcohol dehydrogenase/hypothetical protein |
| ? | USA300TCH1516_ALE | 669128 = | 71 (0.810) | coding (28/108 nt) | USA300TCH1516_00602 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 671622 = | 56 (0.570) | 16 (0.180) | 5/146 | NT | 25.4% | intergenic (+247/‑141) | argS/nth_1 | Arginine‑‑tRNA ligase/Endonuclease III |
| ? | USA300TCH1516_ALE | = 891842 | 43 (0.480) | intergenic (+260/‑479) | USA300HOU_RS04385/rnmV_2 | hypothetical protein/Ribonuclease M5 | |||||
| * | ? | USA300TCH1516_ALE | = 681141 | 93 (0.950) | 5 (0.060) | 4/136 | NT | 5.1% | coding (351/354 nt) | USA300TCH1516_00615 | hypothetical protein |
| ? | USA300TCH1516_ALE | = 681169 | 107 (1.280) | coding (323/354 nt) | USA300TCH1516_00615 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 682222 = | 107 (1.090) | 13 (0.150) | 7/140 | NT | 12.7% | intergenic (‑64/+45) | USA300TCH1516_00616/rcsF_2 | hypothetical protein/Outer membrane lipoprotein RcsF |
| ? | USA300TCH1516_ALE | 682264 = | 85 (0.990) | intergenic (‑106/+3) | USA300TCH1516_00616/rcsF_2 | hypothetical protein/Outer membrane lipoprotein RcsF | |||||
| * | ? | USA300TCH1516_ALE | = 691792 | 107 (1.090) | 8 (0.100) | 5/132 | NT | 7.4% | coding (30/1056 nt) | USA300HOU_RS03335 | hypothetical protein |
| ? | USA300TCH1516_ALE | = 691823 | 113 (1.390) | intergenic (‑2/+59) | USA300HOU_RS03335/USA300HOU_RS03340 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 705182 = | 102 (1.040) | 13 (0.150) | 6/142 | NT | 14.6% | intergenic (+932/+228) | nhaK_1/mntA | Sodium, potassium, lithium and rubidium/H(+) antiporter/Manganese‑binding lipoprotein MntA |
| ? | USA300TCH1516_ALE | 705222 = | 61 (0.700) | intergenic (+972/+188) | nhaK_1/mntA | Sodium, potassium, lithium and rubidium/H(+) antiporter/Manganese‑binding lipoprotein MntA | |||||
| * | ? | USA300TCH1516_ALE | = 705329 | 99 (1.010) | 13 (0.150) | 8/142 | NT | 13.3% | intergenic (+1079/+81) | nhaK_1/mntA | Sodium, potassium, lithium and rubidium/H(+) antiporter/Manganese‑binding lipoprotein MntA |
| ? | USA300TCH1516_ALE | = 705368 | 81 (0.930) | intergenic (+1118/+42) | nhaK_1/mntA | Sodium, potassium, lithium and rubidium/H(+) antiporter/Manganese‑binding lipoprotein MntA | |||||
| * | ? | USA300TCH1516_ALE | = 710532 | 96 (0.980) | 14 (0.160) | 9/142 | NT | 14.1% | intergenic (+25/+36) | tarA/tagH_1 | N‑acetylglucosaminyldiphosphoundecaprenol N‑acetyl‑beta‑D‑mannosaminyltransferase/Teichoic acids export ATP‑binding protein TagH |
| ? | USA300TCH1516_ALE | = 710552 | 85 (0.970) | intergenic (+45/+16) | tarA/tagH_1 | N‑acetylglucosaminyldiphosphoundecaprenol N‑acetyl‑beta‑D‑mannosaminyltransferase/Teichoic acids export ATP‑binding protein TagH | |||||
| * | ? | USA300TCH1516_ALE | = 712543 | 108 (1.100) | 13 (0.140) | 7/148 | NT | 11.2% | intergenic (+22/‑77) | tagG/tarB | Teichoic acid translocation permease protein TagG/Teichoic acid glycerol‑phosphate primase |
| ? | USA300TCH1516_ALE | = 712566 | 107 (1.180) | intergenic (+45/‑54) | tagG/tarB | Teichoic acid translocation permease protein TagG/Teichoic acid glycerol‑phosphate primase | |||||
| * | ? | USA300TCH1516_ALE | = 715316 | 97 (0.990) | 13 (0.160) | 9/132 | NT | 13.5% | intergenic (+74/+43) | tarD/dacA | Glycerol‑3‑phosphate cytidylyltransferase/D‑alanyl‑D‑alanine carboxypeptidase DacA |
| ? | USA300TCH1516_ALE | = 715335 | 87 (1.070) | intergenic (+93/+24) | tarD/dacA | Glycerol‑3‑phosphate cytidylyltransferase/D‑alanyl‑D‑alanine carboxypeptidase DacA | |||||
| * | ? | USA300TCH1516_ALE | = 720543 | 107 (1.090) | 12 (0.130) | 6/148 | NT | 10.7% | intergenic (+153/‑372) | nupG/USA300HOU_RS03495 | Purine nucleoside transport protein NupG/hypothetical protein |
| ? | USA300TCH1516_ALE | = 720571 | 101 (1.110) | intergenic (+181/‑344) | nupG/USA300HOU_RS03495 | Purine nucleoside transport protein NupG/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 724910 | 63 (0.640) | 13 (0.150) | 5/140 | NT | 17.6% | intergenic (+30/‑204) | feuC_1/dhaK | Iron‑uptake system permease protein FeuC/PTS‑dependent dihydroxyacetone kinase, dihydroxyacetone‑binding subunit DhaK |
| ? | USA300TCH1516_ALE | = 724929 | 67 (0.780) | intergenic (+49/‑185) | feuC_1/dhaK | Iron‑uptake system permease protein FeuC/PTS‑dependent dihydroxyacetone kinase, dihydroxyacetone‑binding subunit DhaK | |||||
| * | ? | USA300TCH1516_ALE | 729254 = | 85 (0.860) | 21 (0.250) | 9/136 | NT | 24.2% | intergenic (+55/‑96) | USA300HOU_RS03535/aes | hypothetical protein/Acetyl esterase |
| ? | USA300TCH1516_ALE | 729295 = | 59 (0.710) | intergenic (+96/‑55) | USA300HOU_RS03535/aes | hypothetical protein/Acetyl esterase | |||||
| * | ? | USA300TCH1516_ALE | = 739800 | 78 (0.790) | 10 (0.120) | 10/134 | NT | 14.3% | intergenic (+27/+561) | pitA_1/sle1_2 | Low‑affinity inorganic phosphate transporter 1/N‑acetylmuramoyl‑L‑alanine amidase sle1 |
| ? | USA300TCH1516_ALE | = 739823 | 55 (0.670) | intergenic (+50/+538) | pitA_1/sle1_2 | Low‑affinity inorganic phosphate transporter 1/N‑acetylmuramoyl‑L‑alanine amidase sle1 | |||||
| * | ? | USA300TCH1516_ALE | = 744697 | 92 (0.940) | 8 (0.090) | 6/152 | NT | 7.5% | coding (1838/1980 nt) | melR_1 | Melibiose operon regulatory protein |
| ? | USA300TCH1516_ALE | = 744717 | 109 (1.170) | coding (1858/1980 nt) | melR_1 | Melibiose operon regulatory protein | |||||
| * | ? | USA300TCH1516_ALE | = 749035 | 77 (0.780) | 10 (0.110) | 9/142 | NT | 12.6% | intergenic (+163/‑38) | oxyR/setC | Hydrogen peroxide‑inducible genes activator/Sugar efflux transporter C |
| ? | USA300TCH1516_ALE | = 749050 | 71 (0.810) | intergenic (+178/‑23) | oxyR/setC | Hydrogen peroxide‑inducible genes activator/Sugar efflux transporter C | |||||
| * | ? | USA300TCH1516_ALE | 758250 = | 105 (1.070) | 5 (0.050) | 5/148 | NT | 5.6% | coding (1526/1632 nt) | cydD | ATP‑binding/permease protein CydD |
| ? | USA300TCH1516_ALE | 758282 = | 70 (0.770) | coding (1558/1632 nt) | cydD | ATP‑binding/permease protein CydD | |||||
| * | ? | USA300TCH1516_ALE | = 761262 | 99 (1.010) | 8 (0.090) | 6/148 | NT | 7.8% | coding (440/927 nt) | yciC_2 | Putative metal chaperone YciC |
| ? | USA300TCH1516_ALE | = 761280 | 98 (1.080) | coding (458/927 nt) | yciC_2 | Putative metal chaperone YciC | |||||
| * | ? | USA300TCH1516_ALE | 774819 = | 89 (0.910) | 5 (0.060) | 4/134 | NT | 6.4% | intergenic (+110/‑198) | fruA/nagA | PTS system fructose‑specific EIIABC component/N‑acetylglucosamine‑6‑phosphate deacetylase |
| ? | USA300TCH1516_ALE | 774873 = | 72 (0.870) | intergenic (+164/‑144) | fruA/nagA | PTS system fructose‑specific EIIABC component/N‑acetylglucosamine‑6‑phosphate deacetylase | |||||
| * | ? | USA300TCH1516_ALE | 781357 = | 93 (0.950) | 6 (0.070) | 5/146 | NT | 6.7% | coding (401/687 nt) | saeR | Response regulator SaeR |
| ? | USA300TCH1516_ALE | 781390 = | 83 (0.930) | coding (368/687 nt) | saeR | Response regulator SaeR | |||||
| * | ? | USA300TCH1516_ALE | 782414 = | 111 (1.130) | 8 (0.090) | 5/140 | NT | 7.9% | intergenic (‑209/+133) | USA300HOU_RS03820/USA300HOU_RS03825 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 782453 = | 90 (1.050) | intergenic (‑248/+94) | USA300HOU_RS03820/USA300HOU_RS03825 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 783981 | 83 (0.840) | 12 (0.140) | 7/140 | NT | 13.4% | coding (683/714 nt) | queE_1 | 7‑carboxy‑7‑deazaguanine synthase |
| ? | USA300TCH1516_ALE | = 784017 | 82 (0.950) | coding (647/714 nt) | queE_1 | 7‑carboxy‑7‑deazaguanine synthase | |||||
| * | ? | USA300TCH1516_ALE | = 789633 | 96 (0.980) | 8 (0.090) | 6/148 | NT | 8.0% | coding (137/1005 nt) | kipA_1 | KipI antagonist |
| ? | USA300TCH1516_ALE | = 789649 | 94 (1.030) | coding (153/1005 nt) | kipA_1 | KipI antagonist | |||||
| * | ? | USA300TCH1516_ALE | = 802141 | 80 (0.810) | 11 (0.130) | 9/138 | NT | 12.2% | intergenic (+382/+242) | USA300HOU_RS03915/USA300HOU_RS03920 | Putative 5'(3')‑deoxyribonucleotidase/Putative lipid kinase |
| ? | USA300TCH1516_ALE | = 802168 | 90 (1.060) | intergenic (+409/+215) | USA300HOU_RS03915/USA300HOU_RS03920 | Putative 5'(3')‑deoxyribonucleotidase/Putative lipid kinase | |||||
| * | ? | USA300TCH1516_ALE | 811544 = | 116 (1.180) | 9 (0.100) | 7/144 | NT | 8.6% | intergenic (+386/‑280) | nrdF/fecD_1 | Ribonucleoside‑diphosphate reductase subunit beta/Fe(3+) dicitrate transport system permease protein FecD |
| ? | USA300TCH1516_ALE | 811563 = | 88 (0.990) | intergenic (+405/‑261) | nrdF/fecD_1 | Ribonucleoside‑diphosphate reductase subunit beta/Fe(3+) dicitrate transport system permease protein FecD | |||||
| * | ? | USA300TCH1516_ALE | = 822743 | 69 (0.700) | 4 (0.040) | 4/146 | NT | 6.4% | coding (104/495 nt) | USA300HOU_RS04025 | hypothetical protein |
| ? | USA300TCH1516_ALE | = 822770 | 54 (0.600) | coding (77/495 nt) | USA300HOU_RS04025 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 823754 = | 96 (0.980) | 11 (0.130) | 9/134 | NT | 12.8% | intergenic (‑129/+67) | yjjP_2/dosC | Inner membrane protein YjjP/Diguanylate cyclase DosC |
| ? | USA300TCH1516_ALE | 823814 = | 70 (0.850) | intergenic (‑189/+7) | yjjP_2/dosC | Inner membrane protein YjjP/Diguanylate cyclase DosC | |||||
| * | ? | USA300TCH1516_ALE | 829838 = | 113 (1.150) | 6 (0.070) | 4/142 | NT | 6.1% | coding (315/675 nt) | USA300HOU_RS04060 | hypothetical protein |
| ? | USA300TCH1516_ALE | 829892 = | 83 (0.950) | coding (369/675 nt) | USA300HOU_RS04060 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 842619 = | 103 (1.050) | 13 (0.150) | 10/144 | NT | 13.1% | intergenic (+5/‑657) | uvrA/hprK | UvrABC system protein A/HPr kinase/phosphorylase |
| ? | USA300TCH1516_ALE | 842662 = | 80 (0.900) | intergenic (+48/‑614) | uvrA/hprK | UvrABC system protein A/HPr kinase/phosphorylase | |||||
| * | ? | USA300TCH1516_ALE | = 842626 | 97 (0.990) | 9 (0.100) | 5/144 | NT | 9.7% | intergenic (+12/‑650) | uvrA/hprK | UvrABC system protein A/HPr kinase/phosphorylase |
| ? | USA300TCH1516_ALE | = 842653 | 80 (0.900) | intergenic (+39/‑623) | uvrA/hprK | UvrABC system protein A/HPr kinase/phosphorylase | |||||
| * | ? | USA300TCH1516_ALE | 842851 = | 106 (1.080) | 5 (0.060) | 5/140 | NT | 5.2% | intergenic (+237/‑425) | uvrA/hprK | UvrABC system protein A/HPr kinase/phosphorylase |
| ? | USA300TCH1516_ALE | 891965 = | 90 (1.050) | intergenic (+383/‑356) | USA300HOU_RS04385/rnmV_2 | hypothetical protein/Ribonuclease M5 | |||||
| * | ? | USA300TCH1516_ALE | 858374 = | 91 (0.930) | 7 (0.080) | 5/146 | NT | 8.1% | intergenic (+69/‑70) | gapA1/pgk | Glyceraldehyde‑3‑phosphate dehydrogenase 1/Phosphoglycerate kinase |
| ? | USA300TCH1516_ALE | 858405 = | 75 (0.840) | intergenic (+100/‑39) | gapA1/pgk | Glyceraldehyde‑3‑phosphate dehydrogenase 1/Phosphoglycerate kinase | |||||
| * | ? | USA300TCH1516_ALE | 868058 = | 90 (0.920) | 6 (0.070) | 5/146 | NT | 7.3% | coding (206/465 nt) | smpB | SsrA‑binding protein |
| ? | USA300TCH1516_ALE | 868096 = | 70 (0.780) | coding (244/465 nt) | smpB | SsrA‑binding protein | |||||
| * | ? | USA300TCH1516_ALE | 868305 = | 81 (0.820) | 9 (0.100) | 5/148 | NT | 11.7% | coding (453/465 nt) | smpB | SsrA‑binding protein |
| ? | USA300TCH1516_ALE | 868342 = | 61 (0.670) | intergenic (+25/+1297) | smpB/USA300HOU_RS04240 | SsrA‑binding protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 868310 | 77 (0.780) | 6 (0.070) | 5/148 | NT | 8.3% | coding (458/465 nt) | smpB | SsrA‑binding protein |
| ? | USA300TCH1516_ALE | = 868335 | 61 (0.670) | intergenic (+18/+1304) | smpB/USA300HOU_RS04240 | SsrA‑binding protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 869579 = | 125 (1.270) | 10 (0.120) | 7/140 | NT | 9.4% | intergenic (+1262/+60) | smpB/USA300HOU_RS04240 | SsrA‑binding protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 869621 = | 84 (0.980) | intergenic (+1304/+18) | smpB/USA300HOU_RS04240 | SsrA‑binding protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 878353 | 74 (0.750) | 9 (0.100) | 5/140 | NT | 12.3% | coding (359/1023 nt) | ssp | Extracellular matrix protein‑binding protein emp |
| ? | USA300TCH1516_ALE | = 878384 | 63 (0.730) | coding (390/1023 nt) | ssp | Extracellular matrix protein‑binding protein emp | |||||
| * | ? | USA300TCH1516_ALE | 880859 = | 137 (1.390) | 10 (0.110) | 8/144 | NT | 8.1% | intergenic (+10/‑347) | nuc/cspA_1 | Thermonuclease/Cold shock protein CspA |
| ? | USA300TCH1516_ALE | 880891 = | 103 (1.160) | intergenic (+42/‑315) | nuc/cspA_1 | Thermonuclease/Cold shock protein CspA | |||||
| * | ? | USA300TCH1516_ALE | = 885389 | 93 (0.950) | 15 (0.180) | 10/134 | NT | 15.8% | intergenic (+18/+55) | pspB/argO | Putative phosphoserine phosphatase 2/Arginine exporter protein ArgO |
| ? | USA300TCH1516_ALE | = 885408 | 82 (1.000) | intergenic (+37/+36) | pspB/argO | Putative phosphoserine phosphatase 2/Arginine exporter protein ArgO | |||||
| * | ? | USA300TCH1516_ALE | 900173 = | 93 (0.950) | 14 (0.160) | 7/140 | NT | 18.0% | coding (174/273 nt) | USA300HOU_RS04450 | hypothetical protein |
| ? | USA300TCH1516_ALE | 900207 = | 46 (0.530) | coding (208/273 nt) | USA300HOU_RS04450 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 906356 | 145 (1.470) | 10 (0.110) | 6/150 | NT | 7.1% | intergenic (+140/‑44) | USA300HOU_RS04485/USA300HOU_RS04490 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 1586025 = | 124 (1.350) | intergenic (‑18/+109) | USA300HOU_RS07770/USA300TCH1516_01451 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 920377 = | 81 (0.820) | 9 (0.110) | 7/132 | NT | 12.9% | intergenic (+6/‑207) | USA300HOU_RS04555/USA300HOU_RS04565 | Putative monooxygenase/hypothetical protein |
| ? | USA300TCH1516_ALE | 920443 = | 55 (0.680) | intergenic (+72/‑141) | USA300HOU_RS04555/USA300HOU_RS04565 | Putative monooxygenase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 920690 | 71 (0.720) | 8 (0.090) | 5/138 | NT | 11.2% | coding (107/849 nt) | USA300HOU_RS04565 | hypothetical protein |
| ? | USA300TCH1516_ALE | = 920717 | 66 (0.780) | coding (134/849 nt) | USA300HOU_RS04565 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 933411 | 69 (0.700) | 24 (0.300) | 13/130 | NT | 27.0% | intergenic (+28/+31) | USA300HOU_RS04645/yjlD | hypothetical protein/NADH dehydrogenase‑like protein YjlD |
| ? | USA300TCH1516_ALE | = 933421 | 74 (0.930) | intergenic (+38/+21) | USA300HOU_RS04645/yjlD | hypothetical protein/NADH dehydrogenase‑like protein YjlD | |||||
| * | ? | USA300TCH1516_ALE | 940816 = | 101 (1.030) | 10 (0.110) | 6/148 | NT | 10.5% | coding (372/375 nt) | USA300HOU_RS04680 | Putative esterase |
| ? | USA300TCH1516_ALE | 940879 = | 77 (0.850) | coding (1151/1155 nt) | ptlE | Neopentalenolactone D synthase | |||||
| * | ? | USA300TCH1516_ALE | 943421 = | 100 (1.020) | 7 (0.080) | 4/142 | NT | 7.6% | coding (1462/1497 nt) | mnhD1_2 | Na(+)/H(+) antiporter subunit D1 |
| ? | USA300TCH1516_ALE | 943487 = | 81 (0.930) | coding (1396/1497 nt) | mnhD1_2 | Na(+)/H(+) antiporter subunit D1 | |||||
| * | ? | USA300TCH1516_ALE | = 951516 | 84 (0.850) | 5 (0.060) | 4/144 | NT | 5.5% | intergenic (+21/‑287) | USA300HOU_RS04740/rocD2_2 | putative oxidoreductase/Ornithine aminotransferase 2 |
| ? | USA300TCH1516_ALE | = 951537 | 96 (1.080) | intergenic (+42/‑266) | USA300HOU_RS04740/rocD2_2 | putative oxidoreductase/Ornithine aminotransferase 2 | |||||
| * | ? | USA300TCH1516_ALE | 954365 = | 53 (0.540) | 7 (0.080) | 6/138 | NT | 13.1% | intergenic (+19/+484) | gluD/glpQ_1 | NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase |
| ? | USA300TCH1516_ALE | 954407 = | 47 (0.550) | intergenic (+61/+442) | gluD/glpQ_1 | NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase | |||||
| * | ? | USA300TCH1516_ALE | = 954375 | 53 (0.540) | 9 (0.110) | 6/138 | NT | 16.3% | intergenic (+29/+474) | gluD/glpQ_1 | NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase |
| ? | USA300TCH1516_ALE | = 954395 | 47 (0.550) | intergenic (+49/+454) | gluD/glpQ_1 | NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase | |||||
| * | ? | USA300TCH1516_ALE | = 971402 | 96 (0.980) | 8 (0.090) | 6/142 | NT | 8.2% | intergenic (+30/+141) | USA300HOU_RS04810/cdr | hypothetical protein/Coenzyme A disulfide reductase |
| ? | USA300TCH1516_ALE | = 971425 | 95 (1.090) | intergenic (+53/+118) | USA300HOU_RS04810/cdr | hypothetical protein/Coenzyme A disulfide reductase | |||||
| * | ? | USA300TCH1516_ALE | 979658 = | 112 (1.140) | 9 (0.100) | 4/144 | NT | 8.5% | coding (601/870 nt) | ampR | HTH‑type transcriptional activator AmpR |
| ? | USA300TCH1516_ALE | 979694 = | 94 (1.060) | coding (565/870 nt) | ampR | HTH‑type transcriptional activator AmpR | |||||
| * | ? | USA300TCH1516_ALE | 1005781 = | 113 (1.150) | 20 (0.240) | 10/138 | NT | 16.2% | intergenic (+417/+43) | pepF1_1/USA300HOU_RS04965 | Oligoendopeptidase F, plasmid/hypothetical protein |
| ? | USA300TCH1516_ALE | 1005817 = | 109 (1.290) | intergenic (+453/+7) | pepF1_1/USA300HOU_RS04965 | Oligoendopeptidase F, plasmid/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1005791 | 120 (1.220) | 15 (0.180) | 8/138 | NT | 12.4% | intergenic (+427/+33) | pepF1_1/USA300HOU_RS04965 | Oligoendopeptidase F, plasmid/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1005805 | 109 (1.290) | intergenic (+441/+19) | pepF1_1/USA300HOU_RS04965 | Oligoendopeptidase F, plasmid/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1032068 | 71 (0.720) | 7 (0.080) | 7/146 | NT | 9.7% | coding (1056/1515 nt) | yfkN_2 | Trifunctional nucleotide phosphoesterase protein YfkN |
| ? | USA300TCH1516_ALE | = 1032096 | 66 (0.740) | coding (1084/1515 nt) | yfkN_2 | Trifunctional nucleotide phosphoesterase protein YfkN | |||||
| * | ? | USA300TCH1516_ALE | 1040357 = | 101 (1.030) | 23 (0.280) | 11/132 | NT | 23.4% | intergenic (+18/+70) | USA300TCH1516_00966/USA300TCH1516_00967 | putative ABC transporter ATP‑binding protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 1040412 = | 67 (0.830) | intergenic (+73/+15) | USA300TCH1516_00966/USA300TCH1516_00967 | putative ABC transporter ATP‑binding protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1058102 = | 92 (0.940) | 5 (0.060) | 4/144 | NT | 6.6% | intergenic (+143/+64) | slyA_2/atl_1 | Transcriptional regulator SlyA/Bifunctional autolysin |
| ? | USA300TCH1516_ALE | 1058152 = | 59 (0.670) | intergenic (+193/+14) | slyA_2/atl_1 | Transcriptional regulator SlyA/Bifunctional autolysin | |||||
| * | ? | USA300TCH1516_ALE | = 1084763 | 82 (0.830) | 15 (0.170) | 10/140 | NT | 16.3% | intergenic (+135/+130) | purD/ykoC_1 | Phosphoribosylamine‑‑glycine ligase/Putative HMP/thiamine permease protein YkoC |
| ? | USA300TCH1516_ALE | = 1084806 | 82 (0.950) | intergenic (+178/+87) | purD/ykoC_1 | Phosphoribosylamine‑‑glycine ligase/Putative HMP/thiamine permease protein YkoC | |||||
| * | ? | USA300TCH1516_ALE | 1086962 = | 81 (0.820) | 5 (0.060) | 5/140 | NT | 7.1% | coding (131/1401 nt) | ykoD_1 | Putative HMP/thiamine import ATP‑binding protein YkoD |
| ? | USA300TCH1516_ALE | 1087000 = | 59 (0.690) | coding (93/1401 nt) | ykoD_1 | Putative HMP/thiamine import ATP‑binding protein YkoD | |||||
| * | ? | USA300TCH1516_ALE | 1087705 = | 76 (0.770) | 16 (0.180) | 10/148 | NT | 19.1% | intergenic (‑23/+561) | ykoE/USA300TCH1516_01011 | Putative HMP/thiamine permease protein YkoE/hypothetical protein |
| ? | USA300TCH1516_ALE | 1087738 = | 65 (0.710) | intergenic (‑56/+528) | ykoE/USA300TCH1516_01011 | Putative HMP/thiamine permease protein YkoE/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1098317 | 102 (1.040) | 5 (0.060) | 4/132 | NT | 5.3% | intergenic (+296/+53) | ktrA/rnj1 | Ktr system potassium uptake protein A/Ribonuclease J 1 |
| ? | USA300TCH1516_ALE | = 1098353 | 96 (1.180) | intergenic (+332/+17) | ktrA/rnj1 | Ktr system potassium uptake protein A/Ribonuclease J 1 | |||||
| * | ? | USA300TCH1516_ALE | 1114090 = | 60 (0.610) | 9 (0.120) | 6/126 | NT | 15.8% | intergenic (+19/+63) | USA300HOU_RS05510/mntH_1 | hypothetical protein/Divalent metal cation transporter MntH |
| ? | USA300TCH1516_ALE | 1114149 = | 49 (0.630) | intergenic (+78/+4) | USA300HOU_RS05510/mntH_1 | hypothetical protein/Divalent metal cation transporter MntH | |||||
| * | ? | USA300TCH1516_ALE | = 1114106 | 58 (0.590) | 5 (0.060) | 5/126 | NT | 9.6% | intergenic (+35/+47) | USA300HOU_RS05510/mntH_1 | hypothetical protein/Divalent metal cation transporter MntH |
| ? | USA300TCH1516_ALE | = 1114131 | 49 (0.630) | intergenic (+60/+22) | USA300HOU_RS05510/mntH_1 | hypothetical protein/Divalent metal cation transporter MntH | |||||
| * | ? | USA300TCH1516_ALE | = 1115642 | 105 (1.070) | 23 (0.260) | 8/146 | NT | 20.1% | intergenic (‑137/+47) | mntH_1/USA300TCH1516_01038 | Divalent metal cation transporter MntH/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1115662 | 87 (0.970) | intergenic (‑157/+27) | mntH_1/USA300TCH1516_01038 | Divalent metal cation transporter MntH/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1117293 = | 90 (0.920) | 9 (0.110) | 6/130 | NT | 11.0% | intergenic (+6/+148) | suhB_1/USA300TCH1516_01040 | Inositol‑1‑monophosphatase/hypothetical protein |
| ? | USA300TCH1516_ALE | 1117341 = | 73 (0.910) | intergenic (+54/+100) | suhB_1/USA300TCH1516_01040 | Inositol‑1‑monophosphatase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1119593 = | 104 (1.060) | 8 (0.100) | 4/136 | NT | 9.4% | intergenic (+12/+297) | typA/USA300HOU_RS05545 | GTP‑binding protein TypA/BipA/hypothetical protein |
| ? | USA300TCH1516_ALE | 1119635 = | 65 (0.780) | intergenic (+54/+255) | typA/USA300HOU_RS05545 | GTP‑binding protein TypA/BipA/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1129293 = | 63 (0.640) | 5 (0.060) | 4/144 | NT | 7.5% | intergenic (+71/‑256) | USA300HOU_RS05575/USA300HOU_RS05585 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 1129331 = | 67 (0.760) | intergenic (+109/‑218) | USA300HOU_RS05575/USA300HOU_RS05585 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1129300 | 66 (0.670) | 4 (0.050) | 4/144 | NT | 6.0% | intergenic (+78/‑249) | USA300HOU_RS05575/USA300HOU_RS05585 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1129322 | 67 (0.760) | intergenic (+100/‑227) | USA300HOU_RS05575/USA300HOU_RS05585 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1131036 = | 91 (0.930) | 8 (0.100) | 7/126 | NT | 11.2% | coding (435/435 nt) | USA300HOU_RS05590 | hypothetical protein |
| ? | USA300TCH1516_ALE | 1131101 = | 55 (0.710) | coding (925/927 nt) | glpQ1 | putative glycerophosphodiester phosphodiesterase 1 | |||||
| * | ? | USA300TCH1516_ALE | 1131322 = | 82 (0.830) | 4 (0.040) | 5/148 | NT | 5.1% | coding (704/927 nt) | glpQ1 | putative glycerophosphodiester phosphodiesterase 1 |
| ? | USA300TCH1516_ALE | 1131337 = | 74 (0.810) | coding (689/927 nt) | glpQ1 | putative glycerophosphodiester phosphodiesterase 1 | |||||
| * | ? | USA300TCH1516_ALE | = 1134027 | 85 (0.860) | 8 (0.100) | 5/132 | NT | 8.7% | intergenic (+21/+41) | coaD/USA300HOU_RS05620 | Phosphopantetheine adenylyltransferase/Nicotinamide‑nucleotide adenylyltransferase |
| ? | USA300TCH1516_ALE | = 1134045 | 98 (1.210) | intergenic (+39/+23) | coaD/USA300HOU_RS05620 | Phosphopantetheine adenylyltransferase/Nicotinamide‑nucleotide adenylyltransferase | |||||
| * | ? | USA300TCH1516_ALE | 1135893 = | 99 (1.010) | 10 (0.120) | 6/136 | NT | 10.0% | intergenic (+2/‑78) | USA300TCH1516_01057/rpmF | hypothetical protein/50S ribosomal protein L32 |
| ? | USA300TCH1516_ALE | 1135930 = | 96 (1.150) | intergenic (+39/‑41) | USA300TCH1516_01057/rpmF | hypothetical protein/50S ribosomal protein L32 | |||||
| * | ? | USA300TCH1516_ALE | = 1136225 | 104 (1.060) | 14 (0.160) | 8/142 | NT | 12.4% | intergenic (+81/+73) | rpmF/isdB | 50S ribosomal protein L32/Iron‑regulated surface determinant protein B |
| ? | USA300TCH1516_ALE | = 1136249 | 105 (1.200) | intergenic (+105/+49) | rpmF/isdB | 50S ribosomal protein L32/Iron‑regulated surface determinant protein B | |||||
| * | ? | USA300TCH1516_ALE | 1149421 = | 83 (0.840) | 6 (0.070) | 5/138 | NT | 7.6% | intergenic (+7/+164) | pheT_1/rnhC | Phenylalanine‑‑tRNA ligase beta subunit/Ribonuclease HIII |
| ? | USA300TCH1516_ALE | 1149475 = | 74 (0.870) | intergenic (+61/+110) | pheT_1/rnhC | Phenylalanine‑‑tRNA ligase beta subunit/Ribonuclease HIII | |||||
| * | ? | USA300TCH1516_ALE | 1181842 = | 111 (1.130) | 9 (0.100) | 5/144 | NT | 9.2% | intergenic (+409/+65) | USA300HOU_RS05885/USA300TCH1516_01103 | hypothetical protein/tRNA‑Arg |
| ? | USA300TCH1516_ALE | 1181881 = | 77 (0.870) | intergenic (+448/+26) | USA300HOU_RS05885/USA300TCH1516_01103 | hypothetical protein/tRNA‑Arg | |||||
| * | ? | USA300TCH1516_ALE | 1182136 = | 106 (1.080) | 12 (0.140) | 8/140 | NT | 12.5% | intergenic (‑154/‑209) | USA300TCH1516_01103/USA300HOU_RS05895 | tRNA‑Arg/Antibacterial protein 3 |
| ? | USA300TCH1516_ALE | 1182166 = | 76 (0.880) | intergenic (‑184/‑179) | USA300TCH1516_01103/USA300HOU_RS05895 | tRNA‑Arg/Antibacterial protein 3 | |||||
| * | ? | USA300TCH1516_ALE | 1182690 = | 121 (1.230) | 5 (0.060) | 4/136 | NT | 5.1% | intergenic (+20/‑113) | USA300HOU_RS05900/yfnB | Antibacterial protein 3/Putative HAD‑hydrolase YfnB |
| ? | USA300TCH1516_ALE | 1182741 = | 84 (1.010) | intergenic (+71/‑62) | USA300HOU_RS05900/yfnB | Antibacterial protein 3/Putative HAD‑hydrolase YfnB | |||||
| * | ? | USA300TCH1516_ALE | = 1183556 | 113 (1.150) | 9 (0.100) | 7/140 | NT | 7.7% | intergenic (+67/+42) | yfnB/USA300HOU_RS05910 | Putative HAD‑hydrolase YfnB/putative N‑acetyltransferase |
| ? | USA300TCH1516_ALE | = 1183574 | 116 (1.350) | intergenic (+85/+24) | yfnB/USA300HOU_RS05910 | Putative HAD‑hydrolase YfnB/putative N‑acetyltransferase | |||||
| * | ? | USA300TCH1516_ALE | = 1199293 | 92 (0.940) | 9 (0.100) | 8/144 | NT | 8.7% | intergenic (+20/‑63) | USA300HOU_RS05980/USA300HOU_RS05985 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1199312 | 106 (1.200) | intergenic (+39/‑44) | USA300HOU_RS05980/USA300HOU_RS05985 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1205038 = | 91 (0.930) | 16 (0.180) | 11/148 | NT | 16.0% | coding (82/195 nt) | USA300HOU_RS15290 | hypothetical protein |
| ? | USA300TCH1516_ALE | = 1427022 | NA (NA) | intergenic (‑753/+219) | pstS/cvfB | Phosphate‑binding protein PstS/Conserved virulence factor B | |||||
| * | ? | USA300TCH1516_ALE | = 1217693 | 92 (0.940) | 5 (0.060) | 5/128 | NT | 5.9% | intergenic (+22/‑415) | USA300HOU_RS06060/USA300HOU_RS06065 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1217729 | 87 (1.110) | intergenic (+58/‑379) | USA300HOU_RS06060/USA300HOU_RS06065 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1227656 | 89 (0.910) | 10 (0.110) | 8/148 | NT | 10.7% | coding (125/489 nt) | def1 | Peptide deformylase 1 |
| ? | USA300TCH1516_ALE | = 1227672 | 85 (0.930) | coding (141/489 nt) | def1 | Peptide deformylase 1 | |||||
| * | ? | USA300TCH1516_ALE | = 1236587 | 71 (0.720) | 10 (0.110) | 6/144 | NT | 11.8% | intergenic (+101/+280) | thiN/rpmB | Thiamine pyrophosphokinase/50S ribosomal protein L28 |
| ? | USA300TCH1516_ALE | = 1236607 | 86 (0.970) | intergenic (+121/+260) | thiN/rpmB | Thiamine pyrophosphokinase/50S ribosomal protein L28 | |||||
| * | ? | USA300TCH1516_ALE | 1255833 = | 96 (0.980) | 8 (0.090) | 4/138 | NT | 9.5% | intergenic (+49/+195) | rplS/USA300HOU_RS06250 | 50S ribosomal protein L19/hypothetical protein |
| ? | USA300TCH1516_ALE | 1255876 = | 70 (0.830) | intergenic (+92/+152) | rplS/USA300HOU_RS06250 | 50S ribosomal protein L19/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1255967 = | 82 (0.830) | 10 (0.120) | 6/134 | NT | 14.1% | intergenic (+183/+61) | rplS/USA300HOU_RS06250 | 50S ribosomal protein L19/hypothetical protein |
| ? | USA300TCH1516_ALE | 1256006 = | 53 (0.640) | intergenic (+222/+22) | rplS/USA300HOU_RS06250 | 50S ribosomal protein L19/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1262900 = | 95 (0.970) | 7 (0.080) | 5/140 | NT | 7.6% | intergenic (+25/‑202) | sucD/lytN_1 | Succinate‑‑CoA ligase [ADP‑forming] subunit alpha/putative cell wall hydrolase LytN |
| ? | USA300TCH1516_ALE | 1262943 = | 87 (1.010) | intergenic (+68/‑159) | sucD/lytN_1 | Succinate‑‑CoA ligase [ADP‑forming] subunit alpha/putative cell wall hydrolase LytN | |||||
| * | ? | USA300TCH1516_ALE | = 1262909 | 97 (0.990) | 5 (0.060) | 4/140 | NT | 5.5% | intergenic (+34/‑193) | sucD/lytN_1 | Succinate‑‑CoA ligase [ADP‑forming] subunit alpha/putative cell wall hydrolase LytN |
| ? | USA300TCH1516_ALE | = 1262932 | 87 (1.010) | intergenic (+57/‑170) | sucD/lytN_1 | Succinate‑‑CoA ligase [ADP‑forming] subunit alpha/putative cell wall hydrolase LytN | |||||
| * | ? | USA300TCH1516_ALE | 1265497 = | 98 (1.000) | 15 (0.190) | 8/130 | NT | 15.1% | intergenic (+5/‑168) | femA_1/dprA | Aminoacyltransferase FemA/DNA processing protein DprA |
| ? | USA300TCH1516_ALE | 1265543 = | 89 (1.110) | intergenic (+51/‑122) | femA_1/dprA | Aminoacyltransferase FemA/DNA processing protein DprA | |||||
| * | ? | USA300TCH1516_ALE | = 1265511 | 93 (0.950) | 17 (0.210) | 10/130 | NT | 17.1% | intergenic (+19/‑154) | femA_1/dprA | Aminoacyltransferase FemA/DNA processing protein DprA |
| ? | USA300TCH1516_ALE | = 1265527 | 89 (1.110) | intergenic (+35/‑138) | femA_1/dprA | Aminoacyltransferase FemA/DNA processing protein DprA | |||||
| * | ? | USA300TCH1516_ALE | 1271425 = | 87 (0.880) | 7 (0.080) | 5/146 | NT | 9.1% | coding (760/897 nt) | xerC_1 | Tyrosine recombinase XerC |
| ? | USA300TCH1516_ALE | 1271456 = | 61 (0.680) | coding (791/897 nt) | xerC_1 | Tyrosine recombinase XerC | |||||
| * | ? | USA300TCH1516_ALE | 1279936 = | 101 (1.030) | 16 (0.240) +25 bp |
6/110 | NT | 18.5% | intergenic (+29/‑233) | cdsA/USA300HOU_RS06360 | Phosphatidate cytidylyltransferase/Putative zinc metalloprotease |
| ? | USA300TCH1516_ALE | 1279975 = | 104 (1.060) | intergenic (+68/‑194) | cdsA/USA300HOU_RS06360 | Phosphatidate cytidylyltransferase/Putative zinc metalloprotease | |||||
| * | ? | USA300TCH1516_ALE | = 1281507 | 60 (0.610) | 9 (0.100) | 6/146 | NT | 12.4% | coding (33/1704 nt) | proS | Proline‑‑tRNA ligase |
| ? | USA300TCH1516_ALE | = 1281540 | 72 (0.800) | coding (66/1704 nt) | proS | Proline‑‑tRNA ligase | |||||
| * | ? | USA300TCH1516_ALE | = 1283202 | 96 (0.980) | 7 (0.080) | 5/146 | NT | 7.3% | intergenic (+24/‑234) | proS/polC_1 | Proline‑‑tRNA ligase/DNA polymerase III PolC‑type |
| ? | USA300TCH1516_ALE | = 1283240 | 89 (0.990) | intergenic (+62/‑196) | proS/polC_1 | Proline‑‑tRNA ligase/DNA polymerase III PolC‑type | |||||
| * | ? | USA300TCH1516_ALE | 1283482 = | 136 (1.380) | 10 (0.120) | 7/138 | NT | 8.4% | coding (47/4317 nt) | polC_1 | DNA polymerase III PolC‑type |
| ? | USA300TCH1516_ALE | 1283518 = | 101 (1.190) | coding (83/4317 nt) | polC_1 | DNA polymerase III PolC‑type | |||||
| * | ? | USA300TCH1516_ALE | 1292484 = | 88 (0.890) | 9 (0.110) | 6/128 | NT | 12.0% | intergenic (+38/‑348) | infB/rbfA | Translation initiation factor IF‑2/Ribosome‑binding factor A |
| ? | USA300TCH1516_ALE | 1292539 = | 62 (0.790) | intergenic (+93/‑293) | infB/rbfA | Translation initiation factor IF‑2/Ribosome‑binding factor A | |||||
| * | ? | USA300TCH1516_ALE | = 1298112 | 94 (0.960) | 14 (0.150) | 9/154 | NT | 13.6% | intergenic (+8/‑228) | pnp/rnj2 | Polyribonucleotide nucleotidyltransferase/Ribonuclease J 2 |
| ? | USA300TCH1516_ALE | = 1298143 | 88 (0.930) | intergenic (+39/‑197) | pnp/rnj2 | Polyribonucleotide nucleotidyltransferase/Ribonuclease J 2 | |||||
| * | ? | USA300TCH1516_ALE | = 1303447 | 103 (1.050) | 8 (0.090) | 5/138 | NT | 8.0% | coding (61/1266 nt) | USA300HOU_RS06440 | putative zinc protease |
| ? | USA300TCH1516_ALE | = 1303460 | 96 (1.130) | coding (74/1266 nt) | USA300HOU_RS06440 | putative zinc protease | |||||
| * | ? | USA300TCH1516_ALE | = 1314645 | 91 (0.930) | 9 (0.100) | 5/150 | NT | 9.8% | intergenic (+66/‑74) | USA300HOU_RS06490/korA | hypothetical protein/2‑oxoglutarate oxidoreductase subunit KorA |
| ? | USA300TCH1516_ALE | = 1314663 | 80 (0.870) | intergenic (+84/‑56) | USA300HOU_RS06490/korA | hypothetical protein/2‑oxoglutarate oxidoreductase subunit KorA | |||||
| * | ? | USA300TCH1516_ALE | 1317352 = | 91 (0.930) | 9 (0.100) | 6/140 | NT | 10.9% | intergenic (+6/‑88) | korB/USA300HOU_RS06505 | 2‑oxoglutarate oxidoreductase subunit KorB/hypothetical protein |
| ? | USA300TCH1516_ALE | 1317407 = | 68 (0.790) | intergenic (+61/‑33) | korB/USA300HOU_RS06505 | 2‑oxoglutarate oxidoreductase subunit KorB/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1323767 = | 128 (1.300) | 6 (0.070) | 4/148 | NT | 5.3% | coding (539/2010 nt) | mutL | DNA mismatch repair protein MutL |
| ? | USA300TCH1516_ALE | 1323805 = | 98 (1.080) | coding (577/2010 nt) | mutL | DNA mismatch repair protein MutL | |||||
| * | ? | USA300TCH1516_ALE | = 1330548 | 89 (0.910) | 6 (0.070) | 5/148 | NT | 7.2% | intergenic (+23/‑124) | glpD/USA300HOU_RS06555 | Aerobic glycerol‑3‑phosphate dehydrogenase/Monoacylglycerol lipase |
| ? | USA300TCH1516_ALE | = 1330568 | 72 (0.790) | intergenic (+43/‑104) | glpD/USA300HOU_RS06555 | Aerobic glycerol‑3‑phosphate dehydrogenase/Monoacylglycerol lipase | |||||
| * | ? | USA300TCH1516_ALE | = 1332949 | 84 (0.850) | 7 (0.090) | 5/124 | NT | 8.1% | intergenic (+159/+63) | hfq/bsaA_1 | RNA‑binding protein Hfq/Glutathione peroxidase BsaA |
| ? | USA300TCH1516_ALE | = 1332971 | 94 (1.230) | intergenic (+181/+41) | hfq/bsaA_1 | RNA‑binding protein Hfq/Glutathione peroxidase BsaA | |||||
| * | ? | USA300TCH1516_ALE | 1336102 = | 102 (1.040) | 9 (0.110) | 5/138 | NT | 9.4% | intergenic (+7/‑236) | mgl/glnR | L‑methionine gamma‑lyase/HTH‑type transcriptional regulator GlnR |
| ? | USA300TCH1516_ALE | 1336142 = | 86 (1.010) | intergenic (+47/‑196) | mgl/glnR | L‑methionine gamma‑lyase/HTH‑type transcriptional regulator GlnR | |||||
| * | ? | USA300TCH1516_ALE | 1341822 = | 165 (1.680) | 12 (0.130) | 8/148 | NT | 7.4% | intergenic (+230/‑282) | USA300HOU_RS06615/USA300TCH1516_01244 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 1341877 = | 147 (1.620) | intergenic (+285/‑227) | USA300HOU_RS06615/USA300TCH1516_01244 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1347832 | 155 (1.580) | 9 (0.100) | 7/148 | NT | 6.1% | intergenic (+14/‑44) | USA300HOU_RS06695/cls_1 | hypothetical protein/Cardiolipin synthase |
| ? | USA300TCH1516_ALE | = 1347851 | 134 (1.470) | intergenic (+33/‑25) | USA300HOU_RS06695/cls_1 | hypothetical protein/Cardiolipin synthase | |||||
| * | ? | USA300TCH1516_ALE | = 1353906 | 89 (0.910) | 10 (0.120) | 7/134 | NT | 10.2% | intergenic (+99/+44) | nucH/USA300HOU_RS06735 | Thermonuclease/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1353932 | 101 (1.230) | intergenic (+125/+18) | nucH/USA300HOU_RS06735 | Thermonuclease/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1355713 = | 90 (0.920) | 10 (0.120) | 7/138 | NT | 11.7% | intergenic (+3/+51) | USA300HOU_RS06740/yclM | hypothetical protein/Aspartokinase 3 |
| ? | USA300TCH1516_ALE | 1355761 = | 74 (0.870) | intergenic (+51/+3) | USA300HOU_RS06740/yclM | hypothetical protein/Aspartokinase 3 | |||||
| * | ? | USA300TCH1516_ALE | = 1355723 | 90 (0.920) | 6 (0.070) | 5/138 | NT | 7.3% | intergenic (+13/+41) | USA300HOU_RS06740/yclM | hypothetical protein/Aspartokinase 3 |
| ? | USA300TCH1516_ALE | = 1355749 | 74 (0.870) | intergenic (+39/+15) | USA300HOU_RS06740/yclM | hypothetical protein/Aspartokinase 3 | |||||
| * | ? | USA300TCH1516_ALE | 1355817 = | 108 (1.100) | 6 (0.070) | 5/144 | NT | 5.7% | coding (1330/1383 nt) | yclM | Aspartokinase 3 |
| ? | USA300TCH1516_ALE | 1355853 = | 101 (1.140) | coding (1294/1383 nt) | yclM | Aspartokinase 3 | |||||
| * | ? | USA300TCH1516_ALE | = 1365739 | 99 (1.010) | 14 (0.150) | 11/148 | NT | 12.2% | intergenic (+38/‑416) | rpmG2_1/rpsN2 | 50S ribosomal protein L33 2/Alternate 30S ribosomal protein S14 |
| ? | USA300TCH1516_ALE | = 1365764 | 109 (1.200) | intergenic (+63/‑391) | rpmG2_1/rpsN2 | 50S ribosomal protein L33 2/Alternate 30S ribosomal protein S14 | |||||
| * | ? | USA300TCH1516_ALE | = 1366496 | 118 (1.200) | 8 (0.090) | 6/152 | NT | 6.4% | intergenic (+72/‑85) | rpsN2/guaC | Alternate 30S ribosomal protein S14/GMP reductase |
| ? | USA300TCH1516_ALE | = 1366530 | 122 (1.310) | intergenic (+106/‑51) | rpsN2/guaC | Alternate 30S ribosomal protein S14/GMP reductase | |||||
| * | ? | USA300TCH1516_ALE | 1368741 = | 111 (1.130) | 7 (0.080) | 4/150 | NT | 6.3% | intergenic (+145/+235) | USA300TCH1516_01277/lexA_1 | hypothetical protein/LexA repressor |
| ? | USA300TCH1516_ALE | 1368771 = | 103 (1.120) | intergenic (+175/+205) | USA300TCH1516_01277/lexA_1 | hypothetical protein/LexA repressor | |||||
| * | ? | USA300TCH1516_ALE | = 1371846 | 71 (0.720) | 7 (0.080) | 5/142 | NT | 9.2% | coding (1376/1989 nt) | tkt | Transketolase |
| ? | USA300TCH1516_ALE | = 1371866 | 75 (0.860) | coding (1396/1989 nt) | tkt | Transketolase | |||||
| * | ? | USA300TCH1516_ALE | = 1383873 | 91 (0.930) | 6 (0.060) | 5/154 | NT | 6.4% | intergenic (+90/‑90) | acnA/USA300HOU_RS06875 | Aconitate hydratase A/Putative esterase |
| ? | USA300TCH1516_ALE | = 1383903 | 88 (0.930) | intergenic (+120/‑60) | acnA/USA300HOU_RS06875 | Aconitate hydratase A/Putative esterase | |||||
| * | ? | USA300TCH1516_ALE | 1392266 = | 121 (1.230) | 11 (0.130) | 9/140 | NT | 10.1% | intergenic (+40/‑460) | alsT/glcT | Amino‑acid carrier protein AlsT/GlcA/glcB genes antiterminator |
| ? | USA300TCH1516_ALE | 1392308 = | 90 (1.050) | intergenic (+82/‑418) | alsT/glcT | Amino‑acid carrier protein AlsT/GlcA/glcB genes antiterminator | |||||
| * | ? | USA300TCH1516_ALE | = 1394937 | 92 (0.940) | 5 (0.060) | 5/132 | NT | 5.5% | intergenic (+17/‑464) | tqsA/mprF | AI‑2 transport protein TqsA/Phosphatidylglycerol lysyltransferase |
| ? | USA300TCH1516_ALE | = 1394951 | 95 (1.170) | intergenic (+31/‑450) | tqsA/mprF | AI‑2 transport protein TqsA/Phosphatidylglycerol lysyltransferase | |||||
| * | ? | USA300TCH1516_ALE | 1414391 = | 84 (0.850) | 7 (0.080) | 4/150 | NT | 9.2% | coding (170/768 nt) | yitU_2 | 5‑amino‑6‑(5‑phospho‑D‑ribitylamino)uracil phosphatase YitU |
| ? | USA300TCH1516_ALE | 1414420 = | 60 (0.650) | coding (199/768 nt) | yitU_2 | 5‑amino‑6‑(5‑phospho‑D‑ribitylamino)uracil phosphatase YitU | |||||
| * | ? | USA300TCH1516_ALE | = 1439024 | 116 (1.180) | 12 (0.130) | 7/146 | NT | 10.3% | intergenic (+22/+218) | lysA/USA300HOU_RS07135 | Diaminopimelate decarboxylase/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1439047 | 104 (1.160) | intergenic (+45/+195) | lysA/USA300HOU_RS07135 | Diaminopimelate decarboxylase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1443204 = | 100 (1.020) | 7 (0.110) +30 bp |
6/100 | NT | 10.1% | coding (224/393 nt) | USA300TCH1516_01342 | hypothetical protein |
| ? | USA300TCH1516_ALE | 1803072 = | NA (NA) | coding (796/807 nt) | USA300HOU_RS12765 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1453877 = | 81 (0.820) | 14 (0.160) | 8/146 | NT | 15.5% | coding (45/2799 nt) | odhA | 2‑oxoglutarate dehydrogenase E1 component |
| ? | USA300TCH1516_ALE | 1453904 = | 79 (0.880) | coding (18/2799 nt) | odhA | 2‑oxoglutarate dehydrogenase E1 component | |||||
| * | ? | USA300TCH1516_ALE | 1454597 = | 138 (1.400) | 9 (0.100) | 5/146 | NT | 7.3% | coding (964/1356 nt) | arlS | Signal transduction histidine‑protein kinase ArlS |
| ? | USA300TCH1516_ALE | 1454633 = | 102 (1.140) | coding (928/1356 nt) | arlS | Signal transduction histidine‑protein kinase ArlS | |||||
| * | ? | USA300TCH1516_ALE | 1456948 = | 147 (1.490) | 16 (0.200) | 9/132 | NT | 13.0% | intergenic (‑62/‑182) | USA300HOU_RS07230/USA300HOU_RS07235 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 1456990 = | 93 (1.150) | intergenic (‑104/‑140) | USA300HOU_RS07230/USA300HOU_RS07235 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1456995 = | 90 (0.920) | 16 (0.170) +TTAAA |
8/150 | NT | 14.9% | intergenic (‑109/‑135) | USA300HOU_RS07230/USA300HOU_RS07235 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1918582 | 105 (1.070) | intergenic (‑300/+198) | USA300HOU_RS07235/USA300HOU_RS09510 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1460298 | 79 (0.800) | 15 (0.190) | 10/128 | NT | 18.1% | intergenic (‑330/+70) | USA300HOU_RS07250/USA300HOU_RS07255 | hypothetical protein/putative CtpA‑like serine protease |
| ? | USA300TCH1516_ALE | = 1460310 | 73 (0.930) | intergenic (‑342/+58) | USA300HOU_RS07250/USA300HOU_RS07255 | hypothetical protein/putative CtpA‑like serine protease | |||||
| * | ? | USA300TCH1516_ALE | = 1469397 | 74 (0.750) | 5 (0.060) | 5/144 | NT | 6.2% | coding (345/705 nt) | yhhQ | Inner membrane protein YhhQ |
| ? | USA300TCH1516_ALE | = 1469422 | 84 (0.950) | coding (370/705 nt) | yhhQ | Inner membrane protein YhhQ | |||||
| * | ? | USA300TCH1516_ALE | = 1470044 | NA (NA) | 15 (0.160) | 9/150 | NT | 14.4% | intergenic (‑91/‑254) | USA300TCH1516_01369/rnhA | hypothetical protein/14.7 kDa ribonuclease H‑like protein |
| ? | USA300TCH1516_ALE | = 2866850 | 95 (0.970) | intergenic (‑249/+204) | USA300HOU_RS14695/noc_2 | hypothetical protein/Nucleoid occlusion protein | |||||
| * | ? | USA300TCH1516_ALE | = 1494261 | 55 (0.560) | 7 (0.080) | 4/150 | NT | 11.2% | coding (7763/31266 nt) | ebh_1 | Extracellular matrix‑binding protein ebh |
| ? | USA300TCH1516_ALE | = 1494291 | 59 (0.640) | coding (7733/31266 nt) | ebh_1 | Extracellular matrix‑binding protein ebh | |||||
| * | ? | USA300TCH1516_ALE | 1502964 = | 112 (1.140) | 6 (0.070) | 4/146 | NT | 5.7% | coding (849/1392 nt) | norB_4 | Quinolone resistance protein NorB |
| ? | USA300TCH1516_ALE | 1503001 = | 95 (1.060) | coding (812/1392 nt) | norB_4 | Quinolone resistance protein NorB | |||||
| * | ? | USA300TCH1516_ALE | 1507967 = | 79 (0.800) | 9 (0.110) | 8/128 | NT | 11.6% | intergenic (‑392/+83) | ald1/ypcP | Alanine dehydrogenase 1/5'‑3' exonuclease |
| ? | USA300TCH1516_ALE | 1508010 = | 74 (0.940) | intergenic (‑435/+40) | ald1/ypcP | Alanine dehydrogenase 1/5'‑3' exonuclease | |||||
| * | ? | USA300TCH1516_ALE | = 1507982 | 83 (0.840) | 21 (0.270) | 9/128 | NT | 23.0% | intergenic (‑407/+68) | ald1/ypcP | Alanine dehydrogenase 1/5'‑3' exonuclease |
| ? | USA300TCH1516_ALE | = 1507993 | 74 (0.940) | intergenic (‑418/+57) | ald1/ypcP | Alanine dehydrogenase 1/5'‑3' exonuclease | |||||
| * | ? | USA300TCH1516_ALE | 1519629 = | 109 (1.110) | 8 (0.090) | 4/144 | NT | 7.9% | coding (753/2184 nt) | ponA | Penicillin‑binding protein 1A/1B |
| ? | USA300TCH1516_ALE | 1519680 = | 89 (1.010) | coding (804/2184 nt) | ponA | Penicillin‑binding protein 1A/1B | |||||
| * | ? | USA300TCH1516_ALE | 1532094 = | 129 (1.310) | 7 (0.080) | 5/146 | NT | 6.4% | intergenic (‑263/+74) | USA300HOU_RS07465/USA300HOU_RS07470 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 1532129 = | 88 (0.980) | intergenic (‑298/+39) | USA300HOU_RS07465/USA300HOU_RS07470 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1535925 | 86 (0.870) | 6 (0.070) | 5/144 | NT | 7.0% | coding (711/1299 nt) | aroA | 3‑phosphoshikimate 1‑carboxyvinyltransferase |
| ? | USA300TCH1516_ALE | = 1535948 | 82 (0.930) | coding (688/1299 nt) | aroA | 3‑phosphoshikimate 1‑carboxyvinyltransferase | |||||
| * | ? | USA300TCH1516_ALE | = 1540288 | 92 (0.940) | 10 (0.110) | 8/146 | NT | 10.2% | coding (909/960 nt) | hepT | Heptaprenyl diphosphate synthase component 2 |
| ? | USA300TCH1516_ALE | = 1540309 | 92 (1.030) | coding (888/960 nt) | hepT | Heptaprenyl diphosphate synthase component 2 | |||||
| * | ? | USA300TCH1516_ALE | 1555332 = | 91 (0.930) | 7 (0.080) | 5/140 | NT | 8.6% | intergenic (+28/+78) | USA300HOU_RS07605/ribU | Ferredoxin/Riboflavin transporter RibU |
| ? | USA300TCH1516_ALE | 1555376 = | 70 (0.810) | intergenic (+72/+34) | USA300HOU_RS07605/ribU | Ferredoxin/Riboflavin transporter RibU | |||||
| * | ? | USA300TCH1516_ALE | = 1555341 | 82 (0.830) | 6 (0.070) | 4/140 | NT | 7.8% | intergenic (+37/+69) | USA300HOU_RS07605/ribU | Ferredoxin/Riboflavin transporter RibU |
| ? | USA300TCH1516_ALE | = 1555365 | 70 (0.810) | intergenic (+61/+45) | USA300HOU_RS07605/ribU | Ferredoxin/Riboflavin transporter RibU | |||||
| * | ? | USA300TCH1516_ALE | = 1562383 | 118 (1.200) | 13 (0.140) | 9/148 | NT | 10.4% | intergenic (‑349/+41) | hlgC_1/lytN_2 | Gamma‑hemolysin component C/putative cell wall hydrolase LytN |
| ? | USA300TCH1516_ALE | = 1562397 | 115 (1.260) | intergenic (‑363/+27) | hlgC_1/lytN_2 | Gamma‑hemolysin component C/putative cell wall hydrolase LytN | |||||
| * | ? | USA300TCH1516_ALE | = 1594143 | 74 (0.750) | 14 (0.160) | 7/146 | NT | 16.2% | coding (129/243 nt) | USA300HOU_RS07845 | hypothetical protein |
| ? | USA300TCH1516_ALE | = 1594163 | 77 (0.860) | coding (109/243 nt) | USA300HOU_RS07845 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1600425 = | 109 (1.110) | 14 (0.150) | 10/152 | NT | 12.3% | intergenic (‑61/+205) | USA300HOU_RS07900/USA300HOU_RS07910 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 1600453 = | 97 (1.040) | intergenic (‑89/+177) | USA300HOU_RS07900/USA300HOU_RS07910 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1601454 | NA (NA) | 10 (0.110) | 7/146 | NT | 100% | coding (139/177 nt) | USA300TCH1516_01480 | hypothetical protein |
| ? | USA300TCH1516_ALE | = 1601498 | 0 (0.000) | coding (95/177 nt) | USA300TCH1516_01480 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1601462 = | NA (NA) | 8 (0.090) | 7/146 | NT | 100% | coding (131/177 nt) | USA300TCH1516_01480 | hypothetical protein |
| ? | USA300TCH1516_ALE | 1601492 = | 0 (0.000) | coding (101/177 nt) | USA300TCH1516_01480 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1614319 = | 93 (0.950) | 8 (0.090) | 6/150 | NT | 8.7% | intergenic (+14/+64) | USA300HOU_RS08000/xerD_3 | hypothetical protein/Tyrosine recombinase XerD |
| ? | USA300TCH1516_ALE | 1614368 = | 81 (0.880) | intergenic (+63/+15) | USA300HOU_RS08000/xerD_3 | hypothetical protein/Tyrosine recombinase XerD | |||||
| * | ? | USA300TCH1516_ALE | 1619603 = | 95 (0.970) | 12 (0.130) | 6/148 | NT | 11.5% | intergenic (+6/+99) | proC/rnz | Pyrroline‑5‑carboxylate reductase/Ribonuclease Z |
| ? | USA300TCH1516_ALE | 1619653 = | 96 (1.060) | intergenic (+56/+49) | proC/rnz | Pyrroline‑5‑carboxylate reductase/Ribonuclease Z | |||||
| * | ? | USA300TCH1516_ALE | 1623534 = | 91 (0.930) | 6 (0.070) | 5/138 | NT | 7.8% | intergenic (+19/+64) | marA/malL | Multiple antibiotic resistance protein MarA/Oligo‑1,6‑glucosidase |
| ? | USA300TCH1516_ALE | 1623587 = | 63 (0.740) | intergenic (+72/+11) | marA/malL | Multiple antibiotic resistance protein MarA/Oligo‑1,6‑glucosidase | |||||
| * | ? | USA300TCH1516_ALE | 1645378 = | 118 (1.200) | 17 (0.190) | 8/148 | NT | 13.8% | coding (188/558 nt) | efp | Elongation factor P |
| ? | USA300TCH1516_ALE | 1645401 = | 103 (1.130) | coding (165/558 nt) | efp | Elongation factor P | |||||
| * | ? | USA300TCH1516_ALE | 1647574 = | 87 (0.880) | 9 (0.100) | 7/148 | NT | 9.1% | intergenic (+4/+60) | USA300HOU_RS08180/lipM | hypothetical protein/Octanoyltransferase LipM |
| ? | USA300TCH1516_ALE | 1647624 = | 100 (1.100) | intergenic (+54/+10) | USA300HOU_RS08180/lipM | hypothetical protein/Octanoyltransferase LipM | |||||
| * | ? | USA300TCH1516_ALE | = 1647578 | 91 (0.930) | 11 (0.120) | 9/144 | NT | 10.8% | intergenic (+8/+56) | USA300HOU_RS08180/lipM | hypothetical protein/Octanoyltransferase LipM |
| ? | USA300TCH1516_ALE | = 1647617 | 100 (1.130) | intergenic (+47/+17) | USA300HOU_RS08180/lipM | hypothetical protein/Octanoyltransferase LipM | |||||
| * | ? | USA300TCH1516_ALE | 1660020 = | 99 (1.010) | 18 (0.210) | 7/138 | NT | 17.0% | coding (1289/1464 nt) | gluP | Rhomboid protease GluP |
| ? | USA300TCH1516_ALE | 1660066 = | 90 (1.060) | coding (1243/1464 nt) | gluP | Rhomboid protease GluP | |||||
| * | ? | USA300TCH1516_ALE | = 1660030 | 102 (1.040) | 9 (0.110) | 5/138 | NT | 9.2% | coding (1279/1464 nt) | gluP | Rhomboid protease GluP |
| ? | USA300TCH1516_ALE | = 1660054 | 90 (1.060) | coding (1255/1464 nt) | gluP | Rhomboid protease GluP | |||||
| * | ? | USA300TCH1516_ALE | 1662000 = | 117 (1.190) | 24 (0.290) | 10/136 | NT | 21.7% | intergenic (‑87/+68) | USA300HOU_RS08275/rpmG2_2 | 5‑formyltetrahydrofolate cyclo‑ligase/50S ribosomal protein L33 2 |
| ? | USA300TCH1516_ALE | 1662039 = | 74 (0.890) | intergenic (‑126/+29) | USA300HOU_RS08275/rpmG2_2 | 5‑formyltetrahydrofolate cyclo‑ligase/50S ribosomal protein L33 2 | |||||
| * | ? | USA300TCH1516_ALE | = 1665362 | 67 (0.680) | 17 (0.260) | 10/108 | NT | 24.4% | intergenic (‑237/+40) | sodA/zur | Superoxide dismutase [Mn] 1/Zinc‑specific metallo‑regulatory protein |
| ? | USA300TCH1516_ALE | = 1665378 | 60 (0.900) | intergenic (‑253/+24) | sodA/zur | Superoxide dismutase [Mn] 1/Zinc‑specific metallo‑regulatory protein | |||||
| * | ? | USA300TCH1516_ALE | = 1676788 | 102 (1.040) | 7 (0.070) | 6/156 | NT | 7.1% | intergenic (‑344/‑75) | ccpN/glyQS | Transcriptional repressor CcpN/Glycine‑‑tRNA ligase |
| ? | USA300TCH1516_ALE | = 1676835 | 85 (0.890) | intergenic (‑391/‑28) | ccpN/glyQS | Transcriptional repressor CcpN/Glycine‑‑tRNA ligase | |||||
| * | ? | USA300TCH1516_ALE | = 1682523 | 130 (1.320) | 8 (0.090) | 5/140 | NT | 6.3% | intergenic (‑268/+36) | USA300HOU_RS08380/USA300HOU_RS08385 | PhoH‑like protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1682539 | 124 (1.440) | intergenic (‑284/+20) | USA300HOU_RS08380/USA300HOU_RS08385 | PhoH‑like protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1683123 | 66 (0.670) | 6 (0.070) | 4/138 | NT | 9.8% | coding (135/699 nt) | USA300HOU_RS08385 | hypothetical protein |
| ? | USA300TCH1516_ALE | = 1683155 | 54 (0.640) | coding (103/699 nt) | USA300HOU_RS08385 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1685779 = | 98 (1.000) | 7 (0.080) | 5/140 | NT | 7.8% | coding (1245/1347 nt) | mtaB | Threonylcarbamoyladenosine tRNA methylthiotransferase MtaB |
| ? | USA300TCH1516_ALE | 1685820 = | 80 (0.930) | coding (1204/1347 nt) | mtaB | Threonylcarbamoyladenosine tRNA methylthiotransferase MtaB | |||||
| * | ? | USA300TCH1516_ALE | = 1693764 | 88 (0.890) | 11 (0.130) | 6/140 | NT | 11.6% | coding (1031/1158 nt) | hemN_1 | Oxygen‑independent coproporphyrinogen‑III oxidase‑like protein YqeR |
| ? | USA300TCH1516_ALE | = 1693780 | 91 (1.060) | coding (1015/1158 nt) | hemN_1 | Oxygen‑independent coproporphyrinogen‑III oxidase‑like protein YqeR | |||||
| * | ? | USA300TCH1516_ALE | 1702257 = | 112 (1.140) | 17 (0.200) | 9/138 | NT | 16.5% | intergenic (‑1/+48) | comEA/tylM1 | ComE operon protein 1/dTDP‑3‑amino‑3,6‑dideoxy‑alpha‑D‑glucopyranose N,N‑dimethyltransferase |
| ? | USA300TCH1516_ALE | 1702302 = | 75 (0.880) | intergenic (‑46/+3) | comEA/tylM1 | ComE operon protein 1/dTDP‑3‑amino‑3,6‑dideoxy‑alpha‑D‑glucopyranose N,N‑dimethyltransferase | |||||
| * | ? | USA300TCH1516_ALE | 1710808 = | 104 (1.060) | 9 (0.100) | 8/144 | NT | 8.9% | coding (336/1221 nt) | fic | Adenosine monophosphate‑protein transferase SoFic |
| ? | USA300TCH1516_ALE | 1710841 = | 91 (1.030) | coding (303/1221 nt) | fic | Adenosine monophosphate‑protein transferase SoFic | |||||
| * | ? | USA300TCH1516_ALE | 1721519 = | 80 (0.810) | 5 (0.060) | 5/142 | NT | 6.2% | intergenic (‑236/+49) | USA300HOU_RS08595/USA300HOU_RS08600 | Putative O‑methyltransferase/MSMEI_4947/hypothetical protein |
| ? | USA300TCH1516_ALE | 1721556 = | 80 (0.920) | intergenic (‑273/+12) | USA300HOU_RS08595/USA300HOU_RS08600 | Putative O‑methyltransferase/MSMEI_4947/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1721527 | 85 (0.860) | 9 (0.100) | 5/142 | NT | 10.4% | intergenic (‑244/+41) | USA300HOU_RS08595/USA300HOU_RS08600 | Putative O‑methyltransferase/MSMEI_4947/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1721546 | 80 (0.920) | intergenic (‑263/+22) | USA300HOU_RS08595/USA300HOU_RS08600 | Putative O‑methyltransferase/MSMEI_4947/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1732959 = | 88 (0.890) | 12 (0.140) | 8/136 | NT | 12.3% | intergenic (+145/+92) | limB_2/USA300HOU_RS08645 | Limonene 1,2‑monooxygenase/hypothetical protein |
| ? | USA300TCH1516_ALE | 1733016 = | 97 (1.160) | intergenic (+202/+35) | limB_2/USA300HOU_RS08645 | Limonene 1,2‑monooxygenase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1732970 | 94 (0.960) | 12 (0.140) | 7/136 | NT | 11.9% | intergenic (+156/+81) | limB_2/USA300HOU_RS08645 | Limonene 1,2‑monooxygenase/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1733003 | 97 (1.160) | intergenic (+189/+48) | limB_2/USA300HOU_RS08645 | Limonene 1,2‑monooxygenase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1735361 | 86 (0.870) | 4 (0.050) | 4/134 | NT | 5.1% | intergenic (+61/+100) | USA300TCH1516_01624/tcdA | putative AAA domain‑containing protein/tRNA threonylcarbamoyladenosine dehydratase |
| ? | USA300TCH1516_ALE | = 1735390 | 78 (0.950) | intergenic (+90/+71) | USA300TCH1516_01624/tcdA | putative AAA domain‑containing protein/tRNA threonylcarbamoyladenosine dehydratase | |||||
| * | ? | USA300TCH1516_ALE | 1747122 = | 113 (1.150) | 15 (0.180) | 10/132 | NT | 16.7% | intergenic (‑156/+47) | recJ/USA300HOU_RS08710 | Single‑stranded‑DNA‑specific exonuclease RecJ/Heme uptake protein MmpL11 |
| ? | USA300TCH1516_ALE | 1747161 = | 56 (0.690) | intergenic (‑195/+8) | recJ/USA300HOU_RS08710 | Single‑stranded‑DNA‑specific exonuclease RecJ/Heme uptake protein MmpL11 | |||||
| * | ? | USA300TCH1516_ALE | 1758568 = | 124 (1.260) | 6 (0.070) | 4/140 | NT | 5.6% | intergenic (‑141/+252) | mreC/USA300HOU_RS08780 | Cell shape‑determining protein MreC/hypothetical protein |
| ? | USA300TCH1516_ALE | 1758603 = | 92 (1.070) | intergenic (‑176/+217) | mreC/USA300HOU_RS08780 | Cell shape‑determining protein MreC/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1759667 = | 91 (0.930) | 6 (0.070) | 4/132 | NT | 8.0% | intergenic (‑374/+100) | USA300HOU_RS08780/USA300HOU_RS08785 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 1759723 = | 62 (0.760) | intergenic (‑430/+44) | USA300HOU_RS08780/USA300HOU_RS08785 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1759680 | 90 (0.920) | 8 (0.100) | 7/132 | NT | 10.5% | intergenic (‑387/+87) | USA300HOU_RS08780/USA300HOU_RS08785 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1759708 | 62 (0.760) | intergenic (‑415/+59) | USA300HOU_RS08780/USA300HOU_RS08785 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1766678 = | 73 (0.740) | 8 (0.090) | 5/140 | NT | 12.2% | intergenic (+22/+201) | tag/USA300HOU_RS08820 | DNA‑3‑methyladenine glycosylase 1/hypothetical protein |
| ? | USA300TCH1516_ALE | 1766721 = | 51 (0.590) | intergenic (+65/+158) | tag/USA300HOU_RS08820 | DNA‑3‑methyladenine glycosylase 1/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1775185 = | 88 (0.890) | 12 (0.140) | 7/142 | NT | 14.1% | intergenic (‑78/+76) | engB/clpX | putative GTP‑binding protein EngB/ATP‑dependent Clp protease ATP‑binding subunit ClpX |
| ? | USA300TCH1516_ALE | 1775239 = | 68 (0.780) | intergenic (‑132/+22) | engB/clpX | putative GTP‑binding protein EngB/ATP‑dependent Clp protease ATP‑binding subunit ClpX | |||||
| * | ? | USA300TCH1516_ALE | 1789630 = | 83 (0.840) | 9 (0.110) | 6/138 | NT | 11.5% | intergenic (‑111/+59) | gapA2/coaE | Glyceraldehyde‑3‑phosphate dehydrogenase 2/Dephospho‑CoA kinase |
| ? | USA300TCH1516_ALE | 1789673 = | 67 (0.790) | intergenic (‑154/+16) | gapA2/coaE | Glyceraldehyde‑3‑phosphate dehydrogenase 2/Dephospho‑CoA kinase | |||||
| * | ? | USA300TCH1516_ALE | = 1789640 | 81 (0.820) | 5 (0.060) | 5/138 | NT | 6.8% | intergenic (‑121/+49) | gapA2/coaE | Glyceraldehyde‑3‑phosphate dehydrogenase 2/Dephospho‑CoA kinase |
| ? | USA300TCH1516_ALE | = 1789661 | 67 (0.790) | intergenic (‑142/+28) | gapA2/coaE | Glyceraldehyde‑3‑phosphate dehydrogenase 2/Dephospho‑CoA kinase | |||||
| * | ? | USA300TCH1516_ALE | 1803422 = | 0 (0.000) | 7 (0.070) | 4/154 | NT | 100% | coding (446/807 nt) | USA300HOU_RS12765 | hypothetical protein |
| ? | USA300TCH1516_ALE | 1803448 = | NA (NA) | coding (420/807 nt) | USA300HOU_RS12765 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1803618 | 64 (0.650) | 8 (0.090) | 3/142 | NT | 9.6% | coding (250/807 nt) | USA300HOU_RS12765 | hypothetical protein |
| ? | USA300TCH1516_ALE | 1911906 = | 94 (1.080) | coding (28/609 nt) | USA300HOU_RS15290 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1822865 = | 79 (0.800) | 7 (0.080) | 6/142 | NT | 8.4% | intergenic (+186/+60) | USA300HOU_RS09070/ackA | Putative universal stress protein/Acetate kinase |
| ? | USA300TCH1516_ALE | 1822909 = | 82 (0.940) | intergenic (+230/+16) | USA300HOU_RS09070/ackA | Putative universal stress protein/Acetate kinase | |||||
| * | ? | USA300TCH1516_ALE | = 1822873 | 81 (0.820) | 9 (0.100) | 6/142 | NT | 10.5% | intergenic (+194/+52) | USA300HOU_RS09070/ackA | Putative universal stress protein/Acetate kinase |
| ? | USA300TCH1516_ALE | = 1822899 | 82 (0.940) | intergenic (+220/+26) | USA300HOU_RS09070/ackA | Putative universal stress protein/Acetate kinase | |||||
| * | ? | USA300TCH1516_ALE | 1830989 = | 89 (0.910) | 5 (0.050) | 5/150 | NT | 5.8% | coding (131/1695 nt) | ezrA | Septation ring formation regulator EzrA |
| ? | USA300TCH1516_ALE | 1831014 = | 79 (0.860) | coding (106/1695 nt) | ezrA | Septation ring formation regulator EzrA | |||||
| * | ? | USA300TCH1516_ALE | 1834059 = | 78 (0.790) | 7 (0.080) | 6/138 | NT | 10.1% | intergenic (+8/‑106) | osmC/USA300HOU_RS09140 | Peroxiredoxin OsmC/Soluble hydrogenase 42 kDa subunit |
| ? | USA300TCH1516_ALE | 1834098 = | 58 (0.680) | intergenic (+47/‑67) | osmC/USA300HOU_RS09140 | Peroxiredoxin OsmC/Soluble hydrogenase 42 kDa subunit | |||||
| * | ? | USA300TCH1516_ALE | 1836934 = | 65 (0.660) | 15 (0.180) | 8/132 | NT | 21.3% | intergenic (+18/+132) | serA/gph_2 | D‑3‑phosphoglycerate dehydrogenase/Phosphoglycolate phosphatase |
| ? | USA300TCH1516_ALE | 1836982 = | 57 (0.700) | intergenic (+66/+84) | serA/gph_2 | D‑3‑phosphoglycerate dehydrogenase/Phosphoglycolate phosphatase | |||||
| * | ? | USA300TCH1516_ALE | = 1836947 | 64 (0.650) | 6 (0.070) | 6/132 | NT | 9.9% | intergenic (+31/+119) | serA/gph_2 | D‑3‑phosphoglycerate dehydrogenase/Phosphoglycolate phosphatase |
| ? | USA300TCH1516_ALE | = 1836967 | 57 (0.700) | intergenic (+51/+99) | serA/gph_2 | D‑3‑phosphoglycerate dehydrogenase/Phosphoglycolate phosphatase | |||||
| * | ? | USA300TCH1516_ALE | = 1838263 | 89 (0.910) | 9 (0.100) | 7/140 | NT | 9.7% | intergenic (‑67/+40) | gph_2/nagE | Phosphoglycolate phosphatase/PTS system N‑acetylglucosamine‑specific EIICBA component |
| ? | USA300TCH1516_ALE | = 1838279 | 90 (1.050) | intergenic (‑83/+24) | gph_2/nagE | Phosphoglycolate phosphatase/PTS system N‑acetylglucosamine‑specific EIICBA component | |||||
| * | ? | USA300TCH1516_ALE | 1841984 = | 61 (0.620) | 8 (0.100) | 6/134 | NT | 12.6% | intergenic (+24/+70) | htrA/tyrS | Serine protease Do‑like HtrA/Tyrosine‑‑tRNA ligase |
| ? | USA300TCH1516_ALE | 1842029 = | 60 (0.730) | intergenic (+69/+25) | htrA/tyrS | Serine protease Do‑like HtrA/Tyrosine‑‑tRNA ligase | |||||
| * | ? | USA300TCH1516_ALE | = 1841996 | 64 (0.650) | 12 (0.150) | 7/134 | NT | 17.4% | intergenic (+36/+58) | htrA/tyrS | Serine protease Do‑like HtrA/Tyrosine‑‑tRNA ligase |
| ? | USA300TCH1516_ALE | = 1842015 | 60 (0.730) | intergenic (+55/+39) | htrA/tyrS | Serine protease Do‑like HtrA/Tyrosine‑‑tRNA ligase | |||||
| * | ? | USA300TCH1516_ALE | = 1844661 | 95 (0.970) | 5 (0.060) | 4/142 | NT | 5.1% | intergenic (+58/+145) | mrcA/isdH | Penicillin‑binding protein 1A/Iron‑regulated surface determinant protein H |
| ? | USA300TCH1516_ALE | = 1844689 | 101 (1.160) | intergenic (+86/+117) | mrcA/isdH | Penicillin‑binding protein 1A/Iron‑regulated surface determinant protein H | |||||
| * | ? | USA300TCH1516_ALE | 1850072 = | 103 (1.050) | 8 (0.080) | 4/154 | NT | 8.0% | coding (1531/1707 nt) | acsA_1 | Acetyl‑coenzyme A synthetase |
| ? | USA300TCH1516_ALE | 1850111 = | 86 (0.910) | coding (1492/1707 nt) | acsA_1 | Acetyl‑coenzyme A synthetase | |||||
| * | ? | USA300TCH1516_ALE | 1858390 = | 105 (1.070) | 7 (0.090) | 6/126 | NT | 8.4% | intergenic (‑17/+57) | USA300HOU_RS09235/USA300HOU_RS09240 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 1858437 = | 70 (0.900) | intergenic (‑64/+10) | USA300HOU_RS09235/USA300HOU_RS09240 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1867679 | 106 (1.080) | 14 (0.160) | 10/142 | NT | 12.1% | intergenic (+53/+72) | USA300HOU_RS09275/ytnP | hypothetical protein/putative quorum‑quenching lactonase YtnP |
| ? | USA300TCH1516_ALE | = 1867699 | 110 (1.260) | intergenic (+73/+52) | USA300HOU_RS09275/ytnP | hypothetical protein/putative quorum‑quenching lactonase YtnP | |||||
| * | ? | USA300TCH1516_ALE | 1868935 = | 112 (1.140) | 17 (0.190) | 11/142 | NT | 16.5% | intergenic (‑342/+128) | ytnP/trmB | putative quorum‑quenching lactonase YtnP/tRNA (guanine‑N(7)‑)‑methyltransferase |
| ? | USA300TCH1516_ALE | 1868982 = | 73 (0.840) | intergenic (‑389/+81) | ytnP/trmB | putative quorum‑quenching lactonase YtnP/tRNA (guanine‑N(7)‑)‑methyltransferase | |||||
| * | ? | USA300TCH1516_ALE | 1870532 = | 77 (0.780) | 14 (0.160) | 8/144 | NT | 18.1% | intergenic (‑19/+531) | srkA/dat | Stress response kinase A/D‑alanine aminotransferase |
| ? | USA300TCH1516_ALE | 1870584 = | 57 (0.640) | intergenic (‑71/+479) | srkA/dat | Stress response kinase A/D‑alanine aminotransferase | |||||
| * | ? | USA300TCH1516_ALE | 1873582 = | 112 (1.140) | 8 (0.090) | 6/144 | NT | 8.0% | intergenic (‑258/+492) | USA300HOU_RS09300/USA300HOU_RS09305 | Putative dipeptidase/hypothetical protein |
| ? | USA300TCH1516_ALE | 1873645 = | 84 (0.950) | intergenic (‑321/+429) | USA300HOU_RS09300/USA300HOU_RS09305 | Putative dipeptidase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1876716 | 98 (1.000) | 6 (0.070) | 4/148 | NT | 6.0% | coding (151/1662 nt) | murJ_2 | Lipid II flippase MurJ |
| ? | USA300TCH1516_ALE | = 1876739 | 98 (1.080) | coding (128/1662 nt) | murJ_2 | Lipid II flippase MurJ | |||||
| * | ? | USA300TCH1516_ALE | 1878597 = | 85 (0.860) | 6 (0.080) | 5/124 | NT | 10.2% | intergenic (+56/+61) | USA300HOU_RS09320/ebh_2 | Ferredoxin‑‑NADP reductase/Extracellular matrix‑binding protein ebh |
| ? | USA300TCH1516_ALE | 1878652 = | 40 (0.520) | intergenic (+111/+6) | USA300HOU_RS09320/ebh_2 | Ferredoxin‑‑NADP reductase/Extracellular matrix‑binding protein ebh | |||||
| * | ? | USA300TCH1516_ALE | = 1893332 | 24 (0.240) | 39 (0.420) | 8/150 | NT | 63.4% | intergenic (‑193/+154) | USA300TCH1516_01750/ytpA | hypothetical protein/Phospholipase YtpA |
| ? | USA300TCH1516_ALE | 1910766 = | NA (NA) | intergenic (+299/‑256) | crcB_2/USA300TCH1516_01771 | Putative fluoride ion transporter CrcB/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1901310 = | 105 (1.070) | 11 (0.130) | 6/142 | NT | 11.9% | intergenic (‑306/‑217) | USA300HOU_RS09405/sdpR | hypothetical protein/Transcriptional repressor SdpR |
| ? | USA300TCH1516_ALE | 1901351 = | 69 (0.790) | intergenic (‑347/‑176) | USA300HOU_RS09405/sdpR | hypothetical protein/Transcriptional repressor SdpR | |||||
| * | ? | USA300TCH1516_ALE | = 1909669 | 101 (1.030) | 5 (0.060) | 4/146 | NT | 5.0% | intergenic (+173/‑83) | USA300HOU_RS09460/crcB_1 | hypothetical protein/Putative fluoride ion transporter CrcB |
| ? | USA300TCH1516_ALE | = 1909705 | 96 (1.070) | intergenic (+209/‑47) | USA300HOU_RS09460/crcB_1 | hypothetical protein/Putative fluoride ion transporter CrcB | |||||
| * | ? | USA300TCH1516_ALE | 1910682 = | NA (NA) | 7 (0.080) | 5/140 | NT | 10.4% | intergenic (+215/‑340) | crcB_2/USA300TCH1516_01771 | Putative fluoride ion transporter CrcB/hypothetical protein |
| ? | USA300TCH1516_ALE | 2684309 = | 69 (0.700) | intergenic (+68/+102) | mvaS/ogt | Hydroxymethylglutaryl‑CoA synthase/Methylated‑DNA‑‑protein‑cysteine methyltransferase | |||||
| * | ? | USA300TCH1516_ALE | 1915879 = | 98 (1.000) | 6 (0.060) | 4/156 | NT | 5.6% | intergenic (‑58/‑313) | metK/pckA | S‑adenosylmethionine synthase/Phosphoenolpyruvate carboxykinase (ATP) |
| ? | USA300TCH1516_ALE | 1915913 = | 107 (1.120) | intergenic (‑92/‑279) | metK/pckA | S‑adenosylmethionine synthase/Phosphoenolpyruvate carboxykinase (ATP) | |||||
| * | ? | USA300TCH1516_ALE | 1918322 = | 60 (0.610) | 4 (0.040) | 3/146 | NT | 5.6% | intergenic (‑40/+458) | USA300HOU_RS07235/USA300HOU_RS09510 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 1918351 = | 80 (0.890) | intergenic (‑69/+429) | USA300HOU_RS07235/USA300HOU_RS09510 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1928296 | 146 (1.480) | 9 (0.100) | 8/140 | NT | 6.3% | intergenic (‑250/+51) | USA300HOU_RS09565/USA300HOU_RS09575 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1928318 | 138 (1.600) | intergenic (‑272/+29) | USA300HOU_RS09565/USA300HOU_RS09575 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1939382 | 96 (0.980) | 8 (0.090) | 7/142 | NT | 9.0% | intergenic (‑241/+122) | hsdM_2/splF | Type I restriction enzyme EcoKI M protein/Serine protease SplF |
| ? | USA300TCH1516_ALE | = 1939405 | 77 (0.880) | intergenic (‑264/+99) | hsdM_2/splF | Type I restriction enzyme EcoKI M protein/Serine protease SplF | |||||
| * | ? | USA300TCH1516_ALE | 1946068 = | 128 (1.300) | 11 (0.130) | 8/142 | NT | 9.8% | intergenic (+119/+355) | USA300HOU_RS09665/USA300HOU_RS15380 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 1946105 = | 88 (1.010) | intergenic (+156/+318) | USA300HOU_RS09665/USA300HOU_RS15380 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1965737 = | 62 (0.630) | 6 (0.070) | 4/146 | NT | 9.0% | coding (71/924 nt) | hemH | Ferrochelatase |
| ? | USA300TCH1516_ALE | 1965782 = | 65 (0.720) | coding (26/924 nt) | hemH | Ferrochelatase | |||||
| * | ? | USA300TCH1516_ALE | = 1965743 | 66 (0.670) | 5 (0.060) | 4/146 | NT | 7.4% | coding (65/924 nt) | hemH | Ferrochelatase |
| ? | USA300TCH1516_ALE | = 1965774 | 65 (0.720) | coding (34/924 nt) | hemH | Ferrochelatase | |||||
| * | ? | USA300TCH1516_ALE | 1980867 = | 71 (0.720) | 6 (0.070) | 5/140 | NT | 8.8% | intergenic (‑109/+70) | USA300HOU_RS09865/USA300HOU_RS09870 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 1980913 = | 63 (0.730) | intergenic (‑155/+24) | USA300HOU_RS09865/USA300HOU_RS09870 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1980876 | 66 (0.670) | 9 (0.100) | 4/140 | NT | 13.0% | intergenic (‑118/+61) | USA300HOU_RS09865/USA300HOU_RS09870 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1980902 | 63 (0.730) | intergenic (‑144/+35) | USA300HOU_RS09865/USA300HOU_RS09870 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1990341 = | 52 (0.530) | 6 (0.080) | 5/124 | NT | 12.3% | intergenic (‑90/+61) | queG/tcyC_1 | Epoxyqueuosine reductase/L‑cystine import ATP‑binding protein TcyC |
| ? | USA300TCH1516_ALE | 1990392 = | 45 (0.590) | intergenic (‑141/+10) | queG/tcyC_1 | Epoxyqueuosine reductase/L‑cystine import ATP‑binding protein TcyC | |||||
| * | ? | USA300TCH1516_ALE | = 1990358 | 50 (0.510) | 8 (0.100) | 7/124 | NT | 16.0% | intergenic (‑107/+44) | queG/tcyC_1 | Epoxyqueuosine reductase/L‑cystine import ATP‑binding protein TcyC |
| ? | USA300TCH1516_ALE | = 1990373 | 45 (0.590) | intergenic (‑122/+29) | queG/tcyC_1 | Epoxyqueuosine reductase/L‑cystine import ATP‑binding protein TcyC | |||||
| * | ? | USA300TCH1516_ALE | 1994825 = | NA (NA) | 5 (0.050) | 5/150 | NT | 100% | coding (440/1362 nt) | USA300HOU_RS11675 | hypothetical protein |
| ? | USA300TCH1516_ALE | 1994850 = | 0 (0.000) | coding (465/1362 nt) | USA300HOU_RS11675 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1996391 | 58 (0.590) | 4 (0.050) | 4/144 | NT | 7.4% | noncoding (66/74 nt) | USA300TCH1516_01862 | tRNA‑His |
| ? | USA300TCH1516_ALE | = 1996449 | 48 (0.540) | noncoding (8/74 nt) | USA300TCH1516_01862 | tRNA‑His | |||||
| * | ? | USA300TCH1516_ALE | = 2004069 | 94 (0.960) | 11 (0.130) | 6/142 | NT | 11.6% | intergenic (‑2292/+92) | USA300TCH1516_01884/perR | tRNA‑Ile/Peroxide‑responsive repressor PerR |
| ? | USA300TCH1516_ALE | = 2004081 | 85 (0.970) | intergenic (‑2304/+80) | USA300TCH1516_01884/perR | tRNA‑Ile/Peroxide‑responsive repressor PerR | |||||
| * | ? | USA300TCH1516_ALE | 2008942 = | 91 (0.930) | 14 (0.170) | 7/132 | NT | 17.4% | intergenic (+70/+121) | USA300HOU_RS10115/USA300HOU_RS10125 | hypothetical protein/Putative multidrug export ATP‑binding/permease protein |
| ? | USA300TCH1516_ALE | 2008991 = | 58 (0.710) | intergenic (+119/+72) | USA300HOU_RS10115/USA300HOU_RS10125 | hypothetical protein/Putative multidrug export ATP‑binding/permease protein | |||||
| * | ? | USA300TCH1516_ALE | = 2014149 | 107 (1.090) | 9 (0.100) | 7/148 | NT | 7.6% | intergenic (+49/+212) | USA300HOU_RS10140/USA300HOU_RS10150 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 2014182 | 119 (1.310) | intergenic (+82/+179) | USA300HOU_RS10140/USA300HOU_RS10150 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2019127 = | 106 (1.080) | 7 (0.080) | 6/142 | NT | 7.6% | intergenic (‑209/+132) | mgt/yraA | Monofunctional glycosyltransferase/Putative cysteine protease YraA |
| ? | USA300TCH1516_ALE | 2019176 = | 75 (0.860) | intergenic (‑258/+83) | mgt/yraA | Monofunctional glycosyltransferase/Putative cysteine protease YraA | |||||
| * | ? | USA300TCH1516_ALE | = 2021462 | 87 (0.880) | 10 (0.120) | 8/140 | NT | 11.0% | intergenic (+21/+239) | queE_2/USA300HOU_RS10190 | 7‑carboxy‑7‑deazaguanine synthase/putative acyl‑CoA thioester hydrolase |
| ? | USA300TCH1516_ALE | = 2021482 | 85 (0.990) | intergenic (+41/+219) | queE_2/USA300HOU_RS10190 | 7‑carboxy‑7‑deazaguanine synthase/putative acyl‑CoA thioester hydrolase | |||||
| * | ? | USA300TCH1516_ALE | = 2021642 | 74 (0.750) | 4 (0.050) | 4/134 | NT | 5.4% | intergenic (+201/+59) | queE_2/USA300HOU_RS10190 | 7‑carboxy‑7‑deazaguanine synthase/putative acyl‑CoA thioester hydrolase |
| ? | USA300TCH1516_ALE | = 2021681 | 79 (0.960) | intergenic (+240/+20) | queE_2/USA300HOU_RS10190 | 7‑carboxy‑7‑deazaguanine synthase/putative acyl‑CoA thioester hydrolase | |||||
| * | ? | USA300TCH1516_ALE | 2023587 = | 93 (0.950) | 8 (0.090) | 6/148 | NT | 9.1% | coding (200/207 nt) | USA300HOU_RS10200 | hypothetical protein |
| ? | USA300TCH1516_ALE | 2023639 = | 73 (0.800) | coding (148/207 nt) | USA300HOU_RS10200 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 2028558 | 111 (1.130) | 10 (0.120) | 6/140 | NT | 9.3% | coding (87/702 nt) | USA300HOU_RS10230 | hypothetical protein |
| ? | USA300TCH1516_ALE | = 2028574 | 98 (1.140) | coding (71/702 nt) | USA300HOU_RS10230 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 2030214 | 99 (1.010) | 11 (0.120) | 5/144 | NT | 10.4% | intergenic (‑194/‑334) | map/USA300HOU_RS10250 | Methionine aminopeptidase/hypothetical protein |
| ? | USA300TCH1516_ALE | = 2030262 | 101 (1.140) | intergenic (‑242/‑286) | map/USA300HOU_RS10250 | Methionine aminopeptidase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2036458 = | 120 (1.220) | 7 (0.080) | 6/148 | NT | 6.0% | intergenic (+15/+53) | polC_2/dinB | DNA polymerase III PolC‑type/DNA polymerase IV |
| ? | USA300TCH1516_ALE | 2036504 = | 107 (1.180) | intergenic (+61/+7) | polC_2/dinB | DNA polymerase III PolC‑type/DNA polymerase IV | |||||
| * | ? | USA300TCH1516_ALE | = 2051385 | 114 (1.160) | 6 (0.060) | 4/152 | NT | 5.2% | coding (908/2193 nt) | pcrA | ATP‑dependent DNA helicase PcrA |
| ? | USA300TCH1516_ALE | = 2051416 | 112 (1.200) | coding (877/2193 nt) | pcrA | ATP‑dependent DNA helicase PcrA | |||||
| * | ? | USA300TCH1516_ALE | 2053094 = | 111 (1.130) | 7 (0.080) | 4/144 | NT | 7.3% | intergenic (‑113/+59) | pcrB/trpR | Heptaprenylglyceryl phosphate synthase/Trp operon repressor |
| ? | USA300TCH1516_ALE | 2053141 = | 77 (0.870) | intergenic (‑160/+12) | pcrB/trpR | Heptaprenylglyceryl phosphate synthase/Trp operon repressor | |||||
| * | ? | USA300TCH1516_ALE | 2053744 = | 108 (1.100) | 16 (0.170) | 9/150 | NT | 14.7% | coding (1116/1296 nt) | purB | Adenylosuccinate lyase |
| ? | USA300TCH1516_ALE | 2053767 = | 85 (0.920) | coding (1093/1296 nt) | purB | Adenylosuccinate lyase | |||||
| * | ? | USA300TCH1516_ALE | 2082368 = | 104 (1.060) | 9 (0.110) | 5/138 | NT | 9.6% | intergenic (+9/+315) | aspC/USA300HOU_RS10520 | Aspartate aminotransferase/65 kDa membrane protein |
| ? | USA300TCH1516_ALE | 2082406 = | 79 (0.930) | intergenic (+47/+277) | aspC/USA300HOU_RS10520 | Aspartate aminotransferase/65 kDa membrane protein | |||||
| * | ? | USA300TCH1516_ALE | = 2082527 | 103 (1.050) | 13 (0.150) | 8/142 | NT | 12.1% | intergenic (+168/+156) | aspC/USA300HOU_RS10520 | Aspartate aminotransferase/65 kDa membrane protein |
| ? | USA300TCH1516_ALE | = 2082556 | 98 (1.120) | intergenic (+197/+127) | aspC/USA300HOU_RS10520 | Aspartate aminotransferase/65 kDa membrane protein | |||||
| * | ? | USA300TCH1516_ALE | 2082639 = | 116 (1.180) | 10 (0.110) | 9/148 | NT | 8.7% | intergenic (+280/+44) | aspC/USA300HOU_RS10520 | Aspartate aminotransferase/65 kDa membrane protein |
| ? | USA300TCH1516_ALE | 2082667 = | 102 (1.120) | intergenic (+308/+16) | aspC/USA300HOU_RS10520 | Aspartate aminotransferase/65 kDa membrane protein | |||||
| * | ? | USA300TCH1516_ALE | = 2088038 | 81 (0.820) | 16 (0.210) | 9/126 | NT | 17.7% | intergenic (+55/+40) | chp/USA300HOU_RS10560 | Chemotaxis inhibitory protein/Glycyl‑glycine endopeptidase ALE‑1 |
| ? | USA300TCH1516_ALE | = 2088052 | 85 (1.100) | intergenic (+69/+26) | chp/USA300HOU_RS10560 | Chemotaxis inhibitory protein/Glycyl‑glycine endopeptidase ALE‑1 | |||||
| * | ? | USA300TCH1516_ALE | = 2090954 | 100 (1.020) | 8 (0.090) | 6/142 | NT | 7.9% | intergenic (‑188/+350) | USA300HOU_RS10575/USA300HOU_RS10590 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 2090971 | 99 (1.130) | intergenic (‑205/+333) | USA300HOU_RS10575/USA300HOU_RS10590 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 2117484 | 95 (0.970) | 6 (0.070) | 4/144 | NT | 6.1% | coding (805/921 nt) | USA300HOU_RS10775 | hypothetical protein |
| ? | USA300TCH1516_ALE | = 2117504 | 100 (1.130) | coding (785/921 nt) | USA300HOU_RS10775 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2140331 = | 73 (0.740) | 4 (0.040) | 4/150 | NT | 5.7% | intergenic (‑771/+140) | USA300HOU_RS10910/groL | hypothetical protein/60 kDa chaperonin |
| ? | USA300TCH1516_ALE | 2140372 = | 65 (0.710) | intergenic (‑812/+99) | USA300HOU_RS10910/groL | hypothetical protein/60 kDa chaperonin | |||||
| * | ? | USA300TCH1516_ALE | 2141638 = | 78 (0.790) | 7 (0.080) | 6/148 | NT | 10.3% | coding (450/1617 nt) | groL | 60 kDa chaperonin |
| ? | USA300TCH1516_ALE | 2141666 = | 50 (0.550) | coding (422/1617 nt) | groL | 60 kDa chaperonin | |||||
| * | ? | USA300TCH1516_ALE | 2143370 = | 77 (0.780) | 13 (0.160) | 7/132 | NT | 16.9% | intergenic (+5/+20) | USA300HOU_RS10935/USA300HOU_RS10940 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 2143414 = | 64 (0.790) | coding (1230/1254 nt) | USA300HOU_RS10940 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 2143383 | 72 (0.730) | 11 (0.140) | 8/132 | NT | 15.1% | intergenic (+18/+7) | USA300HOU_RS10935/USA300HOU_RS10940 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 2143399 | 64 (0.790) | coding (1245/1254 nt) | USA300HOU_RS10940 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2150647 = | 105 (1.070) | 14 (0.170) | 8/136 | NT | 13.6% | intergenic (+310/+57) | agrA/scrK | Accessory gene regulator A/Fructokinase |
| ? | USA300TCH1516_ALE | 2150691 = | 89 (1.060) | intergenic (+354/+13) | agrA/scrK | Accessory gene regulator A/Fructokinase | |||||
| * | ? | USA300TCH1516_ALE | = 2160387 | 92 (0.940) | 9 (0.110) | 8/136 | NT | 10.0% | intergenic (+20/‑341) | yheS/mutS_2 | putative ABC transporter ATP‑binding protein YheS/DNA mismatch repair protein MutS |
| ? | USA300TCH1516_ALE | = 2160400 | 83 (0.990) | intergenic (+33/‑328) | yheS/mutS_2 | putative ABC transporter ATP‑binding protein YheS/DNA mismatch repair protein MutS | |||||
| * | ? | USA300TCH1516_ALE | = 2210428 | 75 (0.760) | 9 (0.100) | 5/148 | NT | 10.7% | coding (69/648 nt) | USA300HOU_RS11275 | hypothetical protein |
| ? | USA300TCH1516_ALE | = 2210445 | 81 (0.890) | coding (86/648 nt) | USA300HOU_RS11275 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 2211758 | 97 (0.990) | 6 (0.070) | 5/138 | NT | 6.2% | intergenic (+751/+62) | USA300HOU_RS11275/yidC | hypothetical protein/Membrane protein insertase YidC |
| ? | USA300TCH1516_ALE | = 2211795 | 97 (1.140) | intergenic (+788/+25) | USA300HOU_RS11275/yidC | hypothetical protein/Membrane protein insertase YidC | |||||
| * | ? | USA300TCH1516_ALE | 2215750 = | 72 (0.730) | 5 (0.060) | 4/140 | NT | 7.0% | intergenic (‑42/+344) | tenA/sceD | Aminopyrimidine aminohydrolase/putative transglycosylase SceD |
| ? | USA300TCH1516_ALE | 2215808 = | 69 (0.800) | intergenic (‑100/+286) | tenA/sceD | Aminopyrimidine aminohydrolase/putative transglycosylase SceD | |||||
| * | ? | USA300TCH1516_ALE | = 2215759 | 72 (0.730) | 4 (0.050) | 4/140 | NT | 5.7% | intergenic (‑51/+335) | tenA/sceD | Aminopyrimidine aminohydrolase/putative transglycosylase SceD |
| ? | USA300TCH1516_ALE | = 2215797 | 69 (0.800) | intergenic (‑89/+297) | tenA/sceD | Aminopyrimidine aminohydrolase/putative transglycosylase SceD | |||||
| * | ? | USA300TCH1516_ALE | 2218211 = | 63 (0.640) | 9 (0.120) | 7/124 | NT | 13.5% | intergenic (+4/+55) | USA300HOU_RS11330/fabZ | hypothetical protein/3‑hydroxyacyl‑[acyl‑carrier‑protein] dehydratase FabZ |
| ? | USA300TCH1516_ALE | 2218261 = | 67 (0.880) | intergenic (+54/+5) | USA300HOU_RS11330/fabZ | hypothetical protein/3‑hydroxyacyl‑[acyl‑carrier‑protein] dehydratase FabZ | |||||
| * | ? | USA300TCH1516_ALE | = 2218228 | 63 (0.640) | 14 (0.180) | 9/124 | NT | 19.5% | intergenic (+21/+38) | USA300HOU_RS11330/fabZ | hypothetical protein/3‑hydroxyacyl‑[acyl‑carrier‑protein] dehydratase FabZ |
| ? | USA300TCH1516_ALE | = 2218242 | 67 (0.880) | intergenic (+35/+24) | USA300HOU_RS11330/fabZ | hypothetical protein/3‑hydroxyacyl‑[acyl‑carrier‑protein] dehydratase FabZ | |||||
| * | ? | USA300TCH1516_ALE | 2236023 = | 92 (0.940) | 7 (0.080) | 5/142 | NT | 9.2% | intergenic (‑296/+51) | tdk/rpmE2 | Thymidine kinase/50S ribosomal protein L31 type B |
| ? | USA300TCH1516_ALE | 2236061 = | 56 (0.640) | intergenic (‑334/+13) | tdk/rpmE2 | Thymidine kinase/50S ribosomal protein L31 type B | |||||
| * | ? | USA300TCH1516_ALE | = 2245371 | 96 (0.980) | 10 (0.110) | 8/144 | NT | 10.2% | intergenic (‑230/+106) | pyrG/rpoE | CTP synthase/putative DNA‑directed RNA polymerase subunit delta |
| ? | USA300TCH1516_ALE | = 2245389 | 89 (1.010) | intergenic (‑248/+88) | pyrG/rpoE | CTP synthase/putative DNA‑directed RNA polymerase subunit delta | |||||
| * | ? | USA300TCH1516_ALE | 2248208 = | 88 (0.890) | 4 (0.040) | 4/150 | NT | 5.0% | intergenic (+2/+128) | coaW/USA300HOU_RS11505 | Type II pantothenate kinase/hypothetical protein |
| ? | USA300TCH1516_ALE | 2248263 = | 68 (0.740) | intergenic (+57/+73) | coaW/USA300HOU_RS11505 | Type II pantothenate kinase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2252589 = | 109 (1.110) | 19 (0.220) | 13/142 | NT | 17.6% | intergenic (+25/+127) | luxS/USA300HOU_RS11525 | S‑ribosylhomocysteine lyase/hypothetical protein |
| ? | USA300TCH1516_ALE | 2252638 = | 81 (0.930) | intergenic (+74/+78) | luxS/USA300HOU_RS11525 | S‑ribosylhomocysteine lyase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2252658 = | 74 (0.750) | 5 (0.050) | 4/148 | NT | 6.3% | intergenic (+94/+58) | luxS/USA300HOU_RS11525 | S‑ribosylhomocysteine lyase/hypothetical protein |
| ? | USA300TCH1516_ALE | 2252704 = | 80 (0.880) | intergenic (+140/+12) | luxS/USA300HOU_RS11525 | S‑ribosylhomocysteine lyase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 2255601 | 95 (0.970) | 7 (0.080) | 5/142 | NT | 7.5% | intergenic (‑279/‑36) | deoC2/deoD1 | Deoxyribose‑phosphate aldolase 2/Purine nucleoside phosphorylase DeoD‑type 1 |
| ? | USA300TCH1516_ALE | = 2255626 | 89 (1.020) | intergenic (‑304/‑11) | deoC2/deoD1 | Deoxyribose‑phosphate aldolase 2/Purine nucleoside phosphorylase DeoD‑type 1 | |||||
| * | ? | USA300TCH1516_ALE | 2256396 = | 75 (0.760) | 17 (0.210) | 8/132 | NT | 20.7% | intergenic (+49/+72) | deoD1/dps | Purine nucleoside phosphorylase DeoD‑type 1/General stress protein 20U |
| ? | USA300TCH1516_ALE | 2256443 = | 68 (0.840) | intergenic (+96/+25) | deoD1/dps | Purine nucleoside phosphorylase DeoD‑type 1/General stress protein 20U | |||||
| * | ? | USA300TCH1516_ALE | = 2256409 | 67 (0.680) | 7 (0.090) | 5/132 | NT | 10.2% | intergenic (+62/+59) | deoD1/dps | Purine nucleoside phosphorylase DeoD‑type 1/General stress protein 20U |
| ? | USA300TCH1516_ALE | = 2256428 | 68 (0.840) | intergenic (+81/+40) | deoD1/dps | Purine nucleoside phosphorylase DeoD‑type 1/General stress protein 20U | |||||
| * | ? | USA300TCH1516_ALE | 2259385 = | 88 (0.890) | 20 (0.230) | 9/140 | NT | 21.4% | intergenic (‑30/+642) | USA300HOU_RS11560/USA300HOU_RS11565 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 2259420 = | 70 (0.810) | intergenic (‑65/+607) | USA300HOU_RS11560/USA300HOU_RS11565 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 2264711 | 113 (1.150) | 6 (0.070) | 4/138 | NT | 5.1% | coding (666/1092 nt) | USA300HOU_RS11590 | hypothetical protein |
| ? | USA300TCH1516_ALE | = 2264731 | 125 (1.470) | coding (686/1092 nt) | USA300HOU_RS11590 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2288634 = | 114 (1.160) | 8 (0.090) | 4/138 | NT | 8.6% | coding (45/933 nt) | cdaR | CdaA regulatory protein CdaR |
| ? | USA300TCH1516_ALE | 2288701 = | 72 (0.850) | coding (789/810 nt) | cdaA | Cyclic di‑AMP synthase CdaA | |||||
| * | ? | USA300TCH1516_ALE | 2306983 = | 83 (0.840) | 4 (0.050) | 4/144 | NT | 5.4% | coding (654/1371 nt) | USA300HOU_RS11770 | hypothetical protein |
| ? | USA300TCH1516_ALE | 2307053 = | 65 (0.730) | coding (584/1371 nt) | USA300HOU_RS11770 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2315068 = | 89 (0.910) | 7 (0.080) | 5/150 | NT | 8.4% | coding (202/1194 nt) | ndhE | NAD(P)H‑quinone oxidoreductase subunit 4L, chloroplastic |
| ? | USA300TCH1516_ALE | 2315102 = | 69 (0.750) | coding (168/1194 nt) | ndhE | NAD(P)H‑quinone oxidoreductase subunit 4L, chloroplastic | |||||
| * | ? | USA300TCH1516_ALE | = 2331225 | 76 (0.770) | 7 (0.080) | 4/148 | NT | 8.1% | coding (694/933 nt) | lacC_2 | Tagatose‑6‑phosphate kinase |
| ? | USA300TCH1516_ALE | = 2331255 | 88 (0.970) | coding (664/933 nt) | lacC_2 | Tagatose‑6‑phosphate kinase | |||||
| * | ? | USA300TCH1516_ALE | 2333009 = | 100 (1.020) | 6 (0.070) | 4/136 | NT | 7.0% | intergenic (‑119/+249) | lacA/lacR | Galactose‑6‑phosphate isomerase subunit LacA/Lactose phosphotransferase system repressor |
| ? | USA300TCH1516_ALE | 2333060 = | 74 (0.890) | intergenic (‑170/+198) | lacA/lacR | Galactose‑6‑phosphate isomerase subunit LacA/Lactose phosphotransferase system repressor | |||||
| * | ? | USA300TCH1516_ALE | = 2341657 | 112 (1.140) | 9 (0.100) | 4/146 | NT | 8.4% | intergenic (‑78/+133) | mepM_2/USA300HOU_RS11950 | Murein DD‑endopeptidase MepM/putative hydrolase |
| ? | USA300TCH1516_ALE | = 2341714 | 95 (1.060) | intergenic (‑135/+76) | mepM_2/USA300HOU_RS11950 | Murein DD‑endopeptidase MepM/putative hydrolase | |||||
| * | ? | USA300TCH1516_ALE | 2357381 = | 63 (0.640) | 8 (0.090) | 6/140 | NT | 11.0% | intergenic (‑331/+207) | ecfA1/rplQ | Energy‑coupling factor transporter ATP‑binding protein EcfA1/50S ribosomal protein L17 |
| ? | USA300TCH1516_ALE | 2357417 = | 74 (0.860) | intergenic (‑367/+171) | ecfA1/rplQ | Energy‑coupling factor transporter ATP‑binding protein EcfA1/50S ribosomal protein L17 | |||||
| * | ? | USA300TCH1516_ALE | = 2357390 | 64 (0.650) | 12 (0.140) | 8/140 | NT | 15.6% | intergenic (‑340/+198) | ecfA1/rplQ | Energy‑coupling factor transporter ATP‑binding protein EcfA1/50S ribosomal protein L17 |
| ? | USA300TCH1516_ALE | = 2357406 | 74 (0.860) | intergenic (‑356/+182) | ecfA1/rplQ | Energy‑coupling factor transporter ATP‑binding protein EcfA1/50S ribosomal protein L17 | |||||
| * | ? | USA300TCH1516_ALE | = 2368218 | 73 (0.740) | 7 (0.080) | 6/146 | NT | 9.3% | coding (123/354 nt) | rplV | 50S ribosomal protein L22 |
| ? | USA300TCH1516_ALE | = 2368244 | 70 (0.780) | coding (97/354 nt) | rplV | 50S ribosomal protein L22 | |||||
| * | ? | USA300TCH1516_ALE | 2368663 = | 52 (0.530) | 11 (0.120) | 7/148 | NT | 17.3% | intergenic (‑16/+51) | rpsS/rplB | 30S ribosomal protein S19/50S ribosomal protein L2 |
| ? | USA300TCH1516_ALE | 2368705 = | 57 (0.630) | intergenic (‑58/+9) | rpsS/rplB | 30S ribosomal protein S19/50S ribosomal protein L2 | |||||
| * | ? | USA300TCH1516_ALE | = 2375690 | 104 (1.060) | 7 (0.080) | 5/146 | NT | 6.7% | coding (334/2136 nt) | topB | DNA topoisomerase 3 |
| ? | USA300TCH1516_ALE | = 2375715 | 101 (1.130) | coding (309/2136 nt) | topB | DNA topoisomerase 3 | |||||
| * | ? | USA300TCH1516_ALE | 2378458 = | 84 (0.850) | 14 (0.150) | 8/152 | NT | 14.5% | intergenic (+317/+102) | glcU_2/USA300HOU_RS12220 | putative glucose uptake protein GlcU/hypothetical protein |
| ? | USA300TCH1516_ALE | 2378519 = | 85 (0.910) | intergenic (+378/+41) | glcU_2/USA300HOU_RS12220 | putative glucose uptake protein GlcU/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 2380474 | 114 (1.160) | 14 (0.170) | 8/132 | NT | 12.5% | intergenic (+147/+40) | USA300HOU_RS12230/swrC | hypothetical protein/Swarming motility protein SwrC |
| ? | USA300TCH1516_ALE | = 2380492 | 102 (1.260) | intergenic (+165/+22) | USA300HOU_RS12230/swrC | hypothetical protein/Swarming motility protein SwrC | |||||
| * | ? | USA300TCH1516_ALE | = 2388299 | 76 (0.770) | 11 (0.140) | 6/126 | NT | 13.5% | intergenic (+34/+68) | ribZ_1/sarV | Riboflavin transporter RibZ/HTH‑type transcriptional regulator SarV |
| ? | USA300TCH1516_ALE | = 2388344 | 81 (1.050) | intergenic (+79/+23) | ribZ_1/sarV | Riboflavin transporter RibZ/HTH‑type transcriptional regulator SarV | |||||
| * | ? | USA300TCH1516_ALE | 2399023 = | 88 (0.890) | 14 (0.170) | 12/134 | NT | 19.0% | intergenic (+97/+75) | fdhD/USA300HOU_RS12350 | Sulfurtransferase FdhD/hypothetical protein |
| ? | USA300TCH1516_ALE | 2399070 = | 46 (0.560) | intergenic (+144/+28) | fdhD/USA300HOU_RS12350 | Sulfurtransferase FdhD/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2429428 = | 84 (0.850) | 5 (0.050) | 5/152 | NT | 5.4% | coding (219/948 nt) | lytR_2 | Transcriptional regulator LytR |
| ? | USA300TCH1516_ALE | 2429460 = | 94 (1.010) | coding (187/948 nt) | lytR_2 | Transcriptional regulator LytR | |||||
| * | ? | USA300TCH1516_ALE | = 2434877 | 113 (1.150) | 7 (0.080) | 6/140 | NT | 6.5% | intergenic (+145/+242) | ybbH_3/yifK | putative HTH‑type transcriptional regulator YbbH/putative transport protein YifK |
| ? | USA300TCH1516_ALE | = 2434908 | 101 (1.170) | intergenic (+176/+211) | ybbH_3/yifK | putative HTH‑type transcriptional regulator YbbH/putative transport protein YifK | |||||
| * | ? | USA300TCH1516_ALE | 2440041 = | 55 (0.560) | 7 (0.080) | 6/136 | NT | 13.5% | intergenic (+2/+64) | USA300HOU_RS12570/malP | hypothetical protein/PTS system maltose‑specific EIICB component |
| ? | USA300TCH1516_ALE | 2440099 = | 43 (0.510) | intergenic (+60/+6) | USA300HOU_RS12570/malP | hypothetical protein/PTS system maltose‑specific EIICB component | |||||
| * | ? | USA300TCH1516_ALE | = 2440052 | 54 (0.550) | 9 (0.110) | 7/136 | NT | 16.8% | intergenic (+13/+53) | USA300HOU_RS12570/malP | hypothetical protein/PTS system maltose‑specific EIICB component |
| ? | USA300TCH1516_ALE | = 2440086 | 43 (0.510) | intergenic (+47/+19) | USA300HOU_RS12570/malP | hypothetical protein/PTS system maltose‑specific EIICB component | |||||
| * | ? | USA300TCH1516_ALE | 2442806 = | 67 (0.680) | 6 (0.080) | 6/128 | NT | 9.0% | intergenic (+3/+55) | glvR/USA300HOU_RS12585 | HTH‑type transcriptional regulator GlvR/hypothetical protein |
| ? | USA300TCH1516_ALE | 2442855 = | 67 (0.850) | intergenic (+52/+6) | glvR/USA300HOU_RS12585 | HTH‑type transcriptional regulator GlvR/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 2442821 | 78 (0.790) | 9 (0.110) | 7/128 | NT | 12.2% | intergenic (+18/+40) | glvR/USA300HOU_RS12585 | HTH‑type transcriptional regulator GlvR/hypothetical protein |
| ? | USA300TCH1516_ALE | = 2442838 | 67 (0.850) | intergenic (+35/+23) | glvR/USA300HOU_RS12585 | HTH‑type transcriptional regulator GlvR/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 2455760 | 58 (0.590) | 6 (0.070) | 6/132 | NT | 9.0% | intergenic (+18/+48) | lyrA/rpiA | Lysostaphin resistance protein A/Ribose‑5‑phosphate isomerase A |
| ? | USA300TCH1516_ALE | = 2455780 | 73 (0.900) | intergenic (+38/+28) | lyrA/rpiA | Lysostaphin resistance protein A/Ribose‑5‑phosphate isomerase A | |||||
| * | ? | USA300TCH1516_ALE | 2461467 = | 117 (1.190) | 12 (0.130) | 9/146 | NT | 10.2% | intergenic (‑193/+38) | natA_2/yhaI | ABC transporter ATP‑binding protein NatA/Inner membrane protein YhaI |
| ? | USA300TCH1516_ALE | 2461499 = | 104 (1.160) | intergenic (‑225/+6) | natA_2/yhaI | ABC transporter ATP‑binding protein NatA/Inner membrane protein YhaI | |||||
| * | ? | USA300TCH1516_ALE | = 2475076 | 92 (0.940) | 5 (0.060) | 4/142 | NT | 5.7% | coding (1180/1383 nt) | tcaA | Membrane‑associated protein TcaA |
| ? | USA300TCH1516_ALE | = 2475098 | 84 (0.960) | coding (1158/1383 nt) | tcaA | Membrane‑associated protein TcaA | |||||
| * | ? | USA300TCH1516_ALE | = 2476453 | 77 (0.780) | 9 (0.110) | 6/136 | NT | 10.7% | intergenic (‑198/+42) | tcaA/tcaR | Membrane‑associated protein TcaA/HTH‑type transcriptional regulator TcaR |
| ? | USA300TCH1516_ALE | = 2476476 | 85 (1.020) | intergenic (‑221/+19) | tcaA/tcaR | Membrane‑associated protein TcaA/HTH‑type transcriptional regulator TcaR | |||||
| * | ? | USA300TCH1516_ALE | 2489730 = | 134 (1.360) | 13 (0.160) | 9/136 | NT | 11.9% | intergenic (+79/+74) | tarF_2/USA300HOU_RS12815 | Teichoic acid glycerol‑phosphate transferase/putative lipoprotein |
| ? | USA300TCH1516_ALE | 2489772 = | 78 (0.930) | intergenic (+121/+32) | tarF_2/USA300HOU_RS12815 | Teichoic acid glycerol‑phosphate transferase/putative lipoprotein | |||||
| * | ? | USA300TCH1516_ALE | 2494136 = | 83 (0.840) | 10 (0.110) | 5/150 | NT | 10.9% | intergenic (‑162/+70) | USA300HOU_RS12835/USA300HOU_RS12845 | Ferredoxin‑‑NADP reductase/hypothetical protein |
| ? | USA300TCH1516_ALE | 2494184 = | 86 (0.930) | intergenic (‑210/+22) | USA300HOU_RS12835/USA300HOU_RS12845 | Ferredoxin‑‑NADP reductase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2494782 = | 89 (0.910) | 8 (0.090) | 7/138 | NT | 9.8% | intergenic (‑145/+62) | USA300HOU_RS12845/mnmC_2 | hypothetical protein/tRNA 5‑methylaminomethyl‑2‑thiouridine biosynthesis bifunctional protein MnmC |
| ? | USA300TCH1516_ALE | 2494828 = | 70 (0.830) | intergenic (‑191/+16) | USA300HOU_RS12845/mnmC_2 | hypothetical protein/tRNA 5‑methylaminomethyl‑2‑thiouridine biosynthesis bifunctional protein MnmC | |||||
| * | ? | USA300TCH1516_ALE | = 2494792 | 82 (0.830) | 6 (0.070) | 4/138 | NT | 7.9% | intergenic (‑155/+52) | USA300HOU_RS12845/mnmC_2 | hypothetical protein/tRNA 5‑methylaminomethyl‑2‑thiouridine biosynthesis bifunctional protein MnmC |
| ? | USA300TCH1516_ALE | = 2494816 | 70 (0.830) | intergenic (‑179/+28) | USA300HOU_RS12845/mnmC_2 | hypothetical protein/tRNA 5‑methylaminomethyl‑2‑thiouridine biosynthesis bifunctional protein MnmC | |||||
| * | ? | USA300TCH1516_ALE | 2497326 = | 131 (1.330) | 7 (0.080) | 5/140 | NT | 6.1% | coding (376/945 nt) | USA300HOU_RS12865 | hypothetical protein |
| ? | USA300TCH1516_ALE | 2497363 = | 102 (1.190) | coding (413/945 nt) | USA300HOU_RS12865 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2497906 = | 132 (1.340) | 6 (0.070) | 5/138 | NT | 6.7% | intergenic (+11/+75) | USA300HOU_RS12865/treP_2 | hypothetical protein/PTS system trehalose‑specific EIIBC component |
| ? | USA300TCH1516_ALE | 2497975 = | 54 (0.640) | intergenic (+80/+6) | USA300HOU_RS12865/treP_2 | hypothetical protein/PTS system trehalose‑specific EIIBC component | |||||
| * | ? | USA300TCH1516_ALE | = 2505518 | 90 (0.920) | 7 (0.080) | 5/144 | NT | 7.8% | coding (860/1278 nt) | gltT | Proton/sodium‑glutamate symport protein |
| ? | USA300TCH1516_ALE | = 2505555 | 84 (0.950) | coding (823/1278 nt) | gltT | Proton/sodium‑glutamate symport protein | |||||
| * | ? | USA300TCH1516_ALE | = 2520880 | 81 (0.820) | 5 (0.050) | 5/150 | NT | 6.1% | intergenic (‑249/+60) | narG/nasF | Respiratory nitrate reductase 1 alpha chain/Uroporphyrinogen‑III C‑methyltransferase |
| ? | USA300TCH1516_ALE | = 2520911 | 77 (0.840) | intergenic (‑280/+29) | narG/nasF | Respiratory nitrate reductase 1 alpha chain/Uroporphyrinogen‑III C‑methyltransferase | |||||
| * | ? | USA300TCH1516_ALE | = 2525589 | 73 (0.740) | 8 (0.100) | 7/130 | NT | 10.2% | intergenic (‑161/+69) | sirB/ytmI | Sirohydrochlorin ferrochelatase/putative N‑acetyltransferase YtmI |
| ? | USA300TCH1516_ALE | = 2525624 | 82 (1.030) | intergenic (‑196/+34) | sirB/ytmI | Sirohydrochlorin ferrochelatase/putative N‑acetyltransferase YtmI | |||||
| * | ? | USA300TCH1516_ALE | 2533537 = | 78 (0.790) | 9 (0.100) | 6/142 | NT | 11.4% | intergenic (+33/+64) | femA_3/tcyC_2 | Aminoacyltransferase FemA/L‑cystine import ATP‑binding protein TcyC |
| ? | USA300TCH1516_ALE | 2533595 = | 70 (0.800) | intergenic (+91/+6) | femA_3/tcyC_2 | Aminoacyltransferase FemA/L‑cystine import ATP‑binding protein TcyC | |||||
| * | ? | USA300TCH1516_ALE | = 2533545 | 83 (0.840) | 10 (0.110) | 6/142 | NT | 12.2% | intergenic (+41/+56) | femA_3/tcyC_2 | Aminoacyltransferase FemA/L‑cystine import ATP‑binding protein TcyC |
| ? | USA300TCH1516_ALE | = 2533585 | 70 (0.800) | intergenic (+81/+16) | femA_3/tcyC_2 | Aminoacyltransferase FemA/L‑cystine import ATP‑binding protein TcyC | |||||
| * | ? | USA300TCH1516_ALE | = 2534553 | 72 (0.730) | 5 (0.050) | 4/150 | NT | 6.9% | coding (505/729 nt) | tcyB | L‑cystine transport system permease protein TcyB |
| ? | USA300TCH1516_ALE | = 2534570 | 67 (0.730) | coding (488/729 nt) | tcyB | L‑cystine transport system permease protein TcyB | |||||
| * | ? | USA300TCH1516_ALE | 2537754 = | 96 (0.980) | 10 (0.120) | 8/138 | NT | 12.1% | intergenic (+108/+46) | USA300TCH1516_02423/gpmA_2 | hypothetical protein/2,3‑bisphosphoglycerate‑dependent phosphoglycerate mutase |
| ? | USA300TCH1516_ALE | 2537797 = | 62 (0.730) | intergenic (+151/+3) | USA300TCH1516_02423/gpmA_2 | hypothetical protein/2,3‑bisphosphoglycerate‑dependent phosphoglycerate mutase | |||||
| * | ? | USA300TCH1516_ALE | 2561162 = | 86 (0.870) | 6 (0.070) | 4/146 | NT | 7.7% | coding (648/657 nt) | USA300HOU_RS13195 | hypothetical protein |
| ? | USA300TCH1516_ALE | 2561195 = | 66 (0.740) | intergenic (+24/+39) | USA300HOU_RS13195/cpdA | hypothetical protein/3',5'‑cyclic adenosine monophosphate phosphodiesterase CpdA | |||||
| * | ? | USA300TCH1516_ALE | 2569653 = | 103 (1.050) | 5 (0.060) | 5/142 | NT | 6.1% | intergenic (+5/+87) | pbpX_2/USA300HOU_RS13235 | Putative penicillin‑binding protein PbpX/UDP‑glucose 4‑epimerase |
| ? | USA300TCH1516_ALE | 2569712 = | 63 (0.720) | intergenic (+64/+28) | pbpX_2/USA300HOU_RS13235 | Putative penicillin‑binding protein PbpX/UDP‑glucose 4‑epimerase | |||||
| * | ? | USA300TCH1516_ALE | 2573677 = | 93 (0.950) | 13 (0.150) | 8/138 | NT | 14.7% | intergenic (‑203/+91) | norB_5/opuCD | Quinolone resistance protein NorB/Carnitine transport permease protein OpuCD |
| ? | USA300TCH1516_ALE | 2573715 = | 71 (0.840) | intergenic (‑241/+53) | norB_5/opuCD | Quinolone resistance protein NorB/Carnitine transport permease protein OpuCD | |||||
| * | ? | USA300TCH1516_ALE | 2580412 = | 107 (1.090) | 11 (0.130) | 7/142 | NT | 11.5% | intergenic (+47/‑561) | yveA/pnbA | Aspartate‑proton symporter/Para‑nitrobenzyl esterase |
| ? | USA300TCH1516_ALE | 2580445 = | 74 (0.850) | intergenic (+80/‑528) | yveA/pnbA | Aspartate‑proton symporter/Para‑nitrobenzyl esterase | |||||
| * | ? | USA300TCH1516_ALE | 2580666 = | 87 (0.880) | 8 (0.090) | 4/140 | NT | 10.4% | intergenic (+301/‑307) | yveA/pnbA | Aspartate‑proton symporter/Para‑nitrobenzyl esterase |
| ? | USA300TCH1516_ALE | 2580701 = | 62 (0.720) | intergenic (+336/‑272) | yveA/pnbA | Aspartate‑proton symporter/Para‑nitrobenzyl esterase | |||||
| * | ? | USA300TCH1516_ALE | = 2588442 | 128 (1.300) | 13 (0.150) | 7/142 | NT | 11.2% | intergenic (+25/+143) | yehR/gltB_2 | putative lipoprotein YehR/Glutamate synthase [NADPH] large chain |
| ? | USA300TCH1516_ALE | = 2588473 | 92 (1.050) | intergenic (+56/+112) | yehR/gltB_2 | putative lipoprotein YehR/Glutamate synthase [NADPH] large chain | |||||
| * | ? | USA300TCH1516_ALE | 2591898 = | 89 (0.910) | 6 (0.070) | 5/144 | NT | 7.4% | coding (626/1194 nt) | ttuB | Putative tartrate transporter |
| ? | USA300TCH1516_ALE | 2591947 = | 69 (0.780) | coding (577/1194 nt) | ttuB | Putative tartrate transporter | |||||
| * | ? | USA300TCH1516_ALE | 2595468 = | 97 (0.990) | 9 (0.100) | 6/150 | NT | 9.3% | coding (423/936 nt) | nikB_3 | Nickel transport system permease protein NikB |
| ? | USA300TCH1516_ALE | 2595506 = | 85 (0.920) | coding (385/936 nt) | nikB_3 | Nickel transport system permease protein NikB | |||||
| * | ? | USA300TCH1516_ALE | = 2605654 | 99 (1.010) | 8 (0.090) | 10/146 | NT | 7.6% | intergenic (‑448/+4) | ahpD/USA300HOU_RS13415 | Alkyl hydroperoxide reductase AhpD/hypothetical protein |
| ? | USA300TCH1516_ALE | = 2605665 | 103 (1.150) | coding (413/420 nt) | USA300HOU_RS13415 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2609395 = | 79 (0.800) | 6 (0.070) | 5/136 | NT | 9.1% | intergenic (‑225/+336) | USA300HOU_RS13450/USA300HOU_RS13455 | hypothetical protein/putative lipoprotein |
| ? | USA300TCH1516_ALE | 2609451 = | 53 (0.630) | intergenic (‑281/+280) | USA300HOU_RS13450/USA300HOU_RS13455 | hypothetical protein/putative lipoprotein | |||||
| * | ? | USA300TCH1516_ALE | = 2609406 | 71 (0.720) | 13 (0.160) | 8/136 | NT | 18.7% | intergenic (‑236/+325) | USA300HOU_RS13450/USA300HOU_RS13455 | hypothetical protein/putative lipoprotein |
| ? | USA300TCH1516_ALE | = 2609438 | 53 (0.630) | intergenic (‑268/+293) | USA300HOU_RS13450/USA300HOU_RS13455 | hypothetical protein/putative lipoprotein | |||||
| * | ? | USA300TCH1516_ALE | = 2610898 | 96 (0.980) | 5 (0.060) | 4/144 | NT | 5.4% | intergenic (‑373/+163) | USA300HOU_RS13455/USA300HOU_RS13460 | putative lipoprotein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 2610913 | 90 (1.020) | intergenic (‑388/+148) | USA300HOU_RS13455/USA300HOU_RS13460 | putative lipoprotein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 2633273 | 78 (0.790) | 11 (0.110) +GC |
6/156 | NT | 13.6% | coding (2675/3057 nt) | fnbA_2 | Fibronectin‑binding protein A |
| ? | USA300TCH1516_ALE | = 2633349 | 65 (0.660) | coding (2599/3057 nt) | fnbA_2 | Fibronectin‑binding protein A | |||||
| * | ? | USA300TCH1516_ALE | 2636356 = | 100 (1.020) | 5 (0.060) | 5/138 | NT | 6.5% | intergenic (‑409/+60) | fnbA_2/gntT | Fibronectin‑binding protein A/High‑affinity gluconate transporter |
| ? | USA300TCH1516_ALE | 2636404 = | 58 (0.680) | intergenic (‑457/+12) | fnbA_2/gntT | Fibronectin‑binding protein A/High‑affinity gluconate transporter | |||||
| * | ? | USA300TCH1516_ALE | 2646370 = | 107 (1.090) | 10 (0.110) | 6/148 | NT | 9.9% | intergenic (‑83/‑464) | sauU/USA300HOU_RS13610 | putative sulfoacetate transporter SauU/putative membrane protein |
| ? | USA300TCH1516_ALE | 2646396 = | 83 (0.910) | intergenic (‑109/‑438) | sauU/USA300HOU_RS13610 | putative sulfoacetate transporter SauU/putative membrane protein | |||||
| * | ? | USA300TCH1516_ALE | = 2647507 | 72 (0.730) | 17 (0.220) | 10/124 | NT | 21.5% | intergenic (+62/+35) | USA300HOU_RS13610/ydhC | putative membrane protein/Inner membrane transport protein YdhC |
| ? | USA300TCH1516_ALE | = 2647518 | 68 (0.890) | intergenic (+73/+24) | USA300HOU_RS13610/ydhC | putative membrane protein/Inner membrane transport protein YdhC | |||||
| * | ? | USA300TCH1516_ALE | 2661788 = | 66 (0.670) | 16 (0.200) | 12/128 | NT | 22.3% | intergenic (‑181/‑140) | ybiV/yydI | Sugar phosphatase YbiV/putative peptide export ATP‑binding protein YydI |
| ? | USA300TCH1516_ALE | 2661832 = | 59 (0.750) | intergenic (‑225/‑96) | ybiV/yydI | Sugar phosphatase YbiV/putative peptide export ATP‑binding protein YydI | |||||
| * | ? | USA300TCH1516_ALE | = 2661803 | 67 (0.680) | 7 (0.090) | 6/128 | NT | 11.1% | intergenic (‑196/‑125) | ybiV/yydI | Sugar phosphatase YbiV/putative peptide export ATP‑binding protein YydI |
| ? | USA300TCH1516_ALE | = 2661815 | 59 (0.750) | intergenic (‑208/‑113) | ybiV/yydI | Sugar phosphatase YbiV/putative peptide export ATP‑binding protein YydI | |||||
| * | ? | USA300TCH1516_ALE | 2665481 = | 76 (0.770) | 7 (0.080) | 6/138 | NT | 10.1% | intergenic (‑108/+71) | USA300TCH1516_02535/sdhA | hypothetical protein/L‑serine dehydratase, alpha chain |
| ? | USA300TCH1516_ALE | 2665525 = | 59 (0.700) | intergenic (‑152/+27) | USA300TCH1516_02535/sdhA | hypothetical protein/L‑serine dehydratase, alpha chain | |||||
| * | ? | USA300TCH1516_ALE | 2674533 = | 95 (0.970) | 14 (0.160) | 6/140 | NT | 16.2% | intergenic (‑45/+256) | glcB/ydaP | PTS system glucoside‑specific EIICBA component/Putative thiamine pyrophosphate‑containing protein YdaP |
| ? | USA300TCH1516_ALE | 2674588 = | 62 (0.720) | intergenic (‑100/+201) | glcB/ydaP | PTS system glucoside‑specific EIICBA component/Putative thiamine pyrophosphate‑containing protein YdaP | |||||
| * | ? | USA300TCH1516_ALE | 2679952 = | 120 (1.220) | 6 (0.080) | 4/130 | NT | 6.9% | intergenic (+4/+756) | ssaA2_4/USA300HOU_RS13810 | Staphylococcal secretory antigen ssaA2/hypothetical protein |
| ? | USA300TCH1516_ALE | 2680007 = | 64 (0.800) | intergenic (+59/+701) | ssaA2_4/USA300HOU_RS13810 | Staphylococcal secretory antigen ssaA2/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2679952 = | 120 (1.220) | 6 (0.080) | 4/130 | NT | 6.2% | intergenic (+4/+756) | ssaA2_4/USA300HOU_RS13810 | Staphylococcal secretory antigen ssaA2/hypothetical protein |
| ? | USA300TCH1516_ALE | 2681465 = | 84 (1.050) | intergenic (‑500/+79) | USA300HOU_RS13810/mvaA | hypothetical protein/3‑hydroxy‑3‑methylglutaryl‑coenzyme A reductase | |||||
| * | ? | USA300TCH1516_ALE | = 2681424 | 88 (0.890) | 8 (0.100) | 6/130 | NT | 9.3% | intergenic (‑459/+120) | USA300HOU_RS13810/mvaA | hypothetical protein/3‑hydroxy‑3‑methylglutaryl‑coenzyme A reductase |
| ? | USA300TCH1516_ALE | = 2681449 | 84 (1.050) | intergenic (‑484/+95) | USA300HOU_RS13810/mvaA | hypothetical protein/3‑hydroxy‑3‑methylglutaryl‑coenzyme A reductase | |||||
| * | ? | USA300TCH1516_ALE | 2687471 = | 83 (0.840) | 14 (0.170) | 6/138 | NT | 19.8% | intergenic (+25/+44) | clpL/USA300HOU_RS13835 | ATP‑dependent Clp protease ATP‑binding subunit ClpL/hypothetical protein |
| ? | USA300TCH1516_ALE | 2687511 = | 42 (0.500) | intergenic (+65/+4) | clpL/USA300HOU_RS13835 | ATP‑dependent Clp protease ATP‑binding subunit ClpL/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 2693379 | 85 (0.860) | 14 (0.170) | 8/136 | NT | 16.0% | intergenic (+50/+306) | mtrR/rocA | HTH‑type transcriptional regulator MtrR/1‑pyrroline‑5‑carboxylate dehydrogenase |
| ? | USA300TCH1516_ALE | = 2693404 | 75 (0.900) | intergenic (+75/+281) | mtrR/rocA | HTH‑type transcriptional regulator MtrR/1‑pyrroline‑5‑carboxylate dehydrogenase | |||||
| * | ? | USA300TCH1516_ALE | 2699622 = | 66 (0.670) | 7 (0.080) | 5/140 | NT | 11.9% | intergenic (+29/+61) | copZ/ldhD_2 | Copper chaperone CopZ/D‑lactate dehydrogenase |
| ? | USA300TCH1516_ALE | 2699690 = | 46 (0.530) | coding (992/999 nt) | ldhD_2 | D‑lactate dehydrogenase | |||||
| * | ? | USA300TCH1516_ALE | 2704632 = | 86 (0.870) | 7 (0.080) | 4/142 | NT | 8.5% | coding (37/864 nt) | crtM | Dehydrosqualene synthase |
| ? | USA300TCH1516_ALE | 2704670 = | 75 (0.860) | intergenic (‑2/+35) | crtM/crtQ | Dehydrosqualene synthase/4,4'‑diaponeurosporenoate glycosyltransferase | |||||
| * | ? | USA300TCH1516_ALE | 2716742 = | 97 (0.990) | 7 (0.080) | 4/138 | NT | 8.8% | intergenic (+50/+100) | USA300HOU_RS13965/USA300HOU_RS13970 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 2716816 = | 62 (0.730) | intergenic (+124/+26) | USA300HOU_RS13965/USA300HOU_RS13970 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 2736823 | 47 (0.480) | 6 (0.070) | 5/138 | NT | 12.6% | intergenic (+27/+59) | USA300HOU_RS14090/aldC_2 | Putative 2‑dehydropantoate 2‑reductase/Alpha‑acetolactate decarboxylase |
| ? | USA300TCH1516_ALE | = 2736858 | 43 (0.510) | intergenic (+62/+24) | USA300HOU_RS14090/aldC_2 | Putative 2‑dehydropantoate 2‑reductase/Alpha‑acetolactate decarboxylase | |||||
| * | ? | USA300TCH1516_ALE | 2761242 = | 78 (0.790) | 5 (0.060) | 4/144 | NT | 7.3% | intergenic (‑244/+249) | citN/sirC | Citrate transporter/Precorrin‑2 dehydrogenase |
| ? | USA300TCH1516_ALE | 2761289 = | 57 (0.640) | intergenic (‑291/+202) | citN/sirC | Citrate transporter/Precorrin‑2 dehydrogenase | |||||
| * | ? | USA300TCH1516_ALE | = 2761249 | 68 (0.690) | 8 (0.090) | 5/144 | NT | 11.9% | intergenic (‑251/+242) | citN/sirC | Citrate transporter/Precorrin‑2 dehydrogenase |
| ? | USA300TCH1516_ALE | = 2761280 | 57 (0.640) | intergenic (‑282/+211) | citN/sirC | Citrate transporter/Precorrin‑2 dehydrogenase | |||||
| * | ? | USA300TCH1516_ALE | 2772633 = | 105 (1.070) | 17 (0.210) | 7/134 | NT | 20.0% | intergenic (+7/+53) | phoB/USA300TCH1516_02632 | Alkaline phosphatase 3/hypothetical protein |
| ? | USA300TCH1516_ALE | 2772676 = | 48 (0.580) | intergenic (+50/+10) | phoB/USA300TCH1516_02632 | Alkaline phosphatase 3/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2778362 = | 78 (0.790) | 6 (0.070) | 5/142 | NT | 7.5% | coding (918/942 nt) | arcC2 | Carbamate kinase 2 |
| ? | USA300TCH1516_ALE | 2778404 = | 79 (0.910) | coding (876/942 nt) | arcC2 | Carbamate kinase 2 | |||||
| * | ? | USA300TCH1516_ALE | 2787502 = | 90 (0.920) | 13 (0.150) | 9/142 | NT | 14.5% | intergenic (+48/‑192) | zipA_3/manR_2 | Cell division protein ZipA/Transcriptional regulator ManR |
| ? | USA300TCH1516_ALE | 2787547 = | 74 (0.850) | intergenic (+93/‑147) | zipA_3/manR_2 | Cell division protein ZipA/Transcriptional regulator ManR | |||||
| * | ? | USA300TCH1516_ALE | = 2787510 | 93 (0.950) | 7 (0.080) | 6/142 | NT | 8.2% | intergenic (+56/‑184) | zipA_3/manR_2 | Cell division protein ZipA/Transcriptional regulator ManR |
| ? | USA300TCH1516_ALE | = 2787537 | 74 (0.850) | intergenic (+83/‑157) | zipA_3/manR_2 | Cell division protein ZipA/Transcriptional regulator ManR | |||||
| * | ? | USA300TCH1516_ALE | 2793464 = | 115 (1.170) | 5 (0.060) | 4/140 | NT | 5.1% | coding (2179/2982 nt) | yueB | ESX secretion system protein YueB |
| ? | USA300TCH1516_ALE | 2793513 = | 86 (1.000) | coding (2130/2982 nt) | yueB | ESX secretion system protein YueB | |||||
| * | ? | USA300TCH1516_ALE | = 2830200 | 93 (0.950) | 8 (0.090) | 5/138 | NT | 8.9% | intergenic (+28/+419) | icaC/lipA_2 | putative poly‑beta‑1,6‑N‑acetyl‑D‑glucosamine export protein/Lipase 1 |
| ? | USA300TCH1516_ALE | = 2830235 | 83 (0.980) | intergenic (+63/+384) | icaC/lipA_2 | putative poly‑beta‑1,6‑N‑acetyl‑D‑glucosamine export protein/Lipase 1 | |||||
| * | ? | USA300TCH1516_ALE | = 2830738 | 95 (0.970) | 6 (0.070) | 4/144 | NT | 6.0% | coding (1927/2046 nt) | lipA_2 | Lipase 1 |
| ? | USA300TCH1516_ALE | = 2830760 | 101 (1.140) | coding (1905/2046 nt) | lipA_2 | Lipase 1 | |||||
| * | ? | USA300TCH1516_ALE | 2833267 = | 81 (0.820) | 8 (0.090) | 5/148 | NT | 9.5% | intergenic (‑603/+487) | lipA_2/hisI | Lipase 1/Phosphoribosyl‑AMP cyclohydrolase |
| ? | USA300TCH1516_ALE | 2833307 = | 78 (0.860) | intergenic (‑643/+447) | lipA_2/hisI | Lipase 1/Phosphoribosyl‑AMP cyclohydrolase | |||||
| * | ? | USA300TCH1516_ALE | 2847730 = | 69 (0.700) | 21 (0.260) | 10/132 | NT | 28.8% | intergenic (+39/+110) | yceI/USA300HOU_RS14590 | Protein YceI/Lactonase drp35 |
| ? | USA300TCH1516_ALE | 2847769 = | 47 (0.580) | intergenic (+78/+71) | yceI/USA300HOU_RS14590 | Protein YceI/Lactonase drp35 | |||||
| * | ? | USA300TCH1516_ALE | 2850817 = | 79 (0.800) | 18 (0.220) | 10/132 | NT | 22.3% | intergenic (+16/+103) | pcp/USA300HOU_RS14605 | Pyrrolidone‑carboxylate peptidase/hypothetical protein |
| ? | USA300TCH1516_ALE | 2850866 = | 60 (0.740) | intergenic (+65/+54) | pcp/USA300HOU_RS14605 | Pyrrolidone‑carboxylate peptidase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 2850830 | 70 (0.710) | 6 (0.070) | 4/132 | NT | 9.2% | intergenic (+29/+90) | pcp/USA300HOU_RS14605 | Pyrrolidone‑carboxylate peptidase/hypothetical protein |
| ? | USA300TCH1516_ALE | = 2850851 | 60 (0.740) | intergenic (+50/+69) | pcp/USA300HOU_RS14605 | Pyrrolidone‑carboxylate peptidase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 2863074 | 116 (1.180) | 9 (0.100) | 6/150 | NT | 7.6% | intergenic (+44/+16) | USA300TCH1516_02707/USA300HOU_RS14670 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 2864026 | NA (NA) | intergenic (‑439/‑19) | USA300HOU_RS14670/USA300HOU_RS14675 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 2866995 | 66 (0.670) | 14 (0.170) | 10/134 | NT | 18.9% | intergenic (‑394/+59) | USA300HOU_RS14695/noc_2 | hypothetical protein/Nucleoid occlusion protein |
| ? | USA300TCH1516_ALE | = 2867006 | 65 (0.790) | intergenic (‑405/+48) | USA300HOU_RS14695/noc_2 | hypothetical protein/Nucleoid occlusion protein | |||||