breseq  version 0.33.1  revision 8505477f25b3
mutation predictions | marginal predictions | summary statistics | genome diff | command line log

Predicted mutations
evidence seq id position mutation freq annotation gene description
RA CP000731 81 N→G 100% intergenic (–/‑151) – / → repA –/replication protein A
RA CP000731 5,779 C→T 11.1% intergenic (+296/‑1192) cadX → / → USA300HOU_pUSA300HOUMR0010 cadmium efflux regulator/MarR family transcriptional regulator
RA CP000731 5,784 A→G 12.5% intergenic (+301/‑1187) cadX → / → USA300HOU_pUSA300HOUMR0010 cadmium efflux regulator/MarR family transcriptional regulator
JC CP000731 6,552 +28 bp 100% intergenic (+1069/‑419) cadX → / → USA300HOU_pUSA300HOUMR0010 cadmium efflux regulator/MarR family transcriptional regulator
RA CP000731 11,100 C→A 5.9% intergenic (+105/‑159) blaI → / → USA300HOU_pUSA300HOUMR0014 beta‑lactamase regulator BlaI/recombinase
RA CP000731 12,012 A→G 14.0% intergenic (+175/+48) USA300HOU_pUSA300HOUMR0014 → / ← USA300HOU_pUSA300HOUMR0015 recombinase/hypothetical protein
RA CP000731 12,017 C→T 17.6% intergenic (+180/+43) USA300HOU_pUSA300HOUMR0014 → / ← USA300HOU_pUSA300HOUMR0015 recombinase/hypothetical protein
RA CP000731 25,663 Δ1 bp 100% coding (316/333 nt) USA300HOU_pUSA300HOUMR0031 → hypothetical protein
RA USA300TCH1516_ALE 3,343 Δ1 bp 7.6% intergenic (+27/‑363) dnaN → / → USA300HOU_RS00015 DNA polymerase III subunit beta/hypothetical protein
RA USA300TCH1516_ALE 3,344 A→T 15.6% intergenic (+28/‑362) dnaN → / → USA300HOU_RS00015 DNA polymerase III subunit beta/hypothetical protein
RA USA300TCH1516_ALE 9,710 T→C 20.6% intergenic (+15/+72) gyrA → / ← nnrD DNA gyrase subunit A/ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase
RA USA300TCH1516_ALE 9,716 T→C 22.6% intergenic (+21/+66) gyrA → / ← nnrD DNA gyrase subunit A/ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase
RA USA300TCH1516_ALE 9,719 G→A 21.4% intergenic (+24/+63) gyrA → / ← nnrD DNA gyrase subunit A/ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase
RA USA300TCH1516_ALE 9,725 G→A 19.4% intergenic (+30/+57) gyrA → / ← nnrD DNA gyrase subunit A/ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase
RA USA300TCH1516_ALE 33,661 A→T 6.1% intergenic (+317/‑51) mggB_1 → / → rlmH Mannosylglucosyl‑3‑phosphoglycerate phosphatase/Ribosomal RNA large subunit methyltransferase H
RA USA300TCH1516_ALE 41,166 G→A 9.7% intergenic (‑33/‑67) pbp ← / → mecR1 Beta‑lactam‑inducible penicillin‑binding protein/Methicillin resistance mecR1 protein
RA USA300TCH1516_ALE 41,171 T→C 6.7% intergenic (‑38/‑62) pbp ← / → mecR1 Beta‑lactam‑inducible penicillin‑binding protein/Methicillin resistance mecR1 protein
RA USA300TCH1516_ALE 53,905 C→G 8.1% S281R (AGC→AGG)  USA300HOU_RS00220 → hypothetical protein
RA USA300TCH1516_ALE 76,969 G→A 53.3% intergenic (+509/‑107) USA300HOU_RS00140 → / → USA300HOU_RS00350 hypothetical protein/Monoacylglycerol lipase
RA USA300TCH1516_ALE 79,612 A→T 8.4% intergenic (+221/‑39) USA300HOU_RS00355 → / → cmoB hypothetical protein/tRNA U34 carboxymethyltransferase
RA USA300TCH1516_ALE 79,619 T→A 9.1% intergenic (+228/‑32) USA300HOU_RS00355 → / → cmoB hypothetical protein/tRNA U34 carboxymethyltransferase
RA USA300TCH1516_ALE 79,626 A→T 6.9% intergenic (+235/‑25) USA300HOU_RS00355 → / → cmoB hypothetical protein/tRNA U34 carboxymethyltransferase
RA USA300TCH1516_ALE 92,987 A→G 15.7% intergenic (‑72/‑65) ricR_1 ← / → glpE Copper‑sensing transcriptional repressor RicR/Thiosulfate sulfurtransferase GlpE
RA USA300TCH1516_ALE 96,897 A→G 6.1% intergenic (+201/+466) USA300TCH1516_00088 → / ← dus_2 hypothetical protein/putative tRNA‑dihydrouridine synthase
RA USA300TCH1516_ALE 96,901:1 +G 5.9% intergenic (+205/+462) USA300TCH1516_00088 → / ← dus_2 hypothetical protein/putative tRNA‑dihydrouridine synthase
RA USA300TCH1516_ALE 99,276 G→C 18.1% intergenic (+70/+2) USA300HOU_RS00465 → / ← tetA_1 hypothetical protein/Tetracycline resistance protein, class C
RA USA300TCH1516_ALE 109,949:1 +G 5.2% intergenic (+28/‑193) plc → / → USA300HOU_RS00515 1‑phosphatidylinositol phosphodiesterase/putative lipoprotein
RA USA300TCH1516_ALE 109,958 G→A 5.8% intergenic (+37/‑184) plc → / → USA300HOU_RS00515 1‑phosphatidylinositol phosphodiesterase/putative lipoprotein
RA USA300TCH1516_ALE 109,964 T→A 7.1% intergenic (+43/‑178) plc → / → USA300HOU_RS00515 1‑phosphatidylinositol phosphodiesterase/putative lipoprotein
RA USA300TCH1516_ALE 109,970 T→C 7.6% intergenic (+49/‑172) plc → / → USA300HOU_RS00515 1‑phosphatidylinositol phosphodiesterase/putative lipoprotein
RA USA300TCH1516_ALE 110,660 T→A 23.1% I173I (ATT→ATA)  USA300HOU_RS00515 → putative lipoprotein
RA USA300TCH1516_ALE 111,512 A→G 32.1% S194S (TCA→TCG)  USA300HOU_RS00520 → putative lipoprotein
RA USA300TCH1516_ALE 111,516 C→A 31.2% Q196K (CAA→AAA)  USA300HOU_RS00520 → putative lipoprotein
RA USA300TCH1516_ALE 163,523 A→T 7.5% intergenic (‑19/+195) glnQ ← / ← phnD Glutamine transport ATP‑binding protein GlnQ/Phosphate‑import protein PhnD
RA USA300TCH1516_ALE 164,586 T→A 14.4% Q30L (CAA→CTA)  phnD ← Phosphate‑import protein PhnD
RA USA300TCH1516_ALE 164,590 T→A 13.5% N29Y (AAT→TAT)  phnD ← Phosphate‑import protein PhnD
RA USA300TCH1516_ALE 168,343 G→A 7.1% intergenic (+310/+38) yfkN_1 → / ← USA300TCH1516_00148 Trifunctional nucleotide phosphoesterase protein YfkN/hypothetical protein
RA USA300TCH1516_ALE 168,350 A→T 7.9% intergenic (+317/+31) yfkN_1 → / ← USA300TCH1516_00148 Trifunctional nucleotide phosphoesterase protein YfkN/hypothetical protein
RA USA300TCH1516_ALE 168,354 C→G 7.2% intergenic (+321/+27) yfkN_1 → / ← USA300TCH1516_00148 Trifunctional nucleotide phosphoesterase protein YfkN/hypothetical protein
RA USA300TCH1516_ALE 168,358 A→T 5.6% intergenic (+325/+23) yfkN_1 → / ← USA300TCH1516_00148 Trifunctional nucleotide phosphoesterase protein YfkN/hypothetical protein
RA USA300TCH1516_ALE 186,459 A→G 9.0% Q345R (CAA→CGA)  USA300HOU_RS00855 → hypothetical protein
RA USA300TCH1516_ALE 195,286 T→A 53.1% intergenic (‑97/‑82) USA300HOU_RS00900 ← / → USA300HOU_RS00905 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 216,795 G→C 8.8% I4M (ATC→ATG)  rocD2_1 ← Ornithine aminotransferase 2
RA USA300TCH1516_ALE 217,036 T→A 13.5% intergenic (‑230/+23) rocD2_1 ← / ← brnQ_1 Ornithine aminotransferase 2/Branched‑chain amino acid transport system 2 carrier protein
RA USA300TCH1516_ALE 217,045 A→C 9.5% intergenic (‑239/+14) rocD2_1 ← / ← brnQ_1 Ornithine aminotransferase 2/Branched‑chain amino acid transport system 2 carrier protein
RA USA300TCH1516_ALE 217,046 C→T 9.4% intergenic (‑240/+13) rocD2_1 ← / ← brnQ_1 Ornithine aminotransferase 2/Branched‑chain amino acid transport system 2 carrier protein
RA USA300TCH1516_ALE 290,156 A→T 12.2% intergenic (+47/‑180) gatB_1 → / → gatC_1 PTS system galactitol‑specific EIIB component/PTS system galactitol‑specific EIIC component
RA USA300TCH1516_ALE 308,137 A→C 5.4% I129L (ATT→CTT)  lytR_1 → Sensory transduction protein LytR
RA USA300TCH1516_ALE 341,450 G→C 17.3% D134H (GAT→CAT)  USA300HOU_RS01525 → hypothetical protein
RA USA300TCH1516_ALE 346,350 C→T 5.0% I55I (ATC→ATT)  sotB → sugar efflux transporter
RA USA300TCH1516_ALE 346,353 A→T 5.2% V56V (GTA→GTT)  sotB → sugar efflux transporter
RA USA300TCH1516_ALE 346,356 A→G 5.0% T57T (ACA→ACG)  sotB → sugar efflux transporter
RA USA300TCH1516_ALE 372,106 T→A 14.7% intergenic (‑166/‑204) ylbJ ← / → lip2 Sporulation integral membrane protein YlbJ/Lipase 2
RA USA300TCH1516_ALE 396,540 G→A 41.7% A208T (GCA→ACA)  efeM → putative iron uptake system component EfeM
RA USA300TCH1516_ALE 401,399 A→C 11.4% intergenic (‑184/‑57) USA300HOU_RS01845 ← / → sutR hypothetical protein/HTH‑type transcriptional regulator SutR
RA USA300TCH1516_ALE 401,404 G→T 11.5% intergenic (‑189/‑52) USA300HOU_RS01845 ← / → sutR hypothetical protein/HTH‑type transcriptional regulator SutR
RA USA300TCH1516_ALE 410,464 A→T 6.9% I522I (ATT→ATA)  yitJ ← Bifunctional homocysteine S‑methyltransferase/5,10‑methylenetetrahydrofolate reductase
RA USA300TCH1516_ALE 413,758 G→A 5.8% I167I (ATC→ATT)  metI ← Cystathionine gamma‑synthase/O‑acetylhomoserine (thiol)‑lyase
RA USA300TCH1516_ALE 413,761 A→T 5.8% I166I (ATT→ATA)  metI ← Cystathionine gamma‑synthase/O‑acetylhomoserine (thiol)‑lyase
RA USA300TCH1516_ALE 413,764 T→C 5.7% S165S (TCA→TCG)  metI ← Cystathionine gamma‑synthase/O‑acetylhomoserine (thiol)‑lyase
RA USA300TCH1516_ALE 418,825 A→T 10.9% N53I (AAT→ATT)  rpsF → 30S ribosomal protein S6
RA USA300TCH1516_ALE 419,964 A→T 7.1% intergenic (+182/+84) rpsR → / ← USA300HOU_RS01950 30S ribosomal protein S18/hypothetical protein
RA USA300TCH1516_ALE 419,965 A→T 7.0% intergenic (+183/+83) rpsR → / ← USA300HOU_RS01950 30S ribosomal protein S18/hypothetical protein
RA USA300TCH1516_ALE 462,826 T→A 6.2% intergenic (+85/+18) USA300HOU_RS02185 → / ← USA300HOU_RS02190 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 512,643 A→G 11.3% intergenic (+711/‑6052) recR → / → speA_2 Recombination protein RecR/Arginine decarboxylase
RA USA300TCH1516_ALE 536,863 T→A 7.9% intergenic (+56/‑255) rplY → / → pth 50S ribosomal protein L25/Peptidyl‑tRNA hydrolase
RA USA300TCH1516_ALE 576,915 C→G 11.7% intergenic (+338/‑52) gltX → / → cysE Glutamate‑‑tRNA ligase/Serine acetyltransferase
RA USA300TCH1516_ALE 576,920:1 +T 6.1% intergenic (+343/‑47) gltX → / → cysE Glutamate‑‑tRNA ligase/Serine acetyltransferase
RA USA300TCH1516_ALE 581,901 G→C 10.8% V13L (GTG→CTG)  nusG_2 → Transcription termination/antitermination protein NusG
RA USA300TCH1516_ALE 593,430 T→A 10.2% intergenic (+22/‑115) rpoC → / → rplGB DNA‑directed RNA polymerase subunit beta'/Ribosome‑associated protein L7Ae‑like protein
RA USA300TCH1516_ALE 593,433 T→A 10.4% intergenic (+25/‑112) rpoC → / → rplGB DNA‑directed RNA polymerase subunit beta'/Ribosome‑associated protein L7Ae‑like protein
RA USA300TCH1516_ALE 597,160 G→T 10.8% intergenic (+110/‑107) fusA → / → tuf Elongation factor G/Elongation factor Tu
RA USA300TCH1516_ALE 597,163 A→C 11.5% intergenic (+113/‑104) fusA → / → tuf Elongation factor G/Elongation factor Tu
RA USA300TCH1516_ALE 598,486 T→C 13.0% intergenic (+35/+247) tuf → / ← yxeP_2 Elongation factor Tu/putative hydrolase YxeP
RA USA300TCH1516_ALE 598,492 A→G 14.5% intergenic (+41/+241) tuf → / ← yxeP_2 Elongation factor Tu/putative hydrolase YxeP
RA USA300TCH1516_ALE 598,495 C→T 14.4% intergenic (+44/+238) tuf → / ← yxeP_2 Elongation factor Tu/putative hydrolase YxeP
RA USA300TCH1516_ALE 598,501 G→A 13.3% intergenic (+50/+232) tuf → / ← yxeP_2 Elongation factor Tu/putative hydrolase YxeP
RA USA300TCH1516_ALE 598,505:1 +C 5.0% intergenic (+54/+228) tuf → / ← yxeP_2 Elongation factor Tu/putative hydrolase YxeP
RA USA300TCH1516_ALE 629,681 C→A 16.5% L84I (CTA→ATA)  USA300HOU_RS02990 → 3‑hexulose‑6‑phosphate synthase
RA USA300TCH1516_ALE 631,535 G→A 12.2% intergenic (+161/‑341) gph_1 → / → proP Phosphoglycolate phosphatase/Proline/betaine transporter
RA USA300TCH1516_ALE 631,536 T→C 12.4% intergenic (+162/‑340) gph_1 → / → proP Phosphoglycolate phosphatase/Proline/betaine transporter
RA USA300TCH1516_ALE 639,592 C→G 13.5% A33G (GCC→GGC)  USA300HOU_RS03045 → hypothetical protein
RA USA300TCH1516_ALE 665,392 T→G 32.2% L79* (TTA→TGA)  paiA_1 → Spermidine/spermine N(1)‑acetyltransferase
RA USA300TCH1516_ALE 667,064 T→G 8.1% D18E (GAT→GAG)  USA300TCH1516_00600 → hypothetical protein
RA USA300TCH1516_ALE 690,093 A→G 15.6% intergenic (‑22/+13) USA300HOU_RS03320 ← / ← USA300HOU_RS03325 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 690,098 A→T 15.3% intergenic (‑27/+8) USA300HOU_RS03320 ← / ← USA300HOU_RS03325 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 690,101 A→T 15.8% intergenic (‑30/+5) USA300HOU_RS03320 ← / ← USA300HOU_RS03325 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 690,106 C→T 9.2% *128* (TAG→TAA)  USA300HOU_RS03325 ← hypothetical protein
RA USA300TCH1516_ALE 702,553 T→A 12.7% F116I (TTT→ATT)  nhaK_1 → Sodium, potassium, lithium and rubidium/H(+) antiporter
RA USA300TCH1516_ALE 707,910 A→G 62.6% intergenic (‑1/‑121) znuC_1 ← / → ideR High‑affinity zinc uptake system ATP‑binding protein ZnuC/Iron‑dependent repressor IdeR
RA USA300TCH1516_ALE 707,911 C→T 7.5% intergenic (‑2/‑120) znuC_1 ← / → ideR High‑affinity zinc uptake system ATP‑binding protein ZnuC/Iron‑dependent repressor IdeR
RA USA300TCH1516_ALE 722,987 C→T 19.1% T42I (ACA→ATA)  feuB → Iron‑uptake system permease protein FeuB
RA USA300TCH1516_ALE 722,992 A→G 17.0% I44V (ATA→GTA)  feuB → Iron‑uptake system permease protein FeuB
RA USA300TCH1516_ALE 740,322 G→C 15.8% intergenic (+549/+39) pitA_1 → / ← sle1_2 Low‑affinity inorganic phosphate transporter 1/N‑acetylmuramoyl‑L‑alanine amidase sle1
RA USA300TCH1516_ALE 740,328:1 +G 12.5% intergenic (+555/+33) pitA_1 → / ← sle1_2 Low‑affinity inorganic phosphate transporter 1/N‑acetylmuramoyl‑L‑alanine amidase sle1
RA USA300TCH1516_ALE 756,705 T→A 6.4% intergenic (‑193/‑20) uppP ← / → cydD Undecaprenyl‑diphosphatase/ATP‑binding/permease protein CydD
RA USA300TCH1516_ALE 770,855 A→G 7.4% intergenic (+41/‑209) ybaK → / → glcR Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR
RA USA300TCH1516_ALE 770,860 G→A 8.6% intergenic (+46/‑204) ybaK → / → glcR Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR
RA USA300TCH1516_ALE 770,866 A→T 8.8% intergenic (+52/‑198) ybaK → / → glcR Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR
RA USA300TCH1516_ALE 770,870 T→A 9.1% intergenic (+56/‑194) ybaK → / → glcR Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR
RA USA300TCH1516_ALE 770,877 A→T 7.9% intergenic (+63/‑187) ybaK → / → glcR Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR
RA USA300TCH1516_ALE 770,883 T→C 9.7% intergenic (+69/‑181) ybaK → / → glcR Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR
RA USA300TCH1516_ALE 770,888 C→T 6.3% intergenic (+74/‑176) ybaK → / → glcR Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR
RA USA300TCH1516_ALE 779,959 C→T 7.6% intergenic (+15/+57) csbB → / ← saeS Putative glycosyltransferase CsbB/Histidine protein kinase SaeS
RA USA300TCH1516_ALE 779,970 G→A 10.4% intergenic (+26/+46) csbB → / ← saeS Putative glycosyltransferase CsbB/Histidine protein kinase SaeS
RA USA300TCH1516_ALE 790,718 T→A 6.7% intergenic (+217/‑257) kipA_1 → / → ltaS KipI antagonist/Lipoteichoic acid synthase
RA USA300TCH1516_ALE 792,942 A→T 5.5% intergenic (+27/‑250) ltaS → / → ettA Lipoteichoic acid synthase/Energy‑dependent translational throttle protein EttA
RA USA300TCH1516_ALE 792,943 A→T 5.5% intergenic (+28/‑249) ltaS → / → ettA Lipoteichoic acid synthase/Energy‑dependent translational throttle protein EttA
RA USA300TCH1516_ALE 792,944 A→T 5.8% intergenic (+29/‑248) ltaS → / → ettA Lipoteichoic acid synthase/Energy‑dependent translational throttle protein EttA
RA USA300TCH1516_ALE 803,528 C→T 16.3% intergenic (‑228/+42) USA300HOU_RS03920 ← / ← dtpT Putative lipid kinase/Di‑/tripeptide transporter
RA USA300TCH1516_ALE 803,539 A→G 20.4% intergenic (‑239/+31) USA300HOU_RS03920 ← / ← dtpT Putative lipid kinase/Di‑/tripeptide transporter
RA USA300TCH1516_ALE 806,422 T→G 7.0% I127I (ATA→ATC)  ribN ← Riboflavin transporter
RA USA300TCH1516_ALE 806,425 C→A 6.0% M126I (ATG→ATT)  ribN ← Riboflavin transporter
RA USA300TCH1516_ALE 837,540:1 +T 15.0% intergenic (+34/‑235) USA300HOU_RS04100 → / → uvrB hypothetical protein/UvrABC system protein B
RA USA300TCH1516_ALE 875,946 A→T 11.1% intergenic (+49/‑172) clfA → / → USA300HOU_RS04275 Clumping factor A/Staphylocoagulase
RA USA300TCH1516_ALE 875,947 A→T 11.1% intergenic (+50/‑171) clfA → / → USA300HOU_RS04275 Clumping factor A/Staphylocoagulase
RA USA300TCH1516_ALE 890,542 T→C 9.5% intergenic (+17/‑47) gcvH → / → USA300TCH1516_00820 Glycine cleavage system H protein/hypothetical protein
RA USA300TCH1516_ALE 890,548 A→T 11.6% intergenic (+23/‑41) gcvH → / → USA300TCH1516_00820 Glycine cleavage system H protein/hypothetical protein
RA USA300TCH1516_ALE 895,932 G→A 11.9% intergenic (+131/+12) metQ_2 → / ← Int‑Tn_1 Methionine‑binding lipoprotein MetQ/Transposase from transposon Tn916
RA USA300TCH1516_ALE 895,935 T→C 11.8% intergenic (+134/+9) metQ_2 → / ← Int‑Tn_1 Methionine‑binding lipoprotein MetQ/Transposase from transposon Tn916
RA USA300TCH1516_ALE 895,942 C→T 6.9% intergenic (+141/+2) metQ_2 → / ← Int‑Tn_1 Methionine‑binding lipoprotein MetQ/Transposase from transposon Tn916
RA USA300TCH1516_ALE 897,213:1 +C 5.0% intergenic (‑49/+39) Int‑Tn_1 ← / ← entA_1 Transposase from transposon Tn916/Enterotoxin type A
RA USA300TCH1516_ALE 917,327 T→G 11.6% intergenic (+86/+244) sufB_2 → / ← USA300HOU_RS04545 FeS cluster assembly protein SufB/hypothetical protein
RA USA300TCH1516_ALE 917,330 C→A 10.8% intergenic (+89/+241) sufB_2 → / ← USA300HOU_RS04545 FeS cluster assembly protein SufB/hypothetical protein
RA USA300TCH1516_ALE 937,148 T→C 6.4% intergenic (+55/‑76) USA300HOU_RS04665 → / → pepA_1 NADH dehydrogenase‑like protein/Cytosol aminopeptidase
RA USA300TCH1516_ALE 937,158 T→A 12.1% intergenic (+65/‑66) USA300HOU_RS04665 → / → pepA_1 NADH dehydrogenase‑like protein/Cytosol aminopeptidase
RA USA300TCH1516_ALE 942,207 A→G 7.8% intergenic (‑178/+71) ptlE ← / ← mnhG1 Neopentalenolactone D synthase/Na(+)/H(+) antiporter subunit G1
RA USA300TCH1516_ALE 942,210 C→G 7.2% intergenic (‑181/+68) ptlE ← / ← mnhG1 Neopentalenolactone D synthase/Na(+)/H(+) antiporter subunit G1
RA USA300TCH1516_ALE 942,216 T→A 7.6% intergenic (‑187/+62) ptlE ← / ← mnhG1 Neopentalenolactone D synthase/Na(+)/H(+) antiporter subunit G1
RA USA300TCH1516_ALE 942,221 T→A 7.9% intergenic (‑192/+57) ptlE ← / ← mnhG1 Neopentalenolactone D synthase/Na(+)/H(+) antiporter subunit G1
RA USA300TCH1516_ALE 942,227 C→G 8.2% intergenic (‑198/+51) ptlE ← / ← mnhG1 Neopentalenolactone D synthase/Na(+)/H(+) antiporter subunit G1
RA USA300TCH1516_ALE 942,230 C→T 8.2% intergenic (‑201/+48) ptlE ← / ← mnhG1 Neopentalenolactone D synthase/Na(+)/H(+) antiporter subunit G1
RA USA300TCH1516_ALE 950,088 T→A 18.7% intergenic (+82/‑280) yugI_2 → / → USA300HOU_RS04740 General stress protein 13/putative oxidoreductase
RA USA300TCH1516_ALE 950,093 T→A 19.6% intergenic (+87/‑275) yugI_2 → / → USA300HOU_RS04740 General stress protein 13/putative oxidoreductase
RA USA300TCH1516_ALE 950,098 T→A 18.1% intergenic (+92/‑270) yugI_2 → / → USA300HOU_RS04740 General stress protein 13/putative oxidoreductase
RA USA300TCH1516_ALE 962,321 G→A 6.9% intergenic (+25/‑135) spsB_2 → / → addB Signal peptidase IB/ATP‑dependent helicase/deoxyribonuclease subunit B
RA USA300TCH1516_ALE 962,324 G→A 7.1% intergenic (+28/‑132) spsB_2 → / → addB Signal peptidase IB/ATP‑dependent helicase/deoxyribonuclease subunit B
RA USA300TCH1516_ALE 962,327 T→A 7.2% intergenic (+31/‑129) spsB_2 → / → addB Signal peptidase IB/ATP‑dependent helicase/deoxyribonuclease subunit B
RA USA300TCH1516_ALE 962,332 T→A 7.1% intergenic (+36/‑124) spsB_2 → / → addB Signal peptidase IB/ATP‑dependent helicase/deoxyribonuclease subunit B
RA USA300TCH1516_ALE 962,335 T→C 6.4% intergenic (+39/‑121) spsB_2 → / → addB Signal peptidase IB/ATP‑dependent helicase/deoxyribonuclease subunit B
RA USA300TCH1516_ALE 962,338 T→C 7.3% intergenic (+42/‑118) spsB_2 → / → addB Signal peptidase IB/ATP‑dependent helicase/deoxyribonuclease subunit B
RA USA300TCH1516_ALE 970,677 G→A 9.9% intergenic (+23/‑306) USA300HOU_RS04805 → / → USA300HOU_RS04810 Ureidoglycolate lyase/hypothetical protein
RA USA300TCH1516_ALE 970,681 T→A 9.1% intergenic (+27/‑302) USA300HOU_RS04805 → / → USA300HOU_RS04810 Ureidoglycolate lyase/hypothetical protein
RA USA300TCH1516_ALE 970,686 T→A 10.2% intergenic (+32/‑297) USA300HOU_RS04805 → / → USA300HOU_RS04810 Ureidoglycolate lyase/hypothetical protein
RA USA300TCH1516_ALE 970,690 T→C 9.1% intergenic (+36/‑293) USA300HOU_RS04805 → / → USA300HOU_RS04810 Ureidoglycolate lyase/hypothetical protein
RA USA300TCH1516_ALE 977,289 T→A 9.0% I190N (ATT→AAT)  clpB_1 → Chaperone protein ClpB
RA USA300TCH1516_ALE 1,019,742 G→A 6.5% intergenic (+64/+49) USA300HOU_RS05030 → / ← ltaA Putative phosphoesterase/putative glycolipid permease LtaA
RA USA300TCH1516_ALE 1,019,743 A→C 6.4% intergenic (+65/+48) USA300HOU_RS05030 → / ← ltaA Putative phosphoesterase/putative glycolipid permease LtaA
RA USA300TCH1516_ALE 1,019,746 G→T 6.5% intergenic (+68/+45) USA300HOU_RS05030 → / ← ltaA Putative phosphoesterase/putative glycolipid permease LtaA
RA USA300TCH1516_ALE 1,019,747 T→C 6.7% intergenic (+69/+44) USA300HOU_RS05030 → / ← ltaA Putative phosphoesterase/putative glycolipid permease LtaA
RA USA300TCH1516_ALE 1,038,119 A→C 6.0% T236P (ACG→CCG)  USA300TCH1516_00964 → hypothetical protein
RA USA300TCH1516_ALE 1,038,122 G→T 6.0% G237C (GGT→TGT)  USA300TCH1516_00964 → hypothetical protein
RA USA300TCH1516_ALE 1,042,789 T→C 12.9% intergenic (+19/+70) tagE_3 → / ← catD Poly(glycerol‑phosphate) alpha‑glucosyltransferase/Putative oxidoreductase CatD
RA USA300TCH1516_ALE 1,042,796 G→A 16.9% intergenic (+26/+63) tagE_3 → / ← catD Poly(glycerol‑phosphate) alpha‑glucosyltransferase/Putative oxidoreductase CatD
RA USA300TCH1516_ALE 1,054,586 Δ1 bp 9.5% intergenic (‑87/+441) sspA ← / ← patA_2 Glutamyl endopeptidase/Putative N‑acetyl‑LL‑diaminopimelate aminotransferase
RA USA300TCH1516_ALE 1,055,119 C→A 7.8% G355C (GGT→TGT)  patA_2 ← Putative N‑acetyl‑LL‑diaminopimelate aminotransferase
RA USA300TCH1516_ALE 1,055,126 T→G 13.2% T352T (ACA→ACC)  patA_2 ← Putative N‑acetyl‑LL‑diaminopimelate aminotransferase
RA USA300TCH1516_ALE 1,078,152 A→T 11.3% Q510L (CAG→CTG)  purL → Phosphoribosylformylglycinamidine synthase subunit PurL
RA USA300TCH1516_ALE 1,104,520 T→A 11.8% L309* (TTA→TAA)  pdhB → Pyruvate dehydrogenase E1 component subunit beta
RA USA300TCH1516_ALE 1,117,393 C→G 6.9% intergenic (+106/+48) suhB_1 → / ← USA300TCH1516_01040 Inositol‑1‑monophosphatase/hypothetical protein
RA USA300TCH1516_ALE 1,200,692 G→T 7.6% L169F (TTG→TTT)  divIVA → Septum site‑determining protein DivIVA
RA USA300TCH1516_ALE 1,200,697 A→C 7.3% E171A (GAA→GCA)  divIVA → Septum site‑determining protein DivIVA
RA USA300TCH1516_ALE 1,218,719 Δ1 bp 8.8% intergenic (+210/+53) USA300HOU_RS06065 → / ← USA300HOU_RS06070 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 1,218,722 T→A 8.9% intergenic (+213/+50) USA300HOU_RS06065 → / ← USA300HOU_RS06070 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 1,218,730 G→T 11.4% intergenic (+221/+42) USA300HOU_RS06065 → / ← USA300HOU_RS06070 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 1,218,732 C→G 11.3% intergenic (+223/+40) USA300HOU_RS06065 → / ← USA300HOU_RS06070 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 1,218,734 A→C 11.5% intergenic (+225/+38) USA300HOU_RS06065 → / ← USA300HOU_RS06070 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 1,221,653 G→A 8.8% intergenic (+68/‑148) rpoZ → / → coaBC DNA‑directed RNA polymerase subunit omega/Coenzyme A biosynthesis bifunctional protein CoaBC
RA USA300TCH1516_ALE 1,231,474 G→C 11.0% G40A (GGT→GCT)  stp → Serine/threonine phosphatase stp
RA USA300TCH1516_ALE 1,232,565 C→A 5.9% A157D (GCT→GAT)  prkC → Serine/threonine‑protein kinase PrkC
RA USA300TCH1516_ALE 1,233,504 T→A 12.1% V470D (GTT→GAT)  prkC → Serine/threonine‑protein kinase PrkC
RA USA300TCH1516_ALE 1,239,557:1 +C 5.4% intergenic (+24/‑166) USA300HOU_RS06160 → / → recG hypothetical protein/ATP‑dependent DNA helicase RecG
RA USA300TCH1516_ALE 1,239,562 A→G 5.7% intergenic (+29/‑161) USA300HOU_RS06160 → / → recG hypothetical protein/ATP‑dependent DNA helicase RecG
RA USA300TCH1516_ALE 1,239,564 A→T 5.9% intergenic (+31/‑159) USA300HOU_RS06160 → / → recG hypothetical protein/ATP‑dependent DNA helicase RecG
RA USA300TCH1516_ALE 1,239,566 C→T 5.8% intergenic (+33/‑157) USA300HOU_RS06160 → / → recG hypothetical protein/ATP‑dependent DNA helicase RecG
RA USA300TCH1516_ALE 1,239,571 Δ1 bp 5.4% intergenic (+38/‑152) USA300HOU_RS06160 → / → recG hypothetical protein/ATP‑dependent DNA helicase RecG
RA USA300TCH1516_ALE 1,245,330 A→T 9.4% intergenic (+135/‑108) fabG → / → acpP 3‑oxoacyl‑[acyl‑carrier‑protein] reductase FabG/Acyl carrier protein
RA USA300TCH1516_ALE 1,245,337 A→T 8.8% intergenic (+142/‑101) fabG → / → acpP 3‑oxoacyl‑[acyl‑carrier‑protein] reductase FabG/Acyl carrier protein
RA USA300TCH1516_ALE 1,245,338 A→T 8.5% intergenic (+143/‑100) fabG → / → acpP 3‑oxoacyl‑[acyl‑carrier‑protein] reductase FabG/Acyl carrier protein
RA USA300TCH1516_ALE 1,245,345 A→T 8.7% intergenic (+150/‑93) fabG → / → acpP 3‑oxoacyl‑[acyl‑carrier‑protein] reductase FabG/Acyl carrier protein
RA USA300TCH1516_ALE 1,254,017 A→T 8.4% intergenic (+114/‑74) rpsP → / → rimM 30S ribosomal protein S16/Ribosome maturation factor RimM
RA USA300TCH1516_ALE 1,255,815 A→G 5.5% intergenic (+31/+213) rplS → / ← USA300HOU_RS06250 50S ribosomal protein L19/hypothetical protein
RA USA300TCH1516_ALE 1,270,460 C→G 5.2% intergenic (+211/‑206) trmFO → / → xerC_1 Methylenetetrahydrofolate‑‑tRNA‑(uracil‑5‑)‑ methyltransferase TrmFO/Tyrosine recombinase XerC
RA USA300TCH1516_ALE 1,313,113 A→T 9.6% intergenic (+17/+280) rny_1 → / ← USA300HOU_RS06485 Ribonuclease Y/hypothetical protein
RA USA300TCH1516_ALE 1,313,118 A→T 5.6% intergenic (+22/+275) rny_1 → / ← USA300HOU_RS06485 Ribonuclease Y/hypothetical protein
RA USA300TCH1516_ALE 1,313,343 A→G 5.3% intergenic (+247/+50) rny_1 → / ← USA300HOU_RS06485 Ribonuclease Y/hypothetical protein
RA USA300TCH1516_ALE 1,332,110 G→A 15.0% V168V (GTG→GTA)  miaA → tRNA dimethylallyltransferase
RA USA300TCH1516_ALE 1,338,468:1 +G 8.5% intergenic (+403/‑872) glnA → / → USA300TCH1516_01240 Glutamine synthetase/hypothetical protein
RA USA300TCH1516_ALE 1,338,473 Δ1 bp 5.4% intergenic (+408/‑867) glnA → / → USA300TCH1516_01240 Glutamine synthetase/hypothetical protein
RA USA300TCH1516_ALE 1,343,619 A→C 12.4% intergenic (+32/‑98) USA300HOU_RS06640 → / → USA300TCH1516_01248 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 1,343,622 G→T 12.1% intergenic (+35/‑95) USA300HOU_RS06640 → / → USA300TCH1516_01248 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 1,362,249 A→T 9.2% intergenic (‑181/+37) USA300TCH1516_01271 ← / ← lysP_1 hypothetical protein/Lysine‑specific permease
RA USA300TCH1516_ALE 1,362,255 A→T 9.5% intergenic (‑187/+31) USA300TCH1516_01271 ← / ← lysP_1 hypothetical protein/Lysine‑specific permease
RA USA300TCH1516_ALE 1,362,261 A→T 8.5% intergenic (‑193/+25) USA300TCH1516_01271 ← / ← lysP_1 hypothetical protein/Lysine‑specific permease
RA USA300TCH1516_ALE 1,362,267 C→T 7.3% intergenic (‑199/+19) USA300TCH1516_01271 ← / ← lysP_1 hypothetical protein/Lysine‑specific permease
RA USA300TCH1516_ALE 1,366,121 A→T 10.3% intergenic (+420/‑34) rpmG2_1 → / → rpsN2 50S ribosomal protein L33 2/Alternate 30S ribosomal protein S14
RA USA300TCH1516_ALE 1,368,899 C→A 7.5% intergenic (+303/+77) USA300TCH1516_01277 → / ← lexA_1 hypothetical protein/LexA repressor
RA USA300TCH1516_ALE 1,368,902 A→T 7.5% intergenic (+306/+74) USA300TCH1516_01277 → / ← lexA_1 hypothetical protein/LexA repressor
RA USA300TCH1516_ALE 1,368,905 T→G 7.0% intergenic (+309/+71) USA300TCH1516_01277 → / ← lexA_1 hypothetical protein/LexA repressor
RA USA300TCH1516_ALE 1,415,013 C→G 5.1% intergenic (+24/+24) yitU_2 → / ← mqo 5‑amino‑6‑(5‑phospho‑D‑ribitylamino)uracil phosphatase YitU/malate:quinone oxidoreductase
RA USA300TCH1516_ALE 1,416,458 A→T 100% I216N (ATT→AAT)  oppD_4 ← Oligopeptide transport ATP‑binding protein OppD
RA USA300TCH1516_ALE 1,421,700 T→A 5.8% intergenic (+136/+4) pepF1_2 → / ← phoU Oligoendopeptidase F, plasmid/Phosphate‑specific transport system accessory protein PhoU
RA USA300TCH1516_ALE 1,430,691 C→G 8.6% intergenic (+800/‑60) ybiT → / → lysC putative ABC transporter ATP‑binding protein YbiT/Aspartokinase
RA USA300TCH1516_ALE 1,430,693 T→A 8.8% intergenic (+802/‑58) ybiT → / → lysC putative ABC transporter ATP‑binding protein YbiT/Aspartokinase
RA USA300TCH1516_ALE 1,430,695 C→G 9.0% intergenic (+804/‑56) ybiT → / → lysC putative ABC transporter ATP‑binding protein YbiT/Aspartokinase
RA USA300TCH1516_ALE 1,439,789 C→A 5.4% intergenic (‑146/+51) USA300HOU_RS07135 ← / ← cspA_2 hypothetical protein/Cold shock protein CspA
RA USA300TCH1516_ALE 1,439,806 G→C 13.3% intergenic (‑163/+34) USA300HOU_RS07135 ← / ← cspA_2 hypothetical protein/Cold shock protein CspA
RA USA300TCH1516_ALE 1,440,085 G→T 22.1% intergenic (‑45/+126) cspA_2 ← / ← USA300TCH1516_01338 Cold shock protein CspA/hypothetical protein
RA USA300TCH1516_ALE 1,476,681 T→A 11.5% H8448L (CAT→CTT)  ebh_1 ← Extracellular matrix‑binding protein ebh
RA USA300TCH1516_ALE 1,476,685 T→A 12.2% M8447L (ATG→TTG)  ebh_1 ← Extracellular matrix‑binding protein ebh
RA USA300TCH1516_ALE 1,487,340 T→A 7.1% H4895L (CAT→CTT)  ebh_1 ← Extracellular matrix‑binding protein ebh
RA USA300TCH1516_ALE 1,487,343 T→A 5.8% K4894M (AAG→ATG)  ebh_1 ← Extracellular matrix‑binding protein ebh
RA USA300TCH1516_ALE 1,500,743 T→G 5.6% V427V (GTA→GTC)  ebh_1 ← Extracellular matrix‑binding protein ebh
RA USA300TCH1516_ALE 1,502,422 C→G 6.1% *464S (TGA→TCA)  norB_4 ← Quinolone resistance protein NorB
RA USA300TCH1516_ALE 1,513,930 A→T 100% L413F (TTA→TTT)  USA300HOU_RS07375 → hypothetical protein
RA USA300TCH1516_ALE 1,516,445 A→G 5.5% intergenic (‑96/+5) USA300TCH1516_01381 ← / ← gpsB hypothetical protein/Cell cycle protein GpsB
RA USA300TCH1516_ALE 1,516,450 T→A 6.4% *115Y (TAA→TAT)  gpsB ← Cell cycle protein GpsB
RA USA300TCH1516_ALE 1,516,453 T→A 6.3% K114N (AAA→AAT)  gpsB ← Cell cycle protein GpsB
RA USA300TCH1516_ALE 1,526,532 T→A 7.0% K471* (AAA→TAA)  dinG_1 ← putative ATP‑dependent helicase DinG
RA USA300TCH1516_ALE 1,537,428 A→T 10.0% I94I (ATT→ATA)  aroB ← 3‑dehydroquinate synthase
RA USA300TCH1516_ALE 1,582,474 G→A 9.3% H107H (CAC→CAT)  clpP1 ← ATP‑dependent Clp protease proteolytic subunit 1
RA USA300TCH1516_ALE 1,582,479 T→C 15.1% M106V (ATG→GTG)  clpP1 ← ATP‑dependent Clp protease proteolytic subunit 1
RA USA300TCH1516_ALE 1,615,301 T→A 7.3% intergenic (‑31/+18) xerD_3 ← / ← fur Tyrosine recombinase XerD/Ferric uptake regulation protein
RA USA300TCH1516_ALE 1,615,309 A→T 5.2% intergenic (‑39/+10) xerD_3 ← / ← fur Tyrosine recombinase XerD/Ferric uptake regulation protein
RA USA300TCH1516_ALE 1,622,775 A→T 9.5% K43* (AAA→TAA)  marA → Multiple antibiotic resistance protein MarA
RA USA300TCH1516_ALE 1,646,189 G→C 100% A155G (GCA→GGA)  ypdF ← Aminopeptidase YpdF
RA USA300TCH1516_ALE 1,653,327 A→G 8.3% intergenic (‑32/+127) gcvT ← / ← aroK Aminomethyltransferase/Shikimate kinase
RA USA300TCH1516_ALE 1,653,332 A→G 10.7% intergenic (‑37/+122) gcvT ← / ← aroK Aminomethyltransferase/Shikimate kinase
RA USA300TCH1516_ALE 1,653,335 C→T 9.8% intergenic (‑40/+119) gcvT ← / ← aroK Aminomethyltransferase/Shikimate kinase
RA USA300TCH1516_ALE 1,653,340 C→T 8.7% intergenic (‑45/+114) gcvT ← / ← aroK Aminomethyltransferase/Shikimate kinase
RA USA300TCH1516_ALE 1,662,039 T→A 7.0% intergenic (‑126/+29) USA300HOU_RS08275 ← / ← rpmG2_2 5‑formyltetrahydrofolate cyclo‑ligase/50S ribosomal protein L33 2
RA USA300TCH1516_ALE 1,678,274 T→C 6.3% intergenic (+20/+130) glyQS → / ← recO Glycine‑‑tRNA ligase/DNA repair protein RecO
RA USA300TCH1516_ALE 1,678,277 G→A 6.4% intergenic (+23/+127) glyQS → / ← recO Glycine‑‑tRNA ligase/DNA repair protein RecO
RA USA300TCH1516_ALE 1,678,358 A→G 5.5% intergenic (+104/+46) glyQS → / ← recO Glycine‑‑tRNA ligase/DNA repair protein RecO
RA USA300TCH1516_ALE 1,678,362 A→C 5.1% intergenic (+108/+42) glyQS → / ← recO Glycine‑‑tRNA ligase/DNA repair protein RecO
RA USA300TCH1516_ALE 1,678,369 T→G 5.1% intergenic (+115/+35) glyQS → / ← recO Glycine‑‑tRNA ligase/DNA repair protein RecO
RA USA300TCH1516_ALE 1,685,148 C→T 6.3% intergenic (‑160/+60) USA300HOU_RS08395 ← / ← rpsU hypothetical protein/30S ribosomal protein S21
RA USA300TCH1516_ALE 1,685,149 T→A 6.5% intergenic (‑161/+59) USA300HOU_RS08395 ← / ← rpsU hypothetical protein/30S ribosomal protein S21
RA USA300TCH1516_ALE 1,702,671 G→C 10.2% I117M (ATC→ATG)  tylM1 ← dTDP‑3‑amino‑3,6‑dideoxy‑alpha‑D‑glucopyranose N,N‑dimethyltransferase
RA USA300TCH1516_ALE 1,702,674 G→C 10.2% F116L (TTC→TTG)  tylM1 ← dTDP‑3‑amino‑3,6‑dideoxy‑alpha‑D‑glucopyranose N,N‑dimethyltransferase
RA USA300TCH1516_ALE 1,722,313 G→A 9.2% Q3* (CAA→TAA)  yrrK ← Putative pre‑16S rRNA nuclease
RA USA300TCH1516_ALE 1,722,314 T→C 9.7% L2L (TTA→TTG)  yrrK ← Putative pre‑16S rRNA nuclease
RA USA300TCH1516_ALE 1,744,362 G→A 57.0% H104Y (CAC→TAC)  apt ← Adenine phosphoribosyltransferase
RA USA300TCH1516_ALE 1,744,476 C→G 21.1% V66L (GTA→CTA)  apt ← Adenine phosphoribosyltransferase
RA USA300TCH1516_ALE 1,761,889 C→A 57.4% D388Y (GAT→TAT)  fpgS ← Folylpolyglutamate synthase
RA USA300TCH1516_ALE 1,776,634 C→T 6.7% intergenic (‑111/+40) clpX ← / ← tig ATP‑dependent Clp protease ATP‑binding subunit ClpX/Trigger factor
RA USA300TCH1516_ALE 1,779,807 A→G 15.5% intergenic (‑113/+29) USA300TCH1516_01664 ← / ← rplT hypothetical protein/50S ribosomal protein L20
RA USA300TCH1516_ALE 1,779,810 A→T 14.8% intergenic (‑116/+26) USA300TCH1516_01664 ← / ← rplT hypothetical protein/50S ribosomal protein L20
RA USA300TCH1516_ALE 1,779,813 C→T 16.2% intergenic (‑119/+23) USA300TCH1516_01664 ← / ← rplT hypothetical protein/50S ribosomal protein L20
RA USA300TCH1516_ALE 1,789,551 C→T 9.2% intergenic (‑32/+138) gapA2 ← / ← coaE Glyceraldehyde‑3‑phosphate dehydrogenase 2/Dephospho‑CoA kinase
RA USA300TCH1516_ALE 1,794,352 A→T 6.1% Y426N (TAT→AAT)  USA300HOU_RS08960 ← hypothetical protein
RA USA300TCH1516_ALE 1,805,818 T→A 6.9% L431F (TTA→TTT)  pyk ← Pyruvate kinase
RA USA300TCH1516_ALE 1,870,863 C→T 5.6% intergenic (‑350/+200) srkA ← / ← dat Stress response kinase A/D‑alanine aminotransferase
RA USA300TCH1516_ALE 1,870,864 A→G 5.6% intergenic (‑351/+199) srkA ← / ← dat Stress response kinase A/D‑alanine aminotransferase
RA USA300TCH1516_ALE 1,885,368 G→A 7.0% intergenic (‑150/+176) ebh_2 ← / ← moeZ_2 Extracellular matrix‑binding protein ebh/putative adenylyltransferase/sulfurtransferase MoeZ
RA USA300TCH1516_ALE 1,885,369 T→C 5.3% intergenic (‑151/+175) ebh_2 ← / ← moeZ_2 Extracellular matrix‑binding protein ebh/putative adenylyltransferase/sulfurtransferase MoeZ
RA USA300TCH1516_ALE 1,899,097 C→G 6.3% intergenic (‑88/+405) ribD ← / ← USA300HOU_RS09405 Riboflavin biosynthesis protein RibD/hypothetical protein
RA USA300TCH1516_ALE 1,904,152 C→A 11.4% A182S (GCC→TCC)  atl_2 ← Bifunctional autolysin
RA USA300TCH1516_ALE 1,905,775 G→C 12.3% E128Q (GAA→CAA)  sigS → RNA polymerase sigma factor SigS
RA USA300TCH1516_ALE 1,934,773 T→A 6.0% K159* (AAA→TAA)  USA300HOU_RS09605 ← hypothetical protein
RA USA300TCH1516_ALE 1,934,780 A→T 6.0% N156K (AAT→AAA)  USA300HOU_RS09605 ← hypothetical protein
RA USA300TCH1516_ALE 1,962,395 A→G 5.0% intergenic (‑284/+188) USA300TCH1516_01825 ← / ← ydeN tRNA‑Met/Putative hydrolase YdeN
RA USA300TCH1516_ALE 1,962,405 C→T 5.5% intergenic (‑294/+178) USA300TCH1516_01825 ← / ← ydeN tRNA‑Met/Putative hydrolase YdeN
RA USA300TCH1516_ALE 1,963,768 C→G 53.7% V365L (GTA→CTA)  hemY ← Protoporphyrinogen oxidase
RA USA300TCH1516_ALE 1,984,315 A→T 5.4% E213D (GAA→GAT)  rluD_3 → Ribosomal large subunit pseudouridine synthase D
RA USA300TCH1516_ALE 1,984,316 A→T 5.4% I214F (ATC→TTC)  rluD_3 → Ribosomal large subunit pseudouridine synthase D
RA USA300TCH1516_ALE 2,010,363 C→T 100% C146Y (TGT→TAT)  USA300HOU_RS10125 ← Putative multidrug export ATP‑binding/permease protein
RA USA300TCH1516_ALE 2,033,564 C→T 6.1% R382Q (CGA→CAA)  murF_1 ← UDP‑N‑acetylmuramoyl‑tripeptide‑‑D‑alanyl‑D‑ alanine ligase
RA USA300TCH1516_ALE 2,033,567 A→G 6.3% L381S (TTG→TCG)  murF_1 ← UDP‑N‑acetylmuramoyl‑tripeptide‑‑D‑alanyl‑D‑ alanine ligase
RA USA300TCH1516_ALE 2,042,100 T→A 6.5% K338N (AAA→AAT)  gatB_2 ← Aspartyl/glutamyl‑tRNA(Asn/Gln) amidotransferase subunit B
RA USA300TCH1516_ALE 2,046,831 A→G 5.8% intergenic (+39/+50) putP → / ← USA300HOU_RS10335 Sodium/proline symporter/hypothetical protein
RA USA300TCH1516_ALE 2,046,835 A→T 5.9% intergenic (+43/+46) putP → / ← USA300HOU_RS10335 Sodium/proline symporter/hypothetical protein
RA USA300TCH1516_ALE 2,046,840 A→T 5.9% intergenic (+48/+41) putP → / ← USA300HOU_RS10335 Sodium/proline symporter/hypothetical protein
RA USA300TCH1516_ALE 2,046,844 C→T 6.0% intergenic (+52/+37) putP → / ← USA300HOU_RS10335 Sodium/proline symporter/hypothetical protein
RA USA300TCH1516_ALE 2,049,164 C→A 8.8% E311D (GAG→GAT)  ligA ← DNA ligase
RA USA300TCH1516_ALE 2,050,876 A→G 5.0% L473L (TTA→CTA)  pcrA ← ATP‑dependent DNA helicase PcrA
RA USA300TCH1516_ALE 2,072,011:1 +A 6.6% intergenic (+506/+67) USA300HOU_RS10445 → / ← USA300HOU_RS10450 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 2,072,028 Δ1 bp 5.8% intergenic (+523/+50) USA300HOU_RS10445 → / ← USA300HOU_RS10450 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 2,077,620 T→G 7.9% L174L (CTA→CTC)  yxlF_3 ← putative ABC transporter ATP‑binding protein YxlF
RA USA300TCH1516_ALE 2,077,629 C→A 6.8% M171I (ATG→ATT)  yxlF_3 ← putative ABC transporter ATP‑binding protein YxlF
RA USA300TCH1516_ALE 2,123,544 T→A 6.2% N66I (AAT→ATT)  USA300HOU_RS10825 ← hypothetical protein
RA USA300TCH1516_ALE 2,123,779 T→A 9.9% intergenic (‑39/‑94) USA300HOU_RS10825 ← / → lexA_2 hypothetical protein/LexA repressor
RA USA300TCH1516_ALE 2,129,368 A→G 5.7% intergenic (+201/+37) hlb_2 → / ← USA300HOU_RS10870 Phospholipase C/putative leukocidin‑like protein 1
RA USA300TCH1516_ALE 2,129,372 A→G 5.4% intergenic (+205/+33) hlb_2 → / ← USA300HOU_RS10870 Phospholipase C/putative leukocidin‑like protein 1
RA USA300TCH1516_ALE 2,165,416 A→T 7.8% intergenic (‑384/‑94) tsaE ← / → ilvD tRNA threonylcarbamoyladenosine biosynthesis protein TsaE/Dihydroxy‑acid dehydratase
RA USA300TCH1516_ALE 2,172,067:1 +G 14.4% coding (116/1047 nt) leuB → 3‑isopropylmalate dehydrogenase
RA USA300TCH1516_ALE 2,172,075 G→C 15.3% E42Q (GAA→CAA)  leuB → 3‑isopropylmalate dehydrogenase
RA USA300TCH1516_ALE 2,172,078 T→A 14.7% F43I (TTT→ATT)  leuB → 3‑isopropylmalate dehydrogenase
RA USA300TCH1516_ALE 2,172,081 G→C 12.7% G44R (GGT→CGT)  leuB → 3‑isopropylmalate dehydrogenase
RA USA300TCH1516_ALE 2,172,088 Δ1 bp 10.9% coding (137/1047 nt) leuB → 3‑isopropylmalate dehydrogenase
RA USA300TCH1516_ALE 2,243,494 A→T 12.7% intergenic (+72/+37) USA300HOU_RS11475 → / ← pyrG hypothetical protein/CTP synthase
RA USA300TCH1516_ALE 2,243,499 T→A 19.3% intergenic (+77/+32) USA300HOU_RS11475 → / ← pyrG hypothetical protein/CTP synthase
RA USA300TCH1516_ALE 2,243,504 A→T 17.6% intergenic (+82/+27) USA300HOU_RS11475 → / ← pyrG hypothetical protein/CTP synthase
RA USA300TCH1516_ALE 2,256,968 T→A 9.7% intergenic (‑57/+143) dps ← / ← USA300HOU_RS11555 General stress protein 20U/hypothetical protein
RA USA300TCH1516_ALE 2,273,758 A→T 5.2% G228G (GGA→GGT)  mtlA → PTS system mannitol‑specific EIICB component
RA USA300TCH1516_ALE 2,273,764 T→G 6.0% G230G (GGT→GGG)  mtlA → PTS system mannitol‑specific EIICB component
RA USA300TCH1516_ALE 2,275,551 A→G 7.8% T302A (ACA→GCA) ‡ mtlR → Transcriptional regulator MtlR
RA USA300TCH1516_ALE 2,275,552 C→T 8.0% T302I (ACA→ATA) ‡ mtlR → Transcriptional regulator MtlR
RA USA300TCH1516_ALE 2,279,705 G→A 100% A943V (GCA→GTA)  ebh_3 ← Extracellular matrix‑binding protein ebh
RA USA300TCH1516_ALE 2,309,793:1 +G 8.6% coding (76/1032 nt) yfiZ_2 ← putative siderophore transport system permease protein YfiZ
RA USA300TCH1516_ALE 2,309,800 Δ1 bp 12.0% coding (69/1032 nt) yfiZ_2 ← putative siderophore transport system permease protein YfiZ
RA USA300TCH1516_ALE 2,309,807 Δ1 bp 10.0% coding (62/1032 nt) yfiZ_2 ← putative siderophore transport system permease protein YfiZ
RA USA300TCH1516_ALE 2,328,872 G→C 6.6% F264L (TTC→TTG)  lacE ← PTS system lactose‑specific EIICB component
RA USA300TCH1516_ALE 2,352,654 C→T 6.5% intergenic (‑508/+37) USA300HOU_RS12000 ← / ← rpsI hypothetical protein/30S ribosomal protein S9
RA USA300TCH1516_ALE 2,352,657 A→T 7.0% intergenic (‑511/+34) USA300HOU_RS12000 ← / ← rpsI hypothetical protein/30S ribosomal protein S9
RA USA300TCH1516_ALE 2,352,660 A→G 7.2% intergenic (‑514/+31) USA300HOU_RS12000 ← / ← rpsI hypothetical protein/30S ribosomal protein S9
RA USA300TCH1516_ALE 2,352,815 G→A 53.0% A92V (GCA→GTA)  rpsI ← 30S ribosomal protein S9
RA USA300TCH1516_ALE 2,372,407 A→G 16.9% intergenic (+158/+34) USA300TCH1516_02262 → / ← pbuG hypothetical protein/Guanine/hypoxanthine permease PbuG
RA USA300TCH1516_ALE 2,372,413 C→G 20.7% intergenic (+164/+28) USA300TCH1516_02262 → / ← pbuG hypothetical protein/Guanine/hypoxanthine permease PbuG
RA USA300TCH1516_ALE 2,372,419 C→T 20.8% intergenic (+170/+22) USA300TCH1516_02262 → / ← pbuG hypothetical protein/Guanine/hypoxanthine permease PbuG
RA USA300TCH1516_ALE 2,378,334 T→G 5.4% intergenic (+193/+226) glcU_2 → / ← USA300HOU_RS12220 putative glucose uptake protein GlcU/hypothetical protein
RA USA300TCH1516_ALE 2,378,337 G→T 6.4% intergenic (+196/+223) glcU_2 → / ← USA300HOU_RS12220 putative glucose uptake protein GlcU/hypothetical protein
RA USA300TCH1516_ALE 2,387,416 G→C 5.8% V121V (GTG→GTC)  ribZ_1 → Riboflavin transporter RibZ
RA USA300TCH1516_ALE 2,424,608 A→G 8.1% intergenic (‑166/+62) USA300HOU_RS12490 ← / ← USA300HOU_RS12495 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 2,424,609 C→T 7.9% intergenic (‑167/+61) USA300HOU_RS12490 ← / ← USA300HOU_RS12495 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 2,429,717 T→A 13.5% intergenic (‑71/+62) lytR_2 ← / ← suhB_2 Transcriptional regulator LytR/Inositol‑1‑monophosphatase
RA USA300TCH1516_ALE 2,430,691:1 +A 9.7% intergenic (‑115/‑270) suhB_2 ← / → birA_2 Inositol‑1‑monophosphatase/Bifunctional ligase/repressor BirA
RA USA300TCH1516_ALE 2,432,237 C→T 5.3% intergenic (+584/+63) birA_2 → / ← USA300HOU_RS12525 Bifunctional ligase/repressor BirA/hypothetical protein
RA USA300TCH1516_ALE 2,432,240 A→T 5.7% intergenic (+587/+60) birA_2 → / ← USA300HOU_RS12525 Bifunctional ligase/repressor BirA/hypothetical protein
RA USA300TCH1516_ALE 2,432,243 A→T 5.8% intergenic (+590/+57) birA_2 → / ← USA300HOU_RS12525 Bifunctional ligase/repressor BirA/hypothetical protein
RA USA300TCH1516_ALE 2,432,246 A→G 5.7% intergenic (+593/+54) birA_2 → / ← USA300HOU_RS12525 Bifunctional ligase/repressor BirA/hypothetical protein
RA USA300TCH1516_ALE 2,435,507 A→C 9.3% L331W (TTG→TGG)  yifK ← putative transport protein YifK
RA USA300TCH1516_ALE 2,435,510 G→T 9.0% P330Q (CCA→CAA)  yifK ← putative transport protein YifK
RA USA300TCH1516_ALE 2,448,484 A→G 12.5% intergenic (‑243/+34) yxeP_4 ← / ← hutI putative hydrolase YxeP/Imidazolonepropionase
RA USA300TCH1516_ALE 2,448,493 C→T 16.6% intergenic (‑252/+25) yxeP_4 ← / ← hutI putative hydrolase YxeP/Imidazolonepropionase
RA USA300TCH1516_ALE 2,448,498 C→T 15.2% intergenic (‑257/+20) yxeP_4 ← / ← hutI putative hydrolase YxeP/Imidazolonepropionase
RA USA300TCH1516_ALE 2,454,626 A→T 44.3% L48L (CTA→CTT)  lyrA → Lysostaphin resistance protein A
RA USA300TCH1516_ALE 2,494,035 T→A 5.9% intergenic (‑61/+171) USA300HOU_RS12835 ← / ← USA300HOU_RS12845 Ferredoxin‑‑NADP reductase/hypothetical protein
RA USA300TCH1516_ALE 2,497,391 C→G 9.1% N147K (AAC→AAG)  USA300HOU_RS12865 → hypothetical protein
RA USA300TCH1516_ALE 2,513,975 C→T 5.7% R54Q (CGA→CAA)  USA300HOU_RS12940 ← hypothetical protein
RA USA300TCH1516_ALE 2,517,775 A→C 12.9% S953A (TCA→GCA)  narG ← Respiratory nitrate reductase 1 alpha chain
RA USA300TCH1516_ALE 2,517,782 T→A 15.2% L950L (CTA→CTT)  narG ← Respiratory nitrate reductase 1 alpha chain
RA USA300TCH1516_ALE 2,517,789 G→T 10.4% A948E (GCA→GAA)  narG ← Respiratory nitrate reductase 1 alpha chain
RA USA300TCH1516_ALE 2,530,786 A→G 11.1% intergenic (‑37/+236) yefM ← / ← bdbD Antitoxin YefM/Disulfide bond formation protein D
RA USA300TCH1516_ALE 2,530,791 C→T 8.5% intergenic (‑42/+231) yefM ← / ← bdbD Antitoxin YefM/Disulfide bond formation protein D
RA USA300TCH1516_ALE 2,532,298 A→T 100% T15T (ACA→ACT)  femA_3 → Aminoacyltransferase FemA
RA USA300TCH1516_ALE 2,552,027 Δ1 bp 5.8% coding (1215/1734 nt) USA300HOU_RS13150 ← putative ABC transporter ATP‑binding protein
RA USA300TCH1516_ALE 2,552,031:1 +G 6.2% coding (1211/1734 nt) USA300HOU_RS13150 ← putative ABC transporter ATP‑binding protein
RA USA300TCH1516_ALE 2,559,830 A→G 5.7% intergenic (+24/+99) bcr_2 → / ← USA300HOU_RS13190 Bicyclomycin resistance protein/hypothetical protein
RA USA300TCH1516_ALE 2,559,831 G→A 6.3% intergenic (+25/+98) bcr_2 → / ← USA300HOU_RS13190 Bicyclomycin resistance protein/hypothetical protein
RA USA300TCH1516_ALE 2,559,840 T→G 7.1% intergenic (+34/+89) bcr_2 → / ← USA300HOU_RS13190 Bicyclomycin resistance protein/hypothetical protein
RA USA300TCH1516_ALE 2,559,841 C→A 7.1% intergenic (+35/+88) bcr_2 → / ← USA300HOU_RS13190 Bicyclomycin resistance protein/hypothetical protein
RA USA300TCH1516_ALE 2,563,759 A→G 10.2% intergenic (+24/‑114) cycA_2 → / → nhaK_2 D‑serine/D‑alanine/glycine transporter/Sodium, potassium, lithium and rubidium/H(+) antiporter
RA USA300TCH1516_ALE 2,563,763 C→G 8.1% intergenic (+28/‑110) cycA_2 → / → nhaK_2 D‑serine/D‑alanine/glycine transporter/Sodium, potassium, lithium and rubidium/H(+) antiporter
RA USA300TCH1516_ALE 2,582,141 Δ1 bp 7.7% coding (1169/1353 nt) pnbA → Para‑nitrobenzyl esterase
RA USA300TCH1516_ALE 2,582,146:1 +A 14.7% coding (1174/1353 nt) pnbA → Para‑nitrobenzyl esterase
RA USA300TCH1516_ALE 2,600,622:1 +A 8.8% intergenic (‑34/+833) dapF ← / ← USA300HOU_RS13395 Diaminopimelate epimerase/hypothetical protein
RA USA300TCH1516_ALE 2,600,629 T→A 5.9% intergenic (‑41/+826) dapF ← / ← USA300HOU_RS13395 Diaminopimelate epimerase/hypothetical protein
RA USA300TCH1516_ALE 2,600,630 T→A 5.9% intergenic (‑42/+825) dapF ← / ← USA300HOU_RS13395 Diaminopimelate epimerase/hypothetical protein
RA USA300TCH1516_ALE 2,608,825 A→T 11.7% intergenic (+106/+154) USA300TCH1516_02485 → / ← USA300HOU_RS13450 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 2,656,546 A→T 5.2% intergenic (‑41/+37) mhqA_3 ← / ← mhqR Putative ring‑cleaving dioxygenase MhqA/HTH‑type transcriptional regulator MhqR
RA USA300TCH1516_ALE 2,656,547 A→T 5.2% intergenic (‑42/+36) mhqA_3 ← / ← mhqR Putative ring‑cleaving dioxygenase MhqA/HTH‑type transcriptional regulator MhqR
RA USA300TCH1516_ALE 2,668,296 A→C 5.3% intergenic (‑105/‑446) USA300HOU_RS13735 ← / → USA300TCH1516_02539 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 2,668,298 G→C 5.3% intergenic (‑107/‑444) USA300HOU_RS13735 ← / → USA300TCH1516_02539 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 2,668,300 G→T 5.3% intergenic (‑109/‑442) USA300HOU_RS13735 ← / → USA300TCH1516_02539 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 2,725,352 A→T 11.3% intergenic (‑58/+276) USA300HOU_RS14015 ← / ← USA300HOU_RS14020 Baeyer‑Villiger flavin‑containing monooxygenase/hypothetical protein
RA USA300TCH1516_ALE 2,744,200 G→A 9.7% intergenic (+137/+56) fda → / ← mqo2 Fructose‑bisphosphate aldolase class 1/putative malate:quinone oxidoreductase 2
RA USA300TCH1516_ALE 2,744,205 A→G 13.8% intergenic (+142/+51) fda → / ← mqo2 Fructose‑bisphosphate aldolase class 1/putative malate:quinone oxidoreductase 2
RA USA300TCH1516_ALE 2,744,213 T→A 15.3% intergenic (+150/+43) fda → / ← mqo2 Fructose‑bisphosphate aldolase class 1/putative malate:quinone oxidoreductase 2
RA USA300TCH1516_ALE 2,745,325 T→A 5.6% N143I (AAT→ATT)  mqo2 ← putative malate:quinone oxidoreductase 2
RA USA300TCH1516_ALE 2,754,728 A→G 5.4% intergenic (‑135/+129) gloB ← / ← opuD_3 Hydroxyacylglutathione hydrolase/Glycine betaine transporter OpuD
RA USA300TCH1516_ALE 2,754,732 A→T 5.7% intergenic (‑139/+125) gloB ← / ← opuD_3 Hydroxyacylglutathione hydrolase/Glycine betaine transporter OpuD
RA USA300TCH1516_ALE 2,783,163 T→A 9.0% intergenic (‑68/+279) arcA_2 ← / ← argR_3 Arginine deiminase/Arginine repressor
RA USA300TCH1516_ALE 2,783,168 T→A 5.6% intergenic (‑73/+274) arcA_2 ← / ← argR_3 Arginine deiminase/Arginine repressor
RA USA300TCH1516_ALE 2,817,612 G→A 5.4% R239R (CGC→CGT)  sraP ← Serine‑rich adhesin for platelets
RA USA300TCH1516_ALE 2,825,587 C→T 6.1% intergenic (‑402/+446) cap8A_2 ← / ← icaR Capsular polysaccharide type 8 biosynthesis protein cap8A/Biofilm operon icaADBC HTH‑type negative transcriptional regulator IcaR
RA USA300TCH1516_ALE 2,833,387 G→C 9.9% intergenic (‑723/+367) lipA_2 ← / ← hisI Lipase 1/Phosphoribosyl‑AMP cyclohydrolase
RA USA300TCH1516_ALE 2,840,323 T→A 6.5% L119F (TTA→TTT)  hisZ ← ATP phosphoribosyltransferase regulatory subunit
RA USA300TCH1516_ALE 2,847,006 G→C 15.1% intergenic (‑210/‑170) salL ← / → yceI Adenosyl‑chloride synthase/Protein YceI
RA USA300TCH1516_ALE 2,852,974:1 +T 11.4% coding (91/1419 nt) yflS → Putative malate transporter YflS
RA USA300TCH1516_ALE 2,861,759 C→T 10.8% A481V (GCA→GTA)  bceB_3 → Bacitracin export permease protein BceB

Unassigned new junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? CP000731 1 =0 (0.000)6 (0.020)
+25 bp		 5/110 NT 6.6% intergenic (–/‑231) –/repA –/replication protein A
?CP000731 26987 = 249 (0.710)intergenic (‑140/–) USA300HOU_pUSA300HOUMR0033/– partitioning protein/–
* ? CP000731 = 64267 (0.760)36 (0.170)
+33 bp		 12/94 NT 31.5% intergenic (–/‑168) –/repA –/replication protein A
?CP000731 = 27041 0 (0.000)intergenic (‑194/–) USA300HOU_pUSA300HOUMR0033/– partitioning protein/–
* ? CP000731 = 198386 (1.100)24 (0.070) 7/146 NT 6.1% intergenic (–/‑34) –/repA –/replication protein A
?CP000731 = 216 393 (1.230)intergenic (–/‑16) –/repA –/replication protein A
* ? CP000731 = 648447 (1.270)22 (0.070) 12/148 NT 5.1% coding (417/984 nt) repA replication protein A
?CP000731 = 720 404 (1.250)coding (489/984 nt) repA replication protein A
* ? CP000731 1668 =288 (0.820)17 (0.050) 7/160 NT 5.0% intergenic (+453/‑403) repA/USA300HOU_pUSA300HOUMR0003 replication protein A/hypothetical protein
?CP000731 1685 = 356 (1.020)intergenic (+470/‑386) repA/USA300HOU_pUSA300HOUMR0003 replication protein A/hypothetical protein
* ? CP000731 = 1692388 (1.110)21 (0.070) 7/144 NT 5.4% intergenic (+477/‑379) repA/USA300HOU_pUSA300HOUMR0003 replication protein A/hypothetical protein
?CP000731 = 1696 387 (1.230)intergenic (+481/‑375) repA/USA300HOU_pUSA300HOUMR0003 replication protein A/hypothetical protein
* ? CP000731 3772 =213 (0.610)40 (0.130) 14/140 NT 17.3% intergenic (+388/‑96) USA300HOU_pUSA300HOUMR0005/USA300HOU_pUSA300HOUMR0006 hypothetical protein/hypothetical protein
?CP000731 3805 = 195 (0.640)intergenic (+421/‑63) USA300HOU_pUSA300HOUMR0005/USA300HOU_pUSA300HOUMR0006 hypothetical protein/hypothetical protein
* ? CP000731 = 3781215 (0.610)35 (0.110) 13/140 NT 15.4% intergenic (+397/‑87) USA300HOU_pUSA300HOUMR0005/USA300HOU_pUSA300HOUMR0006 hypothetical protein/hypothetical protein
?CP000731 = 3794 195 (0.640)intergenic (+410/‑74) USA300HOU_pUSA300HOUMR0005/USA300HOU_pUSA300HOUMR0006 hypothetical protein/hypothetical protein
* ? CP000731 = 7672331 (0.940)42 (0.140) 13/138 NT 12.0% intergenic (+282/+244) USA300HOU_pUSA300HOUMR0010/blaZ MarR family transcriptional regulator/beta‑lactamase
?CP000731 = 7688 331 (1.090)intergenic (+298/+228) USA300HOU_pUSA300HOUMR0010/blaZ MarR family transcriptional regulator/beta‑lactamase
* ? CP000731 11093 =374 (1.070)58 (0.180) 13/146 NT 15.9% intergenic (+98/‑166) blaI/USA300HOU_pUSA300HOUMR0014 beta‑lactamase regulator BlaI/recombinase
?CP000731 11129 = 270 (0.840)intergenic (+134/‑130) blaI/USA300HOU_pUSA300HOUMR0014 beta‑lactamase regulator BlaI/recombinase
* ? CP000731 11951 =356 (1.020)33 (0.110) 12/134 NT 10.7% intergenic (+114/+109) USA300HOU_pUSA300HOUMR0014/USA300HOU_pUSA300HOUMR0015 recombinase/hypothetical protein
?CP000731 11987 = 254 (0.860)intergenic (+150/+73) USA300HOU_pUSA300HOUMR0014/USA300HOU_pUSA300HOUMR0015 recombinase/hypothetical protein
* ? CP000731 = 1264680 (0.230)13 (0.040) 8/146 NT 15.1% coding (140/675 nt) USA300HOU_pUSA300HOUMR0016 IS257 transposase
?CP000731 = 12648 NA (NA)coding (142/675 nt) USA300HOU_pUSA300HOUMR0016 IS257 transposase
* ? CP000731 = 12916NA (NA)24 (0.070) 11/148 NT NA coding (410/675 nt) USA300HOU_pUSA300HOUMR0016 IS257 transposase
?CP000731 = 12919 NA (NA)coding (413/675 nt) USA300HOU_pUSA300HOUMR0016 IS257 transposase
* ? CP000731 16918 =NA (NA)8 (0.020) 3/150 NT 100% coding (144/675 nt) USA300HOU_pUSA300HOUMR0021 IS431 mec transposase
?CP000731 16924 = 0 (0.000)coding (138/675 nt) USA300HOU_pUSA300HOUMR0021 IS431 mec transposase
* ? CP000731 17008 =NA (NA)27 (0.080) 14/148 NT 100% coding (54/675 nt) USA300HOU_pUSA300HOUMR0021 IS431 mec transposase
?CP000731 17011 = 0 (0.000)coding (51/675 nt) USA300HOU_pUSA300HOUMR0021 IS431 mec transposase
* ? CP000731 = 17199253 (0.720)20 (0.070) 11/138 NT 7.8% intergenic (‑138/+109) USA300HOU_pUSA300HOUMR0021/USA300HOU_pUSA300HOUMR0023 IS431 mec transposase/bacitracin ABC ATP binding cassette transporter, membrane protein
?CP000731 = 17213 254 (0.840)intergenic (‑152/+95) USA300HOU_pUSA300HOUMR0021/USA300HOU_pUSA300HOUMR0023 IS431 mec transposase/bacitracin ABC ATP binding cassette transporter, membrane protein
* ? CP000731 = 17565310 (0.880)16 (0.050) 10/146 NT 5.5% coding (481/738 nt) USA300HOU_pUSA300HOUMR0023 bacitracin ABC ATP binding cassette transporter, membrane protein
?CP000731 = 17593 265 (0.830)coding (453/738 nt) USA300HOU_pUSA300HOUMR0023 bacitracin ABC ATP binding cassette transporter, membrane protein
* ? CP000731 20439 =327 (0.930)32 (0.100) 14/148 NT 10.1% coding (632/675 nt) USA300HOU_pUSA300HOUMR0027 IS431mec transposase
?CP000731 20463 = 269 (0.830)coding (608/675 nt) USA300HOU_pUSA300HOUMR0027 IS431mec transposase
* ? CP000731 = 21325275 (0.780)14 (0.050) 8/138 NT 5.1% intergenic (‑255/‑219) USA300HOU_pUSA300HOUMR0027/USA300HOU_pUSA300HOUMR0028 IS431mec transposase/macrolide transporter
?CP000731 = 21339 279 (0.920)intergenic (‑269/‑205) USA300HOU_pUSA300HOUMR0027/USA300HOU_pUSA300HOUMR0028 IS431mec transposase/macrolide transporter
* ? CP000731 22935 =341 (0.970)20 (0.060) 10/146 NT 6.6% coding (1392/1467 nt) USA300HOU_pUSA300HOUMR0028 macrolide transporter
?CP000731 22963 = 253 (0.790)coding (1420/1467 nt) USA300HOU_pUSA300HOUMR0028 macrolide transporter
* ? CP000731 = 25287184 (0.520)12 (0.050) 8/114 NT 7.6% intergenic (+185/‑61) USA300HOU_pUSA300HOUMR0030/USA300HOU_pUSA300HOUMR0031 Sin recombinase/hypothetical protein
?CP000731 = 25310 159 (0.640)intergenic (+208/‑38) USA300HOU_pUSA300HOUMR0030/USA300HOU_pUSA300HOUMR0031 Sin recombinase/hypothetical protein
* ? CP000731 25306 =167 (0.480)29 (0.100) 11/138 NT 17.5% intergenic (+204/‑42) USA300HOU_pUSA300HOUMR0030/USA300HOU_pUSA300HOUMR0031 Sin recombinase/hypothetical protein
?CP000731 25340 = 130 (0.430)intergenic (+238/‑8) USA300HOU_pUSA300HOUMR0030/USA300HOU_pUSA300HOUMR0031 Sin recombinase/hypothetical protein
* ? NC_012417 1 =0 (0.000)279 (0.030) 15/160 NT 19.7% intergenic (–/‑279) –/USA300HOU_RS14890 –/replication protein
?NC_012417 3063 = 2269 (0.230)intergenic (‑389/–) USA300HOU_RS14900/– hypothetical protein/–
* ? NC_012417 = 5005203 (0.520)262 (0.030) 24/148 NT 5.1% pseudogene (221/709 nt) USA300HOU_RS14890 replication protein
?NC_012417 = 511 4987 (0.540)pseudogene (232/709 nt) USA300HOU_RS14890 replication protein
* ? NC_012417 987 =3888 (0.390)794 (0.090) 29/138 NT 20.3% pseudogene (708/709 nt) USA300HOU_RS14890 replication protein
?NC_012417 1013 = 2877 (0.330)coding (182/192 nt) USA300HOU_RS15665 hypothetical protein
* ? NC_012417 = 9973489 (0.350)632 (0.070) 58/138 NT 17.7% intergenic (+9/+6) USA300HOU_RS14890/USA300HOU_RS15665 replication protein/hypothetical protein
?NC_012417 = 1001 2877 (0.330)intergenic (+13/+2) USA300HOU_RS14890/USA300HOU_RS15665 replication protein/hypothetical protein
* ? NC_012417 1040 =1110 (0.110)199 (0.030) 26/124 NT 16.6% coding (155/192 nt) USA300HOU_RS15665 hypothetical protein
?NC_012417 1090 = 1144 (0.150)coding (105/192 nt) USA300HOU_RS15665 hypothetical protein
* ? NC_012417 = 1057545 (0.050)427 (0.060) 37/124 NT 35.3% coding (138/192 nt) USA300HOU_RS15665 hypothetical protein
?NC_012417 = 1071 1144 (0.150)coding (124/192 nt) USA300HOU_RS15665 hypothetical protein
* ? NC_012417 = 1057545 (0.050)89 (0.010) 25/116 NT 8.9% coding (138/192 nt) USA300HOU_RS15665 hypothetical protein
?NC_012417 = 1103 1432 (0.200)coding (92/192 nt) USA300HOU_RS15665 hypothetical protein
* ? NC_012417 1172 =4257 (0.430)335 (0.040) 38/148 NT 7.3% coding (23/192 nt) USA300HOU_RS15665 hypothetical protein
?NC_012417 1187 = 4514 (0.490)coding (8/192 nt) USA300HOU_RS15665 hypothetical protein
* ? NC_012417 = 11954796 (0.480)475 (0.050) 37/144 NT 9.4% intergenic (‑1/‑384) USA300HOU_RS15665/USA300HOU_RS14895 hypothetical protein/hypothetical protein
?NC_012417 = 1199 4795 (0.530)intergenic (‑5/‑380) USA300HOU_RS15665/USA300HOU_RS14895 hypothetical protein/hypothetical protein
* ? NC_012417 = 19742842 (0.280)226 (0.030) 29/138 NT 8.4% intergenic (+207/+119) USA300HOU_RS14895/USA300HOU_RS14900 hypothetical protein/hypothetical protein
?NC_012417 = 2041 NA (NA)intergenic (+274/+52) USA300HOU_RS14895/USA300HOU_RS14900 hypothetical protein/hypothetical protein
* ? NC_012417 1975 =NA (NA)276 (0.030) 24/138 NT 12.3% intergenic (+208/+118) USA300HOU_RS14895/USA300HOU_RS14900 hypothetical protein/hypothetical protein
?NC_012417 2042 = 2275 (0.230)intergenic (+275/+51) USA300HOU_RS14895/USA300HOU_RS14900 hypothetical protein/hypothetical protein
* ? NC_012417 = 19922238 (0.220)1026 (0.110) 41/148 NT 36.5% intergenic (+225/+101) USA300HOU_RS14895/USA300HOU_RS14900 hypothetical protein/hypothetical protein
?NC_012417 = 2020 1505 (0.160)intergenic (+253/+73) USA300HOU_RS14895/USA300HOU_RS14900 hypothetical protein/hypothetical protein
* ? NC_012417 1993 =NA (NA)542 (0.060) 27/148 NT 28.0% intergenic (+226/+100) USA300HOU_RS14895/USA300HOU_RS14900 hypothetical protein/hypothetical protein
?NC_012417 2021 = 1505 (0.150)intergenic (+254/+72) USA300HOU_RS14895/USA300HOU_RS14900 hypothetical protein/hypothetical protein
* ? NC_012417 2143 =5513 (0.550)395 (0.040) 30/148 NT 7.1% coding (532/582 nt) USA300HOU_RS14900 hypothetical protein
?NC_012417 2161 = 5288 (0.570)coding (514/582 nt) USA300HOU_RS14900 hypothetical protein
* ? NC_012417 = 29375802 (0.580)1563 (0.170) 53/150 NT 21.9% intergenic (‑263/–) USA300HOU_RS14900/– hypothetical protein/–
?NC_012417 = 2949 5721 (0.610)intergenic (‑275/–) USA300HOU_RS14900/– hypothetical protein/–
* ? NC_012417 = 30692218 (0.220)315 (0.030) 24/146 NT 23.7% intergenic (‑395/–) USA300HOU_RS14900/– hypothetical protein/–
?NC_012417 = 3118 0 (0.000)intergenic (‑444/–) USA300HOU_RS14900/– hypothetical protein/–
* ? USA300TCH1516_ALE = 216176 (0.770)19 (0.200) 12/152 NT 19.5% intergenic (+256/‑22) dnaA/dnaN Chromosomal replication initiator protein DnaA/DNA polymerase III subunit beta
?USA300TCH1516_ALE = 2172 85 (0.910)intergenic (+267/‑11) dnaA/dnaN Chromosomal replication initiator protein DnaA/DNA polymerase III subunit beta
* ? USA300TCH1516_ALE 10273 =82 (0.830)4 (0.040) 4/152 NT 5.6% coding (322/813 nt) nnrD ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase
?USA300TCH1516_ALE 10302 = 57 (0.610)coding (293/813 nt) nnrD ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase
* ? USA300TCH1516_ALE 12708 =103 (1.050)20 (0.220) 17/146 NT 18.1% intergenic (+274/‑105) hutH/serS_1 Histidine ammonia‑lyase/Serine‑‑tRNA ligase
?USA300TCH1516_ALE 12737 = 87 (0.970)intergenic (+303/‑76) hutH/serS_1 Histidine ammonia‑lyase/Serine‑‑tRNA ligase
* ? USA300TCH1516_ALE = 2220671 (0.720)5 (0.060) 4/142 NT 6.8% intergenic (+19/‑259) dnaC/purA Replicative DNA helicase/Adenylosuccinate synthetase
?USA300TCH1516_ALE = 22224 74 (0.850)intergenic (+37/‑241) dnaC/purA Replicative DNA helicase/Adenylosuccinate synthetase
* ? USA300TCH1516_ALE = 2276994 (0.960)6 (0.060) 5/152 NT 6.6% coding (305/1284 nt) purA Adenylosuccinate synthetase
?USA300TCH1516_ALE = 22794 81 (0.870)coding (330/1284 nt) purA Adenylosuccinate synthetase
* ? USA300TCH1516_ALE 36113 =NA (NA)7 (0.080) 4/146 NT NA coding (439/675 nt) USA300HOU_RS00140 hypothetical protein
?USA300TCH1516_ALE 36164 = NA (NA)coding (388/675 nt) USA300HOU_RS00140 hypothetical protein
* ? USA300TCH1516_ALE 42499 =102 (1.040)10 (0.130) 8/124 NT 13.2% coding (1467/1524 nt) USA300TCH1516_00035 hypothetical protein
?USA300TCH1516_ALE 42544 = 52 (0.680)coding (1422/1524 nt) USA300TCH1516_00035 hypothetical protein
* ? USA300TCH1516_ALE 42564 =51 (0.520)35 (0.470)
+TACATTATAAAATACATATC		 9/120 NT 47.8% coding (1402/1524 nt) USA300TCH1516_00035 hypothetical protein
?USA300TCH1516_ALE 1803072 = NA (NA)coding (796/807 nt) USA300HOU_RS12765 hypothetical protein
* ? USA300TCH1516_ALE 51234 =112 (1.140)5 (0.060) 5/144 NT 5.1% intergenic (‑32/‑107) USA300HOU_RS00210/USA300HOU_RS00215 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 51274 = 85 (0.960)intergenic (‑72/‑67) USA300HOU_RS00210/USA300HOU_RS00215 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 52489 =136 (1.380)7 (0.070) 5/160 NT 7.3% intergenic (+99/‑574) USA300HOU_RS00215/USA300HOU_RS00220 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 52811 = 41 (0.420)intergenic (+421/‑252) USA300HOU_RS00215/USA300HOU_RS00220 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 52495 =NA (NA)4 (0.040) 3/156 NT NA intergenic (+105/‑568) USA300HOU_RS00215/USA300HOU_RS00220 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 52882 = NA (NA)intergenic (+492/‑181) USA300HOU_RS00215/USA300HOU_RS00220 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 57551 =118 (1.200)12 (0.140) 10/144 NT 11.0% coding (618/621 nt) USA300HOU_RS00240 hypothetical protein
?USA300TCH1516_ALE 57600 = 87 (0.980)intergenic (+46/+871) USA300HOU_RS00240/USA300TCH1516_00049 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 61689128 (1.300)8 (0.090) 3/146 NT 6.0% intergenic (‑536/+35) USA300HOU_RS00260/USA300TCH1516_00053 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 61720 136 (1.520)intergenic (‑567/+4) USA300HOU_RS00260/USA300TCH1516_00053 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 68692 =106 (1.080)7 (0.080) 5/144 NT 7.1% coding (808/852 nt) USA300TCH1516_00061 hypothetical protein
?USA300TCH1516_ALE 68737 = 89 (1.010)intergenic (+1/+99) USA300TCH1516_00061/arcC1_1 hypothetical protein/Carbamate kinase 1
* ? USA300TCH1516_ALE 75971 =69 (0.700)16 (0.200) 11/128 NT 21.3% intergenic (+29/‑244) USA300HOU_RS00335/USA300HOU_RS00140 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 76020 = 63 (0.800)intergenic (+78/‑195) USA300HOU_RS00335/USA300HOU_RS00140 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 7598668 (0.690)21 (0.270) 11/128 NT 26.3% intergenic (+44/‑229) USA300HOU_RS00335/USA300HOU_RS00140 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 76003 63 (0.800)intergenic (+61/‑212) USA300HOU_RS00335/USA300HOU_RS00140 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 12797880 (0.810)20 (0.230) 14/144 NT 20.3% intergenic (+198/+131) lctP_1/spa L‑lactate permease/Immunoglobulin G‑binding protein A
?USA300TCH1516_ALE = 128000 85 (0.960)intergenic (+220/+109) lctP_1/spa L‑lactate permease/Immunoglobulin G‑binding protein A
* ? USA300TCH1516_ALE = 14692595 (0.970)7 (0.080) 5/142 NT 7.6% intergenic (+71/‑141) USA300HOU_RS00660/butA hypothetical protein/Diacetyl reductase [(S)‑acetoin forming]
?USA300TCH1516_ALE = 146945 87 (1.000)intergenic (+91/‑121) USA300HOU_RS00660/butA hypothetical protein/Diacetyl reductase [(S)‑acetoin forming]
* ? USA300TCH1516_ALE = 153874111 (1.130)6 (0.070) 5/150 NT 5.4% intergenic (+46/‑222) rfbX/sodM Putative O‑antigen transporter/Superoxide dismutase [Mn/Fe] 2
?USA300TCH1516_ALE = 153903 106 (1.150)intergenic (+75/‑193) rfbX/sodM Putative O‑antigen transporter/Superoxide dismutase [Mn/Fe] 2
* ? USA300TCH1516_ALE 169889 =107 (1.090)55 (0.600) 14/148 NT 38.2% intergenic (+436/‑541) repE/USA300HOU_RS07235 Replication initiation protein/hypothetical protein
?USA300TCH1516_ALE = 848673 79 (0.870)intergenic (+678/‑202) trxB/USA300HOU_RS04145 Thioredoxin reductase/Nucleotide‑binding protein
* ? USA300TCH1516_ALE 173490 =94 (0.960)6 (0.070) 5/146 NT 7.1% coding (2390/2610 nt) adhE Aldehyde‑alcohol dehydrogenase
?USA300TCH1516_ALE 173521 = 72 (0.800)coding (2421/2610 nt) adhE Aldehyde‑alcohol dehydrogenase
* ? USA300TCH1516_ALE = 21171285 (0.860)9 (0.100) 7/142 NT 11.0% intergenic (+270/+58) sfp/yagU 4'‑phosphopantetheinyl transferase sfp/Inner membrane protein YagU
?USA300TCH1516_ALE = 211745 70 (0.800)intergenic (+303/+25) sfp/yagU 4'‑phosphopantetheinyl transferase sfp/Inner membrane protein YagU
* ? USA300TCH1516_ALE 221178 =63 (0.640)10 (0.110) 7/146 NT 14.4% intergenic (‑224/+50) ipdC/ptsG_1 Indole‑3‑pyruvate decarboxylase/PTS system glucose‑specific EIICBA component
?USA300TCH1516_ALE 221218 = 61 (0.680)intergenic (‑264/+10) ipdC/ptsG_1 Indole‑3‑pyruvate decarboxylase/PTS system glucose‑specific EIICBA component
* ? USA300TCH1516_ALE = 22118465 (0.660)15 (0.170) 6/146 NT 20.0% intergenic (‑230/+44) ipdC/ptsG_1 Indole‑3‑pyruvate decarboxylase/PTS system glucose‑specific EIICBA component
?USA300TCH1516_ALE = 221210 61 (0.680)intergenic (‑256/+18) ipdC/ptsG_1 Indole‑3‑pyruvate decarboxylase/PTS system glucose‑specific EIICBA component
* ? USA300TCH1516_ALE = 22748779 (0.800)6 (0.060) 5/152 NT 7.3% coding (212/879 nt) ybbH_1 putative HTH‑type transcriptional regulator YbbH
?USA300TCH1516_ALE = 227515 77 (0.820)coding (240/879 nt) ybbH_1 putative HTH‑type transcriptional regulator YbbH
* ? USA300TCH1516_ALE 236074 =98 (1.000)8 (0.090) 5/152 NT 7.4% coding (486/1593 nt) gsiA Glutathione import ATP‑binding protein GsiA
?USA300TCH1516_ALE 236115 = 108 (1.160)coding (445/1593 nt) gsiA Glutathione import ATP‑binding protein GsiA
* ? USA300TCH1516_ALE = 25794879 (0.800)6 (0.070) 4/146 NT 6.9% coding (974/1557 nt) USA300HOU_RS01140 putative sensor‑like histidine kinase
?USA300TCH1516_ALE = 257968 89 (0.990)coding (954/1557 nt) USA300HOU_RS01140 putative sensor‑like histidine kinase
* ? USA300TCH1516_ALE 260284 =65 (0.660)8 (0.090) 7/138 NT 12.8% intergenic (‑398/‑190) potD_1/pflB Spermidine/putrescine‑binding periplasmic protein/Formate acetyltransferase
?USA300TCH1516_ALE 260324 = 53 (0.620)intergenic (‑438/‑150) potD_1/pflB Spermidine/putrescine‑binding periplasmic protein/Formate acetyltransferase
* ? USA300TCH1516_ALE = 26029468 (0.690)11 (0.130) 6/138 NT 16.5% intergenic (‑408/‑180) potD_1/pflB Spermidine/putrescine‑binding periplasmic protein/Formate acetyltransferase
?USA300TCH1516_ALE = 260312 53 (0.620)intergenic (‑426/‑162) potD_1/pflB Spermidine/putrescine‑binding periplasmic protein/Formate acetyltransferase
* ? USA300TCH1516_ALE 263523 =91 (0.930)9 (0.100) 6/140 NT 11.2% intergenic (+22/‑314) pflA/ugpQ_2 Pyruvate formate‑lyase‑activating enzyme/Glycerophosphodiester phosphodiesterase, cytoplasmic
?USA300TCH1516_ALE 263561 = 63 (0.730)intergenic (+60/‑276) pflA/ugpQ_2 Pyruvate formate‑lyase‑activating enzyme/Glycerophosphodiester phosphodiesterase, cytoplasmic
* ? USA300TCH1516_ALE 278631 =103 (1.050)16 (0.190) 8/140 NT 15.0% intergenic (+226/+88) USA300HOU_RS01215/gsiB hypothetical protein/Glutathione‑binding protein GsiB
?USA300TCH1516_ALE 278672 = 91 (1.060)intergenic (+267/+47) USA300HOU_RS01215/gsiB hypothetical protein/Glutathione‑binding protein GsiB
* ? USA300TCH1516_ALE = 278640100 (1.020)5 (0.060) 4/140 NT 5.3% intergenic (+235/+79) USA300HOU_RS01215/gsiB hypothetical protein/Glutathione‑binding protein GsiB
?USA300TCH1516_ALE = 278661 91 (1.060)intergenic (+256/+58) USA300HOU_RS01215/gsiB hypothetical protein/Glutathione‑binding protein GsiB
* ? USA300TCH1516_ALE = 280894103 (1.050)11 (0.130)
+TTAATTGGGAGTA		 7/134 NT 11.2% intergenic (‑146/+11) USA300HOU_RS01225/USA300HOU_RS01230 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 855632 = 105 (1.070)intergenic (+163/‑597) zipA_1/cggR Cell division protein ZipA/Central glycolytic genes regulator
* ? USA300TCH1516_ALE 298069 =80 (0.810)8 (0.090) 8/140 NT 11.2% intergenic (+208/‑220) tarK/tarF_1 Teichoic acid ribitol‑phosphate polymerase TarK/Teichoic acid glycerol‑phosphate transferase
?USA300TCH1516_ALE 298125 = 57 (0.660)intergenic (+264/‑164) tarK/tarF_1 Teichoic acid ribitol‑phosphate polymerase TarK/Teichoic acid glycerol‑phosphate transferase
* ? USA300TCH1516_ALE = 29807876 (0.770)5 (0.060) 5/140 NT 7.5% intergenic (+217/‑211) tarK/tarF_1 Teichoic acid ribitol‑phosphate polymerase TarK/Teichoic acid glycerol‑phosphate transferase
?USA300TCH1516_ALE = 298114 57 (0.660)intergenic (+253/‑175) tarK/tarF_1 Teichoic acid ribitol‑phosphate polymerase TarK/Teichoic acid glycerol‑phosphate transferase
* ? USA300TCH1516_ALE = 30384081 (0.820)9 (0.100) 7/146 NT 10.8% coding (630/1725 nt) epsJ putative glycosyltransferase EpsJ
?USA300TCH1516_ALE = 303860 75 (0.840)coding (650/1725 nt) epsJ putative glycosyltransferase EpsJ
* ? USA300TCH1516_ALE 314324 =65 (0.660)8 (0.090) 4/148 NT 11.3% intergenic (‑182/+69) rebM/rbsK_rbiA Demethylrebeccamycin‑D‑glucose O‑methyltransferase/Bifunctional ribokinase/ribose‑5‑phosphate isomerase A
?USA300TCH1516_ALE 314383 = 65 (0.710)intergenic (‑241/+10) rebM/rbsK_rbiA Demethylrebeccamycin‑D‑glucose O‑methyltransferase/Bifunctional ribokinase/ribose‑5‑phosphate isomerase A
* ? USA300TCH1516_ALE = 31432969 (0.700)6 (0.070) 6/148 NT 8.5% intergenic (‑187/+64) rebM/rbsK_rbiA Demethylrebeccamycin‑D‑glucose O‑methyltransferase/Bifunctional ribokinase/ribose‑5‑phosphate isomerase A
?USA300TCH1516_ALE = 314376 65 (0.710)intergenic (‑234/+17) rebM/rbsK_rbiA Demethylrebeccamycin‑D‑glucose O‑methyltransferase/Bifunctional ribokinase/ribose‑5‑phosphate isomerase A
* ? USA300TCH1516_ALE 329202 =116 (1.180)11 (0.130) 8/140 NT 11.3% intergenic (+70/+73) USA300HOU_RS01475/ssaA2_1 hypothetical protein/Staphylococcal secretory antigen ssaA2
?USA300TCH1516_ALE 329255 = 71 (0.830)intergenic (+123/+20) USA300HOU_RS01475/ssaA2_1 hypothetical protein/Staphylococcal secretory antigen ssaA2
* ? USA300TCH1516_ALE = 34444586 (0.870)10 (0.130)
+ACATTAAGATAGTTTA		 4/128 NT 11.0% intergenic (+44/‑164) yezG_1/USA300HOU_RS01545 putative antitoxin YezG/hypothetical protein
?USA300TCH1516_ALE = 348041 117 (1.190)coding (288/300 nt) yezG_1 putative antitoxin YezG
* ? USA300TCH1516_ALE = 34753594 (0.960)6 (0.080)
+TAGACAATCTTAATGT		 5/128 NT 7.5% coding (489/501 nt) yezG_3 putative antitoxin YezG
?USA300TCH1516_ALE = 348599 92 (0.940)intergenic (+44/‑166) yezG_5/USA300HOU_RS01580 putative antitoxin YezG/hypothetical protein
* ? USA300TCH1516_ALE = 349728122 (1.240)9 (0.100) 5/142 NT 7.7% intergenic (+280/‑306) USA300HOU_RS01580/yezG_6 hypothetical protein/putative antitoxin YezG
?USA300TCH1516_ALE = 349744 107 (1.230)intergenic (+296/‑290) USA300HOU_RS01580/yezG_6 hypothetical protein/putative antitoxin YezG
* ? USA300TCH1516_ALE 365029 =68 (0.690)22 (0.260) 6/136 NT 26.9% intergenic (+39/+66) nupC_1/sglT Nucleoside permease NupC/Sodium/glucose cotransporter
?USA300TCH1516_ALE 365083 = 62 (0.740)intergenic (+93/+12) nupC_1/sglT Nucleoside permease NupC/Sodium/glucose cotransporter
* ? USA300TCH1516_ALE = 36504064 (0.650)9 (0.110) 6/136 NT 13.4% intergenic (+50/+55) nupC_1/sglT Nucleoside permease NupC/Sodium/glucose cotransporter
?USA300TCH1516_ALE = 365070 62 (0.740)intergenic (+80/+25) nupC_1/sglT Nucleoside permease NupC/Sodium/glucose cotransporter
* ? USA300TCH1516_ALE = 37449891 (0.930)6 (0.070) 5/144 NT 7.1% intergenic (+116/+126) lip2/USA300HOU_RS01705 Lipase 2/hypothetical protein
?USA300TCH1516_ALE = 374518 75 (0.850)intergenic (+136/+106) lip2/USA300HOU_RS01705 Lipase 2/hypothetical protein
* ? USA300TCH1516_ALE = 38666788 (0.890)6 (0.070) 4/140 NT 7.4% intergenic (‑57/‑155) licR/slyA_1 putative licABCH operon regulator/Transcriptional regulator SlyA
?USA300TCH1516_ALE = 386691 73 (0.850)intergenic (‑81/‑131) licR/slyA_1 putative licABCH operon regulator/Transcriptional regulator SlyA
* ? USA300TCH1516_ALE 393245 =87 (0.880)8 (0.090) 6/142 NT 10.0% coding (235/567 nt) USA300HOU_RS01800 NAD(P)H‑dependent FAD/FMN reductase
?USA300TCH1516_ALE 393281 = 66 (0.760)coding (271/567 nt) USA300HOU_RS01800 NAD(P)H‑dependent FAD/FMN reductase
* ? USA300TCH1516_ALE 393589 =88 (0.890)5 (0.060) 4/142 NT 6.8% intergenic (+12/+48) USA300HOU_RS01800/USA300HOU_RS01805 NAD(P)H‑dependent FAD/FMN reductase/hypothetical protein
?USA300TCH1516_ALE 393631 = 58 (0.660)intergenic (+54/+6) USA300HOU_RS01800/USA300HOU_RS01805 NAD(P)H‑dependent FAD/FMN reductase/hypothetical protein
* ? USA300TCH1516_ALE 412131 =79 (0.800)8 (0.090) 6/144 NT 11.0% coding (1028/1161 nt) metC Cystathionine beta‑lyase MetC
?USA300TCH1516_ALE 412165 = 59 (0.670)coding (994/1161 nt) metC Cystathionine beta‑lyase MetC
* ? USA300TCH1516_ALE 414290 =92 (0.940)10 (0.110) 5/148 NT 11.0% intergenic (‑32/‑632) metI/spo0C Cystathionine gamma‑synthase/O‑acetylhomoserine (thiol)‑lyase/Chromosome‑partitioning protein Spo0J
?USA300TCH1516_ALE 414341 = 77 (0.850)intergenic (‑83/‑581) metI/spo0C Cystathionine gamma‑synthase/O‑acetylhomoserine (thiol)‑lyase/Chromosome‑partitioning protein Spo0J
* ? USA300TCH1516_ALE = 425019103 (1.050)17 (0.190) 9/146 NT 15.1% intergenic (+34/‑392) USA300HOU_RS01985/gpmA_1 hypothetical protein/2,3‑bisphosphoglycerate‑dependent phosphoglycerate mutase
?USA300TCH1516_ALE = 425031 97 (1.080)intergenic (+46/‑380) USA300HOU_RS01985/gpmA_1 hypothetical protein/2,3‑bisphosphoglycerate‑dependent phosphoglycerate mutase
* ? USA300TCH1516_ALE 433374 =104 (1.060)6 (0.070) 4/132 NT 7.6% intergenic (‑783/+194) tcyP/USA300HOU_RS02040 L‑cystine uptake protein TcyP/hypothetical protein
?USA300TCH1516_ALE 433453 = 61 (0.750)intergenic (‑862/+115) tcyP/USA300HOU_RS02040 L‑cystine uptake protein TcyP/hypothetical protein
* ? USA300TCH1516_ALE = 46368383 (0.840)6 (0.070) 3/146 NT 6.9% coding (194/804 nt) lpl2_1 putative lipoprotein
?USA300TCH1516_ALE = 463707 87 (0.970)coding (218/804 nt) lpl2_1 putative lipoprotein
* ? USA300TCH1516_ALE 474042 =71 (0.720)5 (0.050) 5/150 NT 6.9% intergenic (+24/+266) USA300HOU_RS02255/USA300HOU_RS02260 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 474087 = 68 (0.740)intergenic (+69/+221) USA300HOU_RS02255/USA300HOU_RS02260 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 492708 =68 (0.690)8 (0.100) 7/128 NT 12.4% intergenic (+130/+55) sle1_1/USA300HOU_RS02345 N‑acetylmuramoyl‑L‑alanine amidase sle1/hypothetical protein
?USA300TCH1516_ALE 492758 = 59 (0.750)intergenic (+180/+5) sle1_1/USA300HOU_RS02345 N‑acetylmuramoyl‑L‑alanine amidase sle1/hypothetical protein
* ? USA300TCH1516_ALE = 49272372 (0.730)13 (0.170) 8/128 NT 18.2% intergenic (+145/+40) sle1_1/USA300HOU_RS02345 N‑acetylmuramoyl‑L‑alanine amidase sle1/hypothetical protein
?USA300TCH1516_ALE = 492741 59 (0.750)intergenic (+163/+22) sle1_1/USA300HOU_RS02345 N‑acetylmuramoyl‑L‑alanine amidase sle1/hypothetical protein
* ? USA300TCH1516_ALE 509274 =60 (0.610)9 (0.100) 6/150 NT 13.3% coding (50/1698 nt) dnaX_1 DNA polymerase III subunit tau
?USA300TCH1516_ALE 509307 = 61 (0.660)coding (83/1698 nt) dnaX_1 DNA polymerase III subunit tau
* ? USA300TCH1516_ALE = 5127670 (0.000)9 (0.100) 6/150 NT 100% intergenic (+835/‑5928) recR/speA_2 Recombination protein RecR/Arginine decarboxylase
?USA300TCH1516_ALE = 512806 NA (NA)intergenic (+874/‑5889) recR/speA_2 Recombination protein RecR/Arginine decarboxylase
* ? USA300TCH1516_ALE = 513619NA (NA)7 (0.080) 5/146 NT NA intergenic (+1687/‑5076) recR/speA_2 Recombination protein RecR/Arginine decarboxylase
?USA300TCH1516_ALE = 513665 NA (NA)intergenic (+1733/‑5030) recR/speA_2 Recombination protein RecR/Arginine decarboxylase
* ? USA300TCH1516_ALE 513863 =NA (NA)7 (0.080) 5/148 NT NA intergenic (+1931/‑4832) recR/speA_2 Recombination protein RecR/Arginine decarboxylase
?USA300TCH1516_ALE 513903 = NA (NA)intergenic (+1971/‑4792) recR/speA_2 Recombination protein RecR/Arginine decarboxylase
* ? USA300TCH1516_ALE = 515946NA (NA)7 (0.080) 5/146 NT NA intergenic (+4014/‑2749) recR/speA_2 Recombination protein RecR/Arginine decarboxylase
?USA300TCH1516_ALE = 515981 NA (NA)intergenic (+4049/‑2714) recR/speA_2 Recombination protein RecR/Arginine decarboxylase
* ? USA300TCH1516_ALE 517191 =NA (NA)4 (0.040) 4/148 NT NA intergenic (+5259/‑1504) recR/speA_2 Recombination protein RecR/Arginine decarboxylase
?USA300TCH1516_ALE 517220 = NA (NA)intergenic (+5288/‑1475) recR/speA_2 Recombination protein RecR/Arginine decarboxylase
* ? USA300TCH1516_ALE = 52391175 (0.760)5 (0.060) 5/130 NT 6.4% coding (322/726 nt) yfiC tRNA1(Val) (adenine(37)‑N6)‑methyltransferase
?USA300TCH1516_ALE = 523926 85 (1.060)coding (337/726 nt) yfiC tRNA1(Val) (adenine(37)‑N6)‑methyltransferase
* ? USA300TCH1516_ALE 551684 =84 (0.850)15 (0.170) 8/146 NT 17.1% intergenic (+13/‑203) cysK/folP Cysteine synthase/Dihydropteroate synthase
?USA300TCH1516_ALE 551723 = 69 (0.770)intergenic (+52/‑164) cysK/folP Cysteine synthase/Dihydropteroate synthase
* ? USA300TCH1516_ALE 553211 =87 (0.880)4 (0.050) 4/138 NT 5.1% coding (182/477 nt) folK 2‑amino‑4‑hydroxy‑6‑ hydroxymethyldihydropteridine pyrophosphokinase
?USA300TCH1516_ALE 553257 = 75 (0.880)coding (228/477 nt) folK 2‑amino‑4‑hydroxy‑6‑ hydroxymethyldihydropteridine pyrophosphokinase
* ? USA300TCH1516_ALE 584107 =77 (0.780)7 (0.080) 6/142 NT 9.6% intergenic (+191/‑81) rplA/rplJ 50S ribosomal protein L1/50S ribosomal protein L10
?USA300TCH1516_ALE 584138 = 64 (0.730)intergenic (+222/‑50) rplA/rplJ 50S ribosomal protein L1/50S ribosomal protein L10
* ? USA300TCH1516_ALE 584527 =96 (0.980)6 (0.070) 4/150 NT 6.5% coding (340/501 nt) rplJ 50S ribosomal protein L10
?USA300TCH1516_ALE 584580 = 82 (0.890)coding (393/501 nt) rplJ 50S ribosomal protein L10
* ? USA300TCH1516_ALE = 58758779 (0.800)5 (0.060) 4/144 NT 5.9% coding (1491/3552 nt) rpoB DNA‑directed RNA polymerase subunit beta
?USA300TCH1516_ALE = 587606 87 (0.980)coding (1510/3552 nt) rpoB DNA‑directed RNA polymerase subunit beta
* ? USA300TCH1516_ALE = 59561271 (0.720)6 (0.070) 4/150 NT 8.1% coding (644/2082 nt) fusA Elongation factor G
?USA300TCH1516_ALE = 595639 69 (0.750)coding (671/2082 nt) fusA Elongation factor G
* ? USA300TCH1516_ALE = 59864965 (0.660)8 (0.100) 5/124 NT 12.1% intergenic (+198/+84) tuf/yxeP_2 Elongation factor Tu/putative hydrolase YxeP
?USA300TCH1516_ALE = 598668 66 (0.870)intergenic (+217/+65) tuf/yxeP_2 Elongation factor Tu/putative hydrolase YxeP
* ? USA300TCH1516_ALE 598774 =116 (1.180)7 (0.080) 8/146 NT 6.6% coding (1135/1176 nt) yxeP_2 putative hydrolase YxeP
?USA300TCH1516_ALE 598797 = 93 (1.040)coding (1112/1176 nt) yxeP_2 putative hydrolase YxeP
* ? USA300TCH1516_ALE 633311 =98 (1.000)12 (0.150) 9/134 NT 13.0% intergenic (+35/‑509) proP/yhfT Proline/betaine transporter/putative acyl‑‑CoA ligase YhfT
?USA300TCH1516_ALE 633354 = 79 (0.960)intergenic (+78/‑466) proP/yhfT Proline/betaine transporter/putative acyl‑‑CoA ligase YhfT
* ? USA300TCH1516_ALE 646656 =101 (1.030)11 (0.130) 7/140 NT 11.9% intergenic (+10/‑577) lipL/galK Octanoyl‑[GcvH]:protein N‑octanoyltransferase/Galactokinase
?USA300TCH1516_ALE 646692 = 74 (0.860)intergenic (+46/‑541) lipL/galK Octanoyl‑[GcvH]:protein N‑octanoyltransferase/Galactokinase
* ? USA300TCH1516_ALE 669086 =107 (1.090)7 (0.080) 4/142 NT 7.8% intergenic (+60/‑15) adh/USA300TCH1516_00602 Alcohol dehydrogenase/hypothetical protein
?USA300TCH1516_ALE 669128 = 71 (0.810)coding (28/108 nt) USA300TCH1516_00602 hypothetical protein
* ? USA300TCH1516_ALE 671622 =56 (0.570)16 (0.180) 5/146 NT 25.4% intergenic (+247/‑141) argS/nth_1 Arginine‑‑tRNA ligase/Endonuclease III
?USA300TCH1516_ALE = 891842 43 (0.480)intergenic (+260/‑479) USA300HOU_RS04385/rnmV_2 hypothetical protein/Ribonuclease M5
* ? USA300TCH1516_ALE = 68114193 (0.950)5 (0.060) 4/136 NT 5.1% coding (351/354 nt) USA300TCH1516_00615 hypothetical protein
?USA300TCH1516_ALE = 681169 107 (1.280)coding (323/354 nt) USA300TCH1516_00615 hypothetical protein
* ? USA300TCH1516_ALE 682222 =107 (1.090)13 (0.150) 7/140 NT 12.7% intergenic (‑64/+45) USA300TCH1516_00616/rcsF_2 hypothetical protein/Outer membrane lipoprotein RcsF
?USA300TCH1516_ALE 682264 = 85 (0.990)intergenic (‑106/+3) USA300TCH1516_00616/rcsF_2 hypothetical protein/Outer membrane lipoprotein RcsF
* ? USA300TCH1516_ALE = 691792107 (1.090)8 (0.100) 5/132 NT 7.4% coding (30/1056 nt) USA300HOU_RS03335 hypothetical protein
?USA300TCH1516_ALE = 691823 113 (1.390)intergenic (‑2/+59) USA300HOU_RS03335/USA300HOU_RS03340 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 705182 =102 (1.040)13 (0.150) 6/142 NT 14.6% intergenic (+932/+228) nhaK_1/mntA Sodium, potassium, lithium and rubidium/H(+) antiporter/Manganese‑binding lipoprotein MntA
?USA300TCH1516_ALE 705222 = 61 (0.700)intergenic (+972/+188) nhaK_1/mntA Sodium, potassium, lithium and rubidium/H(+) antiporter/Manganese‑binding lipoprotein MntA
* ? USA300TCH1516_ALE = 70532999 (1.010)13 (0.150) 8/142 NT 13.3% intergenic (+1079/+81) nhaK_1/mntA Sodium, potassium, lithium and rubidium/H(+) antiporter/Manganese‑binding lipoprotein MntA
?USA300TCH1516_ALE = 705368 81 (0.930)intergenic (+1118/+42) nhaK_1/mntA Sodium, potassium, lithium and rubidium/H(+) antiporter/Manganese‑binding lipoprotein MntA
* ? USA300TCH1516_ALE = 71053296 (0.980)14 (0.160) 9/142 NT 14.1% intergenic (+25/+36) tarA/tagH_1 N‑acetylglucosaminyldiphosphoundecaprenol N‑acetyl‑beta‑D‑mannosaminyltransferase/Teichoic acids export ATP‑binding protein TagH
?USA300TCH1516_ALE = 710552 85 (0.970)intergenic (+45/+16) tarA/tagH_1 N‑acetylglucosaminyldiphosphoundecaprenol N‑acetyl‑beta‑D‑mannosaminyltransferase/Teichoic acids export ATP‑binding protein TagH
* ? USA300TCH1516_ALE = 712543108 (1.100)13 (0.140) 7/148 NT 11.2% intergenic (+22/‑77) tagG/tarB Teichoic acid translocation permease protein TagG/Teichoic acid glycerol‑phosphate primase
?USA300TCH1516_ALE = 712566 107 (1.180)intergenic (+45/‑54) tagG/tarB Teichoic acid translocation permease protein TagG/Teichoic acid glycerol‑phosphate primase
* ? USA300TCH1516_ALE = 71531697 (0.990)13 (0.160) 9/132 NT 13.5% intergenic (+74/+43) tarD/dacA Glycerol‑3‑phosphate cytidylyltransferase/D‑alanyl‑D‑alanine carboxypeptidase DacA
?USA300TCH1516_ALE = 715335 87 (1.070)intergenic (+93/+24) tarD/dacA Glycerol‑3‑phosphate cytidylyltransferase/D‑alanyl‑D‑alanine carboxypeptidase DacA
* ? USA300TCH1516_ALE = 720543107 (1.090)12 (0.130) 6/148 NT 10.7% intergenic (+153/‑372) nupG/USA300HOU_RS03495 Purine nucleoside transport protein NupG/hypothetical protein
?USA300TCH1516_ALE = 720571 101 (1.110)intergenic (+181/‑344) nupG/USA300HOU_RS03495 Purine nucleoside transport protein NupG/hypothetical protein
* ? USA300TCH1516_ALE = 72491063 (0.640)13 (0.150) 5/140 NT 17.6% intergenic (+30/‑204) feuC_1/dhaK Iron‑uptake system permease protein FeuC/PTS‑dependent dihydroxyacetone kinase, dihydroxyacetone‑binding subunit DhaK
?USA300TCH1516_ALE = 724929 67 (0.780)intergenic (+49/‑185) feuC_1/dhaK Iron‑uptake system permease protein FeuC/PTS‑dependent dihydroxyacetone kinase, dihydroxyacetone‑binding subunit DhaK
* ? USA300TCH1516_ALE 729254 =85 (0.860)21 (0.250) 9/136 NT 24.2% intergenic (+55/‑96) USA300HOU_RS03535/aes hypothetical protein/Acetyl esterase
?USA300TCH1516_ALE 729295 = 59 (0.710)intergenic (+96/‑55) USA300HOU_RS03535/aes hypothetical protein/Acetyl esterase
* ? USA300TCH1516_ALE = 73980078 (0.790)10 (0.120) 10/134 NT 14.3% intergenic (+27/+561) pitA_1/sle1_2 Low‑affinity inorganic phosphate transporter 1/N‑acetylmuramoyl‑L‑alanine amidase sle1
?USA300TCH1516_ALE = 739823 55 (0.670)intergenic (+50/+538) pitA_1/sle1_2 Low‑affinity inorganic phosphate transporter 1/N‑acetylmuramoyl‑L‑alanine amidase sle1
* ? USA300TCH1516_ALE = 74469792 (0.940)8 (0.090) 6/152 NT 7.5% coding (1838/1980 nt) melR_1 Melibiose operon regulatory protein
?USA300TCH1516_ALE = 744717 109 (1.170)coding (1858/1980 nt) melR_1 Melibiose operon regulatory protein
* ? USA300TCH1516_ALE = 74903577 (0.780)10 (0.110) 9/142 NT 12.6% intergenic (+163/‑38) oxyR/setC Hydrogen peroxide‑inducible genes activator/Sugar efflux transporter C
?USA300TCH1516_ALE = 749050 71 (0.810)intergenic (+178/‑23) oxyR/setC Hydrogen peroxide‑inducible genes activator/Sugar efflux transporter C
* ? USA300TCH1516_ALE 758250 =105 (1.070)5 (0.050) 5/148 NT 5.6% coding (1526/1632 nt) cydD ATP‑binding/permease protein CydD
?USA300TCH1516_ALE 758282 = 70 (0.770)coding (1558/1632 nt) cydD ATP‑binding/permease protein CydD
* ? USA300TCH1516_ALE = 76126299 (1.010)8 (0.090) 6/148 NT 7.8% coding (440/927 nt) yciC_2 Putative metal chaperone YciC
?USA300TCH1516_ALE = 761280 98 (1.080)coding (458/927 nt) yciC_2 Putative metal chaperone YciC
* ? USA300TCH1516_ALE 774819 =89 (0.910)5 (0.060) 4/134 NT 6.4% intergenic (+110/‑198) fruA/nagA PTS system fructose‑specific EIIABC component/N‑acetylglucosamine‑6‑phosphate deacetylase
?USA300TCH1516_ALE 774873 = 72 (0.870)intergenic (+164/‑144) fruA/nagA PTS system fructose‑specific EIIABC component/N‑acetylglucosamine‑6‑phosphate deacetylase
* ? USA300TCH1516_ALE 781357 =93 (0.950)6 (0.070) 5/146 NT 6.7% coding (401/687 nt) saeR Response regulator SaeR
?USA300TCH1516_ALE 781390 = 83 (0.930)coding (368/687 nt) saeR Response regulator SaeR
* ? USA300TCH1516_ALE 782414 =111 (1.130)8 (0.090) 5/140 NT 7.9% intergenic (‑209/+133) USA300HOU_RS03820/USA300HOU_RS03825 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 782453 = 90 (1.050)intergenic (‑248/+94) USA300HOU_RS03820/USA300HOU_RS03825 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 78398183 (0.840)12 (0.140) 7/140 NT 13.4% coding (683/714 nt) queE_1 7‑carboxy‑7‑deazaguanine synthase
?USA300TCH1516_ALE = 784017 82 (0.950)coding (647/714 nt) queE_1 7‑carboxy‑7‑deazaguanine synthase
* ? USA300TCH1516_ALE = 78963396 (0.980)8 (0.090) 6/148 NT 8.0% coding (137/1005 nt) kipA_1 KipI antagonist
?USA300TCH1516_ALE = 789649 94 (1.030)coding (153/1005 nt) kipA_1 KipI antagonist
* ? USA300TCH1516_ALE = 80214180 (0.810)11 (0.130) 9/138 NT 12.2% intergenic (+382/+242) USA300HOU_RS03915/USA300HOU_RS03920 Putative 5'(3')‑deoxyribonucleotidase/Putative lipid kinase
?USA300TCH1516_ALE = 802168 90 (1.060)intergenic (+409/+215) USA300HOU_RS03915/USA300HOU_RS03920 Putative 5'(3')‑deoxyribonucleotidase/Putative lipid kinase
* ? USA300TCH1516_ALE 811544 =116 (1.180)9 (0.100) 7/144 NT 8.6% intergenic (+386/‑280) nrdF/fecD_1 Ribonucleoside‑diphosphate reductase subunit beta/Fe(3+) dicitrate transport system permease protein FecD
?USA300TCH1516_ALE 811563 = 88 (0.990)intergenic (+405/‑261) nrdF/fecD_1 Ribonucleoside‑diphosphate reductase subunit beta/Fe(3+) dicitrate transport system permease protein FecD
* ? USA300TCH1516_ALE = 82274369 (0.700)4 (0.040) 4/146 NT 6.4% coding (104/495 nt) USA300HOU_RS04025 hypothetical protein
?USA300TCH1516_ALE = 822770 54 (0.600)coding (77/495 nt) USA300HOU_RS04025 hypothetical protein
* ? USA300TCH1516_ALE 823754 =96 (0.980)11 (0.130) 9/134 NT 12.8% intergenic (‑129/+67) yjjP_2/dosC Inner membrane protein YjjP/Diguanylate cyclase DosC
?USA300TCH1516_ALE 823814 = 70 (0.850)intergenic (‑189/+7) yjjP_2/dosC Inner membrane protein YjjP/Diguanylate cyclase DosC
* ? USA300TCH1516_ALE 829838 =113 (1.150)6 (0.070) 4/142 NT 6.1% coding (315/675 nt) USA300HOU_RS04060 hypothetical protein
?USA300TCH1516_ALE 829892 = 83 (0.950)coding (369/675 nt) USA300HOU_RS04060 hypothetical protein
* ? USA300TCH1516_ALE 842619 =103 (1.050)13 (0.150) 10/144 NT 13.1% intergenic (+5/‑657) uvrA/hprK UvrABC system protein A/HPr kinase/phosphorylase
?USA300TCH1516_ALE 842662 = 80 (0.900)intergenic (+48/‑614) uvrA/hprK UvrABC system protein A/HPr kinase/phosphorylase
* ? USA300TCH1516_ALE = 84262697 (0.990)9 (0.100) 5/144 NT 9.7% intergenic (+12/‑650) uvrA/hprK UvrABC system protein A/HPr kinase/phosphorylase
?USA300TCH1516_ALE = 842653 80 (0.900)intergenic (+39/‑623) uvrA/hprK UvrABC system protein A/HPr kinase/phosphorylase
* ? USA300TCH1516_ALE 842851 =106 (1.080)5 (0.060) 5/140 NT 5.2% intergenic (+237/‑425) uvrA/hprK UvrABC system protein A/HPr kinase/phosphorylase
?USA300TCH1516_ALE 891965 = 90 (1.050)intergenic (+383/‑356) USA300HOU_RS04385/rnmV_2 hypothetical protein/Ribonuclease M5
* ? USA300TCH1516_ALE 858374 =91 (0.930)7 (0.080) 5/146 NT 8.1% intergenic (+69/‑70) gapA1/pgk Glyceraldehyde‑3‑phosphate dehydrogenase 1/Phosphoglycerate kinase
?USA300TCH1516_ALE 858405 = 75 (0.840)intergenic (+100/‑39) gapA1/pgk Glyceraldehyde‑3‑phosphate dehydrogenase 1/Phosphoglycerate kinase
* ? USA300TCH1516_ALE 868058 =90 (0.920)6 (0.070) 5/146 NT 7.3% coding (206/465 nt) smpB SsrA‑binding protein
?USA300TCH1516_ALE 868096 = 70 (0.780)coding (244/465 nt) smpB SsrA‑binding protein
* ? USA300TCH1516_ALE 868305 =81 (0.820)9 (0.100) 5/148 NT 11.7% coding (453/465 nt) smpB SsrA‑binding protein
?USA300TCH1516_ALE 868342 = 61 (0.670)intergenic (+25/+1297) smpB/USA300HOU_RS04240 SsrA‑binding protein/hypothetical protein
* ? USA300TCH1516_ALE = 86831077 (0.780)6 (0.070) 5/148 NT 8.3% coding (458/465 nt) smpB SsrA‑binding protein
?USA300TCH1516_ALE = 868335 61 (0.670)intergenic (+18/+1304) smpB/USA300HOU_RS04240 SsrA‑binding protein/hypothetical protein
* ? USA300TCH1516_ALE 869579 =125 (1.270)10 (0.120) 7/140 NT 9.4% intergenic (+1262/+60) smpB/USA300HOU_RS04240 SsrA‑binding protein/hypothetical protein
?USA300TCH1516_ALE 869621 = 84 (0.980)intergenic (+1304/+18) smpB/USA300HOU_RS04240 SsrA‑binding protein/hypothetical protein
* ? USA300TCH1516_ALE = 87835374 (0.750)9 (0.100) 5/140 NT 12.3% coding (359/1023 nt) ssp Extracellular matrix protein‑binding protein emp
?USA300TCH1516_ALE = 878384 63 (0.730)coding (390/1023 nt) ssp Extracellular matrix protein‑binding protein emp
* ? USA300TCH1516_ALE 880859 =137 (1.390)10 (0.110) 8/144 NT 8.1% intergenic (+10/‑347) nuc/cspA_1 Thermonuclease/Cold shock protein CspA
?USA300TCH1516_ALE 880891 = 103 (1.160)intergenic (+42/‑315) nuc/cspA_1 Thermonuclease/Cold shock protein CspA
* ? USA300TCH1516_ALE = 88538993 (0.950)15 (0.180) 10/134 NT 15.8% intergenic (+18/+55) pspB/argO Putative phosphoserine phosphatase 2/Arginine exporter protein ArgO
?USA300TCH1516_ALE = 885408 82 (1.000)intergenic (+37/+36) pspB/argO Putative phosphoserine phosphatase 2/Arginine exporter protein ArgO
* ? USA300TCH1516_ALE 900173 =93 (0.950)14 (0.160) 7/140 NT 18.0% coding (174/273 nt) USA300HOU_RS04450 hypothetical protein
?USA300TCH1516_ALE 900207 = 46 (0.530)coding (208/273 nt) USA300HOU_RS04450 hypothetical protein
* ? USA300TCH1516_ALE = 906356145 (1.470)10 (0.110) 6/150 NT 7.1% intergenic (+140/‑44) USA300HOU_RS04485/USA300HOU_RS04490 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 1586025 = 124 (1.350)intergenic (‑18/+109) USA300HOU_RS07770/USA300TCH1516_01451 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 920377 =81 (0.820)9 (0.110) 7/132 NT 12.9% intergenic (+6/‑207) USA300HOU_RS04555/USA300HOU_RS04565 Putative monooxygenase/hypothetical protein
?USA300TCH1516_ALE 920443 = 55 (0.680)intergenic (+72/‑141) USA300HOU_RS04555/USA300HOU_RS04565 Putative monooxygenase/hypothetical protein
* ? USA300TCH1516_ALE = 92069071 (0.720)8 (0.090) 5/138 NT 11.2% coding (107/849 nt) USA300HOU_RS04565 hypothetical protein
?USA300TCH1516_ALE = 920717 66 (0.780)coding (134/849 nt) USA300HOU_RS04565 hypothetical protein
* ? USA300TCH1516_ALE = 93341169 (0.700)24 (0.300) 13/130 NT 27.0% intergenic (+28/+31) USA300HOU_RS04645/yjlD hypothetical protein/NADH dehydrogenase‑like protein YjlD
?USA300TCH1516_ALE = 933421 74 (0.930)intergenic (+38/+21) USA300HOU_RS04645/yjlD hypothetical protein/NADH dehydrogenase‑like protein YjlD
* ? USA300TCH1516_ALE 940816 =101 (1.030)10 (0.110) 6/148 NT 10.5% coding (372/375 nt) USA300HOU_RS04680 Putative esterase
?USA300TCH1516_ALE 940879 = 77 (0.850)coding (1151/1155 nt) ptlE Neopentalenolactone D synthase
* ? USA300TCH1516_ALE 943421 =100 (1.020)7 (0.080) 4/142 NT 7.6% coding (1462/1497 nt) mnhD1_2 Na(+)/H(+) antiporter subunit D1
?USA300TCH1516_ALE 943487 = 81 (0.930)coding (1396/1497 nt) mnhD1_2 Na(+)/H(+) antiporter subunit D1
* ? USA300TCH1516_ALE = 95151684 (0.850)5 (0.060) 4/144 NT 5.5% intergenic (+21/‑287) USA300HOU_RS04740/rocD2_2 putative oxidoreductase/Ornithine aminotransferase 2
?USA300TCH1516_ALE = 951537 96 (1.080)intergenic (+42/‑266) USA300HOU_RS04740/rocD2_2 putative oxidoreductase/Ornithine aminotransferase 2
* ? USA300TCH1516_ALE 954365 =53 (0.540)7 (0.080) 6/138 NT 13.1% intergenic (+19/+484) gluD/glpQ_1 NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase
?USA300TCH1516_ALE 954407 = 47 (0.550)intergenic (+61/+442) gluD/glpQ_1 NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase
* ? USA300TCH1516_ALE = 95437553 (0.540)9 (0.110) 6/138 NT 16.3% intergenic (+29/+474) gluD/glpQ_1 NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase
?USA300TCH1516_ALE = 954395 47 (0.550)intergenic (+49/+454) gluD/glpQ_1 NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase
* ? USA300TCH1516_ALE = 97140296 (0.980)8 (0.090) 6/142 NT 8.2% intergenic (+30/+141) USA300HOU_RS04810/cdr hypothetical protein/Coenzyme A disulfide reductase
?USA300TCH1516_ALE = 971425 95 (1.090)intergenic (+53/+118) USA300HOU_RS04810/cdr hypothetical protein/Coenzyme A disulfide reductase
* ? USA300TCH1516_ALE 979658 =112 (1.140)9 (0.100) 4/144 NT 8.5% coding (601/870 nt) ampR HTH‑type transcriptional activator AmpR
?USA300TCH1516_ALE 979694 = 94 (1.060)coding (565/870 nt) ampR HTH‑type transcriptional activator AmpR
* ? USA300TCH1516_ALE 1005781 =113 (1.150)20 (0.240) 10/138 NT 16.2% intergenic (+417/+43) pepF1_1/USA300HOU_RS04965 Oligoendopeptidase F, plasmid/hypothetical protein
?USA300TCH1516_ALE 1005817 = 109 (1.290)intergenic (+453/+7) pepF1_1/USA300HOU_RS04965 Oligoendopeptidase F, plasmid/hypothetical protein
* ? USA300TCH1516_ALE = 1005791120 (1.220)15 (0.180) 8/138 NT 12.4% intergenic (+427/+33) pepF1_1/USA300HOU_RS04965 Oligoendopeptidase F, plasmid/hypothetical protein
?USA300TCH1516_ALE = 1005805 109 (1.290)intergenic (+441/+19) pepF1_1/USA300HOU_RS04965 Oligoendopeptidase F, plasmid/hypothetical protein
* ? USA300TCH1516_ALE = 103206871 (0.720)7 (0.080) 7/146 NT 9.7% coding (1056/1515 nt) yfkN_2 Trifunctional nucleotide phosphoesterase protein YfkN
?USA300TCH1516_ALE = 1032096 66 (0.740)coding (1084/1515 nt) yfkN_2 Trifunctional nucleotide phosphoesterase protein YfkN
* ? USA300TCH1516_ALE 1040357 =101 (1.030)23 (0.280) 11/132 NT 23.4% intergenic (+18/+70) USA300TCH1516_00966/USA300TCH1516_00967 putative ABC transporter ATP‑binding protein/hypothetical protein
?USA300TCH1516_ALE 1040412 = 67 (0.830)intergenic (+73/+15) USA300TCH1516_00966/USA300TCH1516_00967 putative ABC transporter ATP‑binding protein/hypothetical protein
* ? USA300TCH1516_ALE 1058102 =92 (0.940)5 (0.060) 4/144 NT 6.6% intergenic (+143/+64) slyA_2/atl_1 Transcriptional regulator SlyA/Bifunctional autolysin
?USA300TCH1516_ALE 1058152 = 59 (0.670)intergenic (+193/+14) slyA_2/atl_1 Transcriptional regulator SlyA/Bifunctional autolysin
* ? USA300TCH1516_ALE = 108476382 (0.830)15 (0.170) 10/140 NT 16.3% intergenic (+135/+130) purD/ykoC_1 Phosphoribosylamine‑‑glycine ligase/Putative HMP/thiamine permease protein YkoC
?USA300TCH1516_ALE = 1084806 82 (0.950)intergenic (+178/+87) purD/ykoC_1 Phosphoribosylamine‑‑glycine ligase/Putative HMP/thiamine permease protein YkoC
* ? USA300TCH1516_ALE 1086962 =81 (0.820)5 (0.060) 5/140 NT 7.1% coding (131/1401 nt) ykoD_1 Putative HMP/thiamine import ATP‑binding protein YkoD
?USA300TCH1516_ALE 1087000 = 59 (0.690)coding (93/1401 nt) ykoD_1 Putative HMP/thiamine import ATP‑binding protein YkoD
* ? USA300TCH1516_ALE 1087705 =76 (0.770)16 (0.180) 10/148 NT 19.1% intergenic (‑23/+561) ykoE/USA300TCH1516_01011 Putative HMP/thiamine permease protein YkoE/hypothetical protein
?USA300TCH1516_ALE 1087738 = 65 (0.710)intergenic (‑56/+528) ykoE/USA300TCH1516_01011 Putative HMP/thiamine permease protein YkoE/hypothetical protein
* ? USA300TCH1516_ALE = 1098317102 (1.040)5 (0.060) 4/132 NT 5.3% intergenic (+296/+53) ktrA/rnj1 Ktr system potassium uptake protein A/Ribonuclease J 1
?USA300TCH1516_ALE = 1098353 96 (1.180)intergenic (+332/+17) ktrA/rnj1 Ktr system potassium uptake protein A/Ribonuclease J 1
* ? USA300TCH1516_ALE 1114090 =60 (0.610)9 (0.120) 6/126 NT 15.8% intergenic (+19/+63) USA300HOU_RS05510/mntH_1 hypothetical protein/Divalent metal cation transporter MntH
?USA300TCH1516_ALE 1114149 = 49 (0.630)intergenic (+78/+4) USA300HOU_RS05510/mntH_1 hypothetical protein/Divalent metal cation transporter MntH
* ? USA300TCH1516_ALE = 111410658 (0.590)5 (0.060) 5/126 NT 9.6% intergenic (+35/+47) USA300HOU_RS05510/mntH_1 hypothetical protein/Divalent metal cation transporter MntH
?USA300TCH1516_ALE = 1114131 49 (0.630)intergenic (+60/+22) USA300HOU_RS05510/mntH_1 hypothetical protein/Divalent metal cation transporter MntH
* ? USA300TCH1516_ALE = 1115642105 (1.070)23 (0.260) 8/146 NT 20.1% intergenic (‑137/+47) mntH_1/USA300TCH1516_01038 Divalent metal cation transporter MntH/hypothetical protein
?USA300TCH1516_ALE = 1115662 87 (0.970)intergenic (‑157/+27) mntH_1/USA300TCH1516_01038 Divalent metal cation transporter MntH/hypothetical protein
* ? USA300TCH1516_ALE 1117293 =90 (0.920)9 (0.110) 6/130 NT 11.0% intergenic (+6/+148) suhB_1/USA300TCH1516_01040 Inositol‑1‑monophosphatase/hypothetical protein
?USA300TCH1516_ALE 1117341 = 73 (0.910)intergenic (+54/+100) suhB_1/USA300TCH1516_01040 Inositol‑1‑monophosphatase/hypothetical protein
* ? USA300TCH1516_ALE 1119593 =104 (1.060)8 (0.100) 4/136 NT 9.4% intergenic (+12/+297) typA/USA300HOU_RS05545 GTP‑binding protein TypA/BipA/hypothetical protein
?USA300TCH1516_ALE 1119635 = 65 (0.780)intergenic (+54/+255) typA/USA300HOU_RS05545 GTP‑binding protein TypA/BipA/hypothetical protein
* ? USA300TCH1516_ALE 1129293 =63 (0.640)5 (0.060) 4/144 NT 7.5% intergenic (+71/‑256) USA300HOU_RS05575/USA300HOU_RS05585 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 1129331 = 67 (0.760)intergenic (+109/‑218) USA300HOU_RS05575/USA300HOU_RS05585 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 112930066 (0.670)4 (0.050) 4/144 NT 6.0% intergenic (+78/‑249) USA300HOU_RS05575/USA300HOU_RS05585 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 1129322 67 (0.760)intergenic (+100/‑227) USA300HOU_RS05575/USA300HOU_RS05585 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 1131036 =91 (0.930)8 (0.100) 7/126 NT 11.2% coding (435/435 nt) USA300HOU_RS05590 hypothetical protein
?USA300TCH1516_ALE 1131101 = 55 (0.710)coding (925/927 nt) glpQ1 putative glycerophosphodiester phosphodiesterase 1
* ? USA300TCH1516_ALE 1131322 =82 (0.830)4 (0.040) 5/148 NT 5.1% coding (704/927 nt) glpQ1 putative glycerophosphodiester phosphodiesterase 1
?USA300TCH1516_ALE 1131337 = 74 (0.810)coding (689/927 nt) glpQ1 putative glycerophosphodiester phosphodiesterase 1
* ? USA300TCH1516_ALE = 113402785 (0.860)8 (0.100) 5/132 NT 8.7% intergenic (+21/+41) coaD/USA300HOU_RS05620 Phosphopantetheine adenylyltransferase/Nicotinamide‑nucleotide adenylyltransferase
?USA300TCH1516_ALE = 1134045 98 (1.210)intergenic (+39/+23) coaD/USA300HOU_RS05620 Phosphopantetheine adenylyltransferase/Nicotinamide‑nucleotide adenylyltransferase
* ? USA300TCH1516_ALE 1135893 =99 (1.010)10 (0.120) 6/136 NT 10.0% intergenic (+2/‑78) USA300TCH1516_01057/rpmF hypothetical protein/50S ribosomal protein L32
?USA300TCH1516_ALE 1135930 = 96 (1.150)intergenic (+39/‑41) USA300TCH1516_01057/rpmF hypothetical protein/50S ribosomal protein L32
* ? USA300TCH1516_ALE = 1136225104 (1.060)14 (0.160) 8/142 NT 12.4% intergenic (+81/+73) rpmF/isdB 50S ribosomal protein L32/Iron‑regulated surface determinant protein B
?USA300TCH1516_ALE = 1136249 105 (1.200)intergenic (+105/+49) rpmF/isdB 50S ribosomal protein L32/Iron‑regulated surface determinant protein B
* ? USA300TCH1516_ALE 1149421 =83 (0.840)6 (0.070) 5/138 NT 7.6% intergenic (+7/+164) pheT_1/rnhC Phenylalanine‑‑tRNA ligase beta subunit/Ribonuclease HIII
?USA300TCH1516_ALE 1149475 = 74 (0.870)intergenic (+61/+110) pheT_1/rnhC Phenylalanine‑‑tRNA ligase beta subunit/Ribonuclease HIII
* ? USA300TCH1516_ALE 1181842 =111 (1.130)9 (0.100) 5/144 NT 9.2% intergenic (+409/+65) USA300HOU_RS05885/USA300TCH1516_01103 hypothetical protein/tRNA‑Arg
?USA300TCH1516_ALE 1181881 = 77 (0.870)intergenic (+448/+26) USA300HOU_RS05885/USA300TCH1516_01103 hypothetical protein/tRNA‑Arg
* ? USA300TCH1516_ALE 1182136 =106 (1.080)12 (0.140) 8/140 NT 12.5% intergenic (‑154/‑209) USA300TCH1516_01103/USA300HOU_RS05895 tRNA‑Arg/Antibacterial protein 3
?USA300TCH1516_ALE 1182166 = 76 (0.880)intergenic (‑184/‑179) USA300TCH1516_01103/USA300HOU_RS05895 tRNA‑Arg/Antibacterial protein 3
* ? USA300TCH1516_ALE 1182690 =121 (1.230)5 (0.060) 4/136 NT 5.1% intergenic (+20/‑113) USA300HOU_RS05900/yfnB Antibacterial protein 3/Putative HAD‑hydrolase YfnB
?USA300TCH1516_ALE 1182741 = 84 (1.010)intergenic (+71/‑62) USA300HOU_RS05900/yfnB Antibacterial protein 3/Putative HAD‑hydrolase YfnB
* ? USA300TCH1516_ALE = 1183556113 (1.150)9 (0.100) 7/140 NT 7.7% intergenic (+67/+42) yfnB/USA300HOU_RS05910 Putative HAD‑hydrolase YfnB/putative N‑acetyltransferase
?USA300TCH1516_ALE = 1183574 116 (1.350)intergenic (+85/+24) yfnB/USA300HOU_RS05910 Putative HAD‑hydrolase YfnB/putative N‑acetyltransferase
* ? USA300TCH1516_ALE = 119929392 (0.940)9 (0.100) 8/144 NT 8.7% intergenic (+20/‑63) USA300HOU_RS05980/USA300HOU_RS05985 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 1199312 106 (1.200)intergenic (+39/‑44) USA300HOU_RS05980/USA300HOU_RS05985 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 1205038 =91 (0.930)16 (0.180) 11/148 NT 16.0% coding (82/195 nt) USA300HOU_RS15290 hypothetical protein
?USA300TCH1516_ALE = 1427022 NA (NA)intergenic (‑753/+219) pstS/cvfB Phosphate‑binding protein PstS/Conserved virulence factor B
* ? USA300TCH1516_ALE = 121769392 (0.940)5 (0.060) 5/128 NT 5.9% intergenic (+22/‑415) USA300HOU_RS06060/USA300HOU_RS06065 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 1217729 87 (1.110)intergenic (+58/‑379) USA300HOU_RS06060/USA300HOU_RS06065 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 122765689 (0.910)10 (0.110) 8/148 NT 10.7% coding (125/489 nt) def1 Peptide deformylase 1
?USA300TCH1516_ALE = 1227672 85 (0.930)coding (141/489 nt) def1 Peptide deformylase 1
* ? USA300TCH1516_ALE = 123658771 (0.720)10 (0.110) 6/144 NT 11.8% intergenic (+101/+280) thiN/rpmB Thiamine pyrophosphokinase/50S ribosomal protein L28
?USA300TCH1516_ALE = 1236607 86 (0.970)intergenic (+121/+260) thiN/rpmB Thiamine pyrophosphokinase/50S ribosomal protein L28
* ? USA300TCH1516_ALE 1255833 =96 (0.980)8 (0.090) 4/138 NT 9.5% intergenic (+49/+195) rplS/USA300HOU_RS06250 50S ribosomal protein L19/hypothetical protein
?USA300TCH1516_ALE 1255876 = 70 (0.830)intergenic (+92/+152) rplS/USA300HOU_RS06250 50S ribosomal protein L19/hypothetical protein
* ? USA300TCH1516_ALE 1255967 =82 (0.830)10 (0.120) 6/134 NT 14.1% intergenic (+183/+61) rplS/USA300HOU_RS06250 50S ribosomal protein L19/hypothetical protein
?USA300TCH1516_ALE 1256006 = 53 (0.640)intergenic (+222/+22) rplS/USA300HOU_RS06250 50S ribosomal protein L19/hypothetical protein
* ? USA300TCH1516_ALE 1262900 =95 (0.970)7 (0.080) 5/140 NT 7.6% intergenic (+25/‑202) sucD/lytN_1 Succinate‑‑CoA ligase [ADP‑forming] subunit alpha/putative cell wall hydrolase LytN
?USA300TCH1516_ALE 1262943 = 87 (1.010)intergenic (+68/‑159) sucD/lytN_1 Succinate‑‑CoA ligase [ADP‑forming] subunit alpha/putative cell wall hydrolase LytN
* ? USA300TCH1516_ALE = 126290997 (0.990)5 (0.060) 4/140 NT 5.5% intergenic (+34/‑193) sucD/lytN_1 Succinate‑‑CoA ligase [ADP‑forming] subunit alpha/putative cell wall hydrolase LytN
?USA300TCH1516_ALE = 1262932 87 (1.010)intergenic (+57/‑170) sucD/lytN_1 Succinate‑‑CoA ligase [ADP‑forming] subunit alpha/putative cell wall hydrolase LytN
* ? USA300TCH1516_ALE 1265497 =98 (1.000)15 (0.190) 8/130 NT 15.1% intergenic (+5/‑168) femA_1/dprA Aminoacyltransferase FemA/DNA processing protein DprA
?USA300TCH1516_ALE 1265543 = 89 (1.110)intergenic (+51/‑122) femA_1/dprA Aminoacyltransferase FemA/DNA processing protein DprA
* ? USA300TCH1516_ALE = 126551193 (0.950)17 (0.210) 10/130 NT 17.1% intergenic (+19/‑154) femA_1/dprA Aminoacyltransferase FemA/DNA processing protein DprA
?USA300TCH1516_ALE = 1265527 89 (1.110)intergenic (+35/‑138) femA_1/dprA Aminoacyltransferase FemA/DNA processing protein DprA
* ? USA300TCH1516_ALE 1271425 =87 (0.880)7 (0.080) 5/146 NT 9.1% coding (760/897 nt) xerC_1 Tyrosine recombinase XerC
?USA300TCH1516_ALE 1271456 = 61 (0.680)coding (791/897 nt) xerC_1 Tyrosine recombinase XerC
* ? USA300TCH1516_ALE 1279936 =101 (1.030)16 (0.240)
+25 bp		 6/110 NT 18.5% intergenic (+29/‑233) cdsA/USA300HOU_RS06360 Phosphatidate cytidylyltransferase/Putative zinc metalloprotease
?USA300TCH1516_ALE 1279975 = 104 (1.060)intergenic (+68/‑194) cdsA/USA300HOU_RS06360 Phosphatidate cytidylyltransferase/Putative zinc metalloprotease
* ? USA300TCH1516_ALE = 128150760 (0.610)9 (0.100) 6/146 NT 12.4% coding (33/1704 nt) proS Proline‑‑tRNA ligase
?USA300TCH1516_ALE = 1281540 72 (0.800)coding (66/1704 nt) proS Proline‑‑tRNA ligase
* ? USA300TCH1516_ALE = 128320296 (0.980)7 (0.080) 5/146 NT 7.3% intergenic (+24/‑234) proS/polC_1 Proline‑‑tRNA ligase/DNA polymerase III PolC‑type
?USA300TCH1516_ALE = 1283240 89 (0.990)intergenic (+62/‑196) proS/polC_1 Proline‑‑tRNA ligase/DNA polymerase III PolC‑type
* ? USA300TCH1516_ALE 1283482 =136 (1.380)10 (0.120) 7/138 NT 8.4% coding (47/4317 nt) polC_1 DNA polymerase III PolC‑type
?USA300TCH1516_ALE 1283518 = 101 (1.190)coding (83/4317 nt) polC_1 DNA polymerase III PolC‑type
* ? USA300TCH1516_ALE 1292484 =88 (0.890)9 (0.110) 6/128 NT 12.0% intergenic (+38/‑348) infB/rbfA Translation initiation factor IF‑2/Ribosome‑binding factor A
?USA300TCH1516_ALE 1292539 = 62 (0.790)intergenic (+93/‑293) infB/rbfA Translation initiation factor IF‑2/Ribosome‑binding factor A
* ? USA300TCH1516_ALE = 129811294 (0.960)14 (0.150) 9/154 NT 13.6% intergenic (+8/‑228) pnp/rnj2 Polyribonucleotide nucleotidyltransferase/Ribonuclease J 2
?USA300TCH1516_ALE = 1298143 88 (0.930)intergenic (+39/‑197) pnp/rnj2 Polyribonucleotide nucleotidyltransferase/Ribonuclease J 2
* ? USA300TCH1516_ALE = 1303447103 (1.050)8 (0.090) 5/138 NT 8.0% coding (61/1266 nt) USA300HOU_RS06440 putative zinc protease
?USA300TCH1516_ALE = 1303460 96 (1.130)coding (74/1266 nt) USA300HOU_RS06440 putative zinc protease
* ? USA300TCH1516_ALE = 131464591 (0.930)9 (0.100) 5/150 NT 9.8% intergenic (+66/‑74) USA300HOU_RS06490/korA hypothetical protein/2‑oxoglutarate oxidoreductase subunit KorA
?USA300TCH1516_ALE = 1314663 80 (0.870)intergenic (+84/‑56) USA300HOU_RS06490/korA hypothetical protein/2‑oxoglutarate oxidoreductase subunit KorA
* ? USA300TCH1516_ALE 1317352 =91 (0.930)9 (0.100) 6/140 NT 10.9% intergenic (+6/‑88) korB/USA300HOU_RS06505 2‑oxoglutarate oxidoreductase subunit KorB/hypothetical protein
?USA300TCH1516_ALE 1317407 = 68 (0.790)intergenic (+61/‑33) korB/USA300HOU_RS06505 2‑oxoglutarate oxidoreductase subunit KorB/hypothetical protein
* ? USA300TCH1516_ALE 1323767 =128 (1.300)6 (0.070) 4/148 NT 5.3% coding (539/2010 nt) mutL DNA mismatch repair protein MutL
?USA300TCH1516_ALE 1323805 = 98 (1.080)coding (577/2010 nt) mutL DNA mismatch repair protein MutL
* ? USA300TCH1516_ALE = 133054889 (0.910)6 (0.070) 5/148 NT 7.2% intergenic (+23/‑124) glpD/USA300HOU_RS06555 Aerobic glycerol‑3‑phosphate dehydrogenase/Monoacylglycerol lipase
?USA300TCH1516_ALE = 1330568 72 (0.790)intergenic (+43/‑104) glpD/USA300HOU_RS06555 Aerobic glycerol‑3‑phosphate dehydrogenase/Monoacylglycerol lipase
* ? USA300TCH1516_ALE = 133294984 (0.850)7 (0.090) 5/124 NT 8.1% intergenic (+159/+63) hfq/bsaA_1 RNA‑binding protein Hfq/Glutathione peroxidase BsaA
?USA300TCH1516_ALE = 1332971 94 (1.230)intergenic (+181/+41) hfq/bsaA_1 RNA‑binding protein Hfq/Glutathione peroxidase BsaA
* ? USA300TCH1516_ALE 1336102 =102 (1.040)9 (0.110) 5/138 NT 9.4% intergenic (+7/‑236) mgl/glnR L‑methionine gamma‑lyase/HTH‑type transcriptional regulator GlnR
?USA300TCH1516_ALE 1336142 = 86 (1.010)intergenic (+47/‑196) mgl/glnR L‑methionine gamma‑lyase/HTH‑type transcriptional regulator GlnR
* ? USA300TCH1516_ALE 1341822 =165 (1.680)12 (0.130) 8/148 NT 7.4% intergenic (+230/‑282) USA300HOU_RS06615/USA300TCH1516_01244 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 1341877 = 147 (1.620)intergenic (+285/‑227) USA300HOU_RS06615/USA300TCH1516_01244 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 1347832155 (1.580)9 (0.100) 7/148 NT 6.1% intergenic (+14/‑44) USA300HOU_RS06695/cls_1 hypothetical protein/Cardiolipin synthase
?USA300TCH1516_ALE = 1347851 134 (1.470)intergenic (+33/‑25) USA300HOU_RS06695/cls_1 hypothetical protein/Cardiolipin synthase
* ? USA300TCH1516_ALE = 135390689 (0.910)10 (0.120) 7/134 NT 10.2% intergenic (+99/+44) nucH/USA300HOU_RS06735 Thermonuclease/hypothetical protein
?USA300TCH1516_ALE = 1353932 101 (1.230)intergenic (+125/+18) nucH/USA300HOU_RS06735 Thermonuclease/hypothetical protein
* ? USA300TCH1516_ALE 1355713 =90 (0.920)10 (0.120) 7/138 NT 11.7% intergenic (+3/+51) USA300HOU_RS06740/yclM hypothetical protein/Aspartokinase 3
?USA300TCH1516_ALE 1355761 = 74 (0.870)intergenic (+51/+3) USA300HOU_RS06740/yclM hypothetical protein/Aspartokinase 3
* ? USA300TCH1516_ALE = 135572390 (0.920)6 (0.070) 5/138 NT 7.3% intergenic (+13/+41) USA300HOU_RS06740/yclM hypothetical protein/Aspartokinase 3
?USA300TCH1516_ALE = 1355749 74 (0.870)intergenic (+39/+15) USA300HOU_RS06740/yclM hypothetical protein/Aspartokinase 3
* ? USA300TCH1516_ALE 1355817 =108 (1.100)6 (0.070) 5/144 NT 5.7% coding (1330/1383 nt) yclM Aspartokinase 3
?USA300TCH1516_ALE 1355853 = 101 (1.140)coding (1294/1383 nt) yclM Aspartokinase 3
* ? USA300TCH1516_ALE = 136573999 (1.010)14 (0.150) 11/148 NT 12.2% intergenic (+38/‑416) rpmG2_1/rpsN2 50S ribosomal protein L33 2/Alternate 30S ribosomal protein S14
?USA300TCH1516_ALE = 1365764 109 (1.200)intergenic (+63/‑391) rpmG2_1/rpsN2 50S ribosomal protein L33 2/Alternate 30S ribosomal protein S14
* ? USA300TCH1516_ALE = 1366496118 (1.200)8 (0.090) 6/152 NT 6.4% intergenic (+72/‑85) rpsN2/guaC Alternate 30S ribosomal protein S14/GMP reductase
?USA300TCH1516_ALE = 1366530 122 (1.310)intergenic (+106/‑51) rpsN2/guaC Alternate 30S ribosomal protein S14/GMP reductase
* ? USA300TCH1516_ALE 1368741 =111 (1.130)7 (0.080) 4/150 NT 6.3% intergenic (+145/+235) USA300TCH1516_01277/lexA_1 hypothetical protein/LexA repressor
?USA300TCH1516_ALE 1368771 = 103 (1.120)intergenic (+175/+205) USA300TCH1516_01277/lexA_1 hypothetical protein/LexA repressor
* ? USA300TCH1516_ALE = 137184671 (0.720)7 (0.080) 5/142 NT 9.2% coding (1376/1989 nt) tkt Transketolase
?USA300TCH1516_ALE = 1371866 75 (0.860)coding (1396/1989 nt) tkt Transketolase
* ? USA300TCH1516_ALE = 138387391 (0.930)6 (0.060) 5/154 NT 6.4% intergenic (+90/‑90) acnA/USA300HOU_RS06875 Aconitate hydratase A/Putative esterase
?USA300TCH1516_ALE = 1383903 88 (0.930)intergenic (+120/‑60) acnA/USA300HOU_RS06875 Aconitate hydratase A/Putative esterase
* ? USA300TCH1516_ALE 1392266 =121 (1.230)11 (0.130) 9/140 NT 10.1% intergenic (+40/‑460) alsT/glcT Amino‑acid carrier protein AlsT/GlcA/glcB genes antiterminator
?USA300TCH1516_ALE 1392308 = 90 (1.050)intergenic (+82/‑418) alsT/glcT Amino‑acid carrier protein AlsT/GlcA/glcB genes antiterminator
* ? USA300TCH1516_ALE = 139493792 (0.940)5 (0.060) 5/132 NT 5.5% intergenic (+17/‑464) tqsA/mprF AI‑2 transport protein TqsA/Phosphatidylglycerol lysyltransferase
?USA300TCH1516_ALE = 1394951 95 (1.170)intergenic (+31/‑450) tqsA/mprF AI‑2 transport protein TqsA/Phosphatidylglycerol lysyltransferase
* ? USA300TCH1516_ALE 1414391 =84 (0.850)7 (0.080) 4/150 NT 9.2% coding (170/768 nt) yitU_2 5‑amino‑6‑(5‑phospho‑D‑ribitylamino)uracil phosphatase YitU
?USA300TCH1516_ALE 1414420 = 60 (0.650)coding (199/768 nt) yitU_2 5‑amino‑6‑(5‑phospho‑D‑ribitylamino)uracil phosphatase YitU
* ? USA300TCH1516_ALE = 1439024116 (1.180)12 (0.130) 7/146 NT 10.3% intergenic (+22/+218) lysA/USA300HOU_RS07135 Diaminopimelate decarboxylase/hypothetical protein
?USA300TCH1516_ALE = 1439047 104 (1.160)intergenic (+45/+195) lysA/USA300HOU_RS07135 Diaminopimelate decarboxylase/hypothetical protein
* ? USA300TCH1516_ALE 1443204 =100 (1.020)7 (0.110)
+30 bp		 6/100 NT 10.1% coding (224/393 nt) USA300TCH1516_01342 hypothetical protein
?USA300TCH1516_ALE 1803072 = NA (NA)coding (796/807 nt) USA300HOU_RS12765 hypothetical protein
* ? USA300TCH1516_ALE 1453877 =81 (0.820)14 (0.160) 8/146 NT 15.5% coding (45/2799 nt) odhA 2‑oxoglutarate dehydrogenase E1 component
?USA300TCH1516_ALE 1453904 = 79 (0.880)coding (18/2799 nt) odhA 2‑oxoglutarate dehydrogenase E1 component
* ? USA300TCH1516_ALE 1454597 =138 (1.400)9 (0.100) 5/146 NT 7.3% coding (964/1356 nt) arlS Signal transduction histidine‑protein kinase ArlS
?USA300TCH1516_ALE 1454633 = 102 (1.140)coding (928/1356 nt) arlS Signal transduction histidine‑protein kinase ArlS
* ? USA300TCH1516_ALE 1456948 =147 (1.490)16 (0.200) 9/132 NT 13.0% intergenic (‑62/‑182) USA300HOU_RS07230/USA300HOU_RS07235 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 1456990 = 93 (1.150)intergenic (‑104/‑140) USA300HOU_RS07230/USA300HOU_RS07235 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 1456995 =90 (0.920)16 (0.170)
+TTAAA		 8/150 NT 14.9% intergenic (‑109/‑135) USA300HOU_RS07230/USA300HOU_RS07235 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 1918582 105 (1.070)intergenic (‑300/+198) USA300HOU_RS07235/USA300HOU_RS09510 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 146029879 (0.800)15 (0.190) 10/128 NT 18.1% intergenic (‑330/+70) USA300HOU_RS07250/USA300HOU_RS07255 hypothetical protein/putative CtpA‑like serine protease
?USA300TCH1516_ALE = 1460310 73 (0.930)intergenic (‑342/+58) USA300HOU_RS07250/USA300HOU_RS07255 hypothetical protein/putative CtpA‑like serine protease
* ? USA300TCH1516_ALE = 146939774 (0.750)5 (0.060) 5/144 NT 6.2% coding (345/705 nt) yhhQ Inner membrane protein YhhQ
?USA300TCH1516_ALE = 1469422 84 (0.950)coding (370/705 nt) yhhQ Inner membrane protein YhhQ
* ? USA300TCH1516_ALE = 1470044NA (NA)15 (0.160) 9/150 NT 14.4% intergenic (‑91/‑254) USA300TCH1516_01369/rnhA hypothetical protein/14.7 kDa ribonuclease H‑like protein
?USA300TCH1516_ALE = 2866850 95 (0.970)intergenic (‑249/+204) USA300HOU_RS14695/noc_2 hypothetical protein/Nucleoid occlusion protein
* ? USA300TCH1516_ALE = 149426155 (0.560)7 (0.080) 4/150 NT 11.2% coding (7763/31266 nt) ebh_1 Extracellular matrix‑binding protein ebh
?USA300TCH1516_ALE = 1494291 59 (0.640)coding (7733/31266 nt) ebh_1 Extracellular matrix‑binding protein ebh
* ? USA300TCH1516_ALE 1502964 =112 (1.140)6 (0.070) 4/146 NT 5.7% coding (849/1392 nt) norB_4 Quinolone resistance protein NorB
?USA300TCH1516_ALE 1503001 = 95 (1.060)coding (812/1392 nt) norB_4 Quinolone resistance protein NorB
* ? USA300TCH1516_ALE 1507967 =79 (0.800)9 (0.110) 8/128 NT 11.6% intergenic (‑392/+83) ald1/ypcP Alanine dehydrogenase 1/5'‑3' exonuclease
?USA300TCH1516_ALE 1508010 = 74 (0.940)intergenic (‑435/+40) ald1/ypcP Alanine dehydrogenase 1/5'‑3' exonuclease
* ? USA300TCH1516_ALE = 150798283 (0.840)21 (0.270) 9/128 NT 23.0% intergenic (‑407/+68) ald1/ypcP Alanine dehydrogenase 1/5'‑3' exonuclease
?USA300TCH1516_ALE = 1507993 74 (0.940)intergenic (‑418/+57) ald1/ypcP Alanine dehydrogenase 1/5'‑3' exonuclease
* ? USA300TCH1516_ALE 1519629 =109 (1.110)8 (0.090) 4/144 NT 7.9% coding (753/2184 nt) ponA Penicillin‑binding protein 1A/1B
?USA300TCH1516_ALE 1519680 = 89 (1.010)coding (804/2184 nt) ponA Penicillin‑binding protein 1A/1B
* ? USA300TCH1516_ALE 1532094 =129 (1.310)7 (0.080) 5/146 NT 6.4% intergenic (‑263/+74) USA300HOU_RS07465/USA300HOU_RS07470 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 1532129 = 88 (0.980)intergenic (‑298/+39) USA300HOU_RS07465/USA300HOU_RS07470 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 153592586 (0.870)6 (0.070) 5/144 NT 7.0% coding (711/1299 nt) aroA 3‑phosphoshikimate 1‑carboxyvinyltransferase
?USA300TCH1516_ALE = 1535948 82 (0.930)coding (688/1299 nt) aroA 3‑phosphoshikimate 1‑carboxyvinyltransferase
* ? USA300TCH1516_ALE = 154028892 (0.940)10 (0.110) 8/146 NT 10.2% coding (909/960 nt) hepT Heptaprenyl diphosphate synthase component 2
?USA300TCH1516_ALE = 1540309 92 (1.030)coding (888/960 nt) hepT Heptaprenyl diphosphate synthase component 2
* ? USA300TCH1516_ALE 1555332 =91 (0.930)7 (0.080) 5/140 NT 8.6% intergenic (+28/+78) USA300HOU_RS07605/ribU Ferredoxin/Riboflavin transporter RibU
?USA300TCH1516_ALE 1555376 = 70 (0.810)intergenic (+72/+34) USA300HOU_RS07605/ribU Ferredoxin/Riboflavin transporter RibU
* ? USA300TCH1516_ALE = 155534182 (0.830)6 (0.070) 4/140 NT 7.8% intergenic (+37/+69) USA300HOU_RS07605/ribU Ferredoxin/Riboflavin transporter RibU
?USA300TCH1516_ALE = 1555365 70 (0.810)intergenic (+61/+45) USA300HOU_RS07605/ribU Ferredoxin/Riboflavin transporter RibU
* ? USA300TCH1516_ALE = 1562383118 (1.200)13 (0.140) 9/148 NT 10.4% intergenic (‑349/+41) hlgC_1/lytN_2 Gamma‑hemolysin component C/putative cell wall hydrolase LytN
?USA300TCH1516_ALE = 1562397 115 (1.260)intergenic (‑363/+27) hlgC_1/lytN_2 Gamma‑hemolysin component C/putative cell wall hydrolase LytN
* ? USA300TCH1516_ALE = 159414374 (0.750)14 (0.160) 7/146 NT 16.2% coding (129/243 nt) USA300HOU_RS07845 hypothetical protein
?USA300TCH1516_ALE = 1594163 77 (0.860)coding (109/243 nt) USA300HOU_RS07845 hypothetical protein
* ? USA300TCH1516_ALE 1600425 =109 (1.110)14 (0.150) 10/152 NT 12.3% intergenic (‑61/+205) USA300HOU_RS07900/USA300HOU_RS07910 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 1600453 = 97 (1.040)intergenic (‑89/+177) USA300HOU_RS07900/USA300HOU_RS07910 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 1601454NA (NA)10 (0.110) 7/146 NT 100% coding (139/177 nt) USA300TCH1516_01480 hypothetical protein
?USA300TCH1516_ALE = 1601498 0 (0.000)coding (95/177 nt) USA300TCH1516_01480 hypothetical protein
* ? USA300TCH1516_ALE 1601462 =NA (NA)8 (0.090) 7/146 NT 100% coding (131/177 nt) USA300TCH1516_01480 hypothetical protein
?USA300TCH1516_ALE 1601492 = 0 (0.000)coding (101/177 nt) USA300TCH1516_01480 hypothetical protein
* ? USA300TCH1516_ALE 1614319 =93 (0.950)8 (0.090) 6/150 NT 8.7% intergenic (+14/+64) USA300HOU_RS08000/xerD_3 hypothetical protein/Tyrosine recombinase XerD
?USA300TCH1516_ALE 1614368 = 81 (0.880)intergenic (+63/+15) USA300HOU_RS08000/xerD_3 hypothetical protein/Tyrosine recombinase XerD
* ? USA300TCH1516_ALE 1619603 =95 (0.970)12 (0.130) 6/148 NT 11.5% intergenic (+6/+99) proC/rnz Pyrroline‑5‑carboxylate reductase/Ribonuclease Z
?USA300TCH1516_ALE 1619653 = 96 (1.060)intergenic (+56/+49) proC/rnz Pyrroline‑5‑carboxylate reductase/Ribonuclease Z
* ? USA300TCH1516_ALE 1623534 =91 (0.930)6 (0.070) 5/138 NT 7.8% intergenic (+19/+64) marA/malL Multiple antibiotic resistance protein MarA/Oligo‑1,6‑glucosidase
?USA300TCH1516_ALE 1623587 = 63 (0.740)intergenic (+72/+11) marA/malL Multiple antibiotic resistance protein MarA/Oligo‑1,6‑glucosidase
* ? USA300TCH1516_ALE 1645378 =118 (1.200)17 (0.190) 8/148 NT 13.8% coding (188/558 nt) efp Elongation factor P
?USA300TCH1516_ALE 1645401 = 103 (1.130)coding (165/558 nt) efp Elongation factor P
* ? USA300TCH1516_ALE 1647574 =87 (0.880)9 (0.100) 7/148 NT 9.1% intergenic (+4/+60) USA300HOU_RS08180/lipM hypothetical protein/Octanoyltransferase LipM
?USA300TCH1516_ALE 1647624 = 100 (1.100)intergenic (+54/+10) USA300HOU_RS08180/lipM hypothetical protein/Octanoyltransferase LipM
* ? USA300TCH1516_ALE = 164757891 (0.930)11 (0.120) 9/144 NT 10.8% intergenic (+8/+56) USA300HOU_RS08180/lipM hypothetical protein/Octanoyltransferase LipM
?USA300TCH1516_ALE = 1647617 100 (1.130)intergenic (+47/+17) USA300HOU_RS08180/lipM hypothetical protein/Octanoyltransferase LipM
* ? USA300TCH1516_ALE 1660020 =99 (1.010)18 (0.210) 7/138 NT 17.0% coding (1289/1464 nt) gluP Rhomboid protease GluP
?USA300TCH1516_ALE 1660066 = 90 (1.060)coding (1243/1464 nt) gluP Rhomboid protease GluP
* ? USA300TCH1516_ALE = 1660030102 (1.040)9 (0.110) 5/138 NT 9.2% coding (1279/1464 nt) gluP Rhomboid protease GluP
?USA300TCH1516_ALE = 1660054 90 (1.060)coding (1255/1464 nt) gluP Rhomboid protease GluP
* ? USA300TCH1516_ALE 1662000 =117 (1.190)24 (0.290) 10/136 NT 21.7% intergenic (‑87/+68) USA300HOU_RS08275/rpmG2_2 5‑formyltetrahydrofolate cyclo‑ligase/50S ribosomal protein L33 2
?USA300TCH1516_ALE 1662039 = 74 (0.890)intergenic (‑126/+29) USA300HOU_RS08275/rpmG2_2 5‑formyltetrahydrofolate cyclo‑ligase/50S ribosomal protein L33 2
* ? USA300TCH1516_ALE = 166536267 (0.680)17 (0.260) 10/108 NT 24.4% intergenic (‑237/+40) sodA/zur Superoxide dismutase [Mn] 1/Zinc‑specific metallo‑regulatory protein
?USA300TCH1516_ALE = 1665378 60 (0.900)intergenic (‑253/+24) sodA/zur Superoxide dismutase [Mn] 1/Zinc‑specific metallo‑regulatory protein
* ? USA300TCH1516_ALE = 1676788102 (1.040)7 (0.070) 6/156 NT 7.1% intergenic (‑344/‑75) ccpN/glyQS Transcriptional repressor CcpN/Glycine‑‑tRNA ligase
?USA300TCH1516_ALE = 1676835 85 (0.890)intergenic (‑391/‑28) ccpN/glyQS Transcriptional repressor CcpN/Glycine‑‑tRNA ligase
* ? USA300TCH1516_ALE = 1682523130 (1.320)8 (0.090) 5/140 NT 6.3% intergenic (‑268/+36) USA300HOU_RS08380/USA300HOU_RS08385 PhoH‑like protein/hypothetical protein
?USA300TCH1516_ALE = 1682539 124 (1.440)intergenic (‑284/+20) USA300HOU_RS08380/USA300HOU_RS08385 PhoH‑like protein/hypothetical protein
* ? USA300TCH1516_ALE = 168312366 (0.670)6 (0.070) 4/138 NT 9.8% coding (135/699 nt) USA300HOU_RS08385 hypothetical protein
?USA300TCH1516_ALE = 1683155 54 (0.640)coding (103/699 nt) USA300HOU_RS08385 hypothetical protein
* ? USA300TCH1516_ALE 1685779 =98 (1.000)7 (0.080) 5/140 NT 7.8% coding (1245/1347 nt) mtaB Threonylcarbamoyladenosine tRNA methylthiotransferase MtaB
?USA300TCH1516_ALE 1685820 = 80 (0.930)coding (1204/1347 nt) mtaB Threonylcarbamoyladenosine tRNA methylthiotransferase MtaB
* ? USA300TCH1516_ALE = 169376488 (0.890)11 (0.130) 6/140 NT 11.6% coding (1031/1158 nt) hemN_1 Oxygen‑independent coproporphyrinogen‑III oxidase‑like protein YqeR
?USA300TCH1516_ALE = 1693780 91 (1.060)coding (1015/1158 nt) hemN_1 Oxygen‑independent coproporphyrinogen‑III oxidase‑like protein YqeR
* ? USA300TCH1516_ALE 1702257 =112 (1.140)17 (0.200) 9/138 NT 16.5% intergenic (‑1/+48) comEA/tylM1 ComE operon protein 1/dTDP‑3‑amino‑3,6‑dideoxy‑alpha‑D‑glucopyranose N,N‑dimethyltransferase
?USA300TCH1516_ALE 1702302 = 75 (0.880)intergenic (‑46/+3) comEA/tylM1 ComE operon protein 1/dTDP‑3‑amino‑3,6‑dideoxy‑alpha‑D‑glucopyranose N,N‑dimethyltransferase
* ? USA300TCH1516_ALE 1710808 =104 (1.060)9 (0.100) 8/144 NT 8.9% coding (336/1221 nt) fic Adenosine monophosphate‑protein transferase SoFic
?USA300TCH1516_ALE 1710841 = 91 (1.030)coding (303/1221 nt) fic Adenosine monophosphate‑protein transferase SoFic
* ? USA300TCH1516_ALE 1721519 =80 (0.810)5 (0.060) 5/142 NT 6.2% intergenic (‑236/+49) USA300HOU_RS08595/USA300HOU_RS08600 Putative O‑methyltransferase/MSMEI_4947/hypothetical protein
?USA300TCH1516_ALE 1721556 = 80 (0.920)intergenic (‑273/+12) USA300HOU_RS08595/USA300HOU_RS08600 Putative O‑methyltransferase/MSMEI_4947/hypothetical protein
* ? USA300TCH1516_ALE = 172152785 (0.860)9 (0.100) 5/142 NT 10.4% intergenic (‑244/+41) USA300HOU_RS08595/USA300HOU_RS08600 Putative O‑methyltransferase/MSMEI_4947/hypothetical protein
?USA300TCH1516_ALE = 1721546 80 (0.920)intergenic (‑263/+22) USA300HOU_RS08595/USA300HOU_RS08600 Putative O‑methyltransferase/MSMEI_4947/hypothetical protein
* ? USA300TCH1516_ALE 1732959 =88 (0.890)12 (0.140) 8/136 NT 12.3% intergenic (+145/+92) limB_2/USA300HOU_RS08645 Limonene 1,2‑monooxygenase/hypothetical protein
?USA300TCH1516_ALE 1733016 = 97 (1.160)intergenic (+202/+35) limB_2/USA300HOU_RS08645 Limonene 1,2‑monooxygenase/hypothetical protein
* ? USA300TCH1516_ALE = 173297094 (0.960)12 (0.140) 7/136 NT 11.9% intergenic (+156/+81) limB_2/USA300HOU_RS08645 Limonene 1,2‑monooxygenase/hypothetical protein
?USA300TCH1516_ALE = 1733003 97 (1.160)intergenic (+189/+48) limB_2/USA300HOU_RS08645 Limonene 1,2‑monooxygenase/hypothetical protein
* ? USA300TCH1516_ALE = 173536186 (0.870)4 (0.050) 4/134 NT 5.1% intergenic (+61/+100) USA300TCH1516_01624/tcdA putative AAA domain‑containing protein/tRNA threonylcarbamoyladenosine dehydratase
?USA300TCH1516_ALE = 1735390 78 (0.950)intergenic (+90/+71) USA300TCH1516_01624/tcdA putative AAA domain‑containing protein/tRNA threonylcarbamoyladenosine dehydratase
* ? USA300TCH1516_ALE 1747122 =113 (1.150)15 (0.180) 10/132 NT 16.7% intergenic (‑156/+47) recJ/USA300HOU_RS08710 Single‑stranded‑DNA‑specific exonuclease RecJ/Heme uptake protein MmpL11
?USA300TCH1516_ALE 1747161 = 56 (0.690)intergenic (‑195/+8) recJ/USA300HOU_RS08710 Single‑stranded‑DNA‑specific exonuclease RecJ/Heme uptake protein MmpL11
* ? USA300TCH1516_ALE 1758568 =124 (1.260)6 (0.070) 4/140 NT 5.6% intergenic (‑141/+252) mreC/USA300HOU_RS08780 Cell shape‑determining protein MreC/hypothetical protein
?USA300TCH1516_ALE 1758603 = 92 (1.070)intergenic (‑176/+217) mreC/USA300HOU_RS08780 Cell shape‑determining protein MreC/hypothetical protein
* ? USA300TCH1516_ALE 1759667 =91 (0.930)6 (0.070) 4/132 NT 8.0% intergenic (‑374/+100) USA300HOU_RS08780/USA300HOU_RS08785 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 1759723 = 62 (0.760)intergenic (‑430/+44) USA300HOU_RS08780/USA300HOU_RS08785 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 175968090 (0.920)8 (0.100) 7/132 NT 10.5% intergenic (‑387/+87) USA300HOU_RS08780/USA300HOU_RS08785 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 1759708 62 (0.760)intergenic (‑415/+59) USA300HOU_RS08780/USA300HOU_RS08785 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 1766678 =73 (0.740)8 (0.090) 5/140 NT 12.2% intergenic (+22/+201) tag/USA300HOU_RS08820 DNA‑3‑methyladenine glycosylase 1/hypothetical protein
?USA300TCH1516_ALE 1766721 = 51 (0.590)intergenic (+65/+158) tag/USA300HOU_RS08820 DNA‑3‑methyladenine glycosylase 1/hypothetical protein
* ? USA300TCH1516_ALE 1775185 =88 (0.890)12 (0.140) 7/142 NT 14.1% intergenic (‑78/+76) engB/clpX putative GTP‑binding protein EngB/ATP‑dependent Clp protease ATP‑binding subunit ClpX
?USA300TCH1516_ALE 1775239 = 68 (0.780)intergenic (‑132/+22) engB/clpX putative GTP‑binding protein EngB/ATP‑dependent Clp protease ATP‑binding subunit ClpX
* ? USA300TCH1516_ALE 1789630 =83 (0.840)9 (0.110) 6/138 NT 11.5% intergenic (‑111/+59) gapA2/coaE Glyceraldehyde‑3‑phosphate dehydrogenase 2/Dephospho‑CoA kinase
?USA300TCH1516_ALE 1789673 = 67 (0.790)intergenic (‑154/+16) gapA2/coaE Glyceraldehyde‑3‑phosphate dehydrogenase 2/Dephospho‑CoA kinase
* ? USA300TCH1516_ALE = 178964081 (0.820)5 (0.060) 5/138 NT 6.8% intergenic (‑121/+49) gapA2/coaE Glyceraldehyde‑3‑phosphate dehydrogenase 2/Dephospho‑CoA kinase
?USA300TCH1516_ALE = 1789661 67 (0.790)intergenic (‑142/+28) gapA2/coaE Glyceraldehyde‑3‑phosphate dehydrogenase 2/Dephospho‑CoA kinase
* ? USA300TCH1516_ALE 1803422 =0 (0.000)7 (0.070) 4/154 NT 100% coding (446/807 nt) USA300HOU_RS12765 hypothetical protein
?USA300TCH1516_ALE 1803448 = NA (NA)coding (420/807 nt) USA300HOU_RS12765 hypothetical protein
* ? USA300TCH1516_ALE = 180361864 (0.650)8 (0.090) 3/142 NT 9.6% coding (250/807 nt) USA300HOU_RS12765 hypothetical protein
?USA300TCH1516_ALE 1911906 = 94 (1.080)coding (28/609 nt) USA300HOU_RS15290 hypothetical protein
* ? USA300TCH1516_ALE 1822865 =79 (0.800)7 (0.080) 6/142 NT 8.4% intergenic (+186/+60) USA300HOU_RS09070/ackA Putative universal stress protein/Acetate kinase
?USA300TCH1516_ALE 1822909 = 82 (0.940)intergenic (+230/+16) USA300HOU_RS09070/ackA Putative universal stress protein/Acetate kinase
* ? USA300TCH1516_ALE = 182287381 (0.820)9 (0.100) 6/142 NT 10.5% intergenic (+194/+52) USA300HOU_RS09070/ackA Putative universal stress protein/Acetate kinase
?USA300TCH1516_ALE = 1822899 82 (0.940)intergenic (+220/+26) USA300HOU_RS09070/ackA Putative universal stress protein/Acetate kinase
* ? USA300TCH1516_ALE 1830989 =89 (0.910)5 (0.050) 5/150 NT 5.8% coding (131/1695 nt) ezrA Septation ring formation regulator EzrA
?USA300TCH1516_ALE 1831014 = 79 (0.860)coding (106/1695 nt) ezrA Septation ring formation regulator EzrA
* ? USA300TCH1516_ALE 1834059 =78 (0.790)7 (0.080) 6/138 NT 10.1% intergenic (+8/‑106) osmC/USA300HOU_RS09140 Peroxiredoxin OsmC/Soluble hydrogenase 42 kDa subunit
?USA300TCH1516_ALE 1834098 = 58 (0.680)intergenic (+47/‑67) osmC/USA300HOU_RS09140 Peroxiredoxin OsmC/Soluble hydrogenase 42 kDa subunit
* ? USA300TCH1516_ALE 1836934 =65 (0.660)15 (0.180) 8/132 NT 21.3% intergenic (+18/+132) serA/gph_2 D‑3‑phosphoglycerate dehydrogenase/Phosphoglycolate phosphatase
?USA300TCH1516_ALE 1836982 = 57 (0.700)intergenic (+66/+84) serA/gph_2 D‑3‑phosphoglycerate dehydrogenase/Phosphoglycolate phosphatase
* ? USA300TCH1516_ALE = 183694764 (0.650)6 (0.070) 6/132 NT 9.9% intergenic (+31/+119) serA/gph_2 D‑3‑phosphoglycerate dehydrogenase/Phosphoglycolate phosphatase
?USA300TCH1516_ALE = 1836967 57 (0.700)intergenic (+51/+99) serA/gph_2 D‑3‑phosphoglycerate dehydrogenase/Phosphoglycolate phosphatase
* ? USA300TCH1516_ALE = 183826389 (0.910)9 (0.100) 7/140 NT 9.7% intergenic (‑67/+40) gph_2/nagE Phosphoglycolate phosphatase/PTS system N‑acetylglucosamine‑specific EIICBA component
?USA300TCH1516_ALE = 1838279 90 (1.050)intergenic (‑83/+24) gph_2/nagE Phosphoglycolate phosphatase/PTS system N‑acetylglucosamine‑specific EIICBA component
* ? USA300TCH1516_ALE 1841984 =61 (0.620)8 (0.100) 6/134 NT 12.6% intergenic (+24/+70) htrA/tyrS Serine protease Do‑like HtrA/Tyrosine‑‑tRNA ligase
?USA300TCH1516_ALE 1842029 = 60 (0.730)intergenic (+69/+25) htrA/tyrS Serine protease Do‑like HtrA/Tyrosine‑‑tRNA ligase
* ? USA300TCH1516_ALE = 184199664 (0.650)12 (0.150) 7/134 NT 17.4% intergenic (+36/+58) htrA/tyrS Serine protease Do‑like HtrA/Tyrosine‑‑tRNA ligase
?USA300TCH1516_ALE = 1842015 60 (0.730)intergenic (+55/+39) htrA/tyrS Serine protease Do‑like HtrA/Tyrosine‑‑tRNA ligase
* ? USA300TCH1516_ALE = 184466195 (0.970)5 (0.060) 4/142 NT 5.1% intergenic (+58/+145) mrcA/isdH Penicillin‑binding protein 1A/Iron‑regulated surface determinant protein H
?USA300TCH1516_ALE = 1844689 101 (1.160)intergenic (+86/+117) mrcA/isdH Penicillin‑binding protein 1A/Iron‑regulated surface determinant protein H
* ? USA300TCH1516_ALE 1850072 =103 (1.050)8 (0.080) 4/154 NT 8.0% coding (1531/1707 nt) acsA_1 Acetyl‑coenzyme A synthetase
?USA300TCH1516_ALE 1850111 = 86 (0.910)coding (1492/1707 nt) acsA_1 Acetyl‑coenzyme A synthetase
* ? USA300TCH1516_ALE 1858390 =105 (1.070)7 (0.090) 6/126 NT 8.4% intergenic (‑17/+57) USA300HOU_RS09235/USA300HOU_RS09240 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 1858437 = 70 (0.900)intergenic (‑64/+10) USA300HOU_RS09235/USA300HOU_RS09240 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 1867679106 (1.080)14 (0.160) 10/142 NT 12.1% intergenic (+53/+72) USA300HOU_RS09275/ytnP hypothetical protein/putative quorum‑quenching lactonase YtnP
?USA300TCH1516_ALE = 1867699 110 (1.260)intergenic (+73/+52) USA300HOU_RS09275/ytnP hypothetical protein/putative quorum‑quenching lactonase YtnP
* ? USA300TCH1516_ALE 1868935 =112 (1.140)17 (0.190) 11/142 NT 16.5% intergenic (‑342/+128) ytnP/trmB putative quorum‑quenching lactonase YtnP/tRNA (guanine‑N(7)‑)‑methyltransferase
?USA300TCH1516_ALE 1868982 = 73 (0.840)intergenic (‑389/+81) ytnP/trmB putative quorum‑quenching lactonase YtnP/tRNA (guanine‑N(7)‑)‑methyltransferase
* ? USA300TCH1516_ALE 1870532 =77 (0.780)14 (0.160) 8/144 NT 18.1% intergenic (‑19/+531) srkA/dat Stress response kinase A/D‑alanine aminotransferase
?USA300TCH1516_ALE 1870584 = 57 (0.640)intergenic (‑71/+479) srkA/dat Stress response kinase A/D‑alanine aminotransferase
* ? USA300TCH1516_ALE 1873582 =112 (1.140)8 (0.090) 6/144 NT 8.0% intergenic (‑258/+492) USA300HOU_RS09300/USA300HOU_RS09305 Putative dipeptidase/hypothetical protein
?USA300TCH1516_ALE 1873645 = 84 (0.950)intergenic (‑321/+429) USA300HOU_RS09300/USA300HOU_RS09305 Putative dipeptidase/hypothetical protein
* ? USA300TCH1516_ALE = 187671698 (1.000)6 (0.070) 4/148 NT 6.0% coding (151/1662 nt) murJ_2 Lipid II flippase MurJ
?USA300TCH1516_ALE = 1876739 98 (1.080)coding (128/1662 nt) murJ_2 Lipid II flippase MurJ
* ? USA300TCH1516_ALE 1878597 =85 (0.860)6 (0.080) 5/124 NT 10.2% intergenic (+56/+61) USA300HOU_RS09320/ebh_2 Ferredoxin‑‑NADP reductase/Extracellular matrix‑binding protein ebh
?USA300TCH1516_ALE 1878652 = 40 (0.520)intergenic (+111/+6) USA300HOU_RS09320/ebh_2 Ferredoxin‑‑NADP reductase/Extracellular matrix‑binding protein ebh
* ? USA300TCH1516_ALE = 189333224 (0.240)39 (0.420) 8/150 NT 63.4% intergenic (‑193/+154) USA300TCH1516_01750/ytpA hypothetical protein/Phospholipase YtpA
?USA300TCH1516_ALE 1910766 = NA (NA)intergenic (+299/‑256) crcB_2/USA300TCH1516_01771 Putative fluoride ion transporter CrcB/hypothetical protein
* ? USA300TCH1516_ALE 1901310 =105 (1.070)11 (0.130) 6/142 NT 11.9% intergenic (‑306/‑217) USA300HOU_RS09405/sdpR hypothetical protein/Transcriptional repressor SdpR
?USA300TCH1516_ALE 1901351 = 69 (0.790)intergenic (‑347/‑176) USA300HOU_RS09405/sdpR hypothetical protein/Transcriptional repressor SdpR
* ? USA300TCH1516_ALE = 1909669101 (1.030)5 (0.060) 4/146 NT 5.0% intergenic (+173/‑83) USA300HOU_RS09460/crcB_1 hypothetical protein/Putative fluoride ion transporter CrcB
?USA300TCH1516_ALE = 1909705 96 (1.070)intergenic (+209/‑47) USA300HOU_RS09460/crcB_1 hypothetical protein/Putative fluoride ion transporter CrcB
* ? USA300TCH1516_ALE 1910682 =NA (NA)7 (0.080) 5/140 NT 10.4% intergenic (+215/‑340) crcB_2/USA300TCH1516_01771 Putative fluoride ion transporter CrcB/hypothetical protein
?USA300TCH1516_ALE 2684309 = 69 (0.700)intergenic (+68/+102) mvaS/ogt Hydroxymethylglutaryl‑CoA synthase/Methylated‑DNA‑‑protein‑cysteine methyltransferase
* ? USA300TCH1516_ALE 1915879 =98 (1.000)6 (0.060) 4/156 NT 5.6% intergenic (‑58/‑313) metK/pckA S‑adenosylmethionine synthase/Phosphoenolpyruvate carboxykinase (ATP)
?USA300TCH1516_ALE 1915913 = 107 (1.120)intergenic (‑92/‑279) metK/pckA S‑adenosylmethionine synthase/Phosphoenolpyruvate carboxykinase (ATP)
* ? USA300TCH1516_ALE 1918322 =60 (0.610)4 (0.040) 3/146 NT 5.6% intergenic (‑40/+458) USA300HOU_RS07235/USA300HOU_RS09510 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 1918351 = 80 (0.890)intergenic (‑69/+429) USA300HOU_RS07235/USA300HOU_RS09510 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 1928296146 (1.480)9 (0.100) 8/140 NT 6.3% intergenic (‑250/+51) USA300HOU_RS09565/USA300HOU_RS09575 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 1928318 138 (1.600)intergenic (‑272/+29) USA300HOU_RS09565/USA300HOU_RS09575 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 193938296 (0.980)8 (0.090) 7/142 NT 9.0% intergenic (‑241/+122) hsdM_2/splF Type I restriction enzyme EcoKI M protein/Serine protease SplF
?USA300TCH1516_ALE = 1939405 77 (0.880)intergenic (‑264/+99) hsdM_2/splF Type I restriction enzyme EcoKI M protein/Serine protease SplF
* ? USA300TCH1516_ALE 1946068 =128 (1.300)11 (0.130) 8/142 NT 9.8% intergenic (+119/+355) USA300HOU_RS09665/USA300HOU_RS15380 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 1946105 = 88 (1.010)intergenic (+156/+318) USA300HOU_RS09665/USA300HOU_RS15380 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 1965737 =62 (0.630)6 (0.070) 4/146 NT 9.0% coding (71/924 nt) hemH Ferrochelatase
?USA300TCH1516_ALE 1965782 = 65 (0.720)coding (26/924 nt) hemH Ferrochelatase
* ? USA300TCH1516_ALE = 196574366 (0.670)5 (0.060) 4/146 NT 7.4% coding (65/924 nt) hemH Ferrochelatase
?USA300TCH1516_ALE = 1965774 65 (0.720)coding (34/924 nt) hemH Ferrochelatase
* ? USA300TCH1516_ALE 1980867 =71 (0.720)6 (0.070) 5/140 NT 8.8% intergenic (‑109/+70) USA300HOU_RS09865/USA300HOU_RS09870 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 1980913 = 63 (0.730)intergenic (‑155/+24) USA300HOU_RS09865/USA300HOU_RS09870 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 198087666 (0.670)9 (0.100) 4/140 NT 13.0% intergenic (‑118/+61) USA300HOU_RS09865/USA300HOU_RS09870 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 1980902 63 (0.730)intergenic (‑144/+35) USA300HOU_RS09865/USA300HOU_RS09870 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 1990341 =52 (0.530)6 (0.080) 5/124 NT 12.3% intergenic (‑90/+61) queG/tcyC_1 Epoxyqueuosine reductase/L‑cystine import ATP‑binding protein TcyC
?USA300TCH1516_ALE 1990392 = 45 (0.590)intergenic (‑141/+10) queG/tcyC_1 Epoxyqueuosine reductase/L‑cystine import ATP‑binding protein TcyC
* ? USA300TCH1516_ALE = 199035850 (0.510)8 (0.100) 7/124 NT 16.0% intergenic (‑107/+44) queG/tcyC_1 Epoxyqueuosine reductase/L‑cystine import ATP‑binding protein TcyC
?USA300TCH1516_ALE = 1990373 45 (0.590)intergenic (‑122/+29) queG/tcyC_1 Epoxyqueuosine reductase/L‑cystine import ATP‑binding protein TcyC
* ? USA300TCH1516_ALE 1994825 =NA (NA)5 (0.050) 5/150 NT 100% coding (440/1362 nt) USA300HOU_RS11675 hypothetical protein
?USA300TCH1516_ALE 1994850 = 0 (0.000)coding (465/1362 nt) USA300HOU_RS11675 hypothetical protein
* ? USA300TCH1516_ALE = 199639158 (0.590)4 (0.050) 4/144 NT 7.4% noncoding (66/74 nt) USA300TCH1516_01862 tRNA‑His
?USA300TCH1516_ALE = 1996449 48 (0.540)noncoding (8/74 nt) USA300TCH1516_01862 tRNA‑His
* ? USA300TCH1516_ALE = 200406994 (0.960)11 (0.130) 6/142 NT 11.6% intergenic (‑2292/+92) USA300TCH1516_01884/perR tRNA‑Ile/Peroxide‑responsive repressor PerR
?USA300TCH1516_ALE = 2004081 85 (0.970)intergenic (‑2304/+80) USA300TCH1516_01884/perR tRNA‑Ile/Peroxide‑responsive repressor PerR
* ? USA300TCH1516_ALE 2008942 =91 (0.930)14 (0.170) 7/132 NT 17.4% intergenic (+70/+121) USA300HOU_RS10115/USA300HOU_RS10125 hypothetical protein/Putative multidrug export ATP‑binding/permease protein
?USA300TCH1516_ALE 2008991 = 58 (0.710)intergenic (+119/+72) USA300HOU_RS10115/USA300HOU_RS10125 hypothetical protein/Putative multidrug export ATP‑binding/permease protein
* ? USA300TCH1516_ALE = 2014149107 (1.090)9 (0.100) 7/148 NT 7.6% intergenic (+49/+212) USA300HOU_RS10140/USA300HOU_RS10150 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 2014182 119 (1.310)intergenic (+82/+179) USA300HOU_RS10140/USA300HOU_RS10150 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 2019127 =106 (1.080)7 (0.080) 6/142 NT 7.6% intergenic (‑209/+132) mgt/yraA Monofunctional glycosyltransferase/Putative cysteine protease YraA
?USA300TCH1516_ALE 2019176 = 75 (0.860)intergenic (‑258/+83) mgt/yraA Monofunctional glycosyltransferase/Putative cysteine protease YraA
* ? USA300TCH1516_ALE = 202146287 (0.880)10 (0.120) 8/140 NT 11.0% intergenic (+21/+239) queE_2/USA300HOU_RS10190 7‑carboxy‑7‑deazaguanine synthase/putative acyl‑CoA thioester hydrolase
?USA300TCH1516_ALE = 2021482 85 (0.990)intergenic (+41/+219) queE_2/USA300HOU_RS10190 7‑carboxy‑7‑deazaguanine synthase/putative acyl‑CoA thioester hydrolase
* ? USA300TCH1516_ALE = 202164274 (0.750)4 (0.050) 4/134 NT 5.4% intergenic (+201/+59) queE_2/USA300HOU_RS10190 7‑carboxy‑7‑deazaguanine synthase/putative acyl‑CoA thioester hydrolase
?USA300TCH1516_ALE = 2021681 79 (0.960)intergenic (+240/+20) queE_2/USA300HOU_RS10190 7‑carboxy‑7‑deazaguanine synthase/putative acyl‑CoA thioester hydrolase
* ? USA300TCH1516_ALE 2023587 =93 (0.950)8 (0.090) 6/148 NT 9.1% coding (200/207 nt) USA300HOU_RS10200 hypothetical protein
?USA300TCH1516_ALE 2023639 = 73 (0.800)coding (148/207 nt) USA300HOU_RS10200 hypothetical protein
* ? USA300TCH1516_ALE = 2028558111 (1.130)10 (0.120) 6/140 NT 9.3% coding (87/702 nt) USA300HOU_RS10230 hypothetical protein
?USA300TCH1516_ALE = 2028574 98 (1.140)coding (71/702 nt) USA300HOU_RS10230 hypothetical protein
* ? USA300TCH1516_ALE = 203021499 (1.010)11 (0.120) 5/144 NT 10.4% intergenic (‑194/‑334) map/USA300HOU_RS10250 Methionine aminopeptidase/hypothetical protein
?USA300TCH1516_ALE = 2030262 101 (1.140)intergenic (‑242/‑286) map/USA300HOU_RS10250 Methionine aminopeptidase/hypothetical protein
* ? USA300TCH1516_ALE 2036458 =120 (1.220)7 (0.080) 6/148 NT 6.0% intergenic (+15/+53) polC_2/dinB DNA polymerase III PolC‑type/DNA polymerase IV
?USA300TCH1516_ALE 2036504 = 107 (1.180)intergenic (+61/+7) polC_2/dinB DNA polymerase III PolC‑type/DNA polymerase IV
* ? USA300TCH1516_ALE = 2051385114 (1.160)6 (0.060) 4/152 NT 5.2% coding (908/2193 nt) pcrA ATP‑dependent DNA helicase PcrA
?USA300TCH1516_ALE = 2051416 112 (1.200)coding (877/2193 nt) pcrA ATP‑dependent DNA helicase PcrA
* ? USA300TCH1516_ALE 2053094 =111 (1.130)7 (0.080) 4/144 NT 7.3% intergenic (‑113/+59) pcrB/trpR Heptaprenylglyceryl phosphate synthase/Trp operon repressor
?USA300TCH1516_ALE 2053141 = 77 (0.870)intergenic (‑160/+12) pcrB/trpR Heptaprenylglyceryl phosphate synthase/Trp operon repressor
* ? USA300TCH1516_ALE 2053744 =108 (1.100)16 (0.170) 9/150 NT 14.7% coding (1116/1296 nt) purB Adenylosuccinate lyase
?USA300TCH1516_ALE 2053767 = 85 (0.920)coding (1093/1296 nt) purB Adenylosuccinate lyase
* ? USA300TCH1516_ALE 2082368 =104 (1.060)9 (0.110) 5/138 NT 9.6% intergenic (+9/+315) aspC/USA300HOU_RS10520 Aspartate aminotransferase/65 kDa membrane protein
?USA300TCH1516_ALE 2082406 = 79 (0.930)intergenic (+47/+277) aspC/USA300HOU_RS10520 Aspartate aminotransferase/65 kDa membrane protein
* ? USA300TCH1516_ALE = 2082527103 (1.050)13 (0.150) 8/142 NT 12.1% intergenic (+168/+156) aspC/USA300HOU_RS10520 Aspartate aminotransferase/65 kDa membrane protein
?USA300TCH1516_ALE = 2082556 98 (1.120)intergenic (+197/+127) aspC/USA300HOU_RS10520 Aspartate aminotransferase/65 kDa membrane protein
* ? USA300TCH1516_ALE 2082639 =116 (1.180)10 (0.110) 9/148 NT 8.7% intergenic (+280/+44) aspC/USA300HOU_RS10520 Aspartate aminotransferase/65 kDa membrane protein
?USA300TCH1516_ALE 2082667 = 102 (1.120)intergenic (+308/+16) aspC/USA300HOU_RS10520 Aspartate aminotransferase/65 kDa membrane protein
* ? USA300TCH1516_ALE = 208803881 (0.820)16 (0.210) 9/126 NT 17.7% intergenic (+55/+40) chp/USA300HOU_RS10560 Chemotaxis inhibitory protein/Glycyl‑glycine endopeptidase ALE‑1
?USA300TCH1516_ALE = 2088052 85 (1.100)intergenic (+69/+26) chp/USA300HOU_RS10560 Chemotaxis inhibitory protein/Glycyl‑glycine endopeptidase ALE‑1
* ? USA300TCH1516_ALE = 2090954100 (1.020)8 (0.090) 6/142 NT 7.9% intergenic (‑188/+350) USA300HOU_RS10575/USA300HOU_RS10590 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 2090971 99 (1.130)intergenic (‑205/+333) USA300HOU_RS10575/USA300HOU_RS10590 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 211748495 (0.970)6 (0.070) 4/144 NT 6.1% coding (805/921 nt) USA300HOU_RS10775 hypothetical protein
?USA300TCH1516_ALE = 2117504 100 (1.130)coding (785/921 nt) USA300HOU_RS10775 hypothetical protein
* ? USA300TCH1516_ALE 2140331 =73 (0.740)4 (0.040) 4/150 NT 5.7% intergenic (‑771/+140) USA300HOU_RS10910/groL hypothetical protein/60 kDa chaperonin
?USA300TCH1516_ALE 2140372 = 65 (0.710)intergenic (‑812/+99) USA300HOU_RS10910/groL hypothetical protein/60 kDa chaperonin
* ? USA300TCH1516_ALE 2141638 =78 (0.790)7 (0.080) 6/148 NT 10.3% coding (450/1617 nt) groL 60 kDa chaperonin
?USA300TCH1516_ALE 2141666 = 50 (0.550)coding (422/1617 nt) groL 60 kDa chaperonin
* ? USA300TCH1516_ALE 2143370 =77 (0.780)13 (0.160) 7/132 NT 16.9% intergenic (+5/+20) USA300HOU_RS10935/USA300HOU_RS10940 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 2143414 = 64 (0.790)coding (1230/1254 nt) USA300HOU_RS10940 hypothetical protein
* ? USA300TCH1516_ALE = 214338372 (0.730)11 (0.140) 8/132 NT 15.1% intergenic (+18/+7) USA300HOU_RS10935/USA300HOU_RS10940 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 2143399 64 (0.790)coding (1245/1254 nt) USA300HOU_RS10940 hypothetical protein
* ? USA300TCH1516_ALE 2150647 =105 (1.070)14 (0.170) 8/136 NT 13.6% intergenic (+310/+57) agrA/scrK Accessory gene regulator A/Fructokinase
?USA300TCH1516_ALE 2150691 = 89 (1.060)intergenic (+354/+13) agrA/scrK Accessory gene regulator A/Fructokinase
* ? USA300TCH1516_ALE = 216038792 (0.940)9 (0.110) 8/136 NT 10.0% intergenic (+20/‑341) yheS/mutS_2 putative ABC transporter ATP‑binding protein YheS/DNA mismatch repair protein MutS
?USA300TCH1516_ALE = 2160400 83 (0.990)intergenic (+33/‑328) yheS/mutS_2 putative ABC transporter ATP‑binding protein YheS/DNA mismatch repair protein MutS
* ? USA300TCH1516_ALE = 221042875 (0.760)9 (0.100) 5/148 NT 10.7% coding (69/648 nt) USA300HOU_RS11275 hypothetical protein
?USA300TCH1516_ALE = 2210445 81 (0.890)coding (86/648 nt) USA300HOU_RS11275 hypothetical protein
* ? USA300TCH1516_ALE = 221175897 (0.990)6 (0.070) 5/138 NT 6.2% intergenic (+751/+62) USA300HOU_RS11275/yidC hypothetical protein/Membrane protein insertase YidC
?USA300TCH1516_ALE = 2211795 97 (1.140)intergenic (+788/+25) USA300HOU_RS11275/yidC hypothetical protein/Membrane protein insertase YidC
* ? USA300TCH1516_ALE 2215750 =72 (0.730)5 (0.060) 4/140 NT 7.0% intergenic (‑42/+344) tenA/sceD Aminopyrimidine aminohydrolase/putative transglycosylase SceD
?USA300TCH1516_ALE 2215808 = 69 (0.800)intergenic (‑100/+286) tenA/sceD Aminopyrimidine aminohydrolase/putative transglycosylase SceD
* ? USA300TCH1516_ALE = 221575972 (0.730)4 (0.050) 4/140 NT 5.7% intergenic (‑51/+335) tenA/sceD Aminopyrimidine aminohydrolase/putative transglycosylase SceD
?USA300TCH1516_ALE = 2215797 69 (0.800)intergenic (‑89/+297) tenA/sceD Aminopyrimidine aminohydrolase/putative transglycosylase SceD
* ? USA300TCH1516_ALE 2218211 =63 (0.640)9 (0.120) 7/124 NT 13.5% intergenic (+4/+55) USA300HOU_RS11330/fabZ hypothetical protein/3‑hydroxyacyl‑[acyl‑carrier‑protein] dehydratase FabZ
?USA300TCH1516_ALE 2218261 = 67 (0.880)intergenic (+54/+5) USA300HOU_RS11330/fabZ hypothetical protein/3‑hydroxyacyl‑[acyl‑carrier‑protein] dehydratase FabZ
* ? USA300TCH1516_ALE = 221822863 (0.640)14 (0.180) 9/124 NT 19.5% intergenic (+21/+38) USA300HOU_RS11330/fabZ hypothetical protein/3‑hydroxyacyl‑[acyl‑carrier‑protein] dehydratase FabZ
?USA300TCH1516_ALE = 2218242 67 (0.880)intergenic (+35/+24) USA300HOU_RS11330/fabZ hypothetical protein/3‑hydroxyacyl‑[acyl‑carrier‑protein] dehydratase FabZ
* ? USA300TCH1516_ALE 2236023 =92 (0.940)7 (0.080) 5/142 NT 9.2% intergenic (‑296/+51) tdk/rpmE2 Thymidine kinase/50S ribosomal protein L31 type B
?USA300TCH1516_ALE 2236061 = 56 (0.640)intergenic (‑334/+13) tdk/rpmE2 Thymidine kinase/50S ribosomal protein L31 type B
* ? USA300TCH1516_ALE = 224537196 (0.980)10 (0.110) 8/144 NT 10.2% intergenic (‑230/+106) pyrG/rpoE CTP synthase/putative DNA‑directed RNA polymerase subunit delta
?USA300TCH1516_ALE = 2245389 89 (1.010)intergenic (‑248/+88) pyrG/rpoE CTP synthase/putative DNA‑directed RNA polymerase subunit delta
* ? USA300TCH1516_ALE 2248208 =88 (0.890)4 (0.040) 4/150 NT 5.0% intergenic (+2/+128) coaW/USA300HOU_RS11505 Type II pantothenate kinase/hypothetical protein
?USA300TCH1516_ALE 2248263 = 68 (0.740)intergenic (+57/+73) coaW/USA300HOU_RS11505 Type II pantothenate kinase/hypothetical protein
* ? USA300TCH1516_ALE 2252589 =109 (1.110)19 (0.220) 13/142 NT 17.6% intergenic (+25/+127) luxS/USA300HOU_RS11525 S‑ribosylhomocysteine lyase/hypothetical protein
?USA300TCH1516_ALE 2252638 = 81 (0.930)intergenic (+74/+78) luxS/USA300HOU_RS11525 S‑ribosylhomocysteine lyase/hypothetical protein
* ? USA300TCH1516_ALE 2252658 =74 (0.750)5 (0.050) 4/148 NT 6.3% intergenic (+94/+58) luxS/USA300HOU_RS11525 S‑ribosylhomocysteine lyase/hypothetical protein
?USA300TCH1516_ALE 2252704 = 80 (0.880)intergenic (+140/+12) luxS/USA300HOU_RS11525 S‑ribosylhomocysteine lyase/hypothetical protein
* ? USA300TCH1516_ALE = 225560195 (0.970)7 (0.080) 5/142 NT 7.5% intergenic (‑279/‑36) deoC2/deoD1 Deoxyribose‑phosphate aldolase 2/Purine nucleoside phosphorylase DeoD‑type 1
?USA300TCH1516_ALE = 2255626 89 (1.020)intergenic (‑304/‑11) deoC2/deoD1 Deoxyribose‑phosphate aldolase 2/Purine nucleoside phosphorylase DeoD‑type 1
* ? USA300TCH1516_ALE 2256396 =75 (0.760)17 (0.210) 8/132 NT 20.7% intergenic (+49/+72) deoD1/dps Purine nucleoside phosphorylase DeoD‑type 1/General stress protein 20U
?USA300TCH1516_ALE 2256443 = 68 (0.840)intergenic (+96/+25) deoD1/dps Purine nucleoside phosphorylase DeoD‑type 1/General stress protein 20U
* ? USA300TCH1516_ALE = 225640967 (0.680)7 (0.090) 5/132 NT 10.2% intergenic (+62/+59) deoD1/dps Purine nucleoside phosphorylase DeoD‑type 1/General stress protein 20U
?USA300TCH1516_ALE = 2256428 68 (0.840)intergenic (+81/+40) deoD1/dps Purine nucleoside phosphorylase DeoD‑type 1/General stress protein 20U
* ? USA300TCH1516_ALE 2259385 =88 (0.890)20 (0.230) 9/140 NT 21.4% intergenic (‑30/+642) USA300HOU_RS11560/USA300HOU_RS11565 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 2259420 = 70 (0.810)intergenic (‑65/+607) USA300HOU_RS11560/USA300HOU_RS11565 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 2264711113 (1.150)6 (0.070) 4/138 NT 5.1% coding (666/1092 nt) USA300HOU_RS11590 hypothetical protein
?USA300TCH1516_ALE = 2264731 125 (1.470)coding (686/1092 nt) USA300HOU_RS11590 hypothetical protein
* ? USA300TCH1516_ALE 2288634 =114 (1.160)8 (0.090) 4/138 NT 8.6% coding (45/933 nt) cdaR CdaA regulatory protein CdaR
?USA300TCH1516_ALE 2288701 = 72 (0.850)coding (789/810 nt) cdaA Cyclic di‑AMP synthase CdaA
* ? USA300TCH1516_ALE 2306983 =83 (0.840)4 (0.050) 4/144 NT 5.4% coding (654/1371 nt) USA300HOU_RS11770 hypothetical protein
?USA300TCH1516_ALE 2307053 = 65 (0.730)coding (584/1371 nt) USA300HOU_RS11770 hypothetical protein
* ? USA300TCH1516_ALE 2315068 =89 (0.910)7 (0.080) 5/150 NT 8.4% coding (202/1194 nt) ndhE NAD(P)H‑quinone oxidoreductase subunit 4L, chloroplastic
?USA300TCH1516_ALE 2315102 = 69 (0.750)coding (168/1194 nt) ndhE NAD(P)H‑quinone oxidoreductase subunit 4L, chloroplastic
* ? USA300TCH1516_ALE = 233122576 (0.770)7 (0.080) 4/148 NT 8.1% coding (694/933 nt) lacC_2 Tagatose‑6‑phosphate kinase
?USA300TCH1516_ALE = 2331255 88 (0.970)coding (664/933 nt) lacC_2 Tagatose‑6‑phosphate kinase
* ? USA300TCH1516_ALE 2333009 =100 (1.020)6 (0.070) 4/136 NT 7.0% intergenic (‑119/+249) lacA/lacR Galactose‑6‑phosphate isomerase subunit LacA/Lactose phosphotransferase system repressor
?USA300TCH1516_ALE 2333060 = 74 (0.890)intergenic (‑170/+198) lacA/lacR Galactose‑6‑phosphate isomerase subunit LacA/Lactose phosphotransferase system repressor
* ? USA300TCH1516_ALE = 2341657112 (1.140)9 (0.100) 4/146 NT 8.4% intergenic (‑78/+133) mepM_2/USA300HOU_RS11950 Murein DD‑endopeptidase MepM/putative hydrolase
?USA300TCH1516_ALE = 2341714 95 (1.060)intergenic (‑135/+76) mepM_2/USA300HOU_RS11950 Murein DD‑endopeptidase MepM/putative hydrolase
* ? USA300TCH1516_ALE 2357381 =63 (0.640)8 (0.090) 6/140 NT 11.0% intergenic (‑331/+207) ecfA1/rplQ Energy‑coupling factor transporter ATP‑binding protein EcfA1/50S ribosomal protein L17
?USA300TCH1516_ALE 2357417 = 74 (0.860)intergenic (‑367/+171) ecfA1/rplQ Energy‑coupling factor transporter ATP‑binding protein EcfA1/50S ribosomal protein L17
* ? USA300TCH1516_ALE = 235739064 (0.650)12 (0.140) 8/140 NT 15.6% intergenic (‑340/+198) ecfA1/rplQ Energy‑coupling factor transporter ATP‑binding protein EcfA1/50S ribosomal protein L17
?USA300TCH1516_ALE = 2357406 74 (0.860)intergenic (‑356/+182) ecfA1/rplQ Energy‑coupling factor transporter ATP‑binding protein EcfA1/50S ribosomal protein L17
* ? USA300TCH1516_ALE = 236821873 (0.740)7 (0.080) 6/146 NT 9.3% coding (123/354 nt) rplV 50S ribosomal protein L22
?USA300TCH1516_ALE = 2368244 70 (0.780)coding (97/354 nt) rplV 50S ribosomal protein L22
* ? USA300TCH1516_ALE 2368663 =52 (0.530)11 (0.120) 7/148 NT 17.3% intergenic (‑16/+51) rpsS/rplB 30S ribosomal protein S19/50S ribosomal protein L2
?USA300TCH1516_ALE 2368705 = 57 (0.630)intergenic (‑58/+9) rpsS/rplB 30S ribosomal protein S19/50S ribosomal protein L2
* ? USA300TCH1516_ALE = 2375690104 (1.060)7 (0.080) 5/146 NT 6.7% coding (334/2136 nt) topB DNA topoisomerase 3
?USA300TCH1516_ALE = 2375715 101 (1.130)coding (309/2136 nt) topB DNA topoisomerase 3
* ? USA300TCH1516_ALE 2378458 =84 (0.850)14 (0.150) 8/152 NT 14.5% intergenic (+317/+102) glcU_2/USA300HOU_RS12220 putative glucose uptake protein GlcU/hypothetical protein
?USA300TCH1516_ALE 2378519 = 85 (0.910)intergenic (+378/+41) glcU_2/USA300HOU_RS12220 putative glucose uptake protein GlcU/hypothetical protein
* ? USA300TCH1516_ALE = 2380474114 (1.160)14 (0.170) 8/132 NT 12.5% intergenic (+147/+40) USA300HOU_RS12230/swrC hypothetical protein/Swarming motility protein SwrC
?USA300TCH1516_ALE = 2380492 102 (1.260)intergenic (+165/+22) USA300HOU_RS12230/swrC hypothetical protein/Swarming motility protein SwrC
* ? USA300TCH1516_ALE = 238829976 (0.770)11 (0.140) 6/126 NT 13.5% intergenic (+34/+68) ribZ_1/sarV Riboflavin transporter RibZ/HTH‑type transcriptional regulator SarV
?USA300TCH1516_ALE = 2388344 81 (1.050)intergenic (+79/+23) ribZ_1/sarV Riboflavin transporter RibZ/HTH‑type transcriptional regulator SarV
* ? USA300TCH1516_ALE 2399023 =88 (0.890)14 (0.170) 12/134 NT 19.0% intergenic (+97/+75) fdhD/USA300HOU_RS12350 Sulfurtransferase FdhD/hypothetical protein
?USA300TCH1516_ALE 2399070 = 46 (0.560)intergenic (+144/+28) fdhD/USA300HOU_RS12350 Sulfurtransferase FdhD/hypothetical protein
* ? USA300TCH1516_ALE 2429428 =84 (0.850)5 (0.050) 5/152 NT 5.4% coding (219/948 nt) lytR_2 Transcriptional regulator LytR
?USA300TCH1516_ALE 2429460 = 94 (1.010)coding (187/948 nt) lytR_2 Transcriptional regulator LytR
* ? USA300TCH1516_ALE = 2434877113 (1.150)7 (0.080) 6/140 NT 6.5% intergenic (+145/+242) ybbH_3/yifK putative HTH‑type transcriptional regulator YbbH/putative transport protein YifK
?USA300TCH1516_ALE = 2434908 101 (1.170)intergenic (+176/+211) ybbH_3/yifK putative HTH‑type transcriptional regulator YbbH/putative transport protein YifK
* ? USA300TCH1516_ALE 2440041 =55 (0.560)7 (0.080) 6/136 NT 13.5% intergenic (+2/+64) USA300HOU_RS12570/malP hypothetical protein/PTS system maltose‑specific EIICB component
?USA300TCH1516_ALE 2440099 = 43 (0.510)intergenic (+60/+6) USA300HOU_RS12570/malP hypothetical protein/PTS system maltose‑specific EIICB component
* ? USA300TCH1516_ALE = 244005254 (0.550)9 (0.110) 7/136 NT 16.8% intergenic (+13/+53) USA300HOU_RS12570/malP hypothetical protein/PTS system maltose‑specific EIICB component
?USA300TCH1516_ALE = 2440086 43 (0.510)intergenic (+47/+19) USA300HOU_RS12570/malP hypothetical protein/PTS system maltose‑specific EIICB component
* ? USA300TCH1516_ALE 2442806 =67 (0.680)6 (0.080) 6/128 NT 9.0% intergenic (+3/+55) glvR/USA300HOU_RS12585 HTH‑type transcriptional regulator GlvR/hypothetical protein
?USA300TCH1516_ALE 2442855 = 67 (0.850)intergenic (+52/+6) glvR/USA300HOU_RS12585 HTH‑type transcriptional regulator GlvR/hypothetical protein
* ? USA300TCH1516_ALE = 244282178 (0.790)9 (0.110) 7/128 NT 12.2% intergenic (+18/+40) glvR/USA300HOU_RS12585 HTH‑type transcriptional regulator GlvR/hypothetical protein
?USA300TCH1516_ALE = 2442838 67 (0.850)intergenic (+35/+23) glvR/USA300HOU_RS12585 HTH‑type transcriptional regulator GlvR/hypothetical protein
* ? USA300TCH1516_ALE = 245576058 (0.590)6 (0.070) 6/132 NT 9.0% intergenic (+18/+48) lyrA/rpiA Lysostaphin resistance protein A/Ribose‑5‑phosphate isomerase A
?USA300TCH1516_ALE = 2455780 73 (0.900)intergenic (+38/+28) lyrA/rpiA Lysostaphin resistance protein A/Ribose‑5‑phosphate isomerase A
* ? USA300TCH1516_ALE 2461467 =117 (1.190)12 (0.130) 9/146 NT 10.2% intergenic (‑193/+38) natA_2/yhaI ABC transporter ATP‑binding protein NatA/Inner membrane protein YhaI
?USA300TCH1516_ALE 2461499 = 104 (1.160)intergenic (‑225/+6) natA_2/yhaI ABC transporter ATP‑binding protein NatA/Inner membrane protein YhaI
* ? USA300TCH1516_ALE = 247507692 (0.940)5 (0.060) 4/142 NT 5.7% coding (1180/1383 nt) tcaA Membrane‑associated protein TcaA
?USA300TCH1516_ALE = 2475098 84 (0.960)coding (1158/1383 nt) tcaA Membrane‑associated protein TcaA
* ? USA300TCH1516_ALE = 247645377 (0.780)9 (0.110) 6/136 NT 10.7% intergenic (‑198/+42) tcaA/tcaR Membrane‑associated protein TcaA/HTH‑type transcriptional regulator TcaR
?USA300TCH1516_ALE = 2476476 85 (1.020)intergenic (‑221/+19) tcaA/tcaR Membrane‑associated protein TcaA/HTH‑type transcriptional regulator TcaR
* ? USA300TCH1516_ALE 2489730 =134 (1.360)13 (0.160) 9/136 NT 11.9% intergenic (+79/+74) tarF_2/USA300HOU_RS12815 Teichoic acid glycerol‑phosphate transferase/putative lipoprotein
?USA300TCH1516_ALE 2489772 = 78 (0.930)intergenic (+121/+32) tarF_2/USA300HOU_RS12815 Teichoic acid glycerol‑phosphate transferase/putative lipoprotein
* ? USA300TCH1516_ALE 2494136 =83 (0.840)10 (0.110) 5/150 NT 10.9% intergenic (‑162/+70) USA300HOU_RS12835/USA300HOU_RS12845 Ferredoxin‑‑NADP reductase/hypothetical protein
?USA300TCH1516_ALE 2494184 = 86 (0.930)intergenic (‑210/+22) USA300HOU_RS12835/USA300HOU_RS12845 Ferredoxin‑‑NADP reductase/hypothetical protein
* ? USA300TCH1516_ALE 2494782 =89 (0.910)8 (0.090) 7/138 NT 9.8% intergenic (‑145/+62) USA300HOU_RS12845/mnmC_2 hypothetical protein/tRNA 5‑methylaminomethyl‑2‑thiouridine biosynthesis bifunctional protein MnmC
?USA300TCH1516_ALE 2494828 = 70 (0.830)intergenic (‑191/+16) USA300HOU_RS12845/mnmC_2 hypothetical protein/tRNA 5‑methylaminomethyl‑2‑thiouridine biosynthesis bifunctional protein MnmC
* ? USA300TCH1516_ALE = 249479282 (0.830)6 (0.070) 4/138 NT 7.9% intergenic (‑155/+52) USA300HOU_RS12845/mnmC_2 hypothetical protein/tRNA 5‑methylaminomethyl‑2‑thiouridine biosynthesis bifunctional protein MnmC
?USA300TCH1516_ALE = 2494816 70 (0.830)intergenic (‑179/+28) USA300HOU_RS12845/mnmC_2 hypothetical protein/tRNA 5‑methylaminomethyl‑2‑thiouridine biosynthesis bifunctional protein MnmC
* ? USA300TCH1516_ALE 2497326 =131 (1.330)7 (0.080) 5/140 NT 6.1% coding (376/945 nt) USA300HOU_RS12865 hypothetical protein
?USA300TCH1516_ALE 2497363 = 102 (1.190)coding (413/945 nt) USA300HOU_RS12865 hypothetical protein
* ? USA300TCH1516_ALE 2497906 =132 (1.340)6 (0.070) 5/138 NT 6.7% intergenic (+11/+75) USA300HOU_RS12865/treP_2 hypothetical protein/PTS system trehalose‑specific EIIBC component
?USA300TCH1516_ALE 2497975 = 54 (0.640)intergenic (+80/+6) USA300HOU_RS12865/treP_2 hypothetical protein/PTS system trehalose‑specific EIIBC component
* ? USA300TCH1516_ALE = 250551890 (0.920)7 (0.080) 5/144 NT 7.8% coding (860/1278 nt) gltT Proton/sodium‑glutamate symport protein
?USA300TCH1516_ALE = 2505555 84 (0.950)coding (823/1278 nt) gltT Proton/sodium‑glutamate symport protein
* ? USA300TCH1516_ALE = 252088081 (0.820)5 (0.050) 5/150 NT 6.1% intergenic (‑249/+60) narG/nasF Respiratory nitrate reductase 1 alpha chain/Uroporphyrinogen‑III C‑methyltransferase
?USA300TCH1516_ALE = 2520911 77 (0.840)intergenic (‑280/+29) narG/nasF Respiratory nitrate reductase 1 alpha chain/Uroporphyrinogen‑III C‑methyltransferase
* ? USA300TCH1516_ALE = 252558973 (0.740)8 (0.100) 7/130 NT 10.2% intergenic (‑161/+69) sirB/ytmI Sirohydrochlorin ferrochelatase/putative N‑acetyltransferase YtmI
?USA300TCH1516_ALE = 2525624 82 (1.030)intergenic (‑196/+34) sirB/ytmI Sirohydrochlorin ferrochelatase/putative N‑acetyltransferase YtmI
* ? USA300TCH1516_ALE 2533537 =78 (0.790)9 (0.100) 6/142 NT 11.4% intergenic (+33/+64) femA_3/tcyC_2 Aminoacyltransferase FemA/L‑cystine import ATP‑binding protein TcyC
?USA300TCH1516_ALE 2533595 = 70 (0.800)intergenic (+91/+6) femA_3/tcyC_2 Aminoacyltransferase FemA/L‑cystine import ATP‑binding protein TcyC
* ? USA300TCH1516_ALE = 253354583 (0.840)10 (0.110) 6/142 NT 12.2% intergenic (+41/+56) femA_3/tcyC_2 Aminoacyltransferase FemA/L‑cystine import ATP‑binding protein TcyC
?USA300TCH1516_ALE = 2533585 70 (0.800)intergenic (+81/+16) femA_3/tcyC_2 Aminoacyltransferase FemA/L‑cystine import ATP‑binding protein TcyC
* ? USA300TCH1516_ALE = 253455372 (0.730)5 (0.050) 4/150 NT 6.9% coding (505/729 nt) tcyB L‑cystine transport system permease protein TcyB
?USA300TCH1516_ALE = 2534570 67 (0.730)coding (488/729 nt) tcyB L‑cystine transport system permease protein TcyB
* ? USA300TCH1516_ALE 2537754 =96 (0.980)10 (0.120) 8/138 NT 12.1% intergenic (+108/+46) USA300TCH1516_02423/gpmA_2 hypothetical protein/2,3‑bisphosphoglycerate‑dependent phosphoglycerate mutase
?USA300TCH1516_ALE 2537797 = 62 (0.730)intergenic (+151/+3) USA300TCH1516_02423/gpmA_2 hypothetical protein/2,3‑bisphosphoglycerate‑dependent phosphoglycerate mutase
* ? USA300TCH1516_ALE 2561162 =86 (0.870)6 (0.070) 4/146 NT 7.7% coding (648/657 nt) USA300HOU_RS13195 hypothetical protein
?USA300TCH1516_ALE 2561195 = 66 (0.740)intergenic (+24/+39) USA300HOU_RS13195/cpdA hypothetical protein/3',5'‑cyclic adenosine monophosphate phosphodiesterase CpdA
* ? USA300TCH1516_ALE 2569653 =103 (1.050)5 (0.060) 5/142 NT 6.1% intergenic (+5/+87) pbpX_2/USA300HOU_RS13235 Putative penicillin‑binding protein PbpX/UDP‑glucose 4‑epimerase
?USA300TCH1516_ALE 2569712 = 63 (0.720)intergenic (+64/+28) pbpX_2/USA300HOU_RS13235 Putative penicillin‑binding protein PbpX/UDP‑glucose 4‑epimerase
* ? USA300TCH1516_ALE 2573677 =93 (0.950)13 (0.150) 8/138 NT 14.7% intergenic (‑203/+91) norB_5/opuCD Quinolone resistance protein NorB/Carnitine transport permease protein OpuCD
?USA300TCH1516_ALE 2573715 = 71 (0.840)intergenic (‑241/+53) norB_5/opuCD Quinolone resistance protein NorB/Carnitine transport permease protein OpuCD
* ? USA300TCH1516_ALE 2580412 =107 (1.090)11 (0.130) 7/142 NT 11.5% intergenic (+47/‑561) yveA/pnbA Aspartate‑proton symporter/Para‑nitrobenzyl esterase
?USA300TCH1516_ALE 2580445 = 74 (0.850)intergenic (+80/‑528) yveA/pnbA Aspartate‑proton symporter/Para‑nitrobenzyl esterase
* ? USA300TCH1516_ALE 2580666 =87 (0.880)8 (0.090) 4/140 NT 10.4% intergenic (+301/‑307) yveA/pnbA Aspartate‑proton symporter/Para‑nitrobenzyl esterase
?USA300TCH1516_ALE 2580701 = 62 (0.720)intergenic (+336/‑272) yveA/pnbA Aspartate‑proton symporter/Para‑nitrobenzyl esterase
* ? USA300TCH1516_ALE = 2588442128 (1.300)13 (0.150) 7/142 NT 11.2% intergenic (+25/+143) yehR/gltB_2 putative lipoprotein YehR/Glutamate synthase [NADPH] large chain
?USA300TCH1516_ALE = 2588473 92 (1.050)intergenic (+56/+112) yehR/gltB_2 putative lipoprotein YehR/Glutamate synthase [NADPH] large chain
* ? USA300TCH1516_ALE 2591898 =89 (0.910)6 (0.070) 5/144 NT 7.4% coding (626/1194 nt) ttuB Putative tartrate transporter
?USA300TCH1516_ALE 2591947 = 69 (0.780)coding (577/1194 nt) ttuB Putative tartrate transporter
* ? USA300TCH1516_ALE 2595468 =97 (0.990)9 (0.100) 6/150 NT 9.3% coding (423/936 nt) nikB_3 Nickel transport system permease protein NikB
?USA300TCH1516_ALE 2595506 = 85 (0.920)coding (385/936 nt) nikB_3 Nickel transport system permease protein NikB
* ? USA300TCH1516_ALE = 260565499 (1.010)8 (0.090) 10/146 NT 7.6% intergenic (‑448/+4) ahpD/USA300HOU_RS13415 Alkyl hydroperoxide reductase AhpD/hypothetical protein
?USA300TCH1516_ALE = 2605665 103 (1.150)coding (413/420 nt) USA300HOU_RS13415 hypothetical protein
* ? USA300TCH1516_ALE 2609395 =79 (0.800)6 (0.070) 5/136 NT 9.1% intergenic (‑225/+336) USA300HOU_RS13450/USA300HOU_RS13455 hypothetical protein/putative lipoprotein
?USA300TCH1516_ALE 2609451 = 53 (0.630)intergenic (‑281/+280) USA300HOU_RS13450/USA300HOU_RS13455 hypothetical protein/putative lipoprotein
* ? USA300TCH1516_ALE = 260940671 (0.720)13 (0.160) 8/136 NT 18.7% intergenic (‑236/+325) USA300HOU_RS13450/USA300HOU_RS13455 hypothetical protein/putative lipoprotein
?USA300TCH1516_ALE = 2609438 53 (0.630)intergenic (‑268/+293) USA300HOU_RS13450/USA300HOU_RS13455 hypothetical protein/putative lipoprotein
* ? USA300TCH1516_ALE = 261089896 (0.980)5 (0.060) 4/144 NT 5.4% intergenic (‑373/+163) USA300HOU_RS13455/USA300HOU_RS13460 putative lipoprotein/hypothetical protein
?USA300TCH1516_ALE = 2610913 90 (1.020)intergenic (‑388/+148) USA300HOU_RS13455/USA300HOU_RS13460 putative lipoprotein/hypothetical protein
* ? USA300TCH1516_ALE = 263327378 (0.790)11 (0.110)
+GC		 6/156 NT 13.6% coding (2675/3057 nt) fnbA_2 Fibronectin‑binding protein A
?USA300TCH1516_ALE = 2633349 65 (0.660)coding (2599/3057 nt) fnbA_2 Fibronectin‑binding protein A
* ? USA300TCH1516_ALE 2636356 =100 (1.020)5 (0.060) 5/138 NT 6.5% intergenic (‑409/+60) fnbA_2/gntT Fibronectin‑binding protein A/High‑affinity gluconate transporter
?USA300TCH1516_ALE 2636404 = 58 (0.680)intergenic (‑457/+12) fnbA_2/gntT Fibronectin‑binding protein A/High‑affinity gluconate transporter
* ? USA300TCH1516_ALE 2646370 =107 (1.090)10 (0.110) 6/148 NT 9.9% intergenic (‑83/‑464) sauU/USA300HOU_RS13610 putative sulfoacetate transporter SauU/putative membrane protein
?USA300TCH1516_ALE 2646396 = 83 (0.910)intergenic (‑109/‑438) sauU/USA300HOU_RS13610 putative sulfoacetate transporter SauU/putative membrane protein
* ? USA300TCH1516_ALE = 264750772 (0.730)17 (0.220) 10/124 NT 21.5% intergenic (+62/+35) USA300HOU_RS13610/ydhC putative membrane protein/Inner membrane transport protein YdhC
?USA300TCH1516_ALE = 2647518 68 (0.890)intergenic (+73/+24) USA300HOU_RS13610/ydhC putative membrane protein/Inner membrane transport protein YdhC
* ? USA300TCH1516_ALE 2661788 =66 (0.670)16 (0.200) 12/128 NT 22.3% intergenic (‑181/‑140) ybiV/yydI Sugar phosphatase YbiV/putative peptide export ATP‑binding protein YydI
?USA300TCH1516_ALE 2661832 = 59 (0.750)intergenic (‑225/‑96) ybiV/yydI Sugar phosphatase YbiV/putative peptide export ATP‑binding protein YydI
* ? USA300TCH1516_ALE = 266180367 (0.680)7 (0.090) 6/128 NT 11.1% intergenic (‑196/‑125) ybiV/yydI Sugar phosphatase YbiV/putative peptide export ATP‑binding protein YydI
?USA300TCH1516_ALE = 2661815 59 (0.750)intergenic (‑208/‑113) ybiV/yydI Sugar phosphatase YbiV/putative peptide export ATP‑binding protein YydI
* ? USA300TCH1516_ALE 2665481 =76 (0.770)7 (0.080) 6/138 NT 10.1% intergenic (‑108/+71) USA300TCH1516_02535/sdhA hypothetical protein/L‑serine dehydratase, alpha chain
?USA300TCH1516_ALE 2665525 = 59 (0.700)intergenic (‑152/+27) USA300TCH1516_02535/sdhA hypothetical protein/L‑serine dehydratase, alpha chain
* ? USA300TCH1516_ALE 2674533 =95 (0.970)14 (0.160) 6/140 NT 16.2% intergenic (‑45/+256) glcB/ydaP PTS system glucoside‑specific EIICBA component/Putative thiamine pyrophosphate‑containing protein YdaP
?USA300TCH1516_ALE 2674588 = 62 (0.720)intergenic (‑100/+201) glcB/ydaP PTS system glucoside‑specific EIICBA component/Putative thiamine pyrophosphate‑containing protein YdaP
* ? USA300TCH1516_ALE 2679952 =120 (1.220)6 (0.080) 4/130 NT 6.9% intergenic (+4/+756) ssaA2_4/USA300HOU_RS13810 Staphylococcal secretory antigen ssaA2/hypothetical protein
?USA300TCH1516_ALE 2680007 = 64 (0.800)intergenic (+59/+701) ssaA2_4/USA300HOU_RS13810 Staphylococcal secretory antigen ssaA2/hypothetical protein
* ? USA300TCH1516_ALE 2679952 =120 (1.220)6 (0.080) 4/130 NT 6.2% intergenic (+4/+756) ssaA2_4/USA300HOU_RS13810 Staphylococcal secretory antigen ssaA2/hypothetical protein
?USA300TCH1516_ALE 2681465 = 84 (1.050)intergenic (‑500/+79) USA300HOU_RS13810/mvaA hypothetical protein/3‑hydroxy‑3‑methylglutaryl‑coenzyme A reductase
* ? USA300TCH1516_ALE = 268142488 (0.890)8 (0.100) 6/130 NT 9.3% intergenic (‑459/+120) USA300HOU_RS13810/mvaA hypothetical protein/3‑hydroxy‑3‑methylglutaryl‑coenzyme A reductase
?USA300TCH1516_ALE = 2681449 84 (1.050)intergenic (‑484/+95) USA300HOU_RS13810/mvaA hypothetical protein/3‑hydroxy‑3‑methylglutaryl‑coenzyme A reductase
* ? USA300TCH1516_ALE 2687471 =83 (0.840)14 (0.170) 6/138 NT 19.8% intergenic (+25/+44) clpL/USA300HOU_RS13835 ATP‑dependent Clp protease ATP‑binding subunit ClpL/hypothetical protein
?USA300TCH1516_ALE 2687511 = 42 (0.500)intergenic (+65/+4) clpL/USA300HOU_RS13835 ATP‑dependent Clp protease ATP‑binding subunit ClpL/hypothetical protein
* ? USA300TCH1516_ALE = 269337985 (0.860)14 (0.170) 8/136 NT 16.0% intergenic (+50/+306) mtrR/rocA HTH‑type transcriptional regulator MtrR/1‑pyrroline‑5‑carboxylate dehydrogenase
?USA300TCH1516_ALE = 2693404 75 (0.900)intergenic (+75/+281) mtrR/rocA HTH‑type transcriptional regulator MtrR/1‑pyrroline‑5‑carboxylate dehydrogenase
* ? USA300TCH1516_ALE 2699622 =66 (0.670)7 (0.080) 5/140 NT 11.9% intergenic (+29/+61) copZ/ldhD_2 Copper chaperone CopZ/D‑lactate dehydrogenase
?USA300TCH1516_ALE 2699690 = 46 (0.530)coding (992/999 nt) ldhD_2 D‑lactate dehydrogenase
* ? USA300TCH1516_ALE 2704632 =86 (0.870)7 (0.080) 4/142 NT 8.5% coding (37/864 nt) crtM Dehydrosqualene synthase
?USA300TCH1516_ALE 2704670 = 75 (0.860)intergenic (‑2/+35) crtM/crtQ Dehydrosqualene synthase/4,4'‑diaponeurosporenoate glycosyltransferase
* ? USA300TCH1516_ALE 2716742 =97 (0.990)7 (0.080) 4/138 NT 8.8% intergenic (+50/+100) USA300HOU_RS13965/USA300HOU_RS13970 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 2716816 = 62 (0.730)intergenic (+124/+26) USA300HOU_RS13965/USA300HOU_RS13970 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 273682347 (0.480)6 (0.070) 5/138 NT 12.6% intergenic (+27/+59) USA300HOU_RS14090/aldC_2 Putative 2‑dehydropantoate 2‑reductase/Alpha‑acetolactate decarboxylase
?USA300TCH1516_ALE = 2736858 43 (0.510)intergenic (+62/+24) USA300HOU_RS14090/aldC_2 Putative 2‑dehydropantoate 2‑reductase/Alpha‑acetolactate decarboxylase
* ? USA300TCH1516_ALE 2761242 =78 (0.790)5 (0.060) 4/144 NT 7.3% intergenic (‑244/+249) citN/sirC Citrate transporter/Precorrin‑2 dehydrogenase
?USA300TCH1516_ALE 2761289 = 57 (0.640)intergenic (‑291/+202) citN/sirC Citrate transporter/Precorrin‑2 dehydrogenase
* ? USA300TCH1516_ALE = 276124968 (0.690)8 (0.090) 5/144 NT 11.9% intergenic (‑251/+242) citN/sirC Citrate transporter/Precorrin‑2 dehydrogenase
?USA300TCH1516_ALE = 2761280 57 (0.640)intergenic (‑282/+211) citN/sirC Citrate transporter/Precorrin‑2 dehydrogenase
* ? USA300TCH1516_ALE 2772633 =105 (1.070)17 (0.210) 7/134 NT 20.0% intergenic (+7/+53) phoB/USA300TCH1516_02632 Alkaline phosphatase 3/hypothetical protein
?USA300TCH1516_ALE 2772676 = 48 (0.580)intergenic (+50/+10) phoB/USA300TCH1516_02632 Alkaline phosphatase 3/hypothetical protein
* ? USA300TCH1516_ALE 2778362 =78 (0.790)6 (0.070) 5/142 NT 7.5% coding (918/942 nt) arcC2 Carbamate kinase 2
?USA300TCH1516_ALE 2778404 = 79 (0.910)coding (876/942 nt) arcC2 Carbamate kinase 2
* ? USA300TCH1516_ALE 2787502 =90 (0.920)13 (0.150) 9/142 NT 14.5% intergenic (+48/‑192) zipA_3/manR_2 Cell division protein ZipA/Transcriptional regulator ManR
?USA300TCH1516_ALE 2787547 = 74 (0.850)intergenic (+93/‑147) zipA_3/manR_2 Cell division protein ZipA/Transcriptional regulator ManR
* ? USA300TCH1516_ALE = 278751093 (0.950)7 (0.080) 6/142 NT 8.2% intergenic (+56/‑184) zipA_3/manR_2 Cell division protein ZipA/Transcriptional regulator ManR
?USA300TCH1516_ALE = 2787537 74 (0.850)intergenic (+83/‑157) zipA_3/manR_2 Cell division protein ZipA/Transcriptional regulator ManR
* ? USA300TCH1516_ALE 2793464 =115 (1.170)5 (0.060) 4/140 NT 5.1% coding (2179/2982 nt) yueB ESX secretion system protein YueB
?USA300TCH1516_ALE 2793513 = 86 (1.000)coding (2130/2982 nt) yueB ESX secretion system protein YueB
* ? USA300TCH1516_ALE = 283020093 (0.950)8 (0.090) 5/138 NT 8.9% intergenic (+28/+419) icaC/lipA_2 putative poly‑beta‑1,6‑N‑acetyl‑D‑glucosamine export protein/Lipase 1
?USA300TCH1516_ALE = 2830235 83 (0.980)intergenic (+63/+384) icaC/lipA_2 putative poly‑beta‑1,6‑N‑acetyl‑D‑glucosamine export protein/Lipase 1
* ? USA300TCH1516_ALE = 283073895 (0.970)6 (0.070) 4/144 NT 6.0% coding (1927/2046 nt) lipA_2 Lipase 1
?USA300TCH1516_ALE = 2830760 101 (1.140)coding (1905/2046 nt) lipA_2 Lipase 1
* ? USA300TCH1516_ALE 2833267 =81 (0.820)8 (0.090) 5/148 NT 9.5% intergenic (‑603/+487) lipA_2/hisI Lipase 1/Phosphoribosyl‑AMP cyclohydrolase
?USA300TCH1516_ALE 2833307 = 78 (0.860)intergenic (‑643/+447) lipA_2/hisI Lipase 1/Phosphoribosyl‑AMP cyclohydrolase
* ? USA300TCH1516_ALE 2847730 =69 (0.700)21 (0.260) 10/132 NT 28.8% intergenic (+39/+110) yceI/USA300HOU_RS14590 Protein YceI/Lactonase drp35
?USA300TCH1516_ALE 2847769 = 47 (0.580)intergenic (+78/+71) yceI/USA300HOU_RS14590 Protein YceI/Lactonase drp35
* ? USA300TCH1516_ALE 2850817 =79 (0.800)18 (0.220) 10/132 NT 22.3% intergenic (+16/+103) pcp/USA300HOU_RS14605 Pyrrolidone‑carboxylate peptidase/hypothetical protein
?USA300TCH1516_ALE 2850866 = 60 (0.740)intergenic (+65/+54) pcp/USA300HOU_RS14605 Pyrrolidone‑carboxylate peptidase/hypothetical protein
* ? USA300TCH1516_ALE = 285083070 (0.710)6 (0.070) 4/132 NT 9.2% intergenic (+29/+90) pcp/USA300HOU_RS14605 Pyrrolidone‑carboxylate peptidase/hypothetical protein
?USA300TCH1516_ALE = 2850851 60 (0.740)intergenic (+50/+69) pcp/USA300HOU_RS14605 Pyrrolidone‑carboxylate peptidase/hypothetical protein
* ? USA300TCH1516_ALE = 2863074116 (1.180)9 (0.100) 6/150 NT 7.6% intergenic (+44/+16) USA300TCH1516_02707/USA300HOU_RS14670 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 2864026 NA (NA)intergenic (‑439/‑19) USA300HOU_RS14670/USA300HOU_RS14675 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 286699566 (0.670)14 (0.170) 10/134 NT 18.9% intergenic (‑394/+59) USA300HOU_RS14695/noc_2 hypothetical protein/Nucleoid occlusion protein
?USA300TCH1516_ALE = 2867006 65 (0.790)intergenic (‑405/+48) USA300HOU_RS14695/noc_2 hypothetical protein/Nucleoid occlusion protein