![]() |
breseq version 0.33.1 revision 8505477f25b3
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Predicted mutations | |||||||
|---|---|---|---|---|---|---|---|
| evidence | seq id | position | mutation | freq | annotation | gene | description |
| RA | CP000731 | 81 | N→G | 100% | intergenic (–/‑151) | – / → repA | –/replication protein A |
| RA | CP000731 | 5,779 | C→T | 11.0% | intergenic (+296/‑1192) | cadX → / → USA300HOU_pUSA300HOUMR0010 | cadmium efflux regulator/MarR family transcriptional regulator |
| RA | CP000731 | 5,784 | A→G | 10.7% | intergenic (+301/‑1187) | cadX → / → USA300HOU_pUSA300HOUMR0010 | cadmium efflux regulator/MarR family transcriptional regulator |
| JC | CP000731 | 6,552 | +28 bp | 100% | intergenic (+1069/‑419) | cadX → / → USA300HOU_pUSA300HOUMR0010 | cadmium efflux regulator/MarR family transcriptional regulator |
| RA | CP000731 | 12,012 | A→G | 12.0% | intergenic (+175/+48) | USA300HOU_pUSA300HOUMR0014 → / ← USA300HOU_pUSA300HOUMR0015 | recombinase/hypothetical protein |
| RA | CP000731 | 12,017 | C→T | 12.5% | intergenic (+180/+43) | USA300HOU_pUSA300HOUMR0014 → / ← USA300HOU_pUSA300HOUMR0015 | recombinase/hypothetical protein |
| RA | CP000731 | 25,663 | Δ1 bp | 100% | coding (316/333 nt) | USA300HOU_pUSA300HOUMR0031 → | hypothetical protein |
| RA | USA300TCH1516_ALE | 3,344 | A→T | 9.3% | intergenic (+28/‑362) | dnaN → / → USA300HOU_RS00015 | DNA polymerase III subunit beta/hypothetical protein |
| RA | USA300TCH1516_ALE | 9,710 | T→C | 19.1% | intergenic (+15/+72) | gyrA → / ← nnrD | DNA gyrase subunit A/ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase |
| RA | USA300TCH1516_ALE | 9,716 | T→C | 23.4% | intergenic (+21/+66) | gyrA → / ← nnrD | DNA gyrase subunit A/ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase |
| RA | USA300TCH1516_ALE | 9,719 | G→A | 22.7% | intergenic (+24/+63) | gyrA → / ← nnrD | DNA gyrase subunit A/ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase |
| RA | USA300TCH1516_ALE | 9,725 | G→A | 17.1% | intergenic (+30/+57) | gyrA → / ← nnrD | DNA gyrase subunit A/ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase |
| RA | USA300TCH1516_ALE | 24,137 | G→A | 7.2% | intergenic (+389/‑41) | purA → / → USA300TCH1516_00018 | Adenylosuccinate synthetase/tRNA‑Glu |
| RA | USA300TCH1516_ALE | 41,166 | G→A | 16.8% | intergenic (‑33/‑67) | pbp ← / → mecR1 | Beta‑lactam‑inducible penicillin‑binding protein/Methicillin resistance mecR1 protein |
| RA | USA300TCH1516_ALE | 41,171 | T→C | 14.1% | intergenic (‑38/‑62) | pbp ← / → mecR1 | Beta‑lactam‑inducible penicillin‑binding protein/Methicillin resistance mecR1 protein |
| RA | USA300TCH1516_ALE | 77,984 | T→C | 7.8% | intergenic (+93/‑334) | USA300HOU_RS00350 → / → USA300HOU_RS00355 | Monoacylglycerol lipase/hypothetical protein |
| RA | USA300TCH1516_ALE | 79,619 | T→A | 6.9% | intergenic (+228/‑32) | USA300HOU_RS00355 → / → cmoB | hypothetical protein/tRNA U34 carboxymethyltransferase |
| RA | USA300TCH1516_ALE | 99,276 | G→C | 14.7% | intergenic (+70/+2) | USA300HOU_RS00465 → / ← tetA_1 | hypothetical protein/Tetracycline resistance protein, class C |
| RA | USA300TCH1516_ALE | 110,660 | T→A | 8.3% | I173I (ATT→ATA) | USA300HOU_RS00515 → | putative lipoprotein |
| RA | USA300TCH1516_ALE | 111,512 | A→G | 25.0% | S194S (TCA→TCG) | USA300HOU_RS00520 → | putative lipoprotein |
| RA | USA300TCH1516_ALE | 111,516 | C→A | 24.8% | Q196K (CAA→AAA) | USA300HOU_RS00520 → | putative lipoprotein |
| RA | USA300TCH1516_ALE | 115,755 | T→A | 6.1% | intergenic (+22/‑129) | btr → / → yxeP_1 | HTH‑type transcriptional activator Btr/putative hydrolase YxeP |
| RA | USA300TCH1516_ALE | 115,758 | Δ1 bp | 6.1% | intergenic (+25/‑126) | btr → / → yxeP_1 | HTH‑type transcriptional activator Btr/putative hydrolase YxeP |
| RA | USA300TCH1516_ALE | 115,762:1 | +T | 6.1% | intergenic (+29/‑122) | btr → / → yxeP_1 | HTH‑type transcriptional activator Btr/putative hydrolase YxeP |
| RA | USA300TCH1516_ALE | 115,765 | T→A | 5.3% | intergenic (+32/‑119) | btr → / → yxeP_1 | HTH‑type transcriptional activator Btr/putative hydrolase YxeP |
| RA | USA300TCH1516_ALE | 168,350 | A→T | 14.6% | intergenic (+317/+31) | yfkN_1 → / ← USA300TCH1516_00148 | Trifunctional nucleotide phosphoesterase protein YfkN/hypothetical protein |
| RA | USA300TCH1516_ALE | 168,354 | C→G | 12.5% | intergenic (+321/+27) | yfkN_1 → / ← USA300TCH1516_00148 | Trifunctional nucleotide phosphoesterase protein YfkN/hypothetical protein |
| RA | USA300TCH1516_ALE | 168,358 | A→T | 7.7% | intergenic (+325/+23) | yfkN_1 → / ← USA300TCH1516_00148 | Trifunctional nucleotide phosphoesterase protein YfkN/hypothetical protein |
| RA | USA300TCH1516_ALE | 217,036 | T→A | 14.6% | intergenic (‑230/+23) | rocD2_1 ← / ← brnQ_1 | Ornithine aminotransferase 2/Branched‑chain amino acid transport system 2 carrier protein |
| RA | USA300TCH1516_ALE | 217,045 | A→C | 7.7% | intergenic (‑239/+14) | rocD2_1 ← / ← brnQ_1 | Ornithine aminotransferase 2/Branched‑chain amino acid transport system 2 carrier protein |
| RA | USA300TCH1516_ALE | 217,046 | C→T | 7.9% | intergenic (‑240/+13) | rocD2_1 ← / ← brnQ_1 | Ornithine aminotransferase 2/Branched‑chain amino acid transport system 2 carrier protein |
| RA | USA300TCH1516_ALE | 228,312 | T→C | 12.3% | intergenic (+158/+36) | ybbH_1 → / ← USA300TCH1516_00200 | putative HTH‑type transcriptional regulator YbbH/hypothetical protein |
| RA | USA300TCH1516_ALE | 228,316 | G→A | 11.3% | intergenic (+162/+32) | ybbH_1 → / ← USA300TCH1516_00200 | putative HTH‑type transcriptional regulator YbbH/hypothetical protein |
| RA | USA300TCH1516_ALE | 228,319 | T→C | 11.7% | intergenic (+165/+29) | ybbH_1 → / ← USA300TCH1516_00200 | putative HTH‑type transcriptional regulator YbbH/hypothetical protein |
| RA | USA300TCH1516_ALE | 253,973 | C→T | 5.8% | intergenic (+186/+176) | asbF → / ← USA300HOU_RS01125 | 3‑dehydroshikimate dehydratase/hypothetical protein |
| RA | USA300TCH1516_ALE | 253,983 | A→G | 9.5% | intergenic (+196/+166) | asbF → / ← USA300HOU_RS01125 | 3‑dehydroshikimate dehydratase/hypothetical protein |
| RA | USA300TCH1516_ALE | 253,984 | G→T | 9.5% | intergenic (+197/+165) | asbF → / ← USA300HOU_RS01125 | 3‑dehydroshikimate dehydratase/hypothetical protein |
| RA | USA300TCH1516_ALE | 253,991 | A→C | 6.9% | intergenic (+204/+158) | asbF → / ← USA300HOU_RS01125 | 3‑dehydroshikimate dehydratase/hypothetical protein |
| RA | USA300TCH1516_ALE | 253,992 | C→T | 7.2% | intergenic (+205/+157) | asbF → / ← USA300HOU_RS01125 | 3‑dehydroshikimate dehydratase/hypothetical protein |
| RA | USA300TCH1516_ALE | 290,156 | A→T | 7.1% | intergenic (+47/‑180) | gatB_1 → / → gatC_1 | PTS system galactitol‑specific EIIB component/PTS system galactitol‑specific EIIC component |
| RA | USA300TCH1516_ALE | 299,457 | G→T | 6.6% | *390L (TGA→TTA) | tarF_1 → | Teichoic acid glycerol‑phosphate transferase |
| RA | USA300TCH1516_ALE | 333,049 | G→C | 28.1% | A753P (GCA→CCA) | esaA → | ESAT‑6 secretion accessory factor EsaA |
| RA | USA300TCH1516_ALE | 341,450 | G→C | 10.2% | D134H (GAT→CAT) | USA300HOU_RS01525 → | hypothetical protein |
| RA | USA300TCH1516_ALE | 367,644 | G→T | 5.6% | intergenic (‑96/‑62) | nanA ← / → bglK | N‑acetylneuraminate lyase/Beta‑glucoside kinase |
| RA | USA300TCH1516_ALE | 372,106 | T→A | 7.2% | intergenic (‑166/‑204) | ylbJ ← / → lip2 | Sporulation integral membrane protein YlbJ/Lipase 2 |
| RA | USA300TCH1516_ALE | 401,399 | A→C | 7.0% | intergenic (‑184/‑57) | USA300HOU_RS01845 ← / → sutR | hypothetical protein/HTH‑type transcriptional regulator SutR |
| RA | USA300TCH1516_ALE | 401,404 | G→T | 9.1% | intergenic (‑189/‑52) | USA300HOU_RS01845 ← / → sutR | hypothetical protein/HTH‑type transcriptional regulator SutR |
| RA | USA300TCH1516_ALE | 410,464 | A→T | 5.2% | I522I (ATT→ATA) | yitJ ← | Bifunctional homocysteine S‑methyltransferase/5,10‑methylenetetrahydrofolate reductase |
| RA | USA300TCH1516_ALE | 418,825 | A→T | 7.2% | N53I (AAT→ATT) | rpsF → | 30S ribosomal protein S6 |
| RA | USA300TCH1516_ALE | 419,965 | A→T | 7.1% | intergenic (+183/+83) | rpsR → / ← USA300HOU_RS01950 | 30S ribosomal protein S18/hypothetical protein |
| RA | USA300TCH1516_ALE | 462,826 | T→A | 7.4% | intergenic (+85/+18) | USA300HOU_RS02185 → / ← USA300HOU_RS02190 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 482,712 | C→A | 38.9% | intergenic (+509/‑174) | USA300HOU_RS02285 → / → USA300HOU_RS02295 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 512,643 | A→G | 16.5% | intergenic (+711/‑6052) | recR → / → speA_2 | Recombination protein RecR/Arginine decarboxylase |
| RA | USA300TCH1516_ALE | 536,863 | T→A | 8.5% | intergenic (+56/‑255) | rplY → / → pth | 50S ribosomal protein L25/Peptidyl‑tRNA hydrolase |
| RA | USA300TCH1516_ALE | 536,868 | T→A | 9.9% | intergenic (+61/‑250) | rplY → / → pth | 50S ribosomal protein L25/Peptidyl‑tRNA hydrolase |
| RA | USA300TCH1516_ALE | 536,920 | T→A | 5.2% | intergenic (+113/‑198) | rplY → / → pth | 50S ribosomal protein L25/Peptidyl‑tRNA hydrolase |
| RA | USA300TCH1516_ALE | 536,926 | C→A | 5.1% | intergenic (+119/‑192) | rplY → / → pth | 50S ribosomal protein L25/Peptidyl‑tRNA hydrolase |
| RA | USA300TCH1516_ALE | 576,908 | Δ1 bp | 10.1% | intergenic (+331/‑59) | gltX → / → cysE | Glutamate‑‑tRNA ligase/Serine acetyltransferase |
| RA | USA300TCH1516_ALE | 576,915 | C→G | 9.7% | intergenic (+338/‑52) | gltX → / → cysE | Glutamate‑‑tRNA ligase/Serine acetyltransferase |
| RA | USA300TCH1516_ALE | 576,920:1 | +T | 5.9% | intergenic (+343/‑47) | gltX → / → cysE | Glutamate‑‑tRNA ligase/Serine acetyltransferase |
| RA | USA300TCH1516_ALE | 581,901 | G→C | 6.4% | V13L (GTG→CTG) | nusG_2 → | Transcription termination/antitermination protein NusG |
| RA | USA300TCH1516_ALE | 582,522 | C→G | 7.2% | intergenic (+109/‑72) | nusG_2 → / → rplK | Transcription termination/antitermination protein NusG/50S ribosomal protein L11 |
| RA | USA300TCH1516_ALE | 583,948 | A→T | 5.7% | intergenic (+32/‑240) | rplA → / → rplJ | 50S ribosomal protein L1/50S ribosomal protein L10 |
| RA | USA300TCH1516_ALE | 583,951 | A→T | 6.4% | intergenic (+35/‑237) | rplA → / → rplJ | 50S ribosomal protein L1/50S ribosomal protein L10 |
| RA | USA300TCH1516_ALE | 593,430 | T→A | 8.4% | intergenic (+22/‑115) | rpoC → / → rplGB | DNA‑directed RNA polymerase subunit beta'/Ribosome‑associated protein L7Ae‑like protein |
| RA | USA300TCH1516_ALE | 593,433 | T→A | 8.2% | intergenic (+25/‑112) | rpoC → / → rplGB | DNA‑directed RNA polymerase subunit beta'/Ribosome‑associated protein L7Ae‑like protein |
| RA | USA300TCH1516_ALE | 598,492 | A→G | 10.8% | intergenic (+41/+241) | tuf → / ← yxeP_2 | Elongation factor Tu/putative hydrolase YxeP |
| RA | USA300TCH1516_ALE | 598,495 | C→T | 11.3% | intergenic (+44/+238) | tuf → / ← yxeP_2 | Elongation factor Tu/putative hydrolase YxeP |
| RA | USA300TCH1516_ALE | 598,501 | G→A | 8.9% | intergenic (+50/+232) | tuf → / ← yxeP_2 | Elongation factor Tu/putative hydrolase YxeP |
| RA | USA300TCH1516_ALE | 631,535 | G→A | 9.4% | intergenic (+161/‑341) | gph_1 → / → proP | Phosphoglycolate phosphatase/Proline/betaine transporter |
| RA | USA300TCH1516_ALE | 631,536 | T→C | 9.2% | intergenic (+162/‑340) | gph_1 → / → proP | Phosphoglycolate phosphatase/Proline/betaine transporter |
| RA | USA300TCH1516_ALE | 638,614 | G→T | 5.1% | T14K (ACA→AAA) | pdxK ← | Pyridoxine kinase |
| RA | USA300TCH1516_ALE | 639,592 | C→G | 5.3% | A33G (GCC→GGC) | USA300HOU_RS03045 → | hypothetical protein |
| RA | USA300TCH1516_ALE | 659,371 | T→A | 5.8% | intergenic (+177/‑735) | USA300TCH1516_00590 → / → USA300HOU_RS03165 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 667,064 | T→G | 9.0% | D18E (GAT→GAG) | USA300TCH1516_00600 → | hypothetical protein |
| RA | USA300TCH1516_ALE | 682,085 | Δ1 bp | 5.9% | coding (74/504 nt) | USA300TCH1516_00616 ← | hypothetical protein |
| RA | USA300TCH1516_ALE | 690,093 | A→G | 8.8% | intergenic (‑22/+13) | USA300HOU_RS03320 ← / ← USA300HOU_RS03325 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 690,098 | A→T | 10.8% | intergenic (‑27/+8) | USA300HOU_RS03320 ← / ← USA300HOU_RS03325 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 690,101 | A→T | 10.5% | intergenic (‑30/+5) | USA300HOU_RS03320 ← / ← USA300HOU_RS03325 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 690,106 | C→T | 5.2% | *128* (TAG→TAA) | USA300HOU_RS03325 ← | hypothetical protein |
| RA | USA300TCH1516_ALE | 702,560 | T→A | 7.4% | I118N (ATT→AAT) | nhaK_1 → | Sodium, potassium, lithium and rubidium/H(+) antiporter |
| RA | USA300TCH1516_ALE | 707,879 | A→T | 6.4% | L11I (TTA→ATA) | znuC_1 ← | High‑affinity zinc uptake system ATP‑binding protein ZnuC |
| RA | USA300TCH1516_ALE | 707,911 | C→T | 55.4% | intergenic (‑2/‑120) | znuC_1 ← / → ideR | High‑affinity zinc uptake system ATP‑binding protein ZnuC/Iron‑dependent repressor IdeR |
| RA | USA300TCH1516_ALE | 722,987 | C→T | 12.4% | T42I (ACA→ATA) | feuB → | Iron‑uptake system permease protein FeuB |
| RA | USA300TCH1516_ALE | 722,992 | A→G | 12.0% | I44V (ATA→GTA) | feuB → | Iron‑uptake system permease protein FeuB |
| RA | USA300TCH1516_ALE | 739,247 | T→A | 5.0% | V161D (GTT→GAT) | pitA_1 → | Low‑affinity inorganic phosphate transporter 1 |
| RA | USA300TCH1516_ALE | 740,315 | Δ1 bp | 16.0% | intergenic (+542/+46) | pitA_1 → / ← sle1_2 | Low‑affinity inorganic phosphate transporter 1/N‑acetylmuramoyl‑L‑alanine amidase sle1 |
| RA | USA300TCH1516_ALE | 740,322 | G→C | 21.4% | intergenic (+549/+39) | pitA_1 → / ← sle1_2 | Low‑affinity inorganic phosphate transporter 1/N‑acetylmuramoyl‑L‑alanine amidase sle1 |
| RA | USA300TCH1516_ALE | 740,328:1 | +G | 15.2% | intergenic (+555/+33) | pitA_1 → / ← sle1_2 | Low‑affinity inorganic phosphate transporter 1/N‑acetylmuramoyl‑L‑alanine amidase sle1 |
| RA | USA300TCH1516_ALE | 770,855 | A→G | 5.8% | intergenic (+41/‑209) | ybaK → / → glcR | Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR |
| RA | USA300TCH1516_ALE | 770,860 | G→A | 7.3% | intergenic (+46/‑204) | ybaK → / → glcR | Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR |
| RA | USA300TCH1516_ALE | 770,866 | A→T | 7.6% | intergenic (+52/‑198) | ybaK → / → glcR | Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR |
| RA | USA300TCH1516_ALE | 770,870 | T→A | 7.9% | intergenic (+56/‑194) | ybaK → / → glcR | Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR |
| RA | USA300TCH1516_ALE | 770,877 | A→T | 8.4% | intergenic (+63/‑187) | ybaK → / → glcR | Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR |
| RA | USA300TCH1516_ALE | 770,883 | T→C | 7.5% | intergenic (+69/‑181) | ybaK → / → glcR | Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR |
| RA | USA300TCH1516_ALE | 770,888 | C→T | 5.5% | intergenic (+74/‑176) | ybaK → / → glcR | Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR |
| RA | USA300TCH1516_ALE | 779,970 | G→A | 6.6% | intergenic (+26/+46) | csbB → / ← saeS | Putative glycosyltransferase CsbB/Histidine protein kinase SaeS |
| RA | USA300TCH1516_ALE | 790,778 | G→A | 92.2% | intergenic (+277/‑197) | kipA_1 → / → ltaS | KipI antagonist/Lipoteichoic acid synthase |
| RA | USA300TCH1516_ALE | 803,528 | C→T | 20.7% | intergenic (‑228/+42) | USA300HOU_RS03920 ← / ← dtpT | Putative lipid kinase/Di‑/tripeptide transporter |
| RA | USA300TCH1516_ALE | 803,539 | A→G | 21.7% | intergenic (‑239/+31) | USA300HOU_RS03920 ← / ← dtpT | Putative lipid kinase/Di‑/tripeptide transporter |
| RA | USA300TCH1516_ALE | 837,540:1 | +T | 7.7% | intergenic (+34/‑235) | USA300HOU_RS04100 → / → uvrB | hypothetical protein/UvrABC system protein B |
| RA | USA300TCH1516_ALE | 890,542 | T→C | 10.2% | intergenic (+17/‑47) | gcvH → / → USA300TCH1516_00820 | Glycine cleavage system H protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 890,548 | A→T | 10.9% | intergenic (+23/‑41) | gcvH → / → USA300TCH1516_00820 | Glycine cleavage system H protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 895,932 | G→A | 9.0% | intergenic (+131/+12) | metQ_2 → / ← Int‑Tn_1 | Methionine‑binding lipoprotein MetQ/Transposase from transposon Tn916 |
| RA | USA300TCH1516_ALE | 895,935 | T→C | 9.3% | intergenic (+134/+9) | metQ_2 → / ← Int‑Tn_1 | Methionine‑binding lipoprotein MetQ/Transposase from transposon Tn916 |
| RA | USA300TCH1516_ALE | 897,208 | Δ1 bp | 5.3% | intergenic (‑44/+44) | Int‑Tn_1 ← / ← entA_1 | Transposase from transposon Tn916/Enterotoxin type A |
| RA | USA300TCH1516_ALE | 917,327 | T→G | 5.1% | intergenic (+86/+244) | sufB_2 → / ← USA300HOU_RS04545 | FeS cluster assembly protein SufB/hypothetical protein |
| RA | USA300TCH1516_ALE | 937,148 | T→C | 11.7% | intergenic (+55/‑76) | USA300HOU_RS04665 → / → pepA_1 | NADH dehydrogenase‑like protein/Cytosol aminopeptidase |
| RA | USA300TCH1516_ALE | 937,158 | T→A | 16.1% | intergenic (+65/‑66) | USA300HOU_RS04665 → / → pepA_1 | NADH dehydrogenase‑like protein/Cytosol aminopeptidase |
| RA | USA300TCH1516_ALE | 937,168 | G→A | 10.4% | intergenic (+75/‑56) | USA300HOU_RS04665 → / → pepA_1 | NADH dehydrogenase‑like protein/Cytosol aminopeptidase |
| RA | USA300TCH1516_ALE | 942,207 | A→G | 8.9% | intergenic (‑178/+71) | ptlE ← / ← mnhG1 | Neopentalenolactone D synthase/Na(+)/H(+) antiporter subunit G1 |
| RA | USA300TCH1516_ALE | 942,210 | C→G | 8.8% | intergenic (‑181/+68) | ptlE ← / ← mnhG1 | Neopentalenolactone D synthase/Na(+)/H(+) antiporter subunit G1 |
| RA | USA300TCH1516_ALE | 942,216 | T→A | 10.4% | intergenic (‑187/+62) | ptlE ← / ← mnhG1 | Neopentalenolactone D synthase/Na(+)/H(+) antiporter subunit G1 |
| RA | USA300TCH1516_ALE | 942,221 | T→A | 9.9% | intergenic (‑192/+57) | ptlE ← / ← mnhG1 | Neopentalenolactone D synthase/Na(+)/H(+) antiporter subunit G1 |
| RA | USA300TCH1516_ALE | 942,227 | C→G | 9.2% | intergenic (‑198/+51) | ptlE ← / ← mnhG1 | Neopentalenolactone D synthase/Na(+)/H(+) antiporter subunit G1 |
| RA | USA300TCH1516_ALE | 942,230 | C→T | 9.1% | intergenic (‑201/+48) | ptlE ← / ← mnhG1 | Neopentalenolactone D synthase/Na(+)/H(+) antiporter subunit G1 |
| RA | USA300TCH1516_ALE | 950,088 | T→A | 16.1% | intergenic (+82/‑280) | yugI_2 → / → USA300HOU_RS04740 | General stress protein 13/putative oxidoreductase |
| RA | USA300TCH1516_ALE | 950,093 | T→A | 17.0% | intergenic (+87/‑275) | yugI_2 → / → USA300HOU_RS04740 | General stress protein 13/putative oxidoreductase |
| RA | USA300TCH1516_ALE | 950,098 | T→A | 17.1% | intergenic (+92/‑270) | yugI_2 → / → USA300HOU_RS04740 | General stress protein 13/putative oxidoreductase |
| RA | USA300TCH1516_ALE | 954,763 | G→A | 7.8% | intergenic (+417/+86) | gluD → / ← glpQ_1 | NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase |
| RA | USA300TCH1516_ALE | 954,768 | A→T | 7.9% | intergenic (+422/+81) | gluD → / ← glpQ_1 | NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase |
| RA | USA300TCH1516_ALE | 954,771 | T→C | 7.8% | intergenic (+425/+78) | gluD → / ← glpQ_1 | NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase |
| RA | USA300TCH1516_ALE | 954,775 | T→A | 7.9% | intergenic (+429/+74) | gluD → / ← glpQ_1 | NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase |
| RA | USA300TCH1516_ALE | 954,779 | G→A | 7.8% | intergenic (+433/+70) | gluD → / ← glpQ_1 | NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase |
| RA | USA300TCH1516_ALE | 954,782 | A→T | 7.9% | intergenic (+436/+67) | gluD → / ← glpQ_1 | NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase |
| RA | USA300TCH1516_ALE | 954,787 | T→C | 7.2% | intergenic (+441/+62) | gluD → / ← glpQ_1 | NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase |
| RA | USA300TCH1516_ALE | 970,677 | G→A | 11.2% | intergenic (+23/‑306) | USA300HOU_RS04805 → / → USA300HOU_RS04810 | Ureidoglycolate lyase/hypothetical protein |
| RA | USA300TCH1516_ALE | 970,681 | T→A | 11.0% | intergenic (+27/‑302) | USA300HOU_RS04805 → / → USA300HOU_RS04810 | Ureidoglycolate lyase/hypothetical protein |
| RA | USA300TCH1516_ALE | 970,686 | T→A | 10.5% | intergenic (+32/‑297) | USA300HOU_RS04805 → / → USA300HOU_RS04810 | Ureidoglycolate lyase/hypothetical protein |
| RA | USA300TCH1516_ALE | 970,690 | T→C | 10.7% | intergenic (+36/‑293) | USA300HOU_RS04805 → / → USA300HOU_RS04810 | Ureidoglycolate lyase/hypothetical protein |
| RA | USA300TCH1516_ALE | 993,825 | A→G | 5.4% | intergenic (+29/‑183) | dppE → / → appA | Dipeptide‑binding protein DppE/Oligopeptide‑binding protein AppA |
| RA | USA300TCH1516_ALE | 1,019,742 | G→A | 5.3% | intergenic (+64/+49) | USA300HOU_RS05030 → / ← ltaA | Putative phosphoesterase/putative glycolipid permease LtaA |
| RA | USA300TCH1516_ALE | 1,019,747 | T→C | 5.2% | intergenic (+69/+44) | USA300HOU_RS05030 → / ← ltaA | Putative phosphoesterase/putative glycolipid permease LtaA |
| RA | USA300TCH1516_ALE | 1,042,789 | T→C | 14.8% | intergenic (+19/+70) | tagE_3 → / ← catD | Poly(glycerol‑phosphate) alpha‑glucosyltransferase/Putative oxidoreductase CatD |
| RA | USA300TCH1516_ALE | 1,042,796 | G→A | 18.8% | intergenic (+26/+63) | tagE_3 → / ← catD | Poly(glycerol‑phosphate) alpha‑glucosyltransferase/Putative oxidoreductase CatD |
| RA | USA300TCH1516_ALE | 1,049,713 | G→T | 5.3% | Q457H (CAG→CAT) | menD → | 2‑succinyl‑5‑enolpyruvyl‑6‑hydroxy‑3‑ cyclohexene‑1‑carboxylate synthase |
| RA | USA300TCH1516_ALE | 1,049,714 | A→C | 5.4% | M458L (ATG→CTG) | menD → | 2‑succinyl‑5‑enolpyruvyl‑6‑hydroxy‑3‑ cyclohexene‑1‑carboxylate synthase |
| RA | USA300TCH1516_ALE | 1,055,119 | C→A | 5.2% | G355C (GGT→TGT) | patA_2 ← | Putative N‑acetyl‑LL‑diaminopimelate aminotransferase |
| RA | USA300TCH1516_ALE | 1,055,126 | T→G | 9.7% | T352T (ACA→ACC) | patA_2 ← | Putative N‑acetyl‑LL‑diaminopimelate aminotransferase |
| RA | USA300TCH1516_ALE | 1,076,529 | G→C | 7.9% | M190I (ATG→ATC) | purQ → | Phosphoribosylformylglycinamidine synthase subunit PurQ |
| RA | USA300TCH1516_ALE | 1,078,152 | A→T | 13.7% | Q510L (CAG→CTG) | purL → | Phosphoribosylformylglycinamidine synthase subunit PurL |
| RA | USA300TCH1516_ALE | 1,089,908 | T→G | 5.2% | intergenic (+61/‑364) | USA300HOU_RS05380 → / → rlmI | hypothetical protein/Ribosomal RNA large subunit methyltransferase I |
| RA | USA300TCH1516_ALE | 1,096,997 | T→C | 5.4% | V264A (GTA→GCA) | ythB → | Putative cytochrome bd menaquinol oxidase subunit II |
| RA | USA300TCH1516_ALE | 1,107,402 | T→C | 11.0% | intergenic (+37/‑131) | pdhD → / → USA300HOU_RS05475 | Dihydrolipoyl dehydrogenase/hypothetical protein |
| RA | USA300TCH1516_ALE | 1,128,680 | T→A | 9.3% | Y286N (TAT→AAT) | ctaB2 → | Protoheme IX farnesyltransferase 2 |
| RA | USA300TCH1516_ALE | 1,158,427 | G→A | 9.6% | intergenic (+11/‑313) | uvrC → / → sdhC | UvrABC system protein C/Succinate dehydrogenase cytochrome b558 subunit |
| RA | USA300TCH1516_ALE | 1,158,435 | C→G | 9.6% | intergenic (+19/‑305) | uvrC → / → sdhC | UvrABC system protein C/Succinate dehydrogenase cytochrome b558 subunit |
| RA | USA300TCH1516_ALE | 1,158,443 | T→C | 7.7% | intergenic (+27/‑297) | uvrC → / → sdhC | UvrABC system protein C/Succinate dehydrogenase cytochrome b558 subunit |
| RA | USA300TCH1516_ALE | 1,205,880 | A→T | 5.5% | T65S (ACA→TCA) | lspA → | Lipoprotein signal peptidase |
| RA | USA300TCH1516_ALE | 1,218,719 | Δ1 bp | 9.3% | intergenic (+210/+53) | USA300HOU_RS06065 → / ← USA300HOU_RS06070 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 1,218,722 | T→A | 9.3% | intergenic (+213/+50) | USA300HOU_RS06065 → / ← USA300HOU_RS06070 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 1,218,730 | G→T | 11.9% | intergenic (+221/+42) | USA300HOU_RS06065 → / ← USA300HOU_RS06070 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 1,218,732 | C→G | 11.9% | intergenic (+223/+40) | USA300HOU_RS06065 → / ← USA300HOU_RS06070 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 1,218,734 | A→C | 11.7% | intergenic (+225/+38) | USA300HOU_RS06065 → / ← USA300HOU_RS06070 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 1,218,741:1 | +A | 5.6% | intergenic (+232/+31) | USA300HOU_RS06065 → / ← USA300HOU_RS06070 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 1,218,743 | T→G | 5.1% | intergenic (+234/+29) | USA300HOU_RS06065 → / ← USA300HOU_RS06070 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 1,219,574 | T→A | 5.1% | Q299L (CAG→CTG) | USA300HOU_RS06070 ← | hypothetical protein |
| RA | USA300TCH1516_ALE | 1,221,653 | G→A | 10.5% | intergenic (+68/‑148) | rpoZ → / → coaBC | DNA‑directed RNA polymerase subunit omega/Coenzyme A biosynthesis bifunctional protein CoaBC |
| RA | USA300TCH1516_ALE | 1,221,660 | T→C | 8.7% | intergenic (+75/‑141) | rpoZ → / → coaBC | DNA‑directed RNA polymerase subunit omega/Coenzyme A biosynthesis bifunctional protein CoaBC |
| RA | USA300TCH1516_ALE | 1,221,661 | G→A | 8.8% | intergenic (+76/‑140) | rpoZ → / → coaBC | DNA‑directed RNA polymerase subunit omega/Coenzyme A biosynthesis bifunctional protein CoaBC |
| RA | USA300TCH1516_ALE | 1,232,465 | G→C | 91.8% | A124P (GCG→CCG) | prkC → | Serine/threonine‑protein kinase PrkC |
| RA | USA300TCH1516_ALE | 1,245,330 | A→T | 6.8% | intergenic (+135/‑108) | fabG → / → acpP | 3‑oxoacyl‑[acyl‑carrier‑protein] reductase FabG/Acyl carrier protein |
| RA | USA300TCH1516_ALE | 1,245,337 | A→T | 7.4% | intergenic (+142/‑101) | fabG → / → acpP | 3‑oxoacyl‑[acyl‑carrier‑protein] reductase FabG/Acyl carrier protein |
| RA | USA300TCH1516_ALE | 1,245,338 | A→T | 8.0% | intergenic (+143/‑100) | fabG → / → acpP | 3‑oxoacyl‑[acyl‑carrier‑protein] reductase FabG/Acyl carrier protein |
| RA | USA300TCH1516_ALE | 1,245,345 | A→T | 6.4% | intergenic (+150/‑93) | fabG → / → acpP | 3‑oxoacyl‑[acyl‑carrier‑protein] reductase FabG/Acyl carrier protein |
| RA | USA300TCH1516_ALE | 1,255,820 | C→T | 5.4% | intergenic (+36/+208) | rplS → / ← USA300HOU_RS06250 | 50S ribosomal protein L19/hypothetical protein |
| RA | USA300TCH1516_ALE | 1,313,113 | A→T | 10.7% | intergenic (+17/+280) | rny_1 → / ← USA300HOU_RS06485 | Ribonuclease Y/hypothetical protein |
| RA | USA300TCH1516_ALE | 1,331,236 | T→A | 7.1% | S189T (TCT→ACT) | USA300HOU_RS06555 → | Monoacylglycerol lipase |
| RA | USA300TCH1516_ALE | 1,331,241 | T→A | 7.9% | S190R (AGT→AGA) | USA300HOU_RS06555 → | Monoacylglycerol lipase |
| RA | USA300TCH1516_ALE | 1,343,619 | A→C | 14.5% | intergenic (+32/‑98) | USA300HOU_RS06640 → / → USA300TCH1516_01248 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 1,343,622 | G→T | 13.4% | intergenic (+35/‑95) | USA300HOU_RS06640 → / → USA300TCH1516_01248 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 1,366,121 | A→T | 6.2% | intergenic (+420/‑34) | rpmG2_1 → / → rpsN2 | 50S ribosomal protein L33 2/Alternate 30S ribosomal protein S14 |
| RA | USA300TCH1516_ALE | 1,405,986 | C→A | 8.4% | A77D (GCT→GAT) | trpG_2 → | Anthranilate synthase component 2 |
| RA | USA300TCH1516_ALE | 1,416,458 | A→T | 100% | I216N (ATT→AAT) | oppD_4 ← | Oligopeptide transport ATP‑binding protein OppD |
| RA | USA300TCH1516_ALE | 1,421,606 | T→C | 9.3% | intergenic (+42/+98) | pepF1_2 → / ← phoU | Oligoendopeptidase F, plasmid/Phosphate‑specific transport system accessory protein PhoU |
| RA | USA300TCH1516_ALE | 1,421,610:1 | +A | 8.3% | intergenic (+46/+94) | pepF1_2 → / ← phoU | Oligoendopeptidase F, plasmid/Phosphate‑specific transport system accessory protein PhoU |
| RA | USA300TCH1516_ALE | 1,421,615 | C→G | 7.7% | intergenic (+51/+89) | pepF1_2 → / ← phoU | Oligoendopeptidase F, plasmid/Phosphate‑specific transport system accessory protein PhoU |
| RA | USA300TCH1516_ALE | 1,421,619 | Δ1 bp | 7.2% | intergenic (+55/+85) | pepF1_2 → / ← phoU | Oligoendopeptidase F, plasmid/Phosphate‑specific transport system accessory protein PhoU |
| RA | USA300TCH1516_ALE | 1,421,625 | G→A | 7.5% | intergenic (+61/+79) | pepF1_2 → / ← phoU | Oligoendopeptidase F, plasmid/Phosphate‑specific transport system accessory protein PhoU |
| RA | USA300TCH1516_ALE | 1,430,691 | C→G | 7.1% | intergenic (+800/‑60) | ybiT → / → lysC | putative ABC transporter ATP‑binding protein YbiT/Aspartokinase |
| RA | USA300TCH1516_ALE | 1,430,693 | T→A | 7.3% | intergenic (+802/‑58) | ybiT → / → lysC | putative ABC transporter ATP‑binding protein YbiT/Aspartokinase |
| RA | USA300TCH1516_ALE | 1,430,695 | C→G | 6.9% | intergenic (+804/‑56) | ybiT → / → lysC | putative ABC transporter ATP‑binding protein YbiT/Aspartokinase |
| RA | USA300TCH1516_ALE | 1,435,065 | C→G | 19.9% | A141G (GCT→GGT) | dapH → | 2,3,4,5‑tetrahydropyridine‑2,6‑dicarboxylate N‑acetyltransferase |
| RA | USA300TCH1516_ALE | 1,440,007 | Δ1 bp | 84.7% | coding (34/201 nt) | cspA_2 ← | Cold shock protein CspA |
| RA | USA300TCH1516_ALE | 1,447,045 | T→A | 6.3% | I64F (ATC→TTC) | cobT ← | Aerobic cobaltochelatase subunit CobT |
| RA | USA300TCH1516_ALE | 1,474,639 | C→G | 91.9% | A9129P (GCA→CCA) | ebh_1 ← | Extracellular matrix‑binding protein ebh |
| RA | USA300TCH1516_ALE | 1,476,685 | T→A | 5.7% | M8447L (ATG→TTG) | ebh_1 ← | Extracellular matrix‑binding protein ebh |
| RA | USA300TCH1516_ALE | 1,481,355 | G→T | 88.8% | A6890E (GCA→GAA) | ebh_1 ← | Extracellular matrix‑binding protein ebh |
| RA | USA300TCH1516_ALE | 1,487,340 | T→A | 5.6% | H4895L (CAT→CTT) | ebh_1 ← | Extracellular matrix‑binding protein ebh |
| RA | USA300TCH1516_ALE | 1,487,343 | T→A | 5.1% | K4894M (AAG→ATG) | ebh_1 ← | Extracellular matrix‑binding protein ebh |
| RA | USA300TCH1516_ALE | 1,502,422 | C→G | 6.5% | *464S (TGA→TCA) | norB_4 ← | Quinolone resistance protein NorB |
| RA | USA300TCH1516_ALE | 1,513,930 | A→T | 100% | L413F (TTA→TTT) | USA300HOU_RS07375 → | hypothetical protein |
| RA | USA300TCH1516_ALE | 1,526,532 | T→A | 7.2% | K471* (AAA→TAA) | dinG_1 ← | putative ATP‑dependent helicase DinG |
| RA | USA300TCH1516_ALE | 1,540,018 | T→A | 6.1% | E43V (GAA→GTA) | ndk ← | Nucleoside diphosphate kinase |
| RA | USA300TCH1516_ALE | 1,542,906 | T→G | 5.3% | intergenic (‑408/+23) | USA300HOU_RS07525 ← / ← hup | hypothetical protein/DNA‑binding protein HU |
| RA | USA300TCH1516_ALE | 1,542,910 | C→A | 5.4% | intergenic (‑412/+19) | USA300HOU_RS07525 ← / ← hup | hypothetical protein/DNA‑binding protein HU |
| RA | USA300TCH1516_ALE | 1,615,301 | T→A | 6.8% | intergenic (‑31/+18) | xerD_3 ← / ← fur | Tyrosine recombinase XerD/Ferric uptake regulation protein |
| RA | USA300TCH1516_ALE | 1,615,309 | A→T | 5.6% | intergenic (‑39/+10) | xerD_3 ← / ← fur | Tyrosine recombinase XerD/Ferric uptake regulation protein |
| RA | USA300TCH1516_ALE | 1,622,775 | A→T | 5.3% | K43* (AAA→TAA) | marA → | Multiple antibiotic resistance protein MarA |
| RA | USA300TCH1516_ALE | 1,646,189 | G→C | 100% | A155G (GCA→GGA) | ypdF ← | Aminopeptidase YpdF |
| RA | USA300TCH1516_ALE | 1,653,327 | A→G | 11.2% | intergenic (‑32/+127) | gcvT ← / ← aroK | Aminomethyltransferase/Shikimate kinase |
| RA | USA300TCH1516_ALE | 1,653,332 | A→G | 13.2% | intergenic (‑37/+122) | gcvT ← / ← aroK | Aminomethyltransferase/Shikimate kinase |
| RA | USA300TCH1516_ALE | 1,653,335 | C→T | 12.4% | intergenic (‑40/+119) | gcvT ← / ← aroK | Aminomethyltransferase/Shikimate kinase |
| RA | USA300TCH1516_ALE | 1,653,340 | C→T | 12.4% | intergenic (‑45/+114) | gcvT ← / ← aroK | Aminomethyltransferase/Shikimate kinase |
| RA | USA300TCH1516_ALE | 1,667,524 | G→T | 6.1% | intergenic (‑35/+91) | znuC_2 ← / ← nfo | High‑affinity zinc uptake system ATP‑binding protein ZnuC/putative endonuclease 4 |
| RA | USA300TCH1516_ALE | 1,685,139 | A→T | 7.5% | intergenic (‑151/+69) | USA300HOU_RS08395 ← / ← rpsU | hypothetical protein/30S ribosomal protein S21 |
| RA | USA300TCH1516_ALE | 1,685,148 | C→T | 5.4% | intergenic (‑160/+60) | USA300HOU_RS08395 ← / ← rpsU | hypothetical protein/30S ribosomal protein S21 |
| RA | USA300TCH1516_ALE | 1,685,149 | T→A | 6.8% | intergenic (‑161/+59) | USA300HOU_RS08395 ← / ← rpsU | hypothetical protein/30S ribosomal protein S21 |
| RA | USA300TCH1516_ALE | 1,744,362 | G→A | 8.1% | H104Y (CAC→TAC) | apt ← | Adenine phosphoribosyltransferase |
| RA | USA300TCH1516_ALE | 1,744,454 | C→T | 87.7% | G73D (GGC→GAC) | apt ← | Adenine phosphoribosyltransferase |
| RA | USA300TCH1516_ALE | 1,776,622 | A→G | 5.1% | intergenic (‑99/+52) | clpX ← / ← tig | ATP‑dependent Clp protease ATP‑binding subunit ClpX/Trigger factor |
| RA | USA300TCH1516_ALE | 1,776,634 | C→T | 6.1% | intergenic (‑111/+40) | clpX ← / ← tig | ATP‑dependent Clp protease ATP‑binding subunit ClpX/Trigger factor |
| RA | USA300TCH1516_ALE | 1,779,807 | A→G | 8.3% | intergenic (‑113/+29) | USA300TCH1516_01664 ← / ← rplT | hypothetical protein/50S ribosomal protein L20 |
| RA | USA300TCH1516_ALE | 1,779,810 | A→T | 8.0% | intergenic (‑116/+26) | USA300TCH1516_01664 ← / ← rplT | hypothetical protein/50S ribosomal protein L20 |
| RA | USA300TCH1516_ALE | 1,779,813 | C→T | 7.6% | intergenic (‑119/+23) | USA300TCH1516_01664 ← / ← rplT | hypothetical protein/50S ribosomal protein L20 |
| RA | USA300TCH1516_ALE | 1,794,352 | A→T | 8.6% | Y426N (TAT→AAT) | USA300HOU_RS08960 ← | hypothetical protein |
| RA | USA300TCH1516_ALE | 1,797,772 | G→C | 11.1% | R7G (CGC→GGC) | phoR ← | Alkaline phosphatase synthesis sensor protein PhoR |
| RA | USA300TCH1516_ALE | 1,845,292 | C→T | 7.9% | M734I (ATG→ATA) | isdH ← | Iron‑regulated surface determinant protein H |
| RA | USA300TCH1516_ALE | 1,845,295 | A→G | 8.7% | D733D (GAT→GAC) | isdH ← | Iron‑regulated surface determinant protein H |
| RA | USA300TCH1516_ALE | 1,850,932 | T→A | 7.1% | H224L (CAT→CTT) | acsA_1 ← | Acetyl‑coenzyme A synthetase |
| RA | USA300TCH1516_ALE | 1,857,971 | C→T | 15.7% | A135T (GCA→ACA) | USA300HOU_RS09235 ← | hypothetical protein |
| RA | USA300TCH1516_ALE | 1,909,134 | T→A | 5.4% | intergenic (‑200/‑60) | tal ← / → USA300HOU_RS09460 | Transaldolase/hypothetical protein |
| RA | USA300TCH1516_ALE | 1,909,137 | T→A | 5.2% | intergenic (‑203/‑57) | tal ← / → USA300HOU_RS09460 | Transaldolase/hypothetical protein |
| RA | USA300TCH1516_ALE | 1,929,570 | T→G | 6.1% | E32A (GAG→GCG) | USA300TCH1516_01793 ← | hypothetical protein |
| RA | USA300TCH1516_ALE | 1,929,573 | C→A | 5.9% | R31L (CGC→CTC) | USA300TCH1516_01793 ← | hypothetical protein |
| RA | USA300TCH1516_ALE | 1,931,599 | A→T | 16.4% | L1217I (TTA→ATA) | USA300HOU_RS09605 ← | hypothetical protein |
| RA | USA300TCH1516_ALE | 1,934,780 | A→T | 5.9% | N156K (AAT→AAA) | USA300HOU_RS09605 ← | hypothetical protein |
| RA | USA300TCH1516_ALE | 1,972,372 | G→A | 12.8% | A23T (GCT→ACT) | prsA → | Foldase protein PrsA |
| RA | USA300TCH1516_ALE | 2,010,363 | C→T | 100% | C146Y (TGT→TAT) | USA300HOU_RS10125 ← | Putative multidrug export ATP‑binding/permease protein |
| RA | USA300TCH1516_ALE | 2,042,100 | T→A | 5.3% | K338N (AAA→AAT) | gatB_2 ← | Aspartyl/glutamyl‑tRNA(Asn/Gln) amidotransferase subunit B |
| RA | USA300TCH1516_ALE | 2,123,779 | T→A | 5.5% | intergenic (‑39/‑94) | USA300HOU_RS10825 ← / → lexA_2 | hypothetical protein/LexA repressor |
| RA | USA300TCH1516_ALE | 2,126,293 | A→C | 5.1% | intergenic (+26/‑52) | USA300HOU_RS10850 → / → USA300HOU_RS10855 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,129,368 | A→G | 8.1% | intergenic (+201/+37) | hlb_2 → / ← USA300HOU_RS10870 | Phospholipase C/putative leukocidin‑like protein 1 |
| RA | USA300TCH1516_ALE | 2,129,372 | A→G | 7.5% | intergenic (+205/+33) | hlb_2 → / ← USA300HOU_RS10870 | Phospholipase C/putative leukocidin‑like protein 1 |
| RA | USA300TCH1516_ALE | 2,129,379 | T→A | 7.0% | intergenic (+212/+26) | hlb_2 → / ← USA300HOU_RS10870 | Phospholipase C/putative leukocidin‑like protein 1 |
| RA | USA300TCH1516_ALE | 2,129,380 | C→G | 7.1% | intergenic (+213/+25) | hlb_2 → / ← USA300HOU_RS10870 | Phospholipase C/putative leukocidin‑like protein 1 |
| RA | USA300TCH1516_ALE | 2,129,381 | T→A | 7.0% | intergenic (+214/+24) | hlb_2 → / ← USA300HOU_RS10870 | Phospholipase C/putative leukocidin‑like protein 1 |
| RA | USA300TCH1516_ALE | 2,129,388 | C→T | 8.5% | intergenic (+221/+17) | hlb_2 → / ← USA300HOU_RS10870 | Phospholipase C/putative leukocidin‑like protein 1 |
| RA | USA300TCH1516_ALE | 2,129,392 | C→T | 8.2% | intergenic (+225/+13) | hlb_2 → / ← USA300HOU_RS10870 | Phospholipase C/putative leukocidin‑like protein 1 |
| RA | USA300TCH1516_ALE | 2,133,490 | A→T | 5.6% | intergenic (+334/+38) | dapE → / ← USA300HOU_RS10885 | putative succinyl‑diaminopimelate desuccinylase/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,165,416 | A→T | 5.4% | intergenic (‑384/‑94) | tsaE ← / → ilvD | tRNA threonylcarbamoyladenosine biosynthesis protein TsaE/Dihydroxy‑acid dehydratase |
| RA | USA300TCH1516_ALE | 2,172,067:1 | +G | 9.2% | coding (116/1047 nt) | leuB → | 3‑isopropylmalate dehydrogenase |
| RA | USA300TCH1516_ALE | 2,172,075 | G→C | 11.0% | E42Q (GAA→CAA) | leuB → | 3‑isopropylmalate dehydrogenase |
| RA | USA300TCH1516_ALE | 2,172,078 | T→A | 11.5% | F43I (TTT→ATT) | leuB → | 3‑isopropylmalate dehydrogenase |
| RA | USA300TCH1516_ALE | 2,172,081 | G→C | 11.6% | G44R (GGT→CGT) | leuB → | 3‑isopropylmalate dehydrogenase |
| RA | USA300TCH1516_ALE | 2,172,088 | Δ1 bp | 8.7% | coding (137/1047 nt) | leuB → | 3‑isopropylmalate dehydrogenase |
| RA | USA300TCH1516_ALE | 2,192,759:1 | +G | 5.1% | coding (378/480 nt) | USA300HOU_RS11200 ← | hypothetical protein |
| RA | USA300TCH1516_ALE | 2,211,658 | G→A | 6.5% | intergenic (+651/+162) | USA300HOU_RS11275 → / ← yidC | hypothetical protein/Membrane protein insertase YidC |
| RA | USA300TCH1516_ALE | 2,211,664 | Δ1 bp | 6.8% | intergenic (+657/+156) | USA300HOU_RS11275 → / ← yidC | hypothetical protein/Membrane protein insertase YidC |
| RA | USA300TCH1516_ALE | 2,211,670 | C→A | 7.9% | intergenic (+663/+150) | USA300HOU_RS11275 → / ← yidC | hypothetical protein/Membrane protein insertase YidC |
| RA | USA300TCH1516_ALE | 2,211,673 | T→G | 8.2% | intergenic (+666/+147) | USA300HOU_RS11275 → / ← yidC | hypothetical protein/Membrane protein insertase YidC |
| RA | USA300TCH1516_ALE | 2,211,678:1 | +G | 8.3% | intergenic (+671/+142) | USA300HOU_RS11275 → / ← yidC | hypothetical protein/Membrane protein insertase YidC |
| RA | USA300TCH1516_ALE | 2,211,684 | T→C | 6.1% | intergenic (+677/+136) | USA300HOU_RS11275 → / ← yidC | hypothetical protein/Membrane protein insertase YidC |
| RA | USA300TCH1516_ALE | 2,216,257 | G→A | 38.5% | S178L (TCA→TTA) | sceD ← | putative transglycosylase SceD |
| RA | USA300TCH1516_ALE | 2,243,499 | T→A | 17.4% | intergenic (+77/+32) | USA300HOU_RS11475 → / ← pyrG | hypothetical protein/CTP synthase |
| RA | USA300TCH1516_ALE | 2,243,504 | A→T | 11.3% | intergenic (+82/+27) | USA300HOU_RS11475 → / ← pyrG | hypothetical protein/CTP synthase |
| RA | USA300TCH1516_ALE | 2,268,572 | A→T | 8.6% | intergenic (‑1008/+78) | USA300HOU_RS11605 ← / ← ywpJ_2 | hypothetical protein/Phosphatase YwpJ |
| RA | USA300TCH1516_ALE | 2,279,705 | G→A | 100% | A943V (GCA→GTA) | ebh_3 ← | Extracellular matrix‑binding protein ebh |
| RA | USA300TCH1516_ALE | 2,286,337 | C→T | 5.9% | intergenic (‑250/+27) | ebh_4 ← / ← glmM | Extracellular matrix‑binding protein ebh/Phosphoglucosamine mutase |
| RA | USA300TCH1516_ALE | 2,309,787:1 | +C | 12.7% | coding (82/1032 nt) | yfiZ_2 ← | putative siderophore transport system permease protein YfiZ |
| RA | USA300TCH1516_ALE | 2,309,793:1 | +G | 14.7% | coding (76/1032 nt) | yfiZ_2 ← | putative siderophore transport system permease protein YfiZ |
| RA | USA300TCH1516_ALE | 2,309,800 | Δ1 bp | 15.2% | coding (69/1032 nt) | yfiZ_2 ← | putative siderophore transport system permease protein YfiZ |
| RA | USA300TCH1516_ALE | 2,309,807 | Δ1 bp | 10.4% | coding (62/1032 nt) | yfiZ_2 ← | putative siderophore transport system permease protein YfiZ |
| RA | USA300TCH1516_ALE | 2,328,872 | G→C | 6.0% | F264L (TTC→TTG) | lacE ← | PTS system lactose‑specific EIICB component |
| RA | USA300TCH1516_ALE | 2,372,407 | A→G | 18.2% | intergenic (+158/+34) | USA300TCH1516_02262 → / ← pbuG | hypothetical protein/Guanine/hypoxanthine permease PbuG |
| RA | USA300TCH1516_ALE | 2,372,413 | C→G | 22.1% | intergenic (+164/+28) | USA300TCH1516_02262 → / ← pbuG | hypothetical protein/Guanine/hypoxanthine permease PbuG |
| RA | USA300TCH1516_ALE | 2,372,419 | C→T | 19.8% | intergenic (+170/+22) | USA300TCH1516_02262 → / ← pbuG | hypothetical protein/Guanine/hypoxanthine permease PbuG |
| RA | USA300TCH1516_ALE | 2,398,086 | A→T | 5.2% | intergenic (‑247/‑43) | modA ← / → fdhD | Molybdate‑binding periplasmic protein/Sulfurtransferase FdhD |
| RA | USA300TCH1516_ALE | 2,424,608 | A→G | 6.2% | intergenic (‑166/+62) | USA300HOU_RS12490 ← / ← USA300HOU_RS12495 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,424,609 | C→T | 7.9% | intergenic (‑167/+61) | USA300HOU_RS12490 ← / ← USA300HOU_RS12495 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,428,877 | T→A | 5.6% | D257V (GAT→GTT) | lytR_2 ← | Transcriptional regulator LytR |
| RA | USA300TCH1516_ALE | 2,428,879 | T→A | 5.9% | T256T (ACA→ACT) ‡ | lytR_2 ← | Transcriptional regulator LytR |
| RA | USA300TCH1516_ALE | 2,428,881 | T→A | 5.7% | T256S (ACA→TCA) ‡ | lytR_2 ← | Transcriptional regulator LytR |
| RA | USA300TCH1516_ALE | 2,430,685 | Δ1 bp | 11.6% | intergenic (‑109/‑276) | suhB_2 ← / → birA_2 | Inositol‑1‑monophosphatase/Bifunctional ligase/repressor BirA |
| RA | USA300TCH1516_ALE | 2,430,691:1 | +A | 8.2% | intergenic (‑115/‑270) | suhB_2 ← / → birA_2 | Inositol‑1‑monophosphatase/Bifunctional ligase/repressor BirA |
| RA | USA300TCH1516_ALE | 2,448,479 | A→G | 6.4% | intergenic (‑238/+39) | yxeP_4 ← / ← hutI | putative hydrolase YxeP/Imidazolonepropionase |
| RA | USA300TCH1516_ALE | 2,448,484 | A→G | 9.7% | intergenic (‑243/+34) | yxeP_4 ← / ← hutI | putative hydrolase YxeP/Imidazolonepropionase |
| RA | USA300TCH1516_ALE | 2,448,493 | C→T | 12.4% | intergenic (‑252/+25) | yxeP_4 ← / ← hutI | putative hydrolase YxeP/Imidazolonepropionase |
| RA | USA300TCH1516_ALE | 2,448,498 | C→T | 11.9% | intergenic (‑257/+20) | yxeP_4 ← / ← hutI | putative hydrolase YxeP/Imidazolonepropionase |
| RA | USA300TCH1516_ALE | 2,449,468 | A→T | 9.5% | S97T (TCT→ACT) | hutI ← | Imidazolonepropionase |
| RA | USA300TCH1516_ALE | 2,476,196 | T→A | 6.8% | Q20H (CAA→CAT) | tcaA ← | Membrane‑associated protein TcaA |
| RA | USA300TCH1516_ALE | 2,476,201 | T→G | 11.4% | T19P (ACA→CCA) | tcaA ← | Membrane‑associated protein TcaA |
| RA | USA300TCH1516_ALE | 2,497,391 | C→G | 11.2% | N147K (AAC→AAG) | USA300HOU_RS12865 → | hypothetical protein |
| RA | USA300TCH1516_ALE | 2,509,782 | T→A | 5.1% | intergenic (‑94/‑276) | narT ← / → USA300HOU_RS12920 | putative nitrate transporter NarT/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,514,671 | G→A | 43.6% | H54H (CAC→CAT) | narX ← | Nitrate reductase‑like protein NarX |
| RA | USA300TCH1516_ALE | 2,517,770 | A→T | 6.9% | S954S (TCT→TCA) | narG ← | Respiratory nitrate reductase 1 alpha chain |
| RA | USA300TCH1516_ALE | 2,517,775 | A→C | 12.0% | S953A (TCA→GCA) | narG ← | Respiratory nitrate reductase 1 alpha chain |
| RA | USA300TCH1516_ALE | 2,517,782 | T→A | 12.1% | L950L (CTA→CTT) | narG ← | Respiratory nitrate reductase 1 alpha chain |
| RA | USA300TCH1516_ALE | 2,517,789 | G→T | 8.1% | A948E (GCA→GAA) | narG ← | Respiratory nitrate reductase 1 alpha chain |
| RA | USA300TCH1516_ALE | 2,519,951 | T→G | 8.2% | P227P (CCA→CCC) | narG ← | Respiratory nitrate reductase 1 alpha chain |
| RA | USA300TCH1516_ALE | 2,530,786 | A→G | 10.6% | intergenic (‑37/+236) | yefM ← / ← bdbD | Antitoxin YefM/Disulfide bond formation protein D |
| RA | USA300TCH1516_ALE | 2,530,791 | C→T | 5.9% | intergenic (‑42/+231) | yefM ← / ← bdbD | Antitoxin YefM/Disulfide bond formation protein D |
| RA | USA300TCH1516_ALE | 2,532,298 | A→T | 100% | T15T (ACA→ACT) | femA_3 → | Aminoacyltransferase FemA |
| RA | USA300TCH1516_ALE | 2,538,743 | A→T | 11.3% | intergenic (‑257/+70) | gpmA_2 ← / ← fieF | 2,3‑bisphosphoglycerate‑dependent phosphoglycerate mutase/Ferrous‑iron efflux pump FieF |
| RA | USA300TCH1516_ALE | 2,538,744 | A→T | 11.6% | intergenic (‑258/+69) | gpmA_2 ← / ← fieF | 2,3‑bisphosphoglycerate‑dependent phosphoglycerate mutase/Ferrous‑iron efflux pump FieF |
| RA | USA300TCH1516_ALE | 2,559,830 | A→G | 11.1% | intergenic (+24/+99) | bcr_2 → / ← USA300HOU_RS13190 | Bicyclomycin resistance protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,559,831 | G→A | 11.5% | intergenic (+25/+98) | bcr_2 → / ← USA300HOU_RS13190 | Bicyclomycin resistance protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,559,840 | T→G | 16.5% | intergenic (+34/+89) | bcr_2 → / ← USA300HOU_RS13190 | Bicyclomycin resistance protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,559,841 | C→A | 15.4% | intergenic (+35/+88) | bcr_2 → / ← USA300HOU_RS13190 | Bicyclomycin resistance protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,559,850 | T→C | 7.2% | intergenic (+44/+79) | bcr_2 → / ← USA300HOU_RS13190 | Bicyclomycin resistance protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,559,851 | C→T | 6.7% | intergenic (+45/+78) | bcr_2 → / ← USA300HOU_RS13190 | Bicyclomycin resistance protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,561,495 | Δ1 bp | 5.7% | coding (546/807 nt) | cpdA ← | 3',5'‑cyclic adenosine monophosphate phosphodiesterase CpdA |
| RA | USA300TCH1516_ALE | 2,563,759 | A→G | 9.0% | intergenic (+24/‑114) | cycA_2 → / → nhaK_2 | D‑serine/D‑alanine/glycine transporter/Sodium, potassium, lithium and rubidium/H(+) antiporter |
| RA | USA300TCH1516_ALE | 2,563,763 | C→G | 10.1% | intergenic (+28/‑110) | cycA_2 → / → nhaK_2 | D‑serine/D‑alanine/glycine transporter/Sodium, potassium, lithium and rubidium/H(+) antiporter |
| RA | USA300TCH1516_ALE | 2,582,141 | Δ1 bp | 5.2% | coding (1169/1353 nt) | pnbA → | Para‑nitrobenzyl esterase |
| RA | USA300TCH1516_ALE | 2,608,816 | A→G | 8.6% | intergenic (+97/+163) | USA300TCH1516_02485 → / ← USA300HOU_RS13450 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,608,820 | A→T | 9.4% | intergenic (+101/+159) | USA300TCH1516_02485 → / ← USA300HOU_RS13450 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,608,825 | A→T | 15.0% | intergenic (+106/+154) | USA300TCH1516_02485 → / ← USA300HOU_RS13450 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,608,829 | C→T | 11.1% | intergenic (+110/+150) | USA300TCH1516_02485 → / ← USA300HOU_RS13450 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,611,882 | T→G | 5.5% | intergenic (‑205/+7) | USA300HOU_RS13465 ← / ← USA300TCH1516_02490 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,611,883 | C→A | 5.1% | intergenic (‑206/+6) | USA300HOU_RS13465 ← / ← USA300TCH1516_02490 | hypothetical protein/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,627,278 | Δ1 bp | 8.6% | intergenic (‑216/‑109) | sarT ← / → sarU | HTH‑type transcriptional regulator SarT/HTH‑type transcriptional regulator SarU |
| RA | USA300TCH1516_ALE | 2,627,280:1 | +A | 8.4% | intergenic (‑218/‑107) | sarT ← / → sarU | HTH‑type transcriptional regulator SarT/HTH‑type transcriptional regulator SarU |
| RA | USA300TCH1516_ALE | 2,636,962 | A→T | 5.4% | Y271* (TAT→TAA) | gntT ← | High‑affinity gluconate transporter |
| RA | USA300TCH1516_ALE | 2,636,965 | A→T | 5.1% | I270I (ATT→ATA) | gntT ← | High‑affinity gluconate transporter |
| RA | USA300TCH1516_ALE | 2,679,168 | T→C | 7.6% | intergenic (+40/‑349) | USA300HOU_RS13790 → / → ssaA2_4 | hypothetical protein/Staphylococcal secretory antigen ssaA2 |
| RA | USA300TCH1516_ALE | 2,701,267 | C→T | 5.0% | V198M (GTG→ATG) | bacF ← | Transaminase BacF |
| RA | USA300TCH1516_ALE | 2,725,352 | A→T | 12.1% | intergenic (‑58/+276) | USA300HOU_RS14015 ← / ← USA300HOU_RS14020 | Baeyer‑Villiger flavin‑containing monooxygenase/hypothetical protein |
| RA | USA300TCH1516_ALE | 2,744,200 | G→A | 9.6% | intergenic (+137/+56) | fda → / ← mqo2 | Fructose‑bisphosphate aldolase class 1/putative malate:quinone oxidoreductase 2 |
| RA | USA300TCH1516_ALE | 2,744,205 | A→G | 14.4% | intergenic (+142/+51) | fda → / ← mqo2 | Fructose‑bisphosphate aldolase class 1/putative malate:quinone oxidoreductase 2 |
| RA | USA300TCH1516_ALE | 2,744,213 | T→A | 14.9% | intergenic (+150/+43) | fda → / ← mqo2 | Fructose‑bisphosphate aldolase class 1/putative malate:quinone oxidoreductase 2 |
| RA | USA300TCH1516_ALE | 2,744,226 | T→C | 12.9% | intergenic (+163/+30) | fda → / ← mqo2 | Fructose‑bisphosphate aldolase class 1/putative malate:quinone oxidoreductase 2 |
| RA | USA300TCH1516_ALE | 2,780,409 | A→C | 5.2% | Y106* (TAT→TAG) | arcD_2 ← | Arginine/ornithine antiporter |
| RA | USA300TCH1516_ALE | 2,825,587 | C→T | 5.2% | intergenic (‑402/+446) | cap8A_2 ← / ← icaR | Capsular polysaccharide type 8 biosynthesis protein cap8A/Biofilm operon icaADBC HTH‑type negative transcriptional regulator IcaR |
| RA | USA300TCH1516_ALE | 2,825,599 | A→G | 8.4% | intergenic (‑414/+434) | cap8A_2 ← / ← icaR | Capsular polysaccharide type 8 biosynthesis protein cap8A/Biofilm operon icaADBC HTH‑type negative transcriptional regulator IcaR |
| RA | USA300TCH1516_ALE | 2,833,387 | G→C | 11.9% | intergenic (‑723/+367) | lipA_2 ← / ← hisI | Lipase 1/Phosphoribosyl‑AMP cyclohydrolase |
| Unassigned new junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | CP000731 | 34 = | 384 (0.420) | 78 (0.090) | 17/146 | NT | 14.2% | intergenic (–/‑198) | –/repA | –/replication protein A |
| ? | CP000731 | 65 = | 593 (0.710) | intergenic (–/‑167) | –/repA | –/replication protein A | |||||
| * | ? | CP000731 | = 64 | 652 (0.710) | 83 (0.160) +33 bp |
14/94 | NT | 30.4% | intergenic (–/‑168) | –/repA | –/replication protein A |
| ? | CP000731 | = 27041 | 0 (0.000) | intergenic (‑194/–) | USA300HOU_pUSA300HOUMR0033/– | partitioning protein/– | |||||
| * | ? | CP000731 | 3772 = | 705 (0.770) | 75 (0.090) | 18/140 | NT | 10.8% | intergenic (+388/‑96) | USA300HOU_pUSA300HOUMR0005/USA300HOU_pUSA300HOUMR0006 | hypothetical protein/hypothetical protein |
| ? | CP000731 | 3805 = | 628 (0.790) | intergenic (+421/‑63) | USA300HOU_pUSA300HOUMR0005/USA300HOU_pUSA300HOUMR0006 | hypothetical protein/hypothetical protein | |||||
| * | ? | CP000731 | = 3781 | 672 (0.730) | 119 (0.150) | 18/140 | NT | 16.4% | intergenic (+397/‑87) | USA300HOU_pUSA300HOUMR0005/USA300HOU_pUSA300HOUMR0006 | hypothetical protein/hypothetical protein |
| ? | CP000731 | = 3794 | 628 (0.790) | intergenic (+410/‑74) | USA300HOU_pUSA300HOUMR0005/USA300HOU_pUSA300HOUMR0006 | hypothetical protein/hypothetical protein | |||||
| * | ? | CP000731 | = 4373 | 180 (0.200) | 165 (0.120) | 15/148 | NT | 25.8% | intergenic (+338/‑127) | USA300HOU_pUSA300HOUMR0006/cadR | hypothetical protein/cadmium binding protein |
| ? | NC_012417 | = 1986 | 785 (0.410) | intergenic (+219/+107) | USA300HOU_RS14895/USA300HOU_RS14900 | hypothetical protein/hypothetical protein | |||||
| * | ? | CP000731 | 7662 = | 892 (0.970) | 119 (0.150) | 20/138 | NT | 13.1% | intergenic (+272/+254) | USA300HOU_pUSA300HOUMR0010/blaZ | MarR family transcriptional regulator/beta‑lactamase |
| ? | CP000731 | 7700 = | 816 (1.040) | intergenic (+310/+216) | USA300HOU_pUSA300HOUMR0010/blaZ | MarR family transcriptional regulator/beta‑lactamase | |||||
| * | ? | CP000731 | = 7672 | 883 (0.960) | 132 (0.170) | 19/138 | NT | 14.3% | intergenic (+282/+244) | USA300HOU_pUSA300HOUMR0010/blaZ | MarR family transcriptional regulator/beta‑lactamase |
| ? | CP000731 | = 7688 | 816 (1.040) | intergenic (+298/+228) | USA300HOU_pUSA300HOUMR0010/blaZ | MarR family transcriptional regulator/beta‑lactamase | |||||
| * | ? | CP000731 | 11951 = | 983 (1.070) | 61 (0.080) | 20/134 | NT | 7.5% | intergenic (+114/+109) | USA300HOU_pUSA300HOUMR0014/USA300HOU_pUSA300HOUMR0015 | recombinase/hypothetical protein |
| ? | CP000731 | 11987 = | 687 (0.900) | intergenic (+150/+73) | USA300HOU_pUSA300HOUMR0014/USA300HOU_pUSA300HOUMR0015 | recombinase/hypothetical protein | |||||
| * | ? | CP000731 | = 12901 | NA (NA) | 6 (0.010) | 3/146 | NT | NA | coding (395/675 nt) | USA300HOU_pUSA300HOUMR0016 | IS257 transposase |
| ? | CP000731 | = 12938 | NA (NA) | coding (432/675 nt) | USA300HOU_pUSA300HOUMR0016 | IS257 transposase | |||||
| * | ? | CP000731 | 17008 = | NA (NA) | 29 (0.030) | 13/148 | NT | 100% | coding (54/675 nt) | USA300HOU_pUSA300HOUMR0021 | IS431 mec transposase |
| ? | CP000731 | 17011 = | 0 (0.000) | coding (51/675 nt) | USA300HOU_pUSA300HOUMR0021 | IS431 mec transposase | |||||
| * | ? | CP000731 | 19515 = | 750 (0.820) | 38 (0.040) | 13/148 | NT | 5.4% | intergenic (‑557/+881) | USA300HOU_pUSA300HOUMR0024/USA300HOU_pUSA300HOUMR0027 | bacitracin ABC ATP binding cassette transporter, ABC protein/IS431mec transposase |
| ? | CP000731 | 19534 = | 651 (0.770) | intergenic (‑576/+862) | USA300HOU_pUSA300HOUMR0024/USA300HOU_pUSA300HOUMR0027 | bacitracin ABC ATP binding cassette transporter, ABC protein/IS431mec transposase | |||||
| * | ? | CP000731 | 20439 = | 584 (0.640) | 50 (0.090) | 14/154 | NT | 13.7% | coding (632/675 nt) | USA300HOU_pUSA300HOUMR0027 | IS431mec transposase |
| ? | USA300TCH1516_ALE | 35944 = | 69 (0.350) | coding (608/675 nt) | USA300HOU_RS00140 | hypothetical protein | |||||
| * | ? | CP000731 | = 21481 | 549 (0.600) | 136 (0.170) | 17/144 | NT | 20.6% | intergenic (‑411/‑63) | USA300HOU_pUSA300HOUMR0027/USA300HOU_pUSA300HOUMR0028 | IS431mec transposase/macrolide transporter |
| ? | CP000731 | = 21492 | 553 (0.670) | intergenic (‑422/‑52) | USA300HOU_pUSA300HOUMR0027/USA300HOU_pUSA300HOUMR0028 | IS431mec transposase/macrolide transporter | |||||
| * | ? | CP000731 | 25265 = | 593 (0.650) | 26 (0.040) | 12/114 | NT | 5.3% | intergenic (+163/‑83) | USA300HOU_pUSA300HOUMR0030/USA300HOU_pUSA300HOUMR0031 | Sin recombinase/hypothetical protein |
| ? | CP000731 | 25334 = | 508 (0.780) | intergenic (+232/‑14) | USA300HOU_pUSA300HOUMR0030/USA300HOU_pUSA300HOUMR0031 | Sin recombinase/hypothetical protein | |||||
| * | ? | CP000731 | = 25287 | 559 (0.610) | 38 (0.060) | 12/114 | NT | 7.8% | intergenic (+185/‑61) | USA300HOU_pUSA300HOUMR0030/USA300HOU_pUSA300HOUMR0031 | Sin recombinase/hypothetical protein |
| ? | CP000731 | = 25310 | 508 (0.780) | intergenic (+208/‑38) | USA300HOU_pUSA300HOUMR0030/USA300HOU_pUSA300HOUMR0031 | Sin recombinase/hypothetical protein | |||||
| * | ? | CP000731 | 25306 = | 509 (0.560) | 103 (0.130) | 20/138 | NT | 19.7% | intergenic (+204/‑42) | USA300HOU_pUSA300HOUMR0030/USA300HOU_pUSA300HOUMR0031 | Sin recombinase/hypothetical protein |
| ? | CP000731 | 25340 = | 401 (0.510) | intergenic (+238/‑8) | USA300HOU_pUSA300HOUMR0030/USA300HOU_pUSA300HOUMR0031 | Sin recombinase/hypothetical protein | |||||
| * | ? | NC_012417 | 1 = | 0 (0.000) | 31 (0.020) +ATAAAAAGAC |
8/140 | NT | 5.5% | intergenic (–/‑279) | –/USA300HOU_RS14890 | –/replication protein |
| ? | NC_012417 | 3071 = | 1228 (0.590) | intergenic (‑397/–) | USA300HOU_RS14900/– | hypothetical protein/– | |||||
| * | ? | NC_012417 | 987 = | 980 (0.470) | 192 (0.110) | 19/138 | NT | 19.2% | pseudogene (708/709 nt) | USA300HOU_RS14890 | replication protein |
| ? | NC_012417 | 1013 = | 777 (0.430) | coding (182/192 nt) | USA300HOU_RS15665 | hypothetical protein | |||||
| * | ? | NC_012417 | = 997 | 894 (0.430) | 152 (0.080) | 30/138 | NT | 16.4% | intergenic (+9/+6) | USA300HOU_RS14890/USA300HOU_RS15665 | replication protein/hypothetical protein |
| ? | NC_012417 | = 1001 | 777 (0.430) | intergenic (+13/+2) | USA300HOU_RS14890/USA300HOU_RS15665 | replication protein/hypothetical protein | |||||
| * | ? | NC_012417 | = 1057 | 604 (0.290) | 50 (0.030) | 16/124 | NT | 7.9% | coding (138/192 nt) | USA300HOU_RS15665 | hypothetical protein |
| ? | NC_012417 | = 1071 | 705 (0.440) | coding (124/192 nt) | USA300HOU_RS15665 | hypothetical protein | |||||
| * | ? | NC_012417 | = 1974 | 1112 (0.530) | 157 (0.090) | 16/138 | NT | 14.1% | intergenic (+207/+119) | USA300HOU_RS14895/USA300HOU_RS14900 | hypothetical protein/hypothetical protein |
| ? | NC_012417 | = 2041 | NA (NA) | intergenic (+274/+52) | USA300HOU_RS14895/USA300HOU_RS14900 | hypothetical protein/hypothetical protein | |||||
| * | ? | NC_012417 | 1975 = | NA (NA) | 186 (0.100) | 20/138 | NT | 24.8% | intergenic (+208/+118) | USA300HOU_RS14895/USA300HOU_RS14900 | hypothetical protein/hypothetical protein |
| ? | NC_012417 | 2042 = | 654 (0.310) | intergenic (+275/+51) | USA300HOU_RS14895/USA300HOU_RS14900 | hypothetical protein/hypothetical protein | |||||
| * | ? | NC_012417 | 1993 = | NA (NA) | 197 (0.100) | 16/148 | NT | 29.5% | intergenic (+226/+100) | USA300HOU_RS14895/USA300HOU_RS14900 | hypothetical protein/hypothetical protein |
| ? | NC_012417 | 2021 = | 509 (0.240) | intergenic (+254/+72) | USA300HOU_RS14895/USA300HOU_RS14900 | hypothetical protein/hypothetical protein | |||||
| * | ? | NC_012417 | = 3077 | 1075 (0.510) | 47 (0.020) | 11/146 | NT | 7.5% | intergenic (‑403/–) | USA300HOU_RS14900/– | hypothetical protein/– |
| ? | NC_012417 | = 3108 | 180 (0.090) | intergenic (‑434/–) | USA300HOU_RS14900/– | hypothetical protein/– | |||||
| * | ? | USA300TCH1516_ALE | = 2161 | 198 (0.970) | 13 (0.070) | 10/152 | NT | 6.4% | intergenic (+256/‑22) | dnaA/dnaN | Chromosomal replication initiator protein DnaA/DNA polymerase III subunit beta |
| ? | USA300TCH1516_ALE | = 2172 | 195 (1.010) | intergenic (+267/‑11) | dnaA/dnaN | Chromosomal replication initiator protein DnaA/DNA polymerase III subunit beta | |||||
| * | ? | USA300TCH1516_ALE | = 27343 | 204 (1.000) | 11 (0.060) | 5/148 | NT | 5.4% | coding (1678/1827 nt) | walK | Sensor protein kinase WalK |
| ? | USA300TCH1516_ALE | = 27364 | 197 (1.050) | coding (1699/1827 nt) | walK | Sensor protein kinase WalK | |||||
| * | ? | USA300TCH1516_ALE | = 29630 | 170 (0.830) | 12 (0.070) | 8/142 | NT | 7.2% | intergenic (+22/‑368) | yycI/yycJ | Two‑component system WalR/WalK regulatory protein YycI/Putative metallo‑hydrolase YycJ |
| ? | USA300TCH1516_ALE | = 29658 | 158 (0.880) | intergenic (+50/‑340) | yycI/yycJ | Two‑component system WalR/WalK regulatory protein YycI/Putative metallo‑hydrolase YycJ | |||||
| * | ? | USA300TCH1516_ALE | = 34819 | 169 (0.830) | 17 (0.100) | 10/136 | NT | 10.4% | coding (307/1257 nt) | USA300HOU_RS00135 | hypothetical protein |
| ? | USA300TCH1516_ALE | = 34830 | 150 (0.870) | coding (318/1257 nt) | USA300HOU_RS00135 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 37045 | 144 (0.710) | 20 (0.120) | 9/128 | NT | 13.9% | intergenic (+69/‑768) | USA300HOU_RS14915/ugpQ_1 | hypothetical protein/Glycerophosphodiester phosphodiesterase, cytoplasmic |
| ? | USA300TCH1516_ALE | = 37067 | 133 (0.820) | intergenic (+91/‑746) | USA300HOU_RS14915/ugpQ_1 | hypothetical protein/Glycerophosphodiester phosphodiesterase, cytoplasmic | |||||
| * | ? | USA300TCH1516_ALE | 42499 = | 235 (1.150) | 19 (0.120) +ATAAATTTTTTGATTATTTT |
9/120 | NT | 17.8% | coding (1467/1524 nt) | USA300TCH1516_00035 | hypothetical protein |
| ? | USA300TCH1516_ALE | = 1912410 | 0 (0.000) | coding (532/609 nt) | USA300HOU_RS15290 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 42564 = | 225 (1.100) | 80 (0.530) +TACATTATAAAATACATATC |
13/120 | NT | 32.3% | coding (1402/1524 nt) | USA300TCH1516_00035 | hypothetical protein |
| ? | USA300TCH1516_ALE | 1803072 = | NA (NA) | coding (796/807 nt) | USA300HOU_RS12765 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 54568 | 227 (1.110) | 16 (0.080) | 9/156 | NT | 6.7% | intergenic (+15/+609) | USA300HOU_RS00220/gloC_1 | hypothetical protein/Hydroxyacylglutathione hydrolase GloC |
| ? | USA300TCH1516_ALE | = 54603 | 221 (1.110) | intergenic (+50/+574) | USA300HOU_RS00220/gloC_1 | hypothetical protein/Hydroxyacylglutathione hydrolase GloC | |||||
| * | ? | USA300TCH1516_ALE | = 57559 | 247 (1.210) | 43 (0.230) | 14/148 | NT | 15.2% | intergenic (+5/+912) | USA300HOU_RS00240/USA300TCH1516_00049 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 57591 | 251 (1.330) | intergenic (+37/+880) | USA300HOU_RS00240/USA300TCH1516_00049 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 62785 = | 241 (1.180) | 13 (0.070) | 8/142 | NT | 6.6% | intergenic (‑252/+261) | USA300TCH1516_00053/speG | hypothetical protein/Spermidine N(1)‑acetyltransferase |
| ? | USA300TCH1516_ALE | 62819 = | 153 (0.850) | intergenic (‑286/+227) | USA300TCH1516_00053/speG | hypothetical protein/Spermidine N(1)‑acetyltransferase | |||||
| * | ? | USA300TCH1516_ALE | 68500 = | NA (NA) | 7 (0.040) | 4/154 | NT | 5.0% | coding (616/852 nt) | USA300TCH1516_00061 | hypothetical protein |
| ? | USA300TCH1516_ALE | 68542 = | 138 (0.680) | coding (658/852 nt) | USA300TCH1516_00061 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 75971 = | 184 (0.900) | 18 (0.110) | 12/128 | NT | 10.8% | intergenic (+29/‑244) | USA300HOU_RS00335/USA300HOU_RS00140 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 76020 = | 151 (0.930) | intergenic (+78/‑195) | USA300HOU_RS00335/USA300HOU_RS00140 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 75986 | 174 (0.850) | 28 (0.170) | 14/128 | NT | 16.2% | intergenic (+44/‑229) | USA300HOU_RS00335/USA300HOU_RS00140 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 76003 | 151 (0.930) | intergenic (+61/‑212) | USA300HOU_RS00335/USA300HOU_RS00140 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 82395 = | 176 (0.860) | 9 (0.050) | 5/152 | NT | 5.3% | coding (500/957 nt) | nikB_1 | Nickel transport system permease protein NikB |
| ? | USA300TCH1516_ALE | 82432 = | 152 (0.790) | coding (537/957 nt) | nikB_1 | Nickel transport system permease protein NikB | |||||
| * | ? | USA300TCH1516_ALE | 88662 = | 245 (1.200) | 19 (0.120) | 9/126 | NT | 9.7% | intergenic (+35/‑730) | nusG_1/USA300TCH1516_00080 | Transcription termination/antitermination protein NusG/hypothetical protein |
| ? | USA300TCH1516_ALE | 88722 = | 163 (1.020) | intergenic (+95/‑670) | nusG_1/USA300TCH1516_00080 | Transcription termination/antitermination protein NusG/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 127837 = | 148 (0.730) | 8 (0.050) | 6/138 | NT | 5.7% | intergenic (+57/+272) | lctP_1/spa | L‑lactate permease/Immunoglobulin G‑binding protein A |
| ? | USA300TCH1516_ALE | 127883 = | 138 (0.790) | intergenic (+103/+226) | lctP_1/spa | L‑lactate permease/Immunoglobulin G‑binding protein A | |||||
| * | ? | USA300TCH1516_ALE | = 127847 | 160 (0.790) | 8 (0.050) | 4/138 | NT | 5.5% | intergenic (+67/+262) | lctP_1/spa | L‑lactate permease/Immunoglobulin G‑binding protein A |
| ? | USA300TCH1516_ALE | = 127871 | 138 (0.790) | intergenic (+91/+238) | lctP_1/spa | L‑lactate permease/Immunoglobulin G‑binding protein A | |||||
| * | ? | USA300TCH1516_ALE | 145649 = | 193 (0.950) | 13 (0.070) | 6/140 | NT | 7.2% | intergenic (+74/‑122) | noc_1/USA300HOU_RS00655 | Nucleoid occlusion protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 145689 = | 168 (0.940) | intergenic (+114/‑82) | noc_1/USA300HOU_RS00655 | Nucleoid occlusion protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 161003 = | 188 (0.920) | 22 (0.140) | 8/124 | NT | 15.1% | intergenic (+17/+114) | deoB/phnE_1 | Phosphopentomutase/Phosphate‑import permease protein PhnE |
| ? | USA300TCH1516_ALE | 161059 = | 102 (0.650) | intergenic (+73/+58) | deoB/phnE_1 | Phosphopentomutase/Phosphate‑import permease protein PhnE | |||||
| * | ? | USA300TCH1516_ALE | 194938 = | 206 (1.010) | 16 (0.090) | 8/146 | NT | 8.1% | intergenic (+14/+48) | czcD_1/USA300HOU_RS00900 | Cadmium, cobalt and zinc/H(+)‑K(+) antiporter/hypothetical protein |
| ? | USA300TCH1516_ALE | 194970 = | 174 (0.940) | intergenic (+46/+16) | czcD_1/USA300HOU_RS00900 | Cadmium, cobalt and zinc/H(+)‑K(+) antiporter/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 211704 = | 157 (0.770) | 9 (0.050) | 7/142 | NT | 5.6% | intergenic (+262/+66) | sfp/yagU | 4'‑phosphopantetheinyl transferase sfp/Inner membrane protein YagU |
| ? | USA300TCH1516_ALE | 211755 = | 162 (0.900) | intergenic (+313/+15) | sfp/yagU | 4'‑phosphopantetheinyl transferase sfp/Inner membrane protein YagU | |||||
| * | ? | USA300TCH1516_ALE | 221178 = | 144 (0.710) | 31 (0.170) | 11/146 | NT | 17.9% | intergenic (‑224/+50) | ipdC/ptsG_1 | Indole‑3‑pyruvate decarboxylase/PTS system glucose‑specific EIICBA component |
| ? | USA300TCH1516_ALE | 221218 = | 153 (0.820) | intergenic (‑264/+10) | ipdC/ptsG_1 | Indole‑3‑pyruvate decarboxylase/PTS system glucose‑specific EIICBA component | |||||
| * | ? | USA300TCH1516_ALE | = 221184 | 145 (0.710) | 11 (0.060) | 8/146 | NT | 7.2% | intergenic (‑230/+44) | ipdC/ptsG_1 | Indole‑3‑pyruvate decarboxylase/PTS system glucose‑specific EIICBA component |
| ? | USA300TCH1516_ALE | = 221210 | 153 (0.820) | intergenic (‑256/+18) | ipdC/ptsG_1 | Indole‑3‑pyruvate decarboxylase/PTS system glucose‑specific EIICBA component | |||||
| * | ? | USA300TCH1516_ALE | 231639 = | 201 (0.990) | 22 (0.120) | 13/146 | NT | 10.8% | intergenic (+8/‑197) | hsdR/USA300HOU_RS01035 | Type‑1 restriction enzyme R protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 231667 = | 179 (0.960) | intergenic (+36/‑169) | hsdR/USA300HOU_RS01035 | Type‑1 restriction enzyme R protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 256315 | 166 (0.810) | 9 (0.050) | 7/142 | NT | 5.6% | intergenic (+60/+299) | uhpT/USA300HOU_RS01135 | Hexose‑6‑phosphate:phosphate antiporter/putative response regulatory protein |
| ? | USA300TCH1516_ALE | = 256379 | 158 (0.880) | intergenic (+124/+235) | uhpT/USA300HOU_RS01135 | Hexose‑6‑phosphate:phosphate antiporter/putative response regulatory protein | |||||
| * | ? | USA300TCH1516_ALE | = 256532 | 170 (0.830) | 30 (0.180) | 14/132 | NT | 16.4% | intergenic (+277/+82) | uhpT/USA300HOU_RS01135 | Hexose‑6‑phosphate:phosphate antiporter/putative response regulatory protein |
| ? | USA300TCH1516_ALE | = 256554 | 167 (1.000) | intergenic (+299/+60) | uhpT/USA300HOU_RS01135 | Hexose‑6‑phosphate:phosphate antiporter/putative response regulatory protein | |||||
| * | ? | USA300TCH1516_ALE | 260284 = | 152 (0.750) | 14 (0.080) | 8/138 | NT | 9.7% | intergenic (‑398/‑190) | potD_1/pflB | Spermidine/putrescine‑binding periplasmic protein/Formate acetyltransferase |
| ? | USA300TCH1516_ALE | 260324 = | 131 (0.750) | intergenic (‑438/‑150) | potD_1/pflB | Spermidine/putrescine‑binding periplasmic protein/Formate acetyltransferase | |||||
| * | ? | USA300TCH1516_ALE | = 260294 | 153 (0.750) | 11 (0.060) | 5/138 | NT | 7.7% | intergenic (‑408/‑180) | potD_1/pflB | Spermidine/putrescine‑binding periplasmic protein/Formate acetyltransferase |
| ? | USA300TCH1516_ALE | = 260312 | 131 (0.750) | intergenic (‑426/‑162) | potD_1/pflB | Spermidine/putrescine‑binding periplasmic protein/Formate acetyltransferase | |||||
| * | ? | USA300TCH1516_ALE | 263517 = | 156 (0.770) | 24 (0.130) | 8/146 | NT | 13.5% | intergenic (+16/‑320) | pflA/ugpQ_2 | Pyruvate formate‑lyase‑activating enzyme/Glycerophosphodiester phosphodiesterase, cytoplasmic |
| ? | USA300TCH1516_ALE | 263566 = | 166 (0.890) | intergenic (+65/‑271) | pflA/ugpQ_2 | Pyruvate formate‑lyase‑activating enzyme/Glycerophosphodiester phosphodiesterase, cytoplasmic | |||||
| * | ? | USA300TCH1516_ALE | = 263532 | 162 (0.800) | 21 (0.120) | 12/140 | NT | 12.4% | intergenic (+31/‑305) | pflA/ugpQ_2 | Pyruvate formate‑lyase‑activating enzyme/Glycerophosphodiester phosphodiesterase, cytoplasmic |
| ? | USA300TCH1516_ALE | = 263550 | 155 (0.870) | intergenic (+49/‑287) | pflA/ugpQ_2 | Pyruvate formate‑lyase‑activating enzyme/Glycerophosphodiester phosphodiesterase, cytoplasmic | |||||
| * | ? | USA300TCH1516_ALE | 278631 = | 186 (0.910) | 19 (0.110) | 6/140 | NT | 10.5% | intergenic (+226/+88) | USA300HOU_RS01215/gsiB | hypothetical protein/Glutathione‑binding protein GsiB |
| ? | USA300TCH1516_ALE | 278672 = | 161 (0.900) | intergenic (+267/+47) | USA300HOU_RS01215/gsiB | hypothetical protein/Glutathione‑binding protein GsiB | |||||
| * | ? | USA300TCH1516_ALE | = 278640 | 178 (0.870) | 24 (0.130) | 8/140 | NT | 13.2% | intergenic (+235/+79) | USA300HOU_RS01215/gsiB | hypothetical protein/Glutathione‑binding protein GsiB |
| ? | USA300TCH1516_ALE | = 278661 | 161 (0.900) | intergenic (+256/+58) | USA300HOU_RS01215/gsiB | hypothetical protein/Glutathione‑binding protein GsiB | |||||
| * | ? | USA300TCH1516_ALE | = 280894 | 206 (1.010) | 15 (0.090) +TTAATTGGGAGTA |
5/134 | NT | 8.8% | intergenic (‑146/+11) | USA300HOU_RS01225/USA300HOU_RS01230 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 855632 = | 165 (0.810) | intergenic (+163/‑597) | zipA_1/cggR | Cell division protein ZipA/Central glycolytic genes regulator | |||||
| * | ? | USA300TCH1516_ALE | = 284040 | 167 (0.820) | 10 (0.060) | 6/140 | NT | 6.0% | intergenic (+265/+55) | ldh1/ptsG_2 | L‑lactate dehydrogenase 1/PTS system glucose‑specific EIICBA component |
| ? | USA300TCH1516_ALE | = 284055 | 165 (0.930) | intergenic (+280/+40) | ldh1/ptsG_2 | L‑lactate dehydrogenase 1/PTS system glucose‑specific EIICBA component | |||||
| * | ? | USA300TCH1516_ALE | = 313030 | 173 (0.850) | 10 (0.050) | 6/146 | NT | 6.2% | intergenic (+83/+351) | bglA/rebM | Aryl‑phospho‑beta‑D‑glucosidase BglA/Demethylrebeccamycin‑D‑glucose O‑methyltransferase |
| ? | USA300TCH1516_ALE | = 313078 | 146 (0.790) | intergenic (+131/+303) | bglA/rebM | Aryl‑phospho‑beta‑D‑glucosidase BglA/Demethylrebeccamycin‑D‑glucose O‑methyltransferase | |||||
| * | ? | USA300TCH1516_ALE | = 319232 | 206 (1.010) | 24 (0.160) +TCATAATAAAATGCATATC |
11/122 | NT | 12.9% | coding (368/405 nt) | USA300TCH1516_00272 | hypothetical protein |
| ? | USA300TCH1516_ALE | = 2432264 | 219 (1.080) | intergenic (+611/+36) | birA_2/USA300HOU_RS12525 | Bifunctional ligase/repressor BirA/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 326015 = | 192 (0.940) | 25 (0.140) | 13/142 | NT | 12.5% | intergenic (‑19/+49) | USA300HOU_RS01460/USA300HOU_RS01465 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 326051 = | 181 (1.000) | intergenic (‑55/+13) | USA300HOU_RS01460/USA300HOU_RS01465 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 326023 | 194 (0.950) | 22 (0.120) | 11/142 | NT | 11.1% | intergenic (‑27/+41) | USA300HOU_RS01460/USA300HOU_RS01465 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 326041 | 181 (1.000) | intergenic (‑45/+23) | USA300HOU_RS01460/USA300HOU_RS01465 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 329202 = | 185 (0.910) | 26 (0.150) | 12/140 | NT | 14.1% | intergenic (+70/+73) | USA300HOU_RS01475/ssaA2_1 | hypothetical protein/Staphylococcal secretory antigen ssaA2 |
| ? | USA300TCH1516_ALE | 329255 = | 156 (0.880) | intergenic (+123/+20) | USA300HOU_RS01475/ssaA2_1 | hypothetical protein/Staphylococcal secretory antigen ssaA2 | |||||
| * | ? | USA300TCH1516_ALE | = 329211 | 178 (0.870) | 18 (0.100) | 8/140 | NT | 10.4% | intergenic (+79/+64) | USA300HOU_RS01475/ssaA2_1 | hypothetical protein/Staphylococcal secretory antigen ssaA2 |
| ? | USA300TCH1516_ALE | = 329244 | 156 (0.880) | intergenic (+112/+31) | USA300HOU_RS01475/ssaA2_1 | hypothetical protein/Staphylococcal secretory antigen ssaA2 | |||||
| * | ? | USA300TCH1516_ALE | 330724 = | 227 (1.110) | 18 (0.100) | 14/148 | NT | 8.5% | intergenic (+15/‑69) | esxA/esaA | ESAT‑6 secretion system extracellular protein A/ESAT‑6 secretion accessory factor EsaA |
| ? | USA300TCH1516_ALE | 330754 = | 178 (0.950) | intergenic (+45/‑39) | esxA/esaA | ESAT‑6 secretion system extracellular protein A/ESAT‑6 secretion accessory factor EsaA | |||||
| * | ? | USA300TCH1516_ALE | 337678 = | 183 (0.900) | 11 (0.060) | 5/146 | NT | 6.2% | coding (1816/4440 nt) | essC | ESAT‑6 secretion machinery protein EssC |
| ? | USA300TCH1516_ALE | 337710 = | 167 (0.900) | coding (1848/4440 nt) | essC | ESAT‑6 secretion machinery protein EssC | |||||
| * | ? | USA300TCH1516_ALE | = 344426 | 177 (0.870) | 48 (0.280) | 14/136 | NT | 23.1% | intergenic (+25/‑183) | yezG_1/USA300HOU_RS01545 | putative antitoxin YezG/hypothetical protein |
| ? | USA300TCH1516_ALE | = 344433 | 170 (0.980) | intergenic (+32/‑176) | yezG_1/USA300HOU_RS01545 | putative antitoxin YezG/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 349720 = | 256 (1.260) | 15 (0.080) | 9/142 | NT | 7.0% | intergenic (+272/‑314) | USA300HOU_RS01580/yezG_6 | hypothetical protein/putative antitoxin YezG |
| ? | USA300TCH1516_ALE | 349754 = | 172 (0.950) | intergenic (+306/‑280) | USA300HOU_RS01580/yezG_6 | hypothetical protein/putative antitoxin YezG | |||||
| * | ? | USA300TCH1516_ALE | = 351315 | NA (NA) | 13 (0.070) | 6/146 | NT | 5.7% | coding (259/501 nt) | yezG_8 | putative antitoxin YezG |
| ? | USA300TCH1516_ALE | = 352313 | 238 (1.170) | coding (235/489 nt) | yezG_10 | putative antitoxin YezG | |||||
| * | ? | USA300TCH1516_ALE | 365029 = | 120 (0.590) | 17 (0.100) | 6/136 | NT | 12.4% | intergenic (+39/+66) | nupC_1/sglT | Nucleoside permease NupC/Sodium/glucose cotransporter |
| ? | USA300TCH1516_ALE | 365083 = | 138 (0.800) | intergenic (+93/+12) | nupC_1/sglT | Nucleoside permease NupC/Sodium/glucose cotransporter | |||||
| * | ? | USA300TCH1516_ALE | = 365040 | 123 (0.600) | 23 (0.130) | 10/136 | NT | 16.0% | intergenic (+50/+55) | nupC_1/sglT | Nucleoside permease NupC/Sodium/glucose cotransporter |
| ? | USA300TCH1516_ALE | = 365070 | 138 (0.800) | intergenic (+80/+25) | nupC_1/sglT | Nucleoside permease NupC/Sodium/glucose cotransporter | |||||
| * | ? | USA300TCH1516_ALE | = 368778 | 157 (0.770) | 11 (0.060) | 7/150 | NT | 6.8% | intergenic (+212/+66) | bglK/ybbH_2 | Beta‑glucoside kinase/putative HTH‑type transcriptional regulator YbbH |
| ? | USA300TCH1516_ALE | = 368819 | 156 (0.820) | intergenic (+253/+25) | bglK/ybbH_2 | Beta‑glucoside kinase/putative HTH‑type transcriptional regulator YbbH | |||||
| * | ? | USA300TCH1516_ALE | 374491 = | 163 (0.800) | 12 (0.070) | 6/144 | NT | 7.2% | intergenic (+109/+133) | lip2/USA300HOU_RS01705 | Lipase 2/hypothetical protein |
| ? | USA300TCH1516_ALE | 374527 = | 162 (0.880) | intergenic (+145/+97) | lip2/USA300HOU_RS01705 | Lipase 2/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 374498 | 170 (0.830) | 15 (0.080) | 9/144 | NT | 8.7% | intergenic (+116/+126) | lip2/USA300HOU_RS01705 | Lipase 2/hypothetical protein |
| ? | USA300TCH1516_ALE | = 374518 | 162 (0.880) | intergenic (+136/+106) | lip2/USA300HOU_RS01705 | Lipase 2/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 389251 = | 206 (1.010) | 10 (0.060) | 8/132 | NT | 6.5% | intergenic (+4/+79) | USA300HOU_RS01780/glpT | hypothetical protein/Glycerol‑3‑phosphate transporter |
| ? | USA300TCH1516_ALE | 389318 = | 120 (0.720) | intergenic (+71/+12) | USA300HOU_RS01780/glpT | hypothetical protein/Glycerol‑3‑phosphate transporter | |||||
| * | ? | USA300TCH1516_ALE | 393589 = | 127 (0.620) | 14 (0.080) | 9/142 | NT | 10.7% | intergenic (+12/+48) | USA300HOU_RS01800/USA300HOU_RS01805 | NAD(P)H‑dependent FAD/FMN reductase/hypothetical protein |
| ? | USA300TCH1516_ALE | 393631 = | 121 (0.670) | intergenic (+54/+6) | USA300HOU_RS01800/USA300HOU_RS01805 | NAD(P)H‑dependent FAD/FMN reductase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 393597 | 127 (0.620) | 11 (0.060) | 7/142 | NT | 8.6% | intergenic (+20/+40) | USA300HOU_RS01800/USA300HOU_RS01805 | NAD(P)H‑dependent FAD/FMN reductase/hypothetical protein |
| ? | USA300TCH1516_ALE | = 393621 | 121 (0.670) | intergenic (+44/+16) | USA300HOU_RS01800/USA300HOU_RS01805 | NAD(P)H‑dependent FAD/FMN reductase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 407090 = | 121 (0.590) | 9 (0.050) | 7/136 | NT | 7.4% | intergenic (+5/+78) | USA300HOU_RS01880/kynB | putative acetyl‑CoA acyltransferase/Kynurenine formamidase |
| ? | USA300TCH1516_ALE | 407140 = | 123 (0.710) | intergenic (+55/+28) | USA300HOU_RS01880/kynB | putative acetyl‑CoA acyltransferase/Kynurenine formamidase | |||||
| * | ? | USA300TCH1516_ALE | = 407101 | 132 (0.650) | 8 (0.050) | 7/136 | NT | 6.4% | intergenic (+16/+67) | USA300HOU_RS01880/kynB | putative acetyl‑CoA acyltransferase/Kynurenine formamidase |
| ? | USA300TCH1516_ALE | = 407127 | 123 (0.710) | intergenic (+42/+41) | USA300HOU_RS01880/kynB | putative acetyl‑CoA acyltransferase/Kynurenine formamidase | |||||
| * | ? | USA300TCH1516_ALE | 412131 = | 178 (0.870) | 9 (0.050) | 6/144 | NT | 5.7% | coding (1028/1161 nt) | metC | Cystathionine beta‑lyase MetC |
| ? | USA300TCH1516_ALE | 412165 = | 140 (0.760) | coding (994/1161 nt) | metC | Cystathionine beta‑lyase MetC | |||||
| * | ? | USA300TCH1516_ALE | 414290 = | 187 (0.920) | 15 (0.080) | 9/148 | NT | 8.6% | intergenic (‑32/‑632) | metI/spo0C | Cystathionine gamma‑synthase/O‑acetylhomoserine (thiol)‑lyase/Chromosome‑partitioning protein Spo0J |
| ? | USA300TCH1516_ALE | 414341 = | 148 (0.790) | intergenic (‑83/‑581) | metI/spo0C | Cystathionine gamma‑synthase/O‑acetylhomoserine (thiol)‑lyase/Chromosome‑partitioning protein Spo0J | |||||
| * | ? | USA300TCH1516_ALE | = 422512 | 250 (1.230) | 14 (0.080) | 8/136 | NT | 6.1% | coding (581/612 nt) | USA300HOU_RS01965 | hypothetical protein |
| ? | USA300TCH1516_ALE | = 422533 | 216 (1.250) | coding (602/612 nt) | USA300HOU_RS01965 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 425019 | 196 (0.960) | 13 (0.070) | 10/146 | NT | 6.8% | intergenic (+34/‑392) | USA300HOU_RS01985/gpmA_1 | hypothetical protein/2,3‑bisphosphoglycerate‑dependent phosphoglycerate mutase |
| ? | USA300TCH1516_ALE | = 425031 | 176 (0.950) | intergenic (+46/‑380) | USA300HOU_RS01985/gpmA_1 | hypothetical protein/2,3‑bisphosphoglycerate‑dependent phosphoglycerate mutase | |||||
| * | ? | USA300TCH1516_ALE | = 441303 | 155 (0.760) | 24 (0.130) | 12/142 | NT | 13.8% | intergenic (+20/+93) | guaA/USA300HOU_RS02075 | GMP synthase [glutamine‑hydrolyzing]/hypothetical protein |
| ? | USA300TCH1516_ALE | = 441313 | 163 (0.900) | intergenic (+30/+83) | guaA/USA300HOU_RS02075 | GMP synthase [glutamine‑hydrolyzing]/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 447070 | 195 (0.960) | 34 (0.180) | 13/152 | NT | 15.2% | intergenic (+58/‑228) | tst_1/speC_1 | Toxic shock syndrome toxin‑1/Exotoxin type C |
| ? | USA300TCH1516_ALE | = 447093 | 193 (1.000) | intergenic (+81/‑205) | tst_1/speC_1 | Toxic shock syndrome toxin‑1/Exotoxin type C | |||||
| * | ? | USA300TCH1516_ALE | 458360 = | NA (NA) | 5 (0.030) | 4/148 | NT | NA | coding (970/1557 nt) | hsdM_1 | Type I restriction enzyme EcoKI M protein |
| ? | USA300TCH1516_ALE | 458396 = | NA (NA) | coding (1006/1557 nt) | hsdM_1 | Type I restriction enzyme EcoKI M protein | |||||
| * | ? | USA300TCH1516_ALE | = 458414 | NA (NA) | 5 (0.030) | 4/144 | NT | NA | coding (1024/1557 nt) | hsdM_1 | Type I restriction enzyme EcoKI M protein |
| ? | USA300TCH1516_ALE | = 458432 | NA (NA) | coding (1042/1557 nt) | hsdM_1 | Type I restriction enzyme EcoKI M protein | |||||
| * | ? | USA300TCH1516_ALE | = 459477 | 222 (1.090) | 11 (0.060) | 7/144 | NT | 5.2% | coding (538/1212 nt) | USA300HOU_RS02175 | hypothetical protein |
| ? | USA300TCH1516_ALE | 1937075 = | 203 (1.110) | coding (518/1200 nt) | hsdS | Type‑1 restriction enzyme EcoKI specificity protein | |||||
| * | ? | USA300TCH1516_ALE | 492708 = | 109 (0.540) | 17 (0.100) | 9/128 | NT | 14.9% | intergenic (+130/+55) | sle1_1/USA300HOU_RS02345 | N‑acetylmuramoyl‑L‑alanine amidase sle1/hypothetical protein |
| ? | USA300TCH1516_ALE | 492758 = | 108 (0.660) | intergenic (+180/+5) | sle1_1/USA300HOU_RS02345 | N‑acetylmuramoyl‑L‑alanine amidase sle1/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 492723 | 112 (0.550) | 28 (0.170) | 10/128 | NT | 22.1% | intergenic (+145/+40) | sle1_1/USA300HOU_RS02345 | N‑acetylmuramoyl‑L‑alanine amidase sle1/hypothetical protein |
| ? | USA300TCH1516_ALE | = 492741 | 108 (0.660) | intergenic (+163/+22) | sle1_1/USA300HOU_RS02345 | N‑acetylmuramoyl‑L‑alanine amidase sle1/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 494152 = | 141 (0.690) | 12 (0.070) | 6/142 | NT | 8.9% | intergenic (+101/+68) | bltD_1/USA300HOU_RS02360 | Spermine/spermidine acetyltransferase/hypothetical protein |
| ? | USA300TCH1516_ALE | 494194 = | 120 (0.660) | intergenic (+143/+26) | bltD_1/USA300HOU_RS02360 | Spermine/spermidine acetyltransferase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 494160 | 135 (0.660) | 8 (0.040) | 4/142 | NT | 6.3% | intergenic (+109/+60) | bltD_1/USA300HOU_RS02360 | Spermine/spermidine acetyltransferase/hypothetical protein |
| ? | USA300TCH1516_ALE | = 494184 | 120 (0.660) | intergenic (+133/+36) | bltD_1/USA300HOU_RS02360 | Spermine/spermidine acetyltransferase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 511386 = | 175 (0.860) | 11 (0.060) | 7/150 | NT | 6.6% | coding (51/597 nt) | recR | Recombination protein RecR |
| ? | USA300TCH1516_ALE | 511422 = | 146 (0.770) | coding (87/597 nt) | recR | Recombination protein RecR | |||||
| * | ? | USA300TCH1516_ALE | = 511972 | 199 (0.980) | 12 (0.060) | 10/154 | NT | 6.2% | intergenic (+40/‑6723) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase |
| ? | USA300TCH1516_ALE | = 512004 | 174 (0.890) | intergenic (+72/‑6691) | recR/speA_2 | Recombination protein RecR/Arginine decarboxylase | |||||
| * | ? | USA300TCH1516_ALE | 523897 = | 126 (0.620) | 11 (0.070) | 8/130 | NT | 9.1% | coding (308/726 nt) | yfiC | tRNA1(Val) (adenine(37)‑N6)‑methyltransferase |
| ? | USA300TCH1516_ALE | 523942 = | 117 (0.710) | coding (353/726 nt) | yfiC | tRNA1(Val) (adenine(37)‑N6)‑methyltransferase | |||||
| * | ? | USA300TCH1516_ALE | = 523911 | 133 (0.650) | 7 (0.040) | 5/130 | NT | 5.9% | coding (322/726 nt) | yfiC | tRNA1(Val) (adenine(37)‑N6)‑methyltransferase |
| ? | USA300TCH1516_ALE | = 523926 | 117 (0.710) | coding (337/726 nt) | yfiC | tRNA1(Val) (adenine(37)‑N6)‑methyltransferase | |||||
| * | ? | USA300TCH1516_ALE | 549463 = | 215 (1.060) | 21 (0.130) | 10/130 | NT | 12.1% | intergenic (+13/‑216) | ftsH/hslO | ATP‑dependent zinc metalloprotease FtsH/33 kDa chaperonin |
| ? | USA300TCH1516_ALE | 549502 = | 130 (0.790) | intergenic (+52/‑177) | ftsH/hslO | ATP‑dependent zinc metalloprotease FtsH/33 kDa chaperonin | |||||
| * | ? | USA300TCH1516_ALE | 553211 = | 204 (1.000) | 14 (0.080) | 6/138 | NT | 8.4% | coding (182/477 nt) | folK | 2‑amino‑4‑hydroxy‑6‑ hydroxymethyldihydropteridine pyrophosphokinase |
| ? | USA300TCH1516_ALE | 553257 = | 130 (0.740) | coding (228/477 nt) | folK | 2‑amino‑4‑hydroxy‑6‑ hydroxymethyldihydropteridine pyrophosphokinase | |||||
| * | ? | USA300TCH1516_ALE | = 557240 | NA (NA) | 12 (0.060) | 4/152 | NT | NA | intergenic (+298/‑1471) | USA300TCH1516_00504/USA300TCH1516_00505 | tRNA‑Ala/tRNA‑Ile |
| ? | USA300TCH1516_ALE | = 557277 | NA (NA) | intergenic (+335/‑1434) | USA300TCH1516_00504/USA300TCH1516_00505 | tRNA‑Ala/tRNA‑Ile | |||||
| * | ? | USA300TCH1516_ALE | 562451 = | 170 (0.830) | 7 (0.040) | 6/134 | NT | 5.3% | intergenic (+3664/+138) | USA300TCH1516_00505/gabR | tRNA‑Ile/HTH‑type transcriptional regulatory protein GabR |
| ? | USA300TCH1516_ALE | 562497 = | 110 (0.650) | intergenic (+3710/+92) | USA300TCH1516_00505/gabR | tRNA‑Ile/HTH‑type transcriptional regulatory protein GabR | |||||
| * | ? | USA300TCH1516_ALE | 580739 = | 140 (0.690) | 16 (0.100) | 8/130 | NT | 11.7% | intergenic (+33/‑48) | USA300HOU_RS02805/sigH | hypothetical protein/RNA polymerase sigma‑H factor |
| ? | USA300TCH1516_ALE | 580788 = | 129 (0.780) | coding (2/570 nt) | sigH | RNA polymerase sigma‑H factor | |||||
| * | ? | USA300TCH1516_ALE | = 580753 | 144 (0.710) | 13 (0.080) | 7/130 | NT | 9.6% | intergenic (+47/‑34) | USA300HOU_RS02805/sigH | hypothetical protein/RNA polymerase sigma‑H factor |
| ? | USA300TCH1516_ALE | = 580772 | 129 (0.780) | intergenic (+66/‑15) | USA300HOU_RS02805/sigH | hypothetical protein/RNA polymerase sigma‑H factor | |||||
| * | ? | USA300TCH1516_ALE | 587580 = | 155 (0.760) | 7 (0.040) | 5/144 | NT | 5.1% | coding (1484/3552 nt) | rpoB | DNA‑directed RNA polymerase subunit beta |
| ? | USA300TCH1516_ALE | 587615 = | 123 (0.670) | coding (1519/3552 nt) | rpoB | DNA‑directed RNA polymerase subunit beta | |||||
| * | ? | USA300TCH1516_ALE | 598632 = | 108 (0.530) | 10 (0.060) | 5/124 | NT | 9.3% | intergenic (+181/+101) | tuf/yxeP_2 | Elongation factor Tu/putative hydrolase YxeP |
| ? | USA300TCH1516_ALE | 598687 = | 112 (0.710) | intergenic (+236/+46) | tuf/yxeP_2 | Elongation factor Tu/putative hydrolase YxeP | |||||
| * | ? | USA300TCH1516_ALE | = 598649 | 110 (0.540) | 7 (0.040) | 4/124 | NT | 6.6% | intergenic (+198/+84) | tuf/yxeP_2 | Elongation factor Tu/putative hydrolase YxeP |
| ? | USA300TCH1516_ALE | = 598668 | 112 (0.710) | intergenic (+217/+65) | tuf/yxeP_2 | Elongation factor Tu/putative hydrolase YxeP | |||||
| * | ? | USA300TCH1516_ALE | = 630624 | 231 (1.130) | 20 (0.100) | 10/154 | NT | 7.9% | intergenic (+10/‑103) | hxlB/gph_1 | 3‑hexulose‑6‑phosphate isomerase/Phosphoglycolate phosphatase |
| ? | USA300TCH1516_ALE | = 630661 | 245 (1.250) | intergenic (+47/‑66) | hxlB/gph_1 | 3‑hexulose‑6‑phosphate isomerase/Phosphoglycolate phosphatase | |||||
| * | ? | USA300TCH1516_ALE | = 634596 | 178 (0.870) | 18 (0.100) | 13/146 | NT | 9.6% | coding (777/1377 nt) | yhfT | putative acyl‑‑CoA ligase YhfT |
| ? | USA300TCH1516_ALE | = 634622 | 177 (0.950) | coding (803/1377 nt) | yhfT | putative acyl‑‑CoA ligase YhfT | |||||
| * | ? | USA300TCH1516_ALE | = 637748 | 191 (0.940) | 15 (0.080) | 11/150 | NT | 7.9% | intergenic (‑431/+76) | USA300HOU_RS03030/pdxK | hypothetical protein/Pyridoxine kinase |
| ? | USA300TCH1516_ALE | = 637782 | 169 (0.890) | intergenic (‑465/+42) | USA300HOU_RS03030/pdxK | hypothetical protein/Pyridoxine kinase | |||||
| * | ? | USA300TCH1516_ALE | 646656 = | 172 (0.840) | 28 (0.160) | 12/140 | NT | 15.4% | intergenic (+10/‑577) | lipL/galK | Octanoyl‑[GcvH]:protein N‑octanoyltransferase/Galactokinase |
| ? | USA300TCH1516_ALE | 646692 = | 158 (0.890) | intergenic (+46/‑541) | lipL/galK | Octanoyl‑[GcvH]:protein N‑octanoyltransferase/Galactokinase | |||||
| * | ? | USA300TCH1516_ALE | = 646665 | 171 (0.840) | 17 (0.100) | 9/140 | NT | 10.0% | intergenic (+19/‑568) | lipL/galK | Octanoyl‑[GcvH]:protein N‑octanoyltransferase/Galactokinase |
| ? | USA300TCH1516_ALE | = 646681 | 158 (0.890) | intergenic (+35/‑552) | lipL/galK | Octanoyl‑[GcvH]:protein N‑octanoyltransferase/Galactokinase | |||||
| * | ? | USA300TCH1516_ALE | = 650749 | 185 (0.910) | 18 (0.090) | 9/154 | NT | 9.3% | intergenic (+1/+51) | USA300HOU_RS03100/rclA | hypothetical protein/putative pyridine nucleotide‑disulfide oxidoreductase RclA |
| ? | USA300TCH1516_ALE | = 650786 | 173 (0.880) | intergenic (+38/+14) | USA300HOU_RS03100/rclA | hypothetical protein/putative pyridine nucleotide‑disulfide oxidoreductase RclA | |||||
| * | ? | USA300TCH1516_ALE | 671388 = | 198 (0.970) | 9 (0.050) | 6/140 | NT | 5.4% | intergenic (+13/‑375) | argS/nth_1 | Arginine‑‑tRNA ligase/Endonuclease III |
| ? | USA300TCH1516_ALE | 671434 = | 142 (0.800) | intergenic (+59/‑329) | argS/nth_1 | Arginine‑‑tRNA ligase/Endonuclease III | |||||
| * | ? | USA300TCH1516_ALE | 671622 = | 115 (0.560) | 26 (0.140) | 8/146 | NT | 17.8% | intergenic (+247/‑141) | argS/nth_1 | Arginine‑‑tRNA ligase/Endonuclease III |
| ? | USA300TCH1516_ALE | = 2866877 | 136 (0.730) | intergenic (‑276/+177) | USA300HOU_RS14695/noc_2 | hypothetical protein/Nucleoid occlusion protein | |||||
| * | ? | USA300TCH1516_ALE | 672540 = | 204 (1.000) | 19 (0.100) | 12/150 | NT | 8.9% | intergenic (+142/‑237) | nth_1/btuF | Endonuclease III/Vitamin B12‑binding protein |
| ? | USA300TCH1516_ALE | 672565 = | 198 (1.040) | intergenic (+167/‑212) | nth_1/btuF | Endonuclease III/Vitamin B12‑binding protein | |||||
| * | ? | USA300TCH1516_ALE | 676982 = | 195 (0.960) | 44 (0.250) | 12/136 | NT | 21.8% | intergenic (+20/‑142) | USA300HOU_RS03260/USA300HOU_RS03265 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 677017 = | 150 (0.870) | intergenic (+55/‑107) | USA300HOU_RS03260/USA300HOU_RS03265 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 681130 = | 223 (1.090) | 20 (0.120) | 9/136 | NT | 10.4% | intergenic (‑200/+8) | USA300HOU_RS03280/USA300TCH1516_00615 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 681182 = | 155 (0.900) | coding (310/354 nt) | USA300TCH1516_00615 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 682222 = | 235 (1.150) | 36 (0.200) | 16/140 | NT | 15.8% | intergenic (‑64/+45) | USA300TCH1516_00616/rcsF_2 | hypothetical protein/Outer membrane lipoprotein RcsF |
| ? | USA300TCH1516_ALE | 682264 = | 178 (1.000) | intergenic (‑106/+3) | USA300TCH1516_00616/rcsF_2 | hypothetical protein/Outer membrane lipoprotein RcsF | |||||
| * | ? | USA300TCH1516_ALE | 705182 = | 212 (1.040) | 11 (0.060) | 8/142 | NT | 6.3% | intergenic (+932/+228) | nhaK_1/mntA | Sodium, potassium, lithium and rubidium/H(+) antiporter/Manganese‑binding lipoprotein MntA |
| ? | USA300TCH1516_ALE | 705222 = | 142 (0.790) | intergenic (+972/+188) | nhaK_1/mntA | Sodium, potassium, lithium and rubidium/H(+) antiporter/Manganese‑binding lipoprotein MntA | |||||
| * | ? | USA300TCH1516_ALE | 705321 = | 156 (0.770) | 10 (0.060) | 7/142 | NT | 6.0% | intergenic (+1071/+89) | nhaK_1/mntA | Sodium, potassium, lithium and rubidium/H(+) antiporter/Manganese‑binding lipoprotein MntA |
| ? | USA300TCH1516_ALE | 705378 = | 175 (0.970) | intergenic (+1128/+32) | nhaK_1/mntA | Sodium, potassium, lithium and rubidium/H(+) antiporter/Manganese‑binding lipoprotein MntA | |||||
| * | ? | USA300TCH1516_ALE | = 705329 | 167 (0.820) | 17 (0.090) | 10/142 | NT | 9.5% | intergenic (+1079/+81) | nhaK_1/mntA | Sodium, potassium, lithium and rubidium/H(+) antiporter/Manganese‑binding lipoprotein MntA |
| ? | USA300TCH1516_ALE | = 705368 | 175 (0.970) | intergenic (+1118/+42) | nhaK_1/mntA | Sodium, potassium, lithium and rubidium/H(+) antiporter/Manganese‑binding lipoprotein MntA | |||||
| * | ? | USA300TCH1516_ALE | = 710532 | 237 (1.160) | 22 (0.120) | 12/142 | NT | 8.8% | intergenic (+25/+36) | tarA/tagH_1 | N‑acetylglucosaminyldiphosphoundecaprenol N‑acetyl‑beta‑D‑mannosaminyltransferase/Teichoic acids export ATP‑binding protein TagH |
| ? | USA300TCH1516_ALE | = 710552 | 244 (1.350) | intergenic (+45/+16) | tarA/tagH_1 | N‑acetylglucosaminyldiphosphoundecaprenol N‑acetyl‑beta‑D‑mannosaminyltransferase/Teichoic acids export ATP‑binding protein TagH | |||||
| * | ? | USA300TCH1516_ALE | = 712543 | 173 (0.850) | 14 (0.070) | 4/148 | NT | 8.0% | intergenic (+22/‑77) | tagG/tarB | Teichoic acid translocation permease protein TagG/Teichoic acid glycerol‑phosphate primase |
| ? | USA300TCH1516_ALE | = 712566 | 163 (0.870) | intergenic (+45/‑54) | tagG/tarB | Teichoic acid translocation permease protein TagG/Teichoic acid glycerol‑phosphate primase | |||||
| * | ? | USA300TCH1516_ALE | 715303 = | 160 (0.790) | 14 (0.080) | 9/132 | NT | 9.0% | intergenic (+61/+56) | tarD/dacA | Glycerol‑3‑phosphate cytidylyltransferase/D‑alanyl‑D‑alanine carboxypeptidase DacA |
| ? | USA300TCH1516_ALE | 715350 = | 151 (0.900) | intergenic (+108/+9) | tarD/dacA | Glycerol‑3‑phosphate cytidylyltransferase/D‑alanyl‑D‑alanine carboxypeptidase DacA | |||||
| * | ? | USA300TCH1516_ALE | = 715316 | 168 (0.820) | 13 (0.080) | 7/132 | NT | 8.2% | intergenic (+74/+43) | tarD/dacA | Glycerol‑3‑phosphate cytidylyltransferase/D‑alanyl‑D‑alanine carboxypeptidase DacA |
| ? | USA300TCH1516_ALE | = 715335 | 151 (0.900) | intergenic (+93/+24) | tarD/dacA | Glycerol‑3‑phosphate cytidylyltransferase/D‑alanyl‑D‑alanine carboxypeptidase DacA | |||||
| * | ? | USA300TCH1516_ALE | = 724910 | 172 (0.840) | 26 (0.150) | 11/140 | NT | 13.4% | intergenic (+30/‑204) | feuC_1/dhaK | Iron‑uptake system permease protein FeuC/PTS‑dependent dihydroxyacetone kinase, dihydroxyacetone‑binding subunit DhaK |
| ? | USA300TCH1516_ALE | = 724929 | 186 (1.050) | intergenic (+49/‑185) | feuC_1/dhaK | Iron‑uptake system permease protein FeuC/PTS‑dependent dihydroxyacetone kinase, dihydroxyacetone‑binding subunit DhaK | |||||
| * | ? | USA300TCH1516_ALE | 729254 = | 166 (0.810) | 22 (0.130) | 11/136 | NT | 13.3% | intergenic (+55/‑96) | USA300HOU_RS03535/aes | hypothetical protein/Acetyl esterase |
| ? | USA300TCH1516_ALE | 729295 = | 147 (0.850) | intergenic (+96/‑55) | USA300HOU_RS03535/aes | hypothetical protein/Acetyl esterase | |||||
| * | ? | USA300TCH1516_ALE | = 729265 | 170 (0.830) | 23 (0.130) | 8/136 | NT | 13.6% | intergenic (+66/‑85) | USA300HOU_RS03535/aes | hypothetical protein/Acetyl esterase |
| ? | USA300TCH1516_ALE | = 729282 | 147 (0.850) | intergenic (+83/‑68) | USA300HOU_RS03535/aes | hypothetical protein/Acetyl esterase | |||||
| * | ? | USA300TCH1516_ALE | = 745527 | 220 (1.080) | 20 (0.100) | 12/154 | NT | 8.0% | intergenic (+13/‑177) | sarX/USA300HOU_RS03615 | HTH‑type transcriptional regulator SarX/putative transcriptional regulatory protein |
| ? | USA300TCH1516_ALE | = 745553 | 251 (1.280) | intergenic (+39/‑151) | sarX/USA300HOU_RS03615 | HTH‑type transcriptional regulator SarX/putative transcriptional regulatory protein | |||||
| * | ? | USA300TCH1516_ALE | = 753691 | 133 (0.650) | 13 (0.080) | 8/130 | NT | 9.2% | intergenic (+34/+62) | USA300HOU_RS03675/yvdD | hypothetical protein/LOG family protein YvdD |
| ? | USA300TCH1516_ALE | = 753716 | 148 (0.900) | intergenic (+59/+37) | USA300HOU_RS03675/yvdD | hypothetical protein/LOG family protein YvdD | |||||
| * | ? | USA300TCH1516_ALE | = 754401 | 164 (0.810) | 22 (0.120) | 12/146 | NT | 12.6% | coding (379/459 nt) | USA300HOU_RS03685 | hypothetical protein |
| ? | USA300TCH1516_ALE | = 754417 | 155 (0.830) | coding (363/459 nt) | USA300HOU_RS03685 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 760026 = | 226 (1.110) | 21 (0.130) | 12/132 | NT | 11.3% | coding (1674/1674 nt) | USA300HOU_RS03705 | Putative multidrug export ATP‑binding/permease protein |
| ? | USA300TCH1516_ALE | 760070 = | 145 (0.870) | intergenic (+44/+83) | USA300HOU_RS03705/mgrA | Putative multidrug export ATP‑binding/permease protein/HTH‑type transcriptional regulator MgrA | |||||
| * | ? | USA300TCH1516_ALE | = 761262 | 217 (1.070) | 13 (0.070) | 6/148 | NT | 5.9% | coding (440/927 nt) | yciC_2 | Putative metal chaperone YciC |
| ? | USA300TCH1516_ALE | = 761280 | 215 (1.140) | coding (458/927 nt) | yciC_2 | Putative metal chaperone YciC | |||||
| * | ? | USA300TCH1516_ALE | 763745 = | 173 (0.850) | 26 (0.140) | 10/148 | NT | 14.5% | coding (381/1554 nt) | ybhI | Inner membrane protein YbhI |
| ? | USA300TCH1516_ALE | 763773 = | 146 (0.780) | coding (409/1554 nt) | ybhI | Inner membrane protein YbhI | |||||
| * | ? | USA300TCH1516_ALE | = 769784 | 200 (0.980) | 11 (0.060) | 7/146 | NT | 5.4% | coding (91/465 nt) | USA300HOU_RS03760 | hypothetical protein |
| ? | USA300TCH1516_ALE | = 769799 | 201 (1.080) | coding (106/465 nt) | USA300HOU_RS03760 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 782414 = | 191 (0.940) | 13 (0.070) | 7/140 | NT | 6.6% | intergenic (‑209/+133) | USA300HOU_RS03820/USA300HOU_RS03825 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 782453 = | 202 (1.140) | intergenic (‑248/+94) | USA300HOU_RS03820/USA300HOU_RS03825 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 799573 = | 210 (1.030) | 10 (0.060) | 6/128 | NT | 6.3% | intergenic (+5/‑235) | opuBB/hisC_1 | Choline transport system permease protein OpuBB/Histidinol‑phosphate aminotransferase |
| ? | USA300TCH1516_ALE | 799622 = | 132 (0.810) | intergenic (+54/‑186) | opuBB/hisC_1 | Choline transport system permease protein OpuBB/Histidinol‑phosphate aminotransferase | |||||
| * | ? | USA300TCH1516_ALE | = 802141 | 148 (0.730) | 17 (0.100) | 10/138 | NT | 10.3% | intergenic (+382/+242) | USA300HOU_RS03915/USA300HOU_RS03920 | Putative 5'(3')‑deoxyribonucleotidase/Putative lipid kinase |
| ? | USA300TCH1516_ALE | = 802168 | 169 (0.960) | intergenic (+409/+215) | USA300HOU_RS03915/USA300HOU_RS03920 | Putative 5'(3')‑deoxyribonucleotidase/Putative lipid kinase | |||||
| * | ? | USA300TCH1516_ALE | 815690 = | 214 (1.050) | 20 (0.110) | 11/138 | NT | 11.5% | intergenic (+5/+312) | yclQ/USA300HOU_RS03990 | putative ABC transporter solute‑binding protein YclQ/hypothetical protein |
| ? | USA300TCH1516_ALE | 815739 = | 125 (0.710) | intergenic (+54/+263) | yclQ/USA300HOU_RS03990 | putative ABC transporter solute‑binding protein YclQ/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 823754 = | 152 (0.750) | 11 (0.060) | 9/134 | NT | 7.5% | intergenic (‑129/+67) | yjjP_2/dosC | Inner membrane protein YjjP/Diguanylate cyclase DosC |
| ? | USA300TCH1516_ALE | 823814 = | 144 (0.850) | intergenic (‑189/+7) | yjjP_2/dosC | Inner membrane protein YjjP/Diguanylate cyclase DosC | |||||
| * | ? | USA300TCH1516_ALE | = 823766 | 154 (0.760) | 21 (0.120) | 13/134 | NT | 13.3% | intergenic (‑141/+55) | yjjP_2/dosC | Inner membrane protein YjjP/Diguanylate cyclase DosC |
| ? | USA300TCH1516_ALE | = 823800 | 144 (0.850) | intergenic (‑175/+21) | yjjP_2/dosC | Inner membrane protein YjjP/Diguanylate cyclase DosC | |||||
| * | ? | USA300TCH1516_ALE | 828546 = | 188 (0.920) | 10 (0.050) | 5/154 | NT | 5.5% | coding (98/1083 nt) | comFA | ComF operon protein 1 |
| ? | USA300TCH1516_ALE | 828574 = | 163 (0.830) | coding (126/1083 nt) | comFA | ComF operon protein 1 | |||||
| * | ? | USA300TCH1516_ALE | 842619 = | 194 (0.950) | 10 (0.050) | 8/144 | NT | 5.4% | intergenic (+5/‑657) | uvrA/hprK | UvrABC system protein A/HPr kinase/phosphorylase |
| ? | USA300TCH1516_ALE | 842662 = | 175 (0.960) | intergenic (+48/‑614) | uvrA/hprK | UvrABC system protein A/HPr kinase/phosphorylase | |||||
| * | ? | USA300TCH1516_ALE | = 842626 | 186 (0.910) | 17 (0.090) | 7/144 | NT | 9.0% | intergenic (+12/‑650) | uvrA/hprK | UvrABC system protein A/HPr kinase/phosphorylase |
| ? | USA300TCH1516_ALE | = 842653 | 175 (0.960) | intergenic (+39/‑623) | uvrA/hprK | UvrABC system protein A/HPr kinase/phosphorylase | |||||
| * | ? | USA300TCH1516_ALE | = 853007 | 177 (0.870) | 21 (0.110) | 9/148 | NT | 11.3% | intergenic (+14/+229) | clpP_1/USA300HOU_RS04170 | ATP‑dependent Clp protease proteolytic subunit/Epimerase family protein |
| ? | USA300TCH1516_ALE | = 853023 | 166 (0.880) | intergenic (+30/+213) | clpP_1/USA300HOU_RS04170 | ATP‑dependent Clp protease proteolytic subunit/Epimerase family protein | |||||
| * | ? | USA300TCH1516_ALE | 858374 = | 181 (0.890) | 11 (0.060) | 6/146 | NT | 6.5% | intergenic (+69/‑70) | gapA1/pgk | Glyceraldehyde‑3‑phosphate dehydrogenase 1/Phosphoglycerate kinase |
| ? | USA300TCH1516_ALE | 858405 = | 151 (0.810) | intergenic (+100/‑39) | gapA1/pgk | Glyceraldehyde‑3‑phosphate dehydrogenase 1/Phosphoglycerate kinase | |||||
| * | ? | USA300TCH1516_ALE | = 868310 | 146 (0.720) | 19 (0.100) | 8/148 | NT | 11.7% | coding (458/465 nt) | smpB | SsrA‑binding protein |
| ? | USA300TCH1516_ALE | = 868335 | 153 (0.810) | intergenic (+18/+1304) | smpB/USA300HOU_RS04240 | SsrA‑binding protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 869579 = | 278 (1.360) | 25 (0.140) | 12/140 | NT | 9.3% | intergenic (+1262/+60) | smpB/USA300HOU_RS04240 | SsrA‑binding protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 869621 = | 247 (1.390) | intergenic (+1304/+18) | smpB/USA300HOU_RS04240 | SsrA‑binding protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 872094 = | 203 (1.000) | 11 (0.060) | 8/144 | NT | 5.8% | intergenic (+8/‑209) | USA300HOU_RS04260/USA300HOU_RS04265 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 872124 = | 177 (0.970) | intergenic (+38/‑179) | USA300HOU_RS04260/USA300HOU_RS04265 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 885377 = | 157 (0.770) | 15 (0.090) | 12/134 | NT | 10.1% | intergenic (+6/+67) | pspB/argO | Putative phosphoserine phosphatase 2/Arginine exporter protein ArgO |
| ? | USA300TCH1516_ALE | 885422 = | 137 (0.800) | intergenic (+51/+22) | pspB/argO | Putative phosphoserine phosphatase 2/Arginine exporter protein ArgO | |||||
| * | ? | USA300TCH1516_ALE | = 885389 | 157 (0.770) | 20 (0.120) | 10/134 | NT | 13.0% | intergenic (+18/+55) | pspB/argO | Putative phosphoserine phosphatase 2/Arginine exporter protein ArgO |
| ? | USA300TCH1516_ALE | = 885408 | 137 (0.800) | intergenic (+37/+36) | pspB/argO | Putative phosphoserine phosphatase 2/Arginine exporter protein ArgO | |||||
| * | ? | USA300TCH1516_ALE | 893176 = | 178 (0.870) | 15 (0.090) | 9/136 | NT | 8.9% | intergenic (+177/‑73) | trxA_1/metN2 | Thioredoxin/Methionine import ATP‑binding protein MetN 2 |
| ? | USA300TCH1516_ALE | 893212 = | 155 (0.900) | intergenic (+213/‑37) | trxA_1/metN2 | Thioredoxin/Methionine import ATP‑binding protein MetN 2 | |||||
| * | ? | USA300TCH1516_ALE | = 893187 | 176 (0.860) | 13 (0.080) | 9/136 | NT | 7.9% | intergenic (+188/‑62) | trxA_1/metN2 | Thioredoxin/Methionine import ATP‑binding protein MetN 2 |
| ? | USA300TCH1516_ALE | = 893199 | 155 (0.900) | intergenic (+200/‑50) | trxA_1/metN2 | Thioredoxin/Methionine import ATP‑binding protein MetN 2 | |||||
| * | ? | USA300TCH1516_ALE | 906243 = | 220 (1.080) | 17 (0.090) | 7/148 | NT | 7.9% | intergenic (+27/‑157) | USA300HOU_RS04485/USA300HOU_RS04490 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 906294 = | 191 (1.010) | intergenic (+78/‑106) | USA300HOU_RS04485/USA300HOU_RS04490 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 908480 = | 248 (1.220) | 23 (0.120) | 10/146 | NT | 9.7% | intergenic (+192/+43) | USA300HOU_RS04495/USA300HOU_RS04500 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 908515 = | 200 (1.080) | intergenic (+227/+8) | USA300HOU_RS04495/USA300HOU_RS04500 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 909579 | 200 (0.980) | 25 (0.140) | 10/144 | NT | 12.4% | intergenic (‑502/‑532) | USA300HOU_RS04500/csbD_1 | hypothetical protein/Stress response protein CsbD |
| ? | USA300TCH1516_ALE | = 909596 | 172 (0.940) | intergenic (‑519/‑515) | USA300HOU_RS04500/csbD_1 | hypothetical protein/Stress response protein CsbD | |||||
| * | ? | USA300TCH1516_ALE | 920377 = | 124 (0.610) | 12 (0.070) | 7/132 | NT | 9.7% | intergenic (+6/‑207) | USA300HOU_RS04555/USA300HOU_RS04565 | Putative monooxygenase/hypothetical protein |
| ? | USA300TCH1516_ALE | 920443 = | 121 (0.720) | intergenic (+72/‑141) | USA300HOU_RS04555/USA300HOU_RS04565 | Putative monooxygenase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 924496 | 197 (0.970) | 20 (0.110) | 11/144 | NT | 10.0% | coding (795/918 nt) | lipA_1 | Lipoyl synthase |
| ? | USA300TCH1516_ALE | = 924511 | 183 (1.000) | coding (810/918 nt) | lipA_1 | Lipoyl synthase | |||||
| * | ? | USA300TCH1516_ALE | 932460 = | 150 (0.740) | 11 (0.060) | 11/136 | NT | 7.7% | intergenic (+6/+257) | USA300HOU_RS04635/nfuA | hypothetical protein/Fe/S biogenesis protein NfuA |
| ? | USA300TCH1516_ALE | 932506 = | 135 (0.780) | intergenic (+52/+211) | USA300HOU_RS04635/nfuA | hypothetical protein/Fe/S biogenesis protein NfuA | |||||
| * | ? | USA300TCH1516_ALE | = 932471 | 148 (0.730) | 8 (0.050) | 6/136 | NT | 5.8% | intergenic (+17/+246) | USA300HOU_RS04635/nfuA | hypothetical protein/Fe/S biogenesis protein NfuA |
| ? | USA300TCH1516_ALE | = 932493 | 135 (0.780) | intergenic (+39/+224) | USA300HOU_RS04635/nfuA | hypothetical protein/Fe/S biogenesis protein NfuA | |||||
| * | ? | USA300TCH1516_ALE | = 940821 | 193 (0.950) | 13 (0.070) | 6/148 | NT | 7.2% | intergenic (+2/+54) | USA300HOU_RS04680/ptlE | Putative esterase/Neopentalenolactone D synthase |
| ? | USA300TCH1516_ALE | = 940872 | 156 (0.830) | intergenic (+53/+3) | USA300HOU_RS04680/ptlE | Putative esterase/Neopentalenolactone D synthase | |||||
| * | ? | USA300TCH1516_ALE | 940823 = | 193 (0.950) | 11 (0.060) | 8/140 | NT | 6.4% | intergenic (+4/+52) | USA300HOU_RS04680/ptlE | Putative esterase/Neopentalenolactone D synthase |
| ? | USA300TCH1516_ALE | 940872 = | 153 (0.860) | intergenic (+53/+3) | USA300HOU_RS04680/ptlE | Putative esterase/Neopentalenolactone D synthase | |||||
| * | ? | USA300TCH1516_ALE | 954365 = | 155 (0.760) | 9 (0.050) | 6/138 | NT | 5.8% | intergenic (+19/+484) | gluD/glpQ_1 | NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase |
| ? | USA300TCH1516_ALE | 954407 = | 159 (0.910) | intergenic (+61/+442) | gluD/glpQ_1 | NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase | |||||
| * | ? | USA300TCH1516_ALE | 954695 = | 166 (0.810) | 32 (0.170) +GGCAAG |
12/148 | NT | 15.5% | intergenic (+349/+154) | gluD/glpQ_1 | NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase |
| ? | USA300TCH1516_ALE | 1873938 = | 213 (1.050) | intergenic (‑614/+136) | USA300HOU_RS09300/USA300HOU_RS09305 | Putative dipeptidase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 971394 = | 213 (1.050) | 23 (0.130) | 11/142 | NT | 11.4% | intergenic (+22/+149) | USA300HOU_RS04810/cdr | hypothetical protein/Coenzyme A disulfide reductase |
| ? | USA300TCH1516_ALE | 971435 = | 170 (0.940) | intergenic (+63/+108) | USA300HOU_RS04810/cdr | hypothetical protein/Coenzyme A disulfide reductase | |||||
| * | ? | USA300TCH1516_ALE | 971887 = | 174 (0.850) | 8 (0.040) | 5/140 | NT | 5.0% | coding (973/1317 nt) | cdr | Coenzyme A disulfide reductase |
| ? | USA300TCH1516_ALE | 971952 = | 149 (0.840) | coding (908/1317 nt) | cdr | Coenzyme A disulfide reductase | |||||
| * | ? | USA300TCH1516_ALE | = 974266 | 195 (0.960) | 17 (0.100) | 8/136 | NT | 8.4% | intergenic (+109/‑438) | mrp/oatA_1 | Iron‑sulfur cluster carrier protein/O‑acetyltransferase OatA |
| ? | USA300TCH1516_ALE | = 974288 | 205 (1.190) | intergenic (+131/‑416) | mrp/oatA_1 | Iron‑sulfur cluster carrier protein/O‑acetyltransferase OatA | |||||
| * | ? | USA300TCH1516_ALE | = 979665 | 216 (1.060) | 11 (0.060) | 8/144 | NT | 5.0% | coding (594/870 nt) | ampR | HTH‑type transcriptional activator AmpR |
| ? | USA300TCH1516_ALE | = 979685 | 220 (1.200) | coding (574/870 nt) | ampR | HTH‑type transcriptional activator AmpR | |||||
| * | ? | USA300TCH1516_ALE | = 987447 | 185 (0.910) | 25 (0.150) | 12/128 | NT | 13.9% | intergenic (+20/+35) | fabF/USA300HOU_RS04885 | 3‑oxoacyl‑[acyl‑carrier‑protein] synthase 2/hypothetical protein |
| ? | USA300TCH1516_ALE | = 987456 | 162 (1.000) | intergenic (+29/+26) | fabF/USA300HOU_RS04885 | 3‑oxoacyl‑[acyl‑carrier‑protein] synthase 2/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1005781 = | 188 (0.920) | 30 (0.170) | 14/138 | NT | 15.8% | intergenic (+417/+43) | pepF1_1/USA300HOU_RS04965 | Oligoendopeptidase F, plasmid/hypothetical protein |
| ? | USA300TCH1516_ALE | 1005817 = | 157 (0.900) | intergenic (+453/+7) | pepF1_1/USA300HOU_RS04965 | Oligoendopeptidase F, plasmid/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1015009 = | 207 (1.020) | 19 (0.100) | 11/150 | NT | 9.2% | intergenic (+124/+71) | fabI/USA300HOU_RS05015 | Enoyl‑[acyl‑carrier‑protein] reductase [NADPH] FabI/hypothetical protein |
| ? | USA300TCH1516_ALE | 1015047 = | 180 (0.940) | intergenic (+162/+33) | fabI/USA300HOU_RS05015 | Enoyl‑[acyl‑carrier‑protein] reductase [NADPH] FabI/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1030896 | 178 (0.870) | 10 (0.060) | 8/134 | NT | 5.7% | intergenic (+19/‑117) | ktrB_1/yfkN_2 | Ktr system potassium uptake protein B/Trifunctional nucleotide phosphoesterase protein YfkN |
| ? | USA300TCH1516_ALE | = 1030919 | 181 (1.060) | intergenic (+42/‑94) | ktrB_1/yfkN_2 | Ktr system potassium uptake protein B/Trifunctional nucleotide phosphoesterase protein YfkN | |||||
| * | ? | USA300TCH1516_ALE | = 1032068 | 207 (1.020) | 11 (0.060) | 10/146 | NT | 5.4% | coding (1056/1515 nt) | yfkN_2 | Trifunctional nucleotide phosphoesterase protein YfkN |
| ? | USA300TCH1516_ALE | = 1032096 | 197 (1.060) | coding (1084/1515 nt) | yfkN_2 | Trifunctional nucleotide phosphoesterase protein YfkN | |||||
| * | ? | USA300TCH1516_ALE | 1034042 = | 130 (0.640) | 19 (0.120) | 10/130 | NT | 14.5% | intergenic (+31/+50) | USA300TCH1516_00960/USA300TCH1516_00961 | hypothetical protein/Lipoate‑‑protein ligase 1 |
| ? | USA300TCH1516_ALE | 1034086 = | 119 (0.720) | intergenic (+75/+6) | USA300TCH1516_00960/USA300TCH1516_00961 | hypothetical protein/Lipoate‑‑protein ligase 1 | |||||
| * | ? | USA300TCH1516_ALE | = 1034056 | 120 (0.590) | 16 (0.100) | 8/130 | NT | 12.9% | intergenic (+45/+36) | USA300TCH1516_00960/USA300TCH1516_00961 | hypothetical protein/Lipoate‑‑protein ligase 1 |
| ? | USA300TCH1516_ALE | = 1034070 | 119 (0.720) | intergenic (+59/+22) | USA300TCH1516_00960/USA300TCH1516_00961 | hypothetical protein/Lipoate‑‑protein ligase 1 | |||||
| * | ? | USA300TCH1516_ALE | = 1036086 | 164 (0.810) | 32 (0.190) | 15/132 | NT | 17.5% | intergenic (+16/‑1328) | USA300TCH1516_00963/USA300TCH1516_00964 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1036095 | 167 (1.000) | intergenic (+25/‑1319) | USA300TCH1516_00963/USA300TCH1516_00964 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1036825 | 238 (1.170) | 11 (0.060) | 5/140 | NT | 5.0% | intergenic (+755/‑589) | USA300TCH1516_00963/USA300TCH1516_00964 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1036842 | 210 (1.180) | intergenic (+772/‑572) | USA300TCH1516_00963/USA300TCH1516_00964 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1040357 = | 197 (0.970) | 19 (0.110) | 9/132 | NT | 10.5% | intergenic (+18/+70) | USA300TCH1516_00966/USA300TCH1516_00967 | putative ABC transporter ATP‑binding protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 1040412 = | 161 (0.960) | intergenic (+73/+15) | USA300TCH1516_00966/USA300TCH1516_00967 | putative ABC transporter ATP‑binding protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1040370 | 198 (0.970) | 9 (0.050) | 7/132 | NT | 5.3% | intergenic (+31/+57) | USA300TCH1516_00966/USA300TCH1516_00967 | putative ABC transporter ATP‑binding protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1040397 | 161 (0.960) | intergenic (+58/+30) | USA300TCH1516_00966/USA300TCH1516_00967 | putative ABC transporter ATP‑binding protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1044649 = | 217 (1.070) | 23 (0.140) | 12/132 | NT | 12.1% | coding (958/960 nt) | yfmC_1 | Fe(3+)‑citrate‑binding protein YfmC |
| ? | USA300TCH1516_ALE | 1044700 = | 156 (0.930) | coding (114/117 nt) | USA300HOU_RS05165 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1046337 | 153 (0.750) | 10 (0.050) | 6/148 | NT | 6.6% | coding (477/939 nt) | menA | 1,4‑dihydroxy‑2‑naphthoate octaprenyltransferase |
| ? | USA300TCH1516_ALE | = 1046354 | 143 (0.760) | coding (460/939 nt) | menA | 1,4‑dihydroxy‑2‑naphthoate octaprenyltransferase | |||||
| * | ? | USA300TCH1516_ALE | 1072018 = | 176 (0.860) | 12 (0.080) | 5/126 | NT | 8.9% | intergenic (‑490/+315) | USA300HOU_RS05290/folD | Pesticidal crystal protein Cry22Aa/Bifunctional protein FolD protein |
| ? | USA300TCH1516_ALE | 1072073 = | 108 (0.680) | intergenic (‑545/+260) | USA300HOU_RS05290/folD | Pesticidal crystal protein Cry22Aa/Bifunctional protein FolD protein | |||||
| * | ? | USA300TCH1516_ALE | 1084754 = | 153 (0.750) | 13 (0.070) | 6/140 | NT | 8.1% | intergenic (+126/+139) | purD/ykoC_1 | Phosphoribosylamine‑‑glycine ligase/Putative HMP/thiamine permease protein YkoC |
| ? | USA300TCH1516_ALE | 1084817 = | 161 (0.900) | intergenic (+189/+76) | purD/ykoC_1 | Phosphoribosylamine‑‑glycine ligase/Putative HMP/thiamine permease protein YkoC | |||||
| * | ? | USA300TCH1516_ALE | = 1084763 | 158 (0.780) | 10 (0.060) | 7/140 | NT | 6.3% | intergenic (+135/+130) | purD/ykoC_1 | Phosphoribosylamine‑‑glycine ligase/Putative HMP/thiamine permease protein YkoC |
| ? | USA300TCH1516_ALE | = 1084806 | 161 (0.900) | intergenic (+178/+87) | purD/ykoC_1 | Phosphoribosylamine‑‑glycine ligase/Putative HMP/thiamine permease protein YkoC | |||||
| * | ? | USA300TCH1516_ALE | 1086962 = | 217 (1.070) | 13 (0.070) | 7/140 | NT | 7.0% | coding (131/1401 nt) | ykoD_1 | Putative HMP/thiamine import ATP‑binding protein YkoD |
| ? | USA300TCH1516_ALE | 1087000 = | 156 (0.880) | coding (93/1401 nt) | ykoD_1 | Putative HMP/thiamine import ATP‑binding protein YkoD | |||||
| * | ? | USA300TCH1516_ALE | = 1115642 | 189 (0.930) | 22 (0.120) | 9/146 | NT | 10.9% | intergenic (‑137/+47) | mntH_1/USA300TCH1516_01038 | Divalent metal cation transporter MntH/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1115662 | 188 (1.010) | intergenic (‑157/+27) | mntH_1/USA300TCH1516_01038 | Divalent metal cation transporter MntH/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1117293 = | 242 (1.190) | 14 (0.080) | 7/130 | NT | 7.3% | intergenic (+6/+148) | suhB_1/USA300TCH1516_01040 | Inositol‑1‑monophosphatase/hypothetical protein |
| ? | USA300TCH1516_ALE | 1117341 = | 159 (0.960) | intergenic (+54/+100) | suhB_1/USA300TCH1516_01040 | Inositol‑1‑monophosphatase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1119593 = | 186 (0.910) | 16 (0.090) | 6/136 | NT | 10.1% | intergenic (+12/+297) | typA/USA300HOU_RS05545 | GTP‑binding protein TypA/BipA/hypothetical protein |
| ? | USA300TCH1516_ALE | 1119635 = | 126 (0.730) | intergenic (+54/+255) | typA/USA300HOU_RS05545 | GTP‑binding protein TypA/BipA/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1131052 | 155 (0.760) | 13 (0.080) | 5/126 | NT | 8.7% | intergenic (+16/+47) | USA300HOU_RS05590/glpQ1 | hypothetical protein/putative glycerophosphodiester phosphodiesterase 1 |
| ? | USA300TCH1516_ALE | = 1131083 | 151 (0.940) | intergenic (+47/+16) | USA300HOU_RS05590/glpQ1 | hypothetical protein/putative glycerophosphodiester phosphodiesterase 1 | |||||
| * | ? | USA300TCH1516_ALE | 1134014 = | 170 (0.830) | 9 (0.050) | 6/132 | NT | 5.8% | intergenic (+8/+54) | coaD/USA300HOU_RS05620 | Phosphopantetheine adenylyltransferase/Nicotinamide‑nucleotide adenylyltransferase |
| ? | USA300TCH1516_ALE | 1134060 = | 154 (0.920) | intergenic (+54/+8) | coaD/USA300HOU_RS05620 | Phosphopantetheine adenylyltransferase/Nicotinamide‑nucleotide adenylyltransferase | |||||
| * | ? | USA300TCH1516_ALE | = 1134027 | 174 (0.850) | 9 (0.050) | 6/132 | NT | 5.7% | intergenic (+21/+41) | coaD/USA300HOU_RS05620 | Phosphopantetheine adenylyltransferase/Nicotinamide‑nucleotide adenylyltransferase |
| ? | USA300TCH1516_ALE | = 1134045 | 154 (0.920) | intergenic (+39/+23) | coaD/USA300HOU_RS05620 | Phosphopantetheine adenylyltransferase/Nicotinamide‑nucleotide adenylyltransferase | |||||
| * | ? | USA300TCH1516_ALE | = 1136225 | 195 (0.960) | 12 (0.070) | 9/142 | NT | 6.2% | intergenic (+81/+73) | rpmF/isdB | 50S ribosomal protein L32/Iron‑regulated surface determinant protein B |
| ? | USA300TCH1516_ALE | = 1136249 | 192 (1.060) | intergenic (+105/+49) | rpmF/isdB | 50S ribosomal protein L32/Iron‑regulated surface determinant protein B | |||||
| * | ? | USA300TCH1516_ALE | = 1138356 | 199 (0.980) | 13 (0.070) | 9/140 | NT | 6.8% | intergenic (‑121/+82) | isdB/isdA | Iron‑regulated surface determinant protein B/Iron‑regulated surface determinant protein A |
| ? | USA300TCH1516_ALE | = 1138378 | 181 (1.020) | intergenic (‑143/+60) | isdB/isdA | Iron‑regulated surface determinant protein B/Iron‑regulated surface determinant protein A | |||||
| * | ? | USA300TCH1516_ALE | 1144506 = | 212 (1.040) | 24 (0.130) | 10/142 | NT | 11.5% | intergenic (+57/‑327) | isdG/USA300HOU_RS05685 | Heme oxygenase (staphylobilin‑producing) 1/Putative TrmH family tRNA/rRNA methyltransferase |
| ? | USA300TCH1516_ALE | 1144538 = | 182 (1.010) | intergenic (+89/‑295) | isdG/USA300HOU_RS05685 | Heme oxygenase (staphylobilin‑producing) 1/Putative TrmH family tRNA/rRNA methyltransferase | |||||
| * | ? | USA300TCH1516_ALE | 1149421 = | 217 (1.070) | 11 (0.060) | 5/138 | NT | 5.7% | intergenic (+7/+164) | pheT_1/rnhC | Phenylalanine‑‑tRNA ligase beta subunit/Ribonuclease HIII |
| ? | USA300TCH1516_ALE | 1149475 = | 179 (1.020) | intergenic (+61/+110) | pheT_1/rnhC | Phenylalanine‑‑tRNA ligase beta subunit/Ribonuclease HIII | |||||
| * | ? | USA300TCH1516_ALE | 1149564 = | 173 (0.850) | 21 (0.120) | 11/142 | NT | 11.4% | intergenic (+150/+21) | pheT_1/rnhC | Phenylalanine‑‑tRNA ligase beta subunit/Ribonuclease HIII |
| ? | USA300TCH1516_ALE | 1149598 = | 174 (0.960) | coding (926/939 nt) | rnhC | Ribonuclease HIII | |||||
| * | ? | USA300TCH1516_ALE | = 1149572 | 183 (0.900) | 19 (0.110) | 9/142 | NT | 10.2% | intergenic (+158/+13) | pheT_1/rnhC | Phenylalanine‑‑tRNA ligase beta subunit/Ribonuclease HIII |
| ? | USA300TCH1516_ALE | = 1149588 | 174 (0.960) | coding (936/939 nt) | rnhC | Ribonuclease HIII | |||||
| * | ? | USA300TCH1516_ALE | = 1168159 | 209 (1.030) | 20 (0.110) | 9/140 | NT | 8.7% | intergenic (+15/+638) | scn_2/USA300HOU_RS05810 | Staphylococcal complement inhibitor/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1168177 | 235 (1.320) | intergenic (+33/+620) | scn_2/USA300HOU_RS05810 | Staphylococcal complement inhibitor/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1168782 | 286 (1.400) | 17 (0.090) +AGCTGT |
7/148 | NT | 7.3% | intergenic (+638/+15) | scn_2/USA300HOU_RS05810 | Staphylococcal complement inhibitor/hypothetical protein |
| ? | USA300TCH1516_ALE | 2664923 = | 181 (0.890) | intergenic (+158/+280) | pitA_2/USA300TCH1516_02535 | L‑methionine sulfoximine/L‑methionine sulfone acetyltransferase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1172339 | 162 (0.800) | 28 (0.170) | 9/130 | NT | 16.3% | coding (248/282 nt) | USA300HOU_RS05840 | hypothetical protein |
| ? | USA300TCH1516_ALE | = 1172348 | 156 (0.950) | coding (239/282 nt) | USA300HOU_RS05840 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1177547 | 166 (0.810) | 10 (0.060) | 7/142 | NT | 6.1% | intergenic (+66/‑106) | arcC1_2/USA300HOU_RS05870 | Carbamate kinase 1/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1177574 | 162 (0.900) | intergenic (+93/‑79) | arcC1_2/USA300HOU_RS05870 | Carbamate kinase 1/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1181842 = | 186 (0.910) | 34 (0.190) | 12/144 | NT | 17.4% | intergenic (+409/+65) | USA300HOU_RS05885/USA300TCH1516_01103 | hypothetical protein/tRNA‑Arg |
| ? | USA300TCH1516_ALE | 1181881 = | 156 (0.850) | intergenic (+448/+26) | USA300HOU_RS05885/USA300TCH1516_01103 | hypothetical protein/tRNA‑Arg | |||||
| * | ? | USA300TCH1516_ALE | = 1182701 | 194 (0.950) | 14 (0.080) | 4/136 | NT | 7.9% | intergenic (+31/‑102) | USA300HOU_RS05900/yfnB | Antibacterial protein 3/Putative HAD‑hydrolase YfnB |
| ? | USA300TCH1516_ALE | = 1182728 | 163 (0.940) | intergenic (+58/‑75) | USA300HOU_RS05900/yfnB | Antibacterial protein 3/Putative HAD‑hydrolase YfnB | |||||
| * | ? | USA300TCH1516_ALE | 1183547 = | 215 (1.060) | 16 (0.090) | 6/140 | NT | 8.0% | intergenic (+58/+51) | yfnB/USA300HOU_RS05910 | Putative HAD‑hydrolase YfnB/putative N‑acetyltransferase |
| ? | USA300TCH1516_ALE | 1183585 = | 181 (1.020) | intergenic (+96/+13) | yfnB/USA300HOU_RS05910 | Putative HAD‑hydrolase YfnB/putative N‑acetyltransferase | |||||
| * | ? | USA300TCH1516_ALE | = 1183556 | 208 (1.020) | 18 (0.100) | 11/140 | NT | 9.0% | intergenic (+67/+42) | yfnB/USA300HOU_RS05910 | Putative HAD‑hydrolase YfnB/putative N‑acetyltransferase |
| ? | USA300TCH1516_ALE | = 1183574 | 181 (1.020) | intergenic (+85/+24) | yfnB/USA300HOU_RS05910 | Putative HAD‑hydrolase YfnB/putative N‑acetyltransferase | |||||
| * | ? | USA300TCH1516_ALE | = 1199293 | 163 (0.800) | 18 (0.100) | 7/144 | NT | 9.7% | intergenic (+20/‑63) | USA300HOU_RS05980/USA300HOU_RS05985 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1199312 | 189 (1.030) | intergenic (+39/‑44) | USA300HOU_RS05980/USA300HOU_RS05985 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1205323 | NA (NA) | 41 (0.220) +AGCGAA |
10/148 | NT | 30.1% | intergenic (‑204/‑365) | USA300HOU_RS15290/lspA | hypothetical protein/Lipoprotein signal peptidase |
| ? | USA300TCH1516_ALE | 2478509 = | 103 (0.510) | intergenic (+396/‑179) | USA300HOU_RS12760/USA300HOU_RS12765 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1217678 = | 142 (0.700) | 10 (0.060) | 6/128 | NT | 7.2% | intergenic (+7/‑430) | USA300HOU_RS06060/USA300HOU_RS06065 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 1217746 = | 145 (0.890) | intergenic (+75/‑362) | USA300HOU_RS06060/USA300HOU_RS06065 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1225501 | 222 (1.090) | 12 (0.070) | 8/142 | NT | 5.5% | intergenic (+93/‑413) | priA/USA300HOU_RS06095 | Primosomal protein N'/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1225529 | 215 (1.190) | intergenic (+121/‑385) | priA/USA300HOU_RS06095 | Primosomal protein N'/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1227656 | 179 (0.880) | 12 (0.060) | 8/148 | NT | 6.4% | coding (125/489 nt) | def1 | Peptide deformylase 1 |
| ? | USA300TCH1516_ALE | = 1227672 | 183 (0.970) | coding (141/489 nt) | def1 | Peptide deformylase 1 | |||||
| * | ? | USA300TCH1516_ALE | = 1239557 | 163 (0.800) | 24 (0.150) | 18/124 | NT | 13.8% | intergenic (+24/‑166) | USA300HOU_RS06160/recG | hypothetical protein/ATP‑dependent DNA helicase RecG |
| ? | USA300TCH1516_ALE | = 1239571 | 175 (1.110) | intergenic (+38/‑152) | USA300HOU_RS06160/recG | hypothetical protein/ATP‑dependent DNA helicase RecG | |||||
| * | ? | USA300TCH1516_ALE | 1245227 = | 205 (1.010) | 14 (0.080) | 9/146 | NT | 7.3% | intergenic (+32/‑211) | fabG/acpP | 3‑oxoacyl‑[acyl‑carrier‑protein] reductase FabG/Acyl carrier protein |
| ? | USA300TCH1516_ALE | 1245269 = | 169 (0.910) | intergenic (+74/‑169) | fabG/acpP | 3‑oxoacyl‑[acyl‑carrier‑protein] reductase FabG/Acyl carrier protein | |||||
| * | ? | USA300TCH1516_ALE | = 1253236 | 155 (0.760) | 10 (0.050) | 6/152 | NT | 6.0% | intergenic (+43/‑392) | ffh/rpsP | Signal recognition particle protein/30S ribosomal protein S16 |
| ? | USA300TCH1516_ALE | = 1253273 | 168 (0.870) | intergenic (+80/‑355) | ffh/rpsP | Signal recognition particle protein/30S ribosomal protein S16 | |||||
| * | ? | USA300TCH1516_ALE | = 1255979 | 165 (0.810) | 27 (0.160) | 12/134 | NT | 15.5% | intergenic (+195/+49) | rplS/USA300HOU_RS06250 | 50S ribosomal protein L19/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1255992 | 157 (0.920) | intergenic (+208/+36) | rplS/USA300HOU_RS06250 | 50S ribosomal protein L19/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1262900 = | 158 (0.780) | 23 (0.130) | 8/140 | NT | 13.3% | intergenic (+25/‑202) | sucD/lytN_1 | Succinate‑‑CoA ligase [ADP‑forming] subunit alpha/putative cell wall hydrolase LytN |
| ? | USA300TCH1516_ALE | 1262943 = | 162 (0.910) | intergenic (+68/‑159) | sucD/lytN_1 | Succinate‑‑CoA ligase [ADP‑forming] subunit alpha/putative cell wall hydrolase LytN | |||||
| * | ? | USA300TCH1516_ALE | = 1262909 | 166 (0.810) | 30 (0.170) | 13/140 | NT | 16.3% | intergenic (+34/‑193) | sucD/lytN_1 | Succinate‑‑CoA ligase [ADP‑forming] subunit alpha/putative cell wall hydrolase LytN |
| ? | USA300TCH1516_ALE | = 1262932 | 162 (0.910) | intergenic (+57/‑170) | sucD/lytN_1 | Succinate‑‑CoA ligase [ADP‑forming] subunit alpha/putative cell wall hydrolase LytN | |||||
| * | ? | USA300TCH1516_ALE | = 1265511 | 227 (1.110) | 11 (0.070) | 7/130 | NT | 5.4% | intergenic (+19/‑154) | femA_1/dprA | Aminoacyltransferase FemA/DNA processing protein DprA |
| ? | USA300TCH1516_ALE | = 1265527 | 198 (1.200) | intergenic (+35/‑138) | femA_1/dprA | Aminoacyltransferase FemA/DNA processing protein DprA | |||||
| * | ? | USA300TCH1516_ALE | = 1279942 | 194 (0.950) | 16 (0.090) | 10/146 | NT | 8.0% | intergenic (+35/‑227) | cdsA/USA300HOU_RS06360 | Phosphatidate cytidylyltransferase/Putative zinc metalloprotease |
| ? | USA300TCH1516_ALE | = 1279967 | 193 (1.040) | intergenic (+60/‑202) | cdsA/USA300HOU_RS06360 | Phosphatidate cytidylyltransferase/Putative zinc metalloprotease | |||||
| * | ? | USA300TCH1516_ALE | 1292484 = | 149 (0.730) | 13 (0.080) | 6/128 | NT | 9.3% | intergenic (+38/‑348) | infB/rbfA | Translation initiation factor IF‑2/Ribosome‑binding factor A |
| ? | USA300TCH1516_ALE | 1292539 = | 134 (0.820) | intergenic (+93/‑293) | infB/rbfA | Translation initiation factor IF‑2/Ribosome‑binding factor A | |||||
| * | ? | USA300TCH1516_ALE | = 1292499 | 158 (0.780) | 18 (0.110) | 7/128 | NT | 12.2% | intergenic (+53/‑333) | infB/rbfA | Translation initiation factor IF‑2/Ribosome‑binding factor A |
| ? | USA300TCH1516_ALE | = 1292522 | 134 (0.820) | intergenic (+76/‑310) | infB/rbfA | Translation initiation factor IF‑2/Ribosome‑binding factor A | |||||
| * | ? | USA300TCH1516_ALE | 1332932 = | 122 (0.600) | 14 (0.090) | 5/124 | NT | 11.7% | intergenic (+142/+80) | hfq/bsaA_1 | RNA‑binding protein Hfq/Glutathione peroxidase BsaA |
| ? | USA300TCH1516_ALE | 1332990 = | 117 (0.740) | intergenic (+200/+22) | hfq/bsaA_1 | RNA‑binding protein Hfq/Glutathione peroxidase BsaA | |||||
| * | ? | USA300TCH1516_ALE | = 1332949 | 116 (0.570) | 11 (0.070) | 8/124 | NT | 9.6% | intergenic (+159/+63) | hfq/bsaA_1 | RNA‑binding protein Hfq/Glutathione peroxidase BsaA |
| ? | USA300TCH1516_ALE | = 1332971 | 117 (0.740) | intergenic (+181/+41) | hfq/bsaA_1 | RNA‑binding protein Hfq/Glutathione peroxidase BsaA | |||||
| * | ? | USA300TCH1516_ALE | = 1336112 | 140 (0.690) | 13 (0.070) | 8/138 | NT | 8.5% | intergenic (+17/‑226) | mgl/glnR | L‑methionine gamma‑lyase/HTH‑type transcriptional regulator GlnR |
| ? | USA300TCH1516_ALE | = 1336130 | 160 (0.910) | intergenic (+35/‑208) | mgl/glnR | L‑methionine gamma‑lyase/HTH‑type transcriptional regulator GlnR | |||||
| * | ? | USA300TCH1516_ALE | 1341822 = | 276 (1.350) | 13 (0.070) | 9/148 | NT | 5.6% | intergenic (+230/‑282) | USA300HOU_RS06615/USA300TCH1516_01244 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 1341877 = | 183 (0.970) | intergenic (+285/‑227) | USA300HOU_RS06615/USA300TCH1516_01244 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1353894 = | 179 (0.880) | 9 (0.050) | 5/134 | NT | 5.6% | intergenic (+87/+56) | nucH/USA300HOU_RS06735 | Thermonuclease/hypothetical protein |
| ? | USA300TCH1516_ALE | 1353946 = | 154 (0.900) | intergenic (+139/+4) | nucH/USA300HOU_RS06735 | Thermonuclease/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1353906 | 177 (0.870) | 9 (0.050) | 7/134 | NT | 5.6% | intergenic (+99/+44) | nucH/USA300HOU_RS06735 | Thermonuclease/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1353932 | 154 (0.900) | intergenic (+125/+18) | nucH/USA300HOU_RS06735 | Thermonuclease/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1361472 = | 162 (0.800) | 14 (0.080) | 8/140 | NT | 8.7% | intergenic (+11/+282) | USA300HOU_RS06765/USA300TCH1516_01271 | Putative phosphatase/hypothetical protein |
| ? | USA300TCH1516_ALE | 1361520 = | 153 (0.860) | intergenic (+59/+234) | USA300HOU_RS06765/USA300TCH1516_01271 | Putative phosphatase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1361481 | 174 (0.850) | 11 (0.060) | 7/140 | NT | 6.7% | intergenic (+20/+273) | USA300HOU_RS06765/USA300TCH1516_01271 | Putative phosphatase/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1361509 | 153 (0.860) | intergenic (+48/+245) | USA300HOU_RS06765/USA300TCH1516_01271 | Putative phosphatase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1364100 | 155 (0.760) | 9 (0.050) | 4/144 | NT | 5.8% | coding (157/1518 nt) | katA | Catalase |
| ? | USA300TCH1516_ALE | = 1364118 | 154 (0.840) | coding (175/1518 nt) | katA | Catalase | |||||
| * | ? | USA300TCH1516_ALE | 1371838 = | 163 (0.800) | 7 (0.040) | 5/142 | NT | 5.1% | coding (1368/1989 nt) | tkt | Transketolase |
| ? | USA300TCH1516_ALE | 1371876 = | 115 (0.640) | coding (1406/1989 nt) | tkt | Transketolase | |||||
| * | ? | USA300TCH1516_ALE | 1392266 = | 231 (1.130) | 13 (0.070) | 9/140 | NT | 6.7% | intergenic (+40/‑460) | alsT/glcT | Amino‑acid carrier protein AlsT/GlcA/glcB genes antiterminator |
| ? | USA300TCH1516_ALE | 1392308 = | 162 (0.910) | intergenic (+82/‑418) | alsT/glcT | Amino‑acid carrier protein AlsT/GlcA/glcB genes antiterminator | |||||
| * | ? | USA300TCH1516_ALE | 1394924 = | 166 (0.810) | 14 (0.080) | 5/132 | NT | 9.1% | intergenic (+4/‑477) | tqsA/mprF | AI‑2 transport protein TqsA/Phosphatidylglycerol lysyltransferase |
| ? | USA300TCH1516_ALE | 1394966 = | 144 (0.860) | intergenic (+46/‑435) | tqsA/mprF | AI‑2 transport protein TqsA/Phosphatidylglycerol lysyltransferase | |||||
| * | ? | USA300TCH1516_ALE | = 1394937 | 158 (0.780) | 15 (0.090) | 9/132 | NT | 9.9% | intergenic (+17/‑464) | tqsA/mprF | AI‑2 transport protein TqsA/Phosphatidylglycerol lysyltransferase |
| ? | USA300TCH1516_ALE | = 1394951 | 144 (0.860) | intergenic (+31/‑450) | tqsA/mprF | AI‑2 transport protein TqsA/Phosphatidylglycerol lysyltransferase | |||||
| * | ? | USA300TCH1516_ALE | 1417767 = | 194 (0.950) | 9 (0.050) | 5/136 | NT | 5.9% | coding (152/831 nt) | gsiD_3 | Glutathione transport system permease protein GsiD |
| ? | USA300TCH1516_ALE | 1417824 = | 121 (0.700) | coding (95/831 nt) | gsiD_3 | Glutathione transport system permease protein GsiD | |||||
| * | ? | USA300TCH1516_ALE | 1435387 = | 198 (0.970) | 19 (0.110) | 11/140 | NT | 11.2% | intergenic (+24/‑119) | dapH/yxeP_3 | 2,3,4,5‑tetrahydropyridine‑2,6‑dicarboxylate N‑acetyltransferase/putative hydrolase YxeP |
| ? | USA300TCH1516_ALE | 1435417 = | 129 (0.730) | intergenic (+54/‑89) | dapH/yxeP_3 | 2,3,4,5‑tetrahydropyridine‑2,6‑dicarboxylate N‑acetyltransferase/putative hydrolase YxeP | |||||
| * | ? | USA300TCH1516_ALE | 1439018 = | 188 (0.920) | 21 (0.110) | 12/146 | NT | 11.0% | intergenic (+16/+224) | lysA/USA300HOU_RS07135 | Diaminopimelate decarboxylase/hypothetical protein |
| ? | USA300TCH1516_ALE | 1439055 = | 170 (0.920) | intergenic (+53/+187) | lysA/USA300HOU_RS07135 | Diaminopimelate decarboxylase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1439024 | 187 (0.920) | 22 (0.120) | 11/146 | NT | 11.4% | intergenic (+22/+218) | lysA/USA300HOU_RS07135 | Diaminopimelate decarboxylase/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1439047 | 170 (0.920) | intergenic (+45/+195) | lysA/USA300HOU_RS07135 | Diaminopimelate decarboxylase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1443204 = | 222 (1.090) | 31 (0.250) +30 bp |
10/100 | NT | 18.4% | coding (224/393 nt) | USA300TCH1516_01342 | hypothetical protein |
| ? | USA300TCH1516_ALE | 1803072 = | NA (NA) | coding (796/807 nt) | USA300HOU_RS12765 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1456948 = | 224 (1.100) | 43 (0.230) +GTTTT |
13/150 | NT | 18.5% | intergenic (‑62/‑182) | USA300HOU_RS07230/USA300HOU_RS07235 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1918540 | 180 (0.880) | intergenic (‑258/+240) | USA300HOU_RS07235/USA300HOU_RS09510 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1494261 | 164 (0.810) | 8 (0.040) | 5/150 | NT | 5.4% | coding (7763/31266 nt) | ebh_1 | Extracellular matrix‑binding protein ebh |
| ? | USA300TCH1516_ALE | = 1494291 | 124 (0.650) | coding (7733/31266 nt) | ebh_1 | Extracellular matrix‑binding protein ebh | |||||
| * | ? | USA300TCH1516_ALE | 1507967 = | 201 (0.990) | 20 (0.120) | 12/128 | NT | 12.6% | intergenic (‑392/+83) | ald1/ypcP | Alanine dehydrogenase 1/5'‑3' exonuclease |
| ? | USA300TCH1516_ALE | 1508010 = | 116 (0.710) | intergenic (‑435/+40) | ald1/ypcP | Alanine dehydrogenase 1/5'‑3' exonuclease | |||||
| * | ? | USA300TCH1516_ALE | 1523558 = | 198 (0.970) | 26 (0.140) | 14/150 | NT | 12.5% | intergenic (‑251/+77) | dnaD/asnS | DNA replication protein DnaD/Asparagine‑‑tRNA ligase |
| ? | USA300TCH1516_ALE | 1523591 = | 180 (0.940) | intergenic (‑284/+44) | dnaD/asnS | DNA replication protein DnaD/Asparagine‑‑tRNA ligase | |||||
| * | ? | USA300TCH1516_ALE | 1594137 = | 205 (1.010) | 11 (0.060) | 7/146 | NT | 6.2% | coding (135/243 nt) | USA300HOU_RS07845 | hypothetical protein |
| ? | USA300TCH1516_ALE | 1594171 = | 144 (0.780) | coding (101/243 nt) | USA300HOU_RS07845 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1601454 | NA (NA) | 11 (0.060) | 8/146 | NT | 100% | coding (139/177 nt) | USA300TCH1516_01480 | hypothetical protein |
| ? | USA300TCH1516_ALE | = 1601498 | 0 (0.000) | coding (95/177 nt) | USA300TCH1516_01480 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1608653 | 150 (0.740) | 7 (0.040) | 5/142 | NT | 5.0% | coding (224/930 nt) | USA300HOU_RS07970 | hypothetical protein |
| ? | USA300TCH1516_ALE | = 1608670 | NA (NA) | coding (207/930 nt) | USA300HOU_RS07970 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1614319 = | 217 (1.070) | 17 (0.090) | 8/150 | NT | 8.1% | intergenic (+14/+64) | USA300HOU_RS08000/xerD_3 | hypothetical protein/Tyrosine recombinase XerD |
| ? | USA300TCH1516_ALE | 1614368 = | 181 (0.950) | intergenic (+63/+15) | USA300HOU_RS08000/xerD_3 | hypothetical protein/Tyrosine recombinase XerD | |||||
| * | ? | USA300TCH1516_ALE | = 1616458 | 169 (0.830) | 10 (0.050) | 9/144 | NT | 5.6% | intergenic (‑43/‑39) | nudF/yhdN_2 | ADP‑ribose pyrophosphatase/General stress protein 69 |
| ? | USA300TCH1516_ALE | = 1616473 | 184 (1.000) | intergenic (‑58/‑24) | nudF/yhdN_2 | ADP‑ribose pyrophosphatase/General stress protein 69 | |||||
| * | ? | USA300TCH1516_ALE | = 1619608 | 153 (0.750) | 9 (0.050) | 6/148 | NT | 5.3% | intergenic (+11/+94) | proC/rnz | Pyrroline‑5‑carboxylate reductase/Ribonuclease Z |
| ? | USA300TCH1516_ALE | = 1619646 | 181 (0.960) | intergenic (+49/+56) | proC/rnz | Pyrroline‑5‑carboxylate reductase/Ribonuclease Z | |||||
| * | ? | USA300TCH1516_ALE | = 1627039 | 173 (0.850) | 20 (0.110) | 12/140 | NT | 10.9% | intergenic (‑192/+27) | USA300HOU_RS08070/gnd | hypothetical protein/6‑phosphogluconate dehydrogenase, decarboxylating |
| ? | USA300TCH1516_ALE | = 1627047 | 176 (0.990) | intergenic (‑200/+19) | USA300HOU_RS08070/gnd | hypothetical protein/6‑phosphogluconate dehydrogenase, decarboxylating | |||||
| * | ? | USA300TCH1516_ALE | 1647574 = | 234 (1.150) | 28 (0.150) | 8/148 | NT | 12.9% | intergenic (+4/+60) | USA300HOU_RS08180/lipM | hypothetical protein/Octanoyltransferase LipM |
| ? | USA300TCH1516_ALE | 1647624 = | 161 (0.860) | intergenic (+54/+10) | USA300HOU_RS08180/lipM | hypothetical protein/Octanoyltransferase LipM | |||||
| * | ? | USA300TCH1516_ALE | 1660020 = | 232 (1.140) | 25 (0.140) | 9/138 | NT | 11.9% | coding (1289/1464 nt) | gluP | Rhomboid protease GluP |
| ? | USA300TCH1516_ALE | 1660066 = | 172 (0.980) | coding (1243/1464 nt) | gluP | Rhomboid protease GluP | |||||
| * | ? | USA300TCH1516_ALE | 1662000 = | 282 (1.380) | 28 (0.160) | 18/136 | NT | 11.9% | intergenic (‑87/+68) | USA300HOU_RS08275/rpmG2_2 | 5‑formyltetrahydrofolate cyclo‑ligase/50S ribosomal protein L33 2 |
| ? | USA300TCH1516_ALE | 1662039 = | 177 (1.020) | intergenic (‑126/+29) | USA300HOU_RS08275/rpmG2_2 | 5‑formyltetrahydrofolate cyclo‑ligase/50S ribosomal protein L33 2 | |||||
| * | ? | USA300TCH1516_ALE | 1665337 = | 88 (0.430) | 28 (0.200) | 9/108 | NT | 32.7% | intergenic (‑212/+65) | sodA/zur | Superoxide dismutase [Mn] 1/Zinc‑specific metallo‑regulatory protein |
| ? | USA300TCH1516_ALE | 1665405 = | 56 (0.410) | coding (408/411 nt) | zur | Zinc‑specific metallo‑regulatory protein | |||||
| * | ? | USA300TCH1516_ALE | = 1665362 | 83 (0.410) | 20 (0.150) | 9/108 | NT | 26.4% | intergenic (‑237/+40) | sodA/zur | Superoxide dismutase [Mn] 1/Zinc‑specific metallo‑regulatory protein |
| ? | USA300TCH1516_ALE | = 1665378 | 56 (0.410) | intergenic (‑253/+24) | sodA/zur | Superoxide dismutase [Mn] 1/Zinc‑specific metallo‑regulatory protein | |||||
| * | ? | USA300TCH1516_ALE | 1671778 = | 204 (1.000) | 24 (0.130) | 11/146 | NT | 12.8% | intergenic (‑23/+108) | trmK/sigA | tRNA (adenine(22)‑N(1))‑methyltransferase/RNA polymerase sigma factor SigA |
| ? | USA300TCH1516_ALE | 1671809 = | 142 (0.760) | intergenic (‑54/+77) | trmK/sigA | tRNA (adenine(22)‑N(1))‑methyltransferase/RNA polymerase sigma factor SigA | |||||
| * | ? | USA300TCH1516_ALE | = 1676788 | 167 (0.820) | 15 (0.080) | 8/156 | NT | 8.7% | intergenic (‑344/‑75) | ccpN/glyQS | Transcriptional repressor CcpN/Glycine‑‑tRNA ligase |
| ? | USA300TCH1516_ALE | = 1676835 | 154 (0.780) | intergenic (‑391/‑28) | ccpN/glyQS | Transcriptional repressor CcpN/Glycine‑‑tRNA ligase | |||||
| * | ? | USA300TCH1516_ALE | = 1678311 | 179 (0.880) | 18 (0.110) | 9/132 | NT | 9.9% | intergenic (+57/+93) | glyQS/recO | Glycine‑‑tRNA ligase/DNA repair protein RecO |
| ? | USA300TCH1516_ALE | = 1678323 | 179 (1.070) | intergenic (+69/+81) | glyQS/recO | Glycine‑‑tRNA ligase/DNA repair protein RecO | |||||
| * | ? | USA300TCH1516_ALE | 1682514 = | 188 (0.920) | 21 (0.120) | 11/140 | NT | 11.3% | intergenic (‑259/+45) | USA300HOU_RS08380/USA300HOU_RS08385 | PhoH‑like protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 1682550 = | 164 (0.920) | intergenic (‑295/+9) | USA300HOU_RS08380/USA300HOU_RS08385 | PhoH‑like protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1682523 | 194 (0.950) | 24 (0.130) | 13/140 | NT | 12.6% | intergenic (‑268/+36) | USA300HOU_RS08380/USA300HOU_RS08385 | PhoH‑like protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1682539 | 164 (0.920) | intergenic (‑284/+20) | USA300HOU_RS08380/USA300HOU_RS08385 | PhoH‑like protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1689934 | 183 (0.900) | 11 (0.060) | 9/150 | NT | 5.5% | intergenic (‑69/+67) | dnaJ/dnaK | Chaperone protein DnaJ/Chaperone protein DnaK |
| ? | USA300TCH1516_ALE | = 1689961 | 205 (1.070) | intergenic (‑96/+40) | dnaJ/dnaK | Chaperone protein DnaJ/Chaperone protein DnaK | |||||
| * | ? | USA300TCH1516_ALE | = 1695186 | 204 (1.000) | 12 (0.070) | 4/142 | NT | 6.5% | intergenic (‑392/+138) | hemN_1/lepA | Oxygen‑independent coproporphyrinogen‑III oxidase‑like protein YqeR/Elongation factor 4 |
| ? | USA300TCH1516_ALE | 1873591 = | 163 (0.900) | intergenic (‑267/+483) | USA300HOU_RS09300/USA300HOU_RS09305 | Putative dipeptidase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1702257 = | 169 (0.830) | 17 (0.100) | 10/138 | NT | 10.4% | intergenic (‑1/+48) | comEA/tylM1 | ComE operon protein 1/dTDP‑3‑amino‑3,6‑dideoxy‑alpha‑D‑glucopyranose N,N‑dimethyltransferase |
| ? | USA300TCH1516_ALE | 1702302 = | 148 (0.840) | intergenic (‑46/+3) | comEA/tylM1 | ComE operon protein 1/dTDP‑3‑amino‑3,6‑dideoxy‑alpha‑D‑glucopyranose N,N‑dimethyltransferase | |||||
| * | ? | USA300TCH1516_ALE | = 1702267 | 173 (0.850) | 11 (0.060) | 6/138 | NT | 6.9% | intergenic (‑11/+38) | comEA/tylM1 | ComE operon protein 1/dTDP‑3‑amino‑3,6‑dideoxy‑alpha‑D‑glucopyranose N,N‑dimethyltransferase |
| ? | USA300TCH1516_ALE | = 1702290 | 148 (0.840) | intergenic (‑34/+15) | comEA/tylM1 | ComE operon protein 1/dTDP‑3‑amino‑3,6‑dideoxy‑alpha‑D‑glucopyranose N,N‑dimethyltransferase | |||||
| * | ? | USA300TCH1516_ALE | 1708636 = | 216 (1.060) | 21 (0.130) | 12/132 | NT | 10.3% | intergenic (+81/+121) | USA300HOU_RS08530/entA_3 | hypothetical protein/Enterotoxin type A |
| ? | USA300TCH1516_ALE | 1708685 = | 189 (1.130) | intergenic (+130/+72) | USA300HOU_RS08530/entA_3 | hypothetical protein/Enterotoxin type A | |||||
| * | ? | USA300TCH1516_ALE | = 1708649 | 214 (1.050) | 12 (0.070) | 6/132 | NT | 6.2% | intergenic (+94/+108) | USA300HOU_RS08530/entA_3 | hypothetical protein/Enterotoxin type A |
| ? | USA300TCH1516_ALE | = 1708670 | 189 (1.130) | intergenic (+115/+87) | USA300HOU_RS08530/entA_3 | hypothetical protein/Enterotoxin type A | |||||
| * | ? | USA300TCH1516_ALE | 1728897 = | 221 (1.080) | 13 (0.070) | 8/138 | NT | 7.0% | intergenic (‑131/+331) | yrrB/mnmA | TPR repeat‑containing protein YrrB/tRNA‑specific 2‑thiouridylase MnmA |
| ? | USA300TCH1516_ALE | 1728932 = | 153 (0.870) | intergenic (‑166/+296) | yrrB/mnmA | TPR repeat‑containing protein YrrB/tRNA‑specific 2‑thiouridylase MnmA | |||||
| * | ? | USA300TCH1516_ALE | = 1731936 | 179 (0.880) | 10 (0.060) | 4/142 | NT | 5.5% | coding (136/1014 nt) | limB_2 | Limonene 1,2‑monooxygenase |
| ? | USA300TCH1516_ALE | = 1731960 | 185 (1.020) | coding (160/1014 nt) | limB_2 | Limonene 1,2‑monooxygenase | |||||
| * | ? | USA300TCH1516_ALE | 1732959 = | 151 (0.740) | 13 (0.080) | 7/136 | NT | 8.8% | intergenic (+145/+92) | limB_2/USA300HOU_RS08645 | Limonene 1,2‑monooxygenase/hypothetical protein |
| ? | USA300TCH1516_ALE | 1733016 = | 141 (0.820) | intergenic (+202/+35) | limB_2/USA300HOU_RS08645 | Limonene 1,2‑monooxygenase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1732970 | 145 (0.710) | 10 (0.060) | 6/136 | NT | 7.0% | intergenic (+156/+81) | limB_2/USA300HOU_RS08645 | Limonene 1,2‑monooxygenase/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1733003 | 141 (0.820) | intergenic (+189/+48) | limB_2/USA300HOU_RS08645 | Limonene 1,2‑monooxygenase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1747135 | 174 (0.850) | 24 (0.140) | 12/132 | NT | 13.7% | intergenic (‑169/+34) | recJ/USA300HOU_RS08710 | Single‑stranded‑DNA‑specific exonuclease RecJ/Heme uptake protein MmpL11 |
| ? | USA300TCH1516_ALE | = 1747146 | 159 (0.950) | intergenic (‑180/+23) | recJ/USA300HOU_RS08710 | Single‑stranded‑DNA‑specific exonuclease RecJ/Heme uptake protein MmpL11 | |||||
| * | ? | USA300TCH1516_ALE | 1755658 = | 146 (0.720) | 18 (0.100) | 11/142 | NT | 11.8% | intergenic (‑55/+300) | obg/rpmA | GTPase Obg/50S ribosomal protein L27 |
| ? | USA300TCH1516_ALE | 1755694 = | 140 (0.780) | intergenic (‑91/+264) | obg/rpmA | GTPase Obg/50S ribosomal protein L27 | |||||
| * | ? | USA300TCH1516_ALE | = 1755666 | 150 (0.740) | 17 (0.090) | 9/142 | NT | 11.1% | intergenic (‑63/+292) | obg/rpmA | GTPase Obg/50S ribosomal protein L27 |
| ? | USA300TCH1516_ALE | = 1755684 | 140 (0.780) | intergenic (‑81/+274) | obg/rpmA | GTPase Obg/50S ribosomal protein L27 | |||||
| * | ? | USA300TCH1516_ALE | = 1759680 | 163 (0.800) | 16 (0.100) | 11/132 | NT | 10.6% | intergenic (‑387/+87) | USA300HOU_RS08780/USA300HOU_RS08785 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1759708 | 136 (0.810) | intergenic (‑415/+59) | USA300HOU_RS08780/USA300HOU_RS08785 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1772785 | 176 (0.860) | 19 (0.110) | 13/142 | NT | 10.4% | coding (148/816 nt) | USA300HOU_RS08850 | hypothetical protein |
| ? | USA300TCH1516_ALE | = 1772792 | 172 (0.950) | coding (141/816 nt) | USA300HOU_RS08850 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1775185 = | 146 (0.720) | 16 (0.090) | 7/142 | NT | 10.4% | intergenic (‑78/+76) | engB/clpX | putative GTP‑binding protein EngB/ATP‑dependent Clp protease ATP‑binding subunit ClpX |
| ? | USA300TCH1516_ALE | 1775239 = | 146 (0.810) | intergenic (‑132/+22) | engB/clpX | putative GTP‑binding protein EngB/ATP‑dependent Clp protease ATP‑binding subunit ClpX | |||||
| * | ? | USA300TCH1516_ALE | = 1775193 | 141 (0.690) | 13 (0.070) | 9/142 | NT | 8.8% | intergenic (‑86/+68) | engB/clpX | putative GTP‑binding protein EngB/ATP‑dependent Clp protease ATP‑binding subunit ClpX |
| ? | USA300TCH1516_ALE | = 1775229 | 146 (0.810) | intergenic (‑122/+32) | engB/clpX | putative GTP‑binding protein EngB/ATP‑dependent Clp protease ATP‑binding subunit ClpX | |||||
| * | ? | USA300TCH1516_ALE | 1782814 = | 186 (0.910) | 9 (0.050) | 7/146 | NT | 5.5% | intergenic (‑97/+329) | lysP_2/thrS | Lysine‑specific permease/Threonine‑‑tRNA ligase |
| ? | USA300TCH1516_ALE | 1782851 = | 142 (0.760) | intergenic (‑134/+292) | lysP_2/thrS | Lysine‑specific permease/Threonine‑‑tRNA ligase | |||||
| * | ? | USA300TCH1516_ALE | 1789630 = | 223 (1.090) | 12 (0.070) | 8/138 | NT | 6.6% | intergenic (‑111/+59) | gapA2/coaE | Glyceraldehyde‑3‑phosphate dehydrogenase 2/Dephospho‑CoA kinase |
| ? | USA300TCH1516_ALE | 1789673 = | 149 (0.850) | intergenic (‑154/+16) | gapA2/coaE | Glyceraldehyde‑3‑phosphate dehydrogenase 2/Dephospho‑CoA kinase | |||||
| * | ? | USA300TCH1516_ALE | = 1822873 | 144 (0.710) | 15 (0.080) | 8/142 | NT | 9.6% | intergenic (+194/+52) | USA300HOU_RS09070/ackA | Putative universal stress protein/Acetate kinase |
| ? | USA300TCH1516_ALE | = 1822899 | 154 (0.850) | intergenic (+220/+26) | USA300HOU_RS09070/ackA | Putative universal stress protein/Acetate kinase | |||||
| * | ? | USA300TCH1516_ALE | 1834059 = | 150 (0.740) | 17 (0.100) | 7/138 | NT | 11.6% | intergenic (+8/‑106) | osmC/USA300HOU_RS09140 | Peroxiredoxin OsmC/Soluble hydrogenase 42 kDa subunit |
| ? | USA300TCH1516_ALE | 1834098 = | 130 (0.740) | intergenic (+47/‑67) | osmC/USA300HOU_RS09140 | Peroxiredoxin OsmC/Soluble hydrogenase 42 kDa subunit | |||||
| * | ? | USA300TCH1516_ALE | = 1834069 | 142 (0.700) | 8 (0.050) | 5/138 | NT | 6.0% | intergenic (+18/‑96) | osmC/USA300HOU_RS09140 | Peroxiredoxin OsmC/Soluble hydrogenase 42 kDa subunit |
| ? | USA300TCH1516_ALE | = 1834086 | 130 (0.740) | intergenic (+35/‑79) | osmC/USA300HOU_RS09140 | Peroxiredoxin OsmC/Soluble hydrogenase 42 kDa subunit | |||||
| * | ? | USA300TCH1516_ALE | 1836934 = | 134 (0.660) | 22 (0.130) | 10/132 | NT | 16.5% | intergenic (+18/+132) | serA/gph_2 | D‑3‑phosphoglycerate dehydrogenase/Phosphoglycolate phosphatase |
| ? | USA300TCH1516_ALE | 1836982 = | 112 (0.670) | intergenic (+66/+84) | serA/gph_2 | D‑3‑phosphoglycerate dehydrogenase/Phosphoglycolate phosphatase | |||||
| * | ? | USA300TCH1516_ALE | = 1836947 | 134 (0.660) | 22 (0.130) | 12/132 | NT | 16.5% | intergenic (+31/+119) | serA/gph_2 | D‑3‑phosphoglycerate dehydrogenase/Phosphoglycolate phosphatase |
| ? | USA300TCH1516_ALE | = 1836967 | 112 (0.670) | intergenic (+51/+99) | serA/gph_2 | D‑3‑phosphoglycerate dehydrogenase/Phosphoglycolate phosphatase | |||||
| * | ? | USA300TCH1516_ALE | 1838254 = | 172 (0.840) | 21 (0.120) | 10/140 | NT | 12.4% | intergenic (‑58/+49) | gph_2/nagE | Phosphoglycolate phosphatase/PTS system N‑acetylglucosamine‑specific EIICBA component |
| ? | USA300TCH1516_ALE | 1838290 = | 147 (0.830) | intergenic (‑94/+13) | gph_2/nagE | Phosphoglycolate phosphatase/PTS system N‑acetylglucosamine‑specific EIICBA component | |||||
| * | ? | USA300TCH1516_ALE | = 1838263 | 164 (0.810) | 26 (0.150) | 10/140 | NT | 15.2% | intergenic (‑67/+40) | gph_2/nagE | Phosphoglycolate phosphatase/PTS system N‑acetylglucosamine‑specific EIICBA component |
| ? | USA300TCH1516_ALE | = 1838279 | 147 (0.830) | intergenic (‑83/+24) | gph_2/nagE | Phosphoglycolate phosphatase/PTS system N‑acetylglucosamine‑specific EIICBA component | |||||
| * | ? | USA300TCH1516_ALE | 1841984 = | 128 (0.630) | 22 (0.130) | 6/134 | NT | 17.9% | intergenic (+24/+70) | htrA/tyrS | Serine protease Do‑like HtrA/Tyrosine‑‑tRNA ligase |
| ? | USA300TCH1516_ALE | 1842029 = | 95 (0.560) | intergenic (+69/+25) | htrA/tyrS | Serine protease Do‑like HtrA/Tyrosine‑‑tRNA ligase | |||||
| * | ? | USA300TCH1516_ALE | = 1841996 | 129 (0.630) | 23 (0.140) | 7/134 | NT | 18.5% | intergenic (+36/+58) | htrA/tyrS | Serine protease Do‑like HtrA/Tyrosine‑‑tRNA ligase |
| ? | USA300TCH1516_ALE | = 1842015 | 95 (0.560) | intergenic (+55/+39) | htrA/tyrS | Serine protease Do‑like HtrA/Tyrosine‑‑tRNA ligase | |||||
| * | ? | USA300TCH1516_ALE | 1844653 = | 249 (1.220) | 12 (0.070) | 9/142 | NT | 5.7% | intergenic (+50/+153) | mrcA/isdH | Penicillin‑binding protein 1A/Iron‑regulated surface determinant protein H |
| ? | USA300TCH1516_ALE | 1844699 = | 176 (0.980) | intergenic (+96/+107) | mrcA/isdH | Penicillin‑binding protein 1A/Iron‑regulated surface determinant protein H | |||||
| * | ? | USA300TCH1516_ALE | 1856910 = | 248 (1.220) | 23 (0.130) | 11/144 | NT | 9.8% | intergenic (‑595/+105) | aroF/USA300HOU_RS09235 | Phospho‑2‑dehydro‑3‑deoxyheptonate aldolase/hypothetical protein |
| ? | USA300TCH1516_ALE | 1856940 = | 199 (1.090) | intergenic (‑625/+75) | aroF/USA300HOU_RS09235 | Phospho‑2‑dehydro‑3‑deoxyheptonate aldolase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1858390 = | 114 (0.560) | 19 (0.120) | 10/126 | NT | 15.3% | intergenic (‑17/+57) | USA300HOU_RS09235/USA300HOU_RS09240 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 1858437 = | 121 (0.760) | intergenic (‑64/+10) | USA300HOU_RS09235/USA300HOU_RS09240 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1858406 | 122 (0.600) | 17 (0.110) | 8/126 | NT | 13.6% | intergenic (‑33/+41) | USA300HOU_RS09235/USA300HOU_RS09240 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1858419 | 121 (0.760) | intergenic (‑46/+28) | USA300HOU_RS09235/USA300HOU_RS09240 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1867671 = | 166 (0.810) | 17 (0.090) | 10/142 | NT | 9.7% | intergenic (+45/+80) | USA300HOU_RS09275/ytnP | hypothetical protein/putative quorum‑quenching lactonase YtnP |
| ? | USA300TCH1516_ALE | 1867709 = | 170 (0.940) | intergenic (+83/+42) | USA300HOU_RS09275/ytnP | hypothetical protein/putative quorum‑quenching lactonase YtnP | |||||
| * | ? | USA300TCH1516_ALE | = 1867679 | 174 (0.850) | 16 (0.090) | 10/142 | NT | 9.0% | intergenic (+53/+72) | USA300HOU_RS09275/ytnP | hypothetical protein/putative quorum‑quenching lactonase YtnP |
| ? | USA300TCH1516_ALE | = 1867699 | 170 (0.940) | intergenic (+73/+52) | USA300HOU_RS09275/ytnP | hypothetical protein/putative quorum‑quenching lactonase YtnP | |||||
| * | ? | USA300TCH1516_ALE | 1868935 = | 198 (0.970) | 16 (0.090) | 7/142 | NT | 8.3% | intergenic (‑342/+128) | ytnP/trmB | putative quorum‑quenching lactonase YtnP/tRNA (guanine‑N(7)‑)‑methyltransferase |
| ? | USA300TCH1516_ALE | 1868982 = | 180 (1.000) | intergenic (‑389/+81) | ytnP/trmB | putative quorum‑quenching lactonase YtnP/tRNA (guanine‑N(7)‑)‑methyltransferase | |||||
| * | ? | USA300TCH1516_ALE | = 1868943 | 198 (0.970) | 16 (0.090) | 7/142 | NT | 8.3% | intergenic (‑350/+120) | ytnP/trmB | putative quorum‑quenching lactonase YtnP/tRNA (guanine‑N(7)‑)‑methyltransferase |
| ? | USA300TCH1516_ALE | = 1868972 | 180 (1.000) | intergenic (‑379/+91) | ytnP/trmB | putative quorum‑quenching lactonase YtnP/tRNA (guanine‑N(7)‑)‑methyltransferase | |||||
| * | ? | USA300TCH1516_ALE | 1870541 = | 223 (1.090) | 24 (0.130) | 15/144 | NT | 10.4% | intergenic (‑28/+522) | srkA/dat | Stress response kinase A/D‑alanine aminotransferase |
| ? | USA300TCH1516_ALE | 1870573 = | 213 (1.160) | intergenic (‑60/+490) | srkA/dat | Stress response kinase A/D‑alanine aminotransferase | |||||
| * | ? | USA300TCH1516_ALE | 1878597 = | 148 (0.730) | 12 (0.080) | 8/124 | NT | 9.8% | intergenic (+56/+61) | USA300HOU_RS09320/ebh_2 | Ferredoxin‑‑NADP reductase/Extracellular matrix‑binding protein ebh |
| ? | USA300TCH1516_ALE | 1878652 = | 106 (0.670) | intergenic (+111/+6) | USA300HOU_RS09320/ebh_2 | Ferredoxin‑‑NADP reductase/Extracellular matrix‑binding protein ebh | |||||
| * | ? | USA300TCH1516_ALE | = 1895575 | 168 (0.820) | 16 (0.090) | 9/142 | NT | 9.0% | intergenic (+27/+95) | putB/ribH | Proline dehydrogenase 2/6,7‑dimethyl‑8‑ribityllumazine synthase |
| ? | USA300TCH1516_ALE | = 1895601 | 174 (0.960) | intergenic (+53/+69) | putB/ribH | Proline dehydrogenase 2/6,7‑dimethyl‑8‑ribityllumazine synthase | |||||
| * | ? | USA300TCH1516_ALE | 1901310 = | 177 (0.870) | 18 (0.100) | 9/142 | NT | 10.3% | intergenic (‑306/‑217) | USA300HOU_RS09405/sdpR | hypothetical protein/Transcriptional repressor SdpR |
| ? | USA300TCH1516_ALE | 1901351 = | 157 (0.870) | intergenic (‑347/‑176) | USA300HOU_RS09405/sdpR | hypothetical protein/Transcriptional repressor SdpR | |||||
| * | ? | USA300TCH1516_ALE | = 1901318 | 173 (0.850) | 45 (0.250) | 14/142 | NT | 22.5% | intergenic (‑314/‑209) | USA300HOU_RS09405/sdpR | hypothetical protein/Transcriptional repressor SdpR |
| ? | USA300TCH1516_ALE | = 1901341 | 157 (0.870) | intergenic (‑337/‑186) | USA300HOU_RS09405/sdpR | hypothetical protein/Transcriptional repressor SdpR | |||||
| * | ? | USA300TCH1516_ALE | 1904457 = | 247 (1.210) | 24 (0.130) | 15/146 | NT | 9.8% | coding (239/855 nt) | atl_2 | Bifunctional autolysin |
| ? | USA300TCH1516_ALE | 1904477 = | 217 (1.170) | coding (219/855 nt) | atl_2 | Bifunctional autolysin | |||||
| * | ? | USA300TCH1516_ALE | 1908173 = | 237 (1.160) | 27 (0.140) | 16/148 | NT | 11.3% | intergenic (+392/+48) | USA300HOU_RS09450/tal | hypothetical protein/Transaldolase |
| ? | USA300TCH1516_ALE | 1908206 = | 206 (1.090) | intergenic (+425/+15) | USA300HOU_RS09450/tal | hypothetical protein/Transaldolase | |||||
| * | ? | USA300TCH1516_ALE | 1911750 = | 135 (0.660) | 14 (0.070) | 5/148 | NT | 10.1% | coding (729/825 nt) | USA300TCH1516_01771 | hypothetical protein |
| ? | USA300TCH1516_ALE | 2318662 = | NA (NA) | coding (42/300 nt) | USA300HOU_RS12765 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1911930 = | 183 (0.900) | 8 (0.040) | 3/142 | NT | 6.4% | coding (52/609 nt) | USA300HOU_RS15290 | hypothetical protein |
| ? | USA300TCH1516_ALE | 2318846 = | 73 (0.400) | coding (226/300 nt) | USA300HOU_RS12765 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1928296 | 216 (1.060) | 12 (0.070) | 9/140 | NT | 5.4% | intergenic (‑250/+51) | USA300HOU_RS09565/USA300HOU_RS09575 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1928318 | 228 (1.280) | intergenic (‑272/+29) | USA300HOU_RS09565/USA300HOU_RS09575 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1939382 | 168 (0.820) | 18 (0.100) | 11/142 | NT | 10.7% | intergenic (‑241/+122) | hsdM_2/splF | Type I restriction enzyme EcoKI M protein/Serine protease SplF |
| ? | USA300TCH1516_ALE | = 1939405 | 151 (0.840) | intergenic (‑264/+99) | hsdM_2/splF | Type I restriction enzyme EcoKI M protein/Serine protease SplF | |||||
| * | ? | USA300TCH1516_ALE | 1946068 = | 207 (1.020) | 12 (0.070) | 5/142 | NT | 6.4% | intergenic (+119/+355) | USA300HOU_RS09665/USA300HOU_RS15380 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 1946105 = | 165 (0.910) | intergenic (+156/+318) | USA300HOU_RS09665/USA300HOU_RS15380 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1967716 = | 182 (0.890) | 13 (0.070) | 6/146 | NT | 7.3% | intergenic (+48/+76) | traP/USA300HOU_RS09810 | Signal transduction protein TRAP/hypothetical protein |
| ? | USA300TCH1516_ALE | 1967758 = | 165 (0.890) | intergenic (+90/+34) | traP/USA300HOU_RS09810 | Signal transduction protein TRAP/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1970888 = | 209 (1.030) | 25 (0.140) | 13/142 | NT | 11.6% | intergenic (+77/‑656) | USA300HOU_RS09825/USA300HOU_RS09830 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 1970925 = | 197 (1.090) | intergenic (+114/‑619) | USA300HOU_RS09825/USA300HOU_RS09830 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1970896 | 206 (1.010) | 14 (0.080) | 9/142 | NT | 6.9% | intergenic (+85/‑648) | USA300HOU_RS09825/USA300HOU_RS09830 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1970915 | 197 (1.090) | intergenic (+104/‑629) | USA300HOU_RS09825/USA300HOU_RS09830 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1980867 = | 172 (0.840) | 16 (0.090) | 8/140 | NT | 9.4% | intergenic (‑109/+70) | USA300HOU_RS09865/USA300HOU_RS09870 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 1980913 = | 158 (0.890) | intergenic (‑155/+24) | USA300HOU_RS09865/USA300HOU_RS09870 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 1980876 | 169 (0.830) | 17 (0.100) | 6/140 | NT | 10.0% | intergenic (‑118/+61) | USA300HOU_RS09865/USA300HOU_RS09870 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 1980902 | 158 (0.890) | intergenic (‑144/+35) | USA300HOU_RS09865/USA300HOU_RS09870 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 1990341 = | 192 (0.940) | 13 (0.080) | 7/124 | NT | 9.5% | intergenic (‑90/+61) | queG/tcyC_1 | Epoxyqueuosine reductase/L‑cystine import ATP‑binding protein TcyC |
| ? | USA300TCH1516_ALE | 1990392 = | 98 (0.620) | intergenic (‑141/+10) | queG/tcyC_1 | Epoxyqueuosine reductase/L‑cystine import ATP‑binding protein TcyC | |||||
| * | ? | USA300TCH1516_ALE | 2008942 = | 157 (0.770) | 16 (0.100) | 7/132 | NT | 10.5% | intergenic (+70/+121) | USA300HOU_RS10115/USA300HOU_RS10125 | hypothetical protein/Putative multidrug export ATP‑binding/permease protein |
| ? | USA300TCH1516_ALE | 2008991 = | 145 (0.870) | intergenic (+119/+72) | USA300HOU_RS10115/USA300HOU_RS10125 | hypothetical protein/Putative multidrug export ATP‑binding/permease protein | |||||
| * | ? | USA300TCH1516_ALE | 2021453 = | 159 (0.780) | 12 (0.070) | 6/140 | NT | 7.1% | intergenic (+12/+248) | queE_2/USA300HOU_RS10190 | 7‑carboxy‑7‑deazaguanine synthase/putative acyl‑CoA thioester hydrolase |
| ? | USA300TCH1516_ALE | 2021493 = | 174 (0.980) | intergenic (+52/+208) | queE_2/USA300HOU_RS10190 | 7‑carboxy‑7‑deazaguanine synthase/putative acyl‑CoA thioester hydrolase | |||||
| * | ? | USA300TCH1516_ALE | = 2021462 | 164 (0.810) | 13 (0.070) | 8/140 | NT | 7.6% | intergenic (+21/+239) | queE_2/USA300HOU_RS10190 | 7‑carboxy‑7‑deazaguanine synthase/putative acyl‑CoA thioester hydrolase |
| ? | USA300TCH1516_ALE | = 2021482 | 174 (0.980) | intergenic (+41/+219) | queE_2/USA300HOU_RS10190 | 7‑carboxy‑7‑deazaguanine synthase/putative acyl‑CoA thioester hydrolase | |||||
| * | ? | USA300TCH1516_ALE | = 2041621 | 207 (1.020) | 17 (0.100) | 9/138 | NT | 7.7% | intergenic (‑704/+65) | dagK/gatB_2 | Diacylglycerol kinase/Aspartyl/glutamyl‑tRNA(Asn/Gln) amidotransferase subunit B |
| ? | USA300TCH1516_ALE | = 2041645 | 230 (1.310) | intergenic (‑728/+41) | dagK/gatB_2 | Diacylglycerol kinase/Aspartyl/glutamyl‑tRNA(Asn/Gln) amidotransferase subunit B | |||||
| * | ? | USA300TCH1516_ALE | 2053744 = | 215 (1.060) | 37 (0.190) | 16/150 | NT | 15.9% | coding (1116/1296 nt) | purB | Adenylosuccinate lyase |
| ? | USA300TCH1516_ALE | 2053767 = | 189 (0.990) | coding (1093/1296 nt) | purB | Adenylosuccinate lyase | |||||
| * | ? | USA300TCH1516_ALE | 2057377 = | 198 (0.970) | 27 (0.150) | 13/138 | NT | 16.3% | intergenic (+134/+158) | USA300HOU_RS10370/USA300HOU_RS10375 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 2057415 = | 106 (0.600) | intergenic (+172/+120) | USA300HOU_RS10370/USA300HOU_RS10375 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 2057471 | 172 (0.840) | 14 (0.080) | 7/132 | NT | 7.7% | intergenic (+228/+64) | USA300HOU_RS10370/USA300HOU_RS10375 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 2057483 | 196 (1.170) | intergenic (+240/+52) | USA300HOU_RS10370/USA300HOU_RS10375 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 2067939 | 221 (1.080) | 14 (0.080) | 8/138 | NT | 6.1% | intergenic (+52/‑368) | ppaC/mdlD | putative manganese‑dependent inorganic pyrophosphatase/NAD(P)‑dependent benzaldehyde dehydrogenase |
| ? | USA300TCH1516_ALE | = 2067962 | 239 (1.360) | intergenic (+75/‑345) | ppaC/mdlD | putative manganese‑dependent inorganic pyrophosphatase/NAD(P)‑dependent benzaldehyde dehydrogenase | |||||
| * | ? | USA300TCH1516_ALE | 2082368 = | 234 (1.150) | 16 (0.090) | 9/138 | NT | 8.0% | intergenic (+9/+315) | aspC/USA300HOU_RS10520 | Aspartate aminotransferase/65 kDa membrane protein |
| ? | USA300TCH1516_ALE | 2082406 = | 167 (0.950) | intergenic (+47/+277) | aspC/USA300HOU_RS10520 | Aspartate aminotransferase/65 kDa membrane protein | |||||
| * | ? | USA300TCH1516_ALE | 2082519 = | 234 (1.150) | 11 (0.060) | 7/142 | NT | 5.3% | intergenic (+160/+164) | aspC/USA300HOU_RS10520 | Aspartate aminotransferase/65 kDa membrane protein |
| ? | USA300TCH1516_ALE | 2082566 = | 187 (1.040) | intergenic (+207/+117) | aspC/USA300HOU_RS10520 | Aspartate aminotransferase/65 kDa membrane protein | |||||
| * | ? | USA300TCH1516_ALE | 2082639 = | 204 (1.000) | 29 (0.150) | 12/148 | NT | 12.8% | intergenic (+280/+44) | aspC/USA300HOU_RS10520 | Aspartate aminotransferase/65 kDa membrane protein |
| ? | USA300TCH1516_ALE | 2082667 = | 207 (1.100) | intergenic (+308/+16) | aspC/USA300HOU_RS10520 | Aspartate aminotransferase/65 kDa membrane protein | |||||
| * | ? | USA300TCH1516_ALE | = 2088038 | 191 (0.940) | 22 (0.140) | 13/126 | NT | 11.6% | intergenic (+55/+40) | chp/USA300HOU_RS10560 | Chemotaxis inhibitory protein/Glycyl‑glycine endopeptidase ALE‑1 |
| ? | USA300TCH1516_ALE | = 2088052 | 185 (1.160) | intergenic (+69/+26) | chp/USA300HOU_RS10560 | Chemotaxis inhibitory protein/Glycyl‑glycine endopeptidase ALE‑1 | |||||
| * | ? | USA300TCH1516_ALE | = 2090954 | 191 (0.940) | 15 (0.080) | 6/142 | NT | 8.0% | intergenic (‑188/+350) | USA300HOU_RS10575/USA300HOU_RS10590 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 2090971 | 177 (0.980) | intergenic (‑205/+333) | USA300HOU_RS10575/USA300HOU_RS10590 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2141638 = | 203 (1.000) | 13 (0.070) | 7/148 | NT | 6.8% | coding (450/1617 nt) | groL | 60 kDa chaperonin |
| ? | USA300TCH1516_ALE | 2141666 = | 168 (0.890) | coding (422/1617 nt) | groL | 60 kDa chaperonin | |||||
| * | ? | USA300TCH1516_ALE | 2141814 = | 179 (0.880) | 17 (0.090) | 11/152 | NT | 8.7% | coding (274/1617 nt) | groL | 60 kDa chaperonin |
| ? | USA300TCH1516_ALE | 2141841 = | 187 (0.970) | coding (247/1617 nt) | groL | 60 kDa chaperonin | |||||
| * | ? | USA300TCH1516_ALE | 2142773 = | 195 (0.960) | 18 (0.100) | 10/148 | NT | 9.4% | coding (152/744 nt) | USA300HOU_RS10935 | hypothetical protein |
| ? | USA300TCH1516_ALE | 2142794 = | 167 (0.890) | coding (173/744 nt) | USA300HOU_RS10935 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2143370 = | 137 (0.670) | 11 (0.070) | 8/132 | NT | 9.0% | intergenic (+5/+20) | USA300HOU_RS10935/USA300HOU_RS10940 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 2143414 = | 109 (0.650) | coding (1230/1254 nt) | USA300HOU_RS10940 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 2143383 | 129 (0.630) | 22 (0.130) | 11/132 | NT | 17.0% | intergenic (+18/+7) | USA300HOU_RS10935/USA300HOU_RS10940 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 2143399 | 109 (0.650) | coding (1245/1254 nt) | USA300HOU_RS10940 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2150647 = | 177 (0.870) | 19 (0.110) | 11/136 | NT | 10.9% | intergenic (+310/+57) | agrA/scrK | Accessory gene regulator A/Fructokinase |
| ? | USA300TCH1516_ALE | 2150691 = | 161 (0.930) | intergenic (+354/+13) | agrA/scrK | Accessory gene regulator A/Fructokinase | |||||
| * | ? | USA300TCH1516_ALE | 2160376 = | 178 (0.870) | 14 (0.080) | 7/136 | NT | 8.2% | intergenic (+9/‑352) | yheS/mutS_2 | putative ABC transporter ATP‑binding protein YheS/DNA mismatch repair protein MutS |
| ? | USA300TCH1516_ALE | 2160413 = | 163 (0.940) | intergenic (+46/‑315) | yheS/mutS_2 | putative ABC transporter ATP‑binding protein YheS/DNA mismatch repair protein MutS | |||||
| * | ? | USA300TCH1516_ALE | = 2160387 | 177 (0.870) | 13 (0.080) | 10/136 | NT | 7.7% | intergenic (+20/‑341) | yheS/mutS_2 | putative ABC transporter ATP‑binding protein YheS/DNA mismatch repair protein MutS |
| ? | USA300TCH1516_ALE | = 2160400 | 163 (0.940) | intergenic (+33/‑328) | yheS/mutS_2 | putative ABC transporter ATP‑binding protein YheS/DNA mismatch repair protein MutS | |||||
| * | ? | USA300TCH1516_ALE | 2201275 = | 169 (0.830) | 13 (0.080) | 10/136 | NT | 8.5% | intergenic (+5/+364) | kdpE/cshA | KDP operon transcriptional regulatory protein KdpE/DEAD‑box ATP‑dependent RNA helicase CshA |
| ? | USA300TCH1516_ALE | 2201326 = | 135 (0.780) | intergenic (+56/+313) | kdpE/cshA | KDP operon transcriptional regulatory protein KdpE/DEAD‑box ATP‑dependent RNA helicase CshA | |||||
| * | ? | USA300TCH1516_ALE | = 2201286 | 162 (0.800) | 12 (0.070) | 10/136 | NT | 8.1% | intergenic (+16/+353) | kdpE/cshA | KDP operon transcriptional regulatory protein KdpE/DEAD‑box ATP‑dependent RNA helicase CshA |
| ? | USA300TCH1516_ALE | = 2201313 | 135 (0.780) | intergenic (+43/+326) | kdpE/cshA | KDP operon transcriptional regulatory protein KdpE/DEAD‑box ATP‑dependent RNA helicase CshA | |||||
| * | ? | USA300TCH1516_ALE | 2218211 = | 156 (0.770) | 13 (0.080) | 8/124 | NT | 9.2% | intergenic (+4/+55) | USA300HOU_RS11330/fabZ | hypothetical protein/3‑hydroxyacyl‑[acyl‑carrier‑protein] dehydratase FabZ |
| ? | USA300TCH1516_ALE | 2218261 = | 135 (0.860) | intergenic (+54/+5) | USA300HOU_RS11330/fabZ | hypothetical protein/3‑hydroxyacyl‑[acyl‑carrier‑protein] dehydratase FabZ | |||||
| * | ? | USA300TCH1516_ALE | = 2218228 | 156 (0.770) | 14 (0.090) | 10/124 | NT | 9.9% | intergenic (+21/+38) | USA300HOU_RS11330/fabZ | hypothetical protein/3‑hydroxyacyl‑[acyl‑carrier‑protein] dehydratase FabZ |
| ? | USA300TCH1516_ALE | = 2218242 | 135 (0.860) | intergenic (+35/+24) | USA300HOU_RS11330/fabZ | hypothetical protein/3‑hydroxyacyl‑[acyl‑carrier‑protein] dehydratase FabZ | |||||
| * | ? | USA300TCH1516_ALE | 2236023 = | 136 (0.670) | 12 (0.070) | 7/142 | NT | 8.5% | intergenic (‑296/+51) | tdk/rpmE2 | Thymidine kinase/50S ribosomal protein L31 type B |
| ? | USA300TCH1516_ALE | 2236061 = | 138 (0.760) | intergenic (‑334/+13) | tdk/rpmE2 | Thymidine kinase/50S ribosomal protein L31 type B | |||||
| * | ? | USA300TCH1516_ALE | = 2236031 | 141 (0.690) | 10 (0.060) | 6/142 | NT | 7.1% | intergenic (‑304/+43) | tdk/rpmE2 | Thymidine kinase/50S ribosomal protein L31 type B |
| ? | USA300TCH1516_ALE | = 2236051 | 138 (0.760) | intergenic (‑324/+23) | tdk/rpmE2 | Thymidine kinase/50S ribosomal protein L31 type B | |||||
| * | ? | USA300TCH1516_ALE | 2241742 = | 215 (1.060) | 32 (0.180) | 14/140 | NT | 15.3% | intergenic (‑385/+81) | murA2/fba | UDP‑N‑acetylglucosamine 1‑carboxyvinyltransferase 2/Fructose‑bisphosphate aldolase |
| ? | USA300TCH1516_ALE | 2241776 = | 166 (0.930) | intergenic (‑419/+47) | murA2/fba | UDP‑N‑acetylglucosamine 1‑carboxyvinyltransferase 2/Fructose‑bisphosphate aldolase | |||||
| * | ? | USA300TCH1516_ALE | 2245364 = | 180 (0.880) | 19 (0.100) | 10/144 | NT | 10.7% | intergenic (‑223/+113) | pyrG/rpoE | CTP synthase/putative DNA‑directed RNA polymerase subunit delta |
| ? | USA300TCH1516_ALE | 2245398 = | 154 (0.840) | intergenic (‑257/+79) | pyrG/rpoE | CTP synthase/putative DNA‑directed RNA polymerase subunit delta | |||||
| * | ? | USA300TCH1516_ALE | = 2245371 | 168 (0.820) | 11 (0.060) | 6/144 | NT | 6.7% | intergenic (‑230/+106) | pyrG/rpoE | CTP synthase/putative DNA‑directed RNA polymerase subunit delta |
| ? | USA300TCH1516_ALE | = 2245389 | 154 (0.840) | intergenic (‑248/+88) | pyrG/rpoE | CTP synthase/putative DNA‑directed RNA polymerase subunit delta | |||||
| * | ? | USA300TCH1516_ALE | 2248208 = | 209 (1.030) | 23 (0.120) | 10/150 | NT | 10.9% | intergenic (+2/+128) | coaW/USA300HOU_RS11505 | Type II pantothenate kinase/hypothetical protein |
| ? | USA300TCH1516_ALE | 2248263 = | 182 (0.950) | intergenic (+57/+73) | coaW/USA300HOU_RS11505 | Type II pantothenate kinase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2256396 = | 157 (0.770) | 23 (0.140) | 8/132 | NT | 13.7% | intergenic (+49/+72) | deoD1/dps | Purine nucleoside phosphorylase DeoD‑type 1/General stress protein 20U |
| ? | USA300TCH1516_ALE | 2256443 = | 161 (0.960) | intergenic (+96/+25) | deoD1/dps | Purine nucleoside phosphorylase DeoD‑type 1/General stress protein 20U | |||||
| * | ? | USA300TCH1516_ALE | = 2256409 | 157 (0.770) | 18 (0.110) | 9/132 | NT | 11.0% | intergenic (+62/+59) | deoD1/dps | Purine nucleoside phosphorylase DeoD‑type 1/General stress protein 20U |
| ? | USA300TCH1516_ALE | = 2256428 | 161 (0.960) | intergenic (+81/+40) | deoD1/dps | Purine nucleoside phosphorylase DeoD‑type 1/General stress protein 20U | |||||
| * | ? | USA300TCH1516_ALE | 2259385 = | 215 (1.060) | 19 (0.110) | 9/140 | NT | 9.8% | intergenic (‑30/+642) | USA300HOU_RS11560/USA300HOU_RS11565 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 2259420 = | 162 (0.910) | intergenic (‑65/+607) | USA300HOU_RS11560/USA300HOU_RS11565 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2263788 = | 241 (1.180) | 24 (0.150) | 10/130 | NT | 11.5% | intergenic (+8/‑258) | czcD_2/USA300HOU_RS11590 | Cadmium, cobalt and zinc/H(+)‑K(+) antiporter/hypothetical protein |
| ? | USA300TCH1516_ALE | 2263834 = | 174 (1.050) | intergenic (+54/‑212) | czcD_2/USA300HOU_RS11590 | Cadmium, cobalt and zinc/H(+)‑K(+) antiporter/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2306141 = | 187 (0.920) | 22 (0.140) | 12/126 | NT | 14.2% | intergenic (+7/+125) | USA300HOU_RS11765/USA300HOU_RS11770 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 2306185 = | 120 (0.750) | intergenic (+51/+81) | USA300HOU_RS11765/USA300HOU_RS11770 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2307807 = | 151 (0.740) | 20 (0.120) | 11/128 | NT | 13.7% | intergenic (‑171/+65) | USA300HOU_RS11770/fecD_2 | hypothetical protein/Fe(3+) dicitrate transport system permease protein FecD |
| ? | USA300TCH1516_ALE | 2307852 = | 131 (0.810) | intergenic (‑216/+20) | USA300HOU_RS11770/fecD_2 | hypothetical protein/Fe(3+) dicitrate transport system permease protein FecD | |||||
| * | ? | USA300TCH1516_ALE | = 2307822 | 153 (0.750) | 16 (0.100) | 9/128 | NT | 11.2% | intergenic (‑186/+50) | USA300HOU_RS11770/fecD_2 | hypothetical protein/Fe(3+) dicitrate transport system permease protein FecD |
| ? | USA300TCH1516_ALE | = 2307835 | 131 (0.810) | intergenic (‑199/+37) | USA300HOU_RS11770/fecD_2 | hypothetical protein/Fe(3+) dicitrate transport system permease protein FecD | |||||
| * | ? | USA300TCH1516_ALE | 2317588 = | NA (NA) | 57 (0.300) | 12/150 | NT | 64.8% | intergenic (+241/‑215) | iucC_3/USA300TCH1516_02193 | Aerobactin synthase/hypothetical protein |
| ? | USA300TCH1516_ALE | 2317610 = | 33 (0.160) | intergenic (+263/‑193) | iucC_3/USA300TCH1516_02193 | Aerobactin synthase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2322819 = | 156 (0.770) | 11 (0.060) | 7/142 | NT | 7.5% | intergenic (‑259/+48) | opuD_2/USA300HOU_RS11850 | Glycine betaine transporter OpuD/Zinc‑type alcohol dehydrogenase‑like protein |
| ? | USA300TCH1516_ALE | 2322856 = | 132 (0.730) | intergenic (‑296/+11) | opuD_2/USA300HOU_RS11850 | Glycine betaine transporter OpuD/Zinc‑type alcohol dehydrogenase‑like protein | |||||
| * | ? | USA300TCH1516_ALE | = 2322827 | 144 (0.710) | 11 (0.060) | 6/142 | NT | 7.8% | intergenic (‑267/+40) | opuD_2/USA300HOU_RS11850 | Glycine betaine transporter OpuD/Zinc‑type alcohol dehydrogenase‑like protein |
| ? | USA300TCH1516_ALE | = 2322846 | 132 (0.730) | intergenic (‑286/+21) | opuD_2/USA300HOU_RS11850 | Glycine betaine transporter OpuD/Zinc‑type alcohol dehydrogenase‑like protein | |||||
| * | ? | USA300TCH1516_ALE | 2326404 = | 167 (0.820) | 14 (0.080) | 9/146 | NT | 8.8% | intergenic (‑149/+117) | USA300HOU_RS11860/lacG | hypothetical protein/6‑phospho‑beta‑galactosidase |
| ? | USA300TCH1516_ALE | 2326426 = | 139 (0.750) | intergenic (‑171/+95) | USA300HOU_RS11860/lacG | hypothetical protein/6‑phospho‑beta‑galactosidase | |||||
| * | ? | USA300TCH1516_ALE | 2336425 = | 231 (1.130) | 17 (0.100) | 9/138 | NT | 8.5% | intergenic (‑145/+75) | USA300HOU_RS11920/USA300HOU_RS11925 | hypothetical protein/putative oxidoreductase/MSMEI_2347 |
| ? | USA300TCH1516_ALE | 2336465 = | 166 (0.950) | intergenic (‑185/+35) | USA300HOU_RS11920/USA300HOU_RS11925 | hypothetical protein/putative oxidoreductase/MSMEI_2347 | |||||
| * | ? | USA300TCH1516_ALE | 2357381 = | 157 (0.770) | 13 (0.070) | 8/140 | NT | 8.3% | intergenic (‑331/+207) | ecfA1/rplQ | Energy‑coupling factor transporter ATP‑binding protein EcfA1/50S ribosomal protein L17 |
| ? | USA300TCH1516_ALE | 2357417 = | 152 (0.850) | intergenic (‑367/+171) | ecfA1/rplQ | Energy‑coupling factor transporter ATP‑binding protein EcfA1/50S ribosomal protein L17 | |||||
| * | ? | USA300TCH1516_ALE | = 2357390 | 155 (0.760) | 10 (0.060) | 9/140 | NT | 6.5% | intergenic (‑340/+198) | ecfA1/rplQ | Energy‑coupling factor transporter ATP‑binding protein EcfA1/50S ribosomal protein L17 |
| ? | USA300TCH1516_ALE | = 2357406 | 152 (0.850) | intergenic (‑356/+182) | ecfA1/rplQ | Energy‑coupling factor transporter ATP‑binding protein EcfA1/50S ribosomal protein L17 | |||||
| * | ? | USA300TCH1516_ALE | 2371393 = | 188 (0.920) | 9 (0.050) | 6/146 | NT | 5.1% | coding (111/309 nt) | rpsJ | 30S ribosomal protein S10 |
| ? | USA300TCH1516_ALE | 2371427 = | 162 (0.870) | coding (77/309 nt) | rpsJ | 30S ribosomal protein S10 | |||||
| * | ? | USA300TCH1516_ALE | 2378465 = | 234 (1.150) | 13 (0.070) | 7/140 | NT | 6.9% | intergenic (+324/+95) | glcU_2/USA300HOU_RS12220 | putative glucose uptake protein GlcU/hypothetical protein |
| ? | USA300TCH1516_ALE | 2378512 = | 149 (0.840) | intergenic (+371/+48) | glcU_2/USA300HOU_RS12220 | putative glucose uptake protein GlcU/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2380461 = | 146 (0.720) | 20 (0.120) | 10/132 | NT | 13.3% | intergenic (+134/+53) | USA300HOU_RS12230/swrC | hypothetical protein/Swarming motility protein SwrC |
| ? | USA300TCH1516_ALE | 2380507 = | 140 (0.840) | intergenic (+180/+7) | USA300HOU_RS12230/swrC | hypothetical protein/Swarming motility protein SwrC | |||||
| * | ? | USA300TCH1516_ALE | = 2380474 | 153 (0.750) | 24 (0.140) | 9/132 | NT | 15.3% | intergenic (+147/+40) | USA300HOU_RS12230/swrC | hypothetical protein/Swarming motility protein SwrC |
| ? | USA300TCH1516_ALE | = 2380492 | 140 (0.840) | intergenic (+165/+22) | USA300HOU_RS12230/swrC | hypothetical protein/Swarming motility protein SwrC | |||||
| * | ? | USA300TCH1516_ALE | = 2383757 | 162 (0.800) | 13 (0.080) | 7/136 | NT | 8.1% | intergenic (‑76/+41) | swrC/femX | Swarming motility protein SwrC/Lipid II:glycine glycyltransferase |
| ? | USA300TCH1516_ALE | = 2383774 | 159 (0.920) | intergenic (‑93/+24) | swrC/femX | Swarming motility protein SwrC/Lipid II:glycine glycyltransferase | |||||
| * | ? | USA300TCH1516_ALE | 2388283 = | 137 (0.670) | 17 (0.110) | 9/126 | NT | 13.0% | intergenic (+18/+84) | ribZ_1/sarV | Riboflavin transporter RibZ/HTH‑type transcriptional regulator SarV |
| ? | USA300TCH1516_ALE | 2388362 = | 121 (0.760) | intergenic (+97/+5) | ribZ_1/sarV | Riboflavin transporter RibZ/HTH‑type transcriptional regulator SarV | |||||
| * | ? | USA300TCH1516_ALE | = 2388299 | 138 (0.680) | 20 (0.130) | 11/126 | NT | 14.9% | intergenic (+34/+68) | ribZ_1/sarV | Riboflavin transporter RibZ/HTH‑type transcriptional regulator SarV |
| ? | USA300TCH1516_ALE | = 2388344 | 121 (0.760) | intergenic (+79/+23) | ribZ_1/sarV | Riboflavin transporter RibZ/HTH‑type transcriptional regulator SarV | |||||
| * | ? | USA300TCH1516_ALE | 2399023 = | 212 (1.040) | 23 (0.140) | 11/134 | NT | 12.8% | intergenic (+97/+75) | fdhD/USA300HOU_RS12350 | Sulfurtransferase FdhD/hypothetical protein |
| ? | USA300TCH1516_ALE | 2399070 = | 137 (0.800) | intergenic (+144/+28) | fdhD/USA300HOU_RS12350 | Sulfurtransferase FdhD/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 2421927 | 160 (0.790) | 31 (0.170) | 17/146 | NT | 17.3% | intergenic (+43/+49) | USA300HOU_RS12475/hpxO | Putative 2‑hydroxyacid dehydrogenase/FAD‑dependent urate hydroxylase |
| ? | USA300TCH1516_ALE | = 2421954 | 151 (0.810) | intergenic (+70/+22) | USA300HOU_RS12475/hpxO | Putative 2‑hydroxyacid dehydrogenase/FAD‑dependent urate hydroxylase | |||||
| * | ? | USA300TCH1516_ALE | 2434868 = | 183 (0.900) | 11 (0.060) | 8/140 | NT | 6.4% | intergenic (+136/+251) | ybbH_3/yifK | putative HTH‑type transcriptional regulator YbbH/putative transport protein YifK |
| ? | USA300TCH1516_ALE | 2434919 = | 162 (0.910) | intergenic (+187/+200) | ybbH_3/yifK | putative HTH‑type transcriptional regulator YbbH/putative transport protein YifK | |||||
| * | ? | USA300TCH1516_ALE | = 2434877 | 172 (0.840) | 14 (0.080) | 8/140 | NT | 8.2% | intergenic (+145/+242) | ybbH_3/yifK | putative HTH‑type transcriptional regulator YbbH/putative transport protein YifK |
| ? | USA300TCH1516_ALE | = 2434908 | 162 (0.910) | intergenic (+176/+211) | ybbH_3/yifK | putative HTH‑type transcriptional regulator YbbH/putative transport protein YifK | |||||
| * | ? | USA300TCH1516_ALE | 2440041 = | 155 (0.760) | 8 (0.050) | 6/136 | NT | 5.6% | intergenic (+2/+64) | USA300HOU_RS12570/malP | hypothetical protein/PTS system maltose‑specific EIICB component |
| ? | USA300TCH1516_ALE | 2440099 = | 136 (0.790) | intergenic (+60/+6) | USA300HOU_RS12570/malP | hypothetical protein/PTS system maltose‑specific EIICB component | |||||
| * | ? | USA300TCH1516_ALE | = 2440052 | 151 (0.740) | 12 (0.070) | 8/136 | NT | 8.3% | intergenic (+13/+53) | USA300HOU_RS12570/malP | hypothetical protein/PTS system maltose‑specific EIICB component |
| ? | USA300TCH1516_ALE | = 2440086 | 136 (0.790) | intergenic (+47/+19) | USA300HOU_RS12570/malP | hypothetical protein/PTS system maltose‑specific EIICB component | |||||
| * | ? | USA300TCH1516_ALE | 2442806 = | 119 (0.580) | 17 (0.100) | 12/128 | NT | 14.2% | intergenic (+3/+55) | glvR/USA300HOU_RS12585 | HTH‑type transcriptional regulator GlvR/hypothetical protein |
| ? | USA300TCH1516_ALE | 2442855 = | 111 (0.680) | intergenic (+52/+6) | glvR/USA300HOU_RS12585 | HTH‑type transcriptional regulator GlvR/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 2442821 | 122 (0.600) | 33 (0.200) | 12/128 | NT | 24.1% | intergenic (+18/+40) | glvR/USA300HOU_RS12585 | HTH‑type transcriptional regulator GlvR/hypothetical protein |
| ? | USA300TCH1516_ALE | = 2442838 | 111 (0.680) | intergenic (+35/+23) | glvR/USA300HOU_RS12585 | HTH‑type transcriptional regulator GlvR/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 2444885 | 165 (0.810) | 20 (0.110) | 10/140 | NT | 11.4% | intergenic (‑38/+187) | mleN_2/USA300HOU_RS12595 | Malate‑2H(+)/Na(+)‑lactate antiporter/hypothetical protein |
| ? | USA300TCH1516_ALE | = 2444897 | 167 (0.940) | intergenic (‑50/+175) | mleN_2/USA300HOU_RS12595 | Malate‑2H(+)/Na(+)‑lactate antiporter/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2455747 = | 108 (0.530) | 13 (0.080) | 5/132 | NT | 10.7% | intergenic (+5/+61) | lyrA/rpiA | Lysostaphin resistance protein A/Ribose‑5‑phosphate isomerase A |
| ? | USA300TCH1516_ALE | 2455795 = | 127 (0.760) | intergenic (+53/+13) | lyrA/rpiA | Lysostaphin resistance protein A/Ribose‑5‑phosphate isomerase A | |||||
| * | ? | USA300TCH1516_ALE | = 2455760 | 122 (0.600) | 21 (0.130) | 11/132 | NT | 15.6% | intergenic (+18/+48) | lyrA/rpiA | Lysostaphin resistance protein A/Ribose‑5‑phosphate isomerase A |
| ? | USA300TCH1516_ALE | = 2455780 | 127 (0.760) | intergenic (+38/+28) | lyrA/rpiA | Lysostaphin resistance protein A/Ribose‑5‑phosphate isomerase A | |||||
| * | ? | USA300TCH1516_ALE | 2461467 = | 159 (0.780) | 20 (0.110) | 9/146 | NT | 12.1% | intergenic (‑193/+38) | natA_2/yhaI | ABC transporter ATP‑binding protein NatA/Inner membrane protein YhaI |
| ? | USA300TCH1516_ALE | 2461499 = | 147 (0.790) | intergenic (‑225/+6) | natA_2/yhaI | ABC transporter ATP‑binding protein NatA/Inner membrane protein YhaI | |||||
| * | ? | USA300TCH1516_ALE | 2473265 = | 218 (1.070) | 31 (0.190) | 13/126 | NT | 17.8% | intergenic (+99/+131) | USA300HOU_RS12730/bcr_1 | hypothetical protein/Bicyclomycin resistance protein |
| ? | USA300TCH1516_ALE | 2473309 = | 116 (0.730) | intergenic (+143/+87) | USA300HOU_RS12730/bcr_1 | hypothetical protein/Bicyclomycin resistance protein | |||||
| * | ? | USA300TCH1516_ALE | = 2478424 | 7 (0.030) | 6 (0.030) | 4/146 | NT | 48.5% | intergenic (+311/‑264) | USA300HOU_RS12760/USA300HOU_RS12765 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 2478463 | NA (NA) | intergenic (+350/‑225) | USA300HOU_RS12760/USA300HOU_RS12765 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2483085 = | 206 (1.010) | 29 (0.170) | 16/136 | NT | 15.4% | intergenic (+5/‑158) | hssS/USA300HOU_RS12790 | Heme sensor protein HssS/putative HTH‑type transcriptional regulator |
| ? | USA300TCH1516_ALE | 2483126 = | 143 (0.830) | intergenic (+46/‑117) | hssS/USA300HOU_RS12790 | Heme sensor protein HssS/putative HTH‑type transcriptional regulator | |||||
| * | ? | USA300TCH1516_ALE | 2489730 = | 230 (1.130) | 24 (0.140) | 14/136 | NT | 11.6% | intergenic (+79/+74) | tarF_2/USA300HOU_RS12815 | Teichoic acid glycerol‑phosphate transferase/putative lipoprotein |
| ? | USA300TCH1516_ALE | 2489772 = | 172 (1.000) | intergenic (+121/+32) | tarF_2/USA300HOU_RS12815 | Teichoic acid glycerol‑phosphate transferase/putative lipoprotein | |||||
| * | ? | USA300TCH1516_ALE | 2492466 = | 142 (0.700) | 25 (0.140) | 13/138 | NT | 18.6% | intergenic (+9/+37) | yhfP/rimI_4 | Putative quinone oxidoreductase YhfP/Ribosomal‑protein‑alanine acetyltransferase |
| ? | USA300TCH1516_ALE | 2492499 = | 96 (0.550) | intergenic (+42/+4) | yhfP/rimI_4 | Putative quinone oxidoreductase YhfP/Ribosomal‑protein‑alanine acetyltransferase | |||||
| * | ? | USA300TCH1516_ALE | 2499443 = | 168 (0.820) | 9 (0.050) | 5/142 | NT | 5.6% | intergenic (‑20/‑163) | treP_2/USA300HOU_RS12875 | PTS system trehalose‑specific EIIBC component/hypothetical protein |
| ? | USA300TCH1516_ALE | 2499482 = | 153 (0.850) | intergenic (‑59/‑124) | treP_2/USA300HOU_RS12875 | PTS system trehalose‑specific EIIBC component/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 2525589 | 163 (0.800) | 8 (0.050) | 6/130 | NT | 5.4% | intergenic (‑161/+69) | sirB/ytmI | Sirohydrochlorin ferrochelatase/putative N‑acetyltransferase YtmI |
| ? | USA300TCH1516_ALE | = 2525624 | 148 (0.900) | intergenic (‑196/+34) | sirB/ytmI | Sirohydrochlorin ferrochelatase/putative N‑acetyltransferase YtmI | |||||
| * | ? | USA300TCH1516_ALE | 2533537 = | 140 (0.690) | 21 (0.120) | 8/142 | NT | 13.3% | intergenic (+33/+64) | femA_3/tcyC_2 | Aminoacyltransferase FemA/L‑cystine import ATP‑binding protein TcyC |
| ? | USA300TCH1516_ALE | 2533595 = | 150 (0.830) | intergenic (+91/+6) | femA_3/tcyC_2 | Aminoacyltransferase FemA/L‑cystine import ATP‑binding protein TcyC | |||||
| * | ? | USA300TCH1516_ALE | = 2533545 | 142 (0.700) | 9 (0.050) | 6/142 | NT | 6.1% | intergenic (+41/+56) | femA_3/tcyC_2 | Aminoacyltransferase FemA/L‑cystine import ATP‑binding protein TcyC |
| ? | USA300TCH1516_ALE | = 2533585 | 150 (0.830) | intergenic (+81/+16) | femA_3/tcyC_2 | Aminoacyltransferase FemA/L‑cystine import ATP‑binding protein TcyC | |||||
| * | ? | USA300TCH1516_ALE | 2537754 = | 219 (1.080) | 24 (0.140) | 10/138 | NT | 12.3% | intergenic (+108/+46) | USA300TCH1516_02423/gpmA_2 | hypothetical protein/2,3‑bisphosphoglycerate‑dependent phosphoglycerate mutase |
| ? | USA300TCH1516_ALE | 2537797 = | 154 (0.880) | intergenic (+151/+3) | USA300TCH1516_02423/gpmA_2 | hypothetical protein/2,3‑bisphosphoglycerate‑dependent phosphoglycerate mutase | |||||
| * | ? | USA300TCH1516_ALE | = 2552502 | 185 (0.910) | 11 (0.060) | 8/140 | NT | 6.0% | coding (740/1734 nt) | USA300HOU_RS13150 | putative ABC transporter ATP‑binding protein |
| ? | USA300TCH1516_ALE | = 2552516 | 183 (1.030) | coding (726/1734 nt) | USA300HOU_RS13150 | putative ABC transporter ATP‑binding protein | |||||
| * | ? | USA300TCH1516_ALE | 2569653 = | 207 (1.020) | 9 (0.050) | 6/142 | NT | 5.3% | intergenic (+5/+87) | pbpX_2/USA300HOU_RS13235 | Putative penicillin‑binding protein PbpX/UDP‑glucose 4‑epimerase |
| ? | USA300TCH1516_ALE | 2569712 = | 137 (0.760) | intergenic (+64/+28) | pbpX_2/USA300HOU_RS13235 | Putative penicillin‑binding protein PbpX/UDP‑glucose 4‑epimerase | |||||
| * | ? | USA300TCH1516_ALE | 2573677 = | 229 (1.120) | 15 (0.090) | 9/138 | NT | 8.0% | intergenic (‑203/+91) | norB_5/opuCD | Quinolone resistance protein NorB/Carnitine transport permease protein OpuCD |
| ? | USA300TCH1516_ALE | 2573715 = | 146 (0.830) | intergenic (‑241/+53) | norB_5/opuCD | Quinolone resistance protein NorB/Carnitine transport permease protein OpuCD | |||||
| * | ? | USA300TCH1516_ALE | = 2577878 | 153 (0.750) | 26 (0.150) | 11/140 | NT | 15.5% | intergenic (‑599/+71) | opuCA/USA300HOU_RS13285 | Carnitine transport ATP‑binding protein OpuCA/hypothetical protein |
| ? | USA300TCH1516_ALE | = 2577890 | 149 (0.840) | intergenic (‑611/+59) | opuCA/USA300HOU_RS13285 | Carnitine transport ATP‑binding protein OpuCA/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2580557 = | 168 (0.820) | 85 (0.450) | 13/148 | NT | 37.1% | intergenic (+192/‑416) | yveA/pnbA | Aspartate‑proton symporter/Para‑nitrobenzyl esterase |
| ? | USA300TCH1516_ALE | 2580587 = | 133 (0.710) | intergenic (+222/‑386) | yveA/pnbA | Aspartate‑proton symporter/Para‑nitrobenzyl esterase | |||||
| * | ? | USA300TCH1516_ALE | 2588434 = | 177 (0.870) | 8 (0.040) | 7/142 | NT | 5.2% | intergenic (+17/+151) | yehR/gltB_2 | putative lipoprotein YehR/Glutamate synthase [NADPH] large chain |
| ? | USA300TCH1516_ALE | 2588483 = | 137 (0.760) | intergenic (+66/+102) | yehR/gltB_2 | putative lipoprotein YehR/Glutamate synthase [NADPH] large chain | |||||
| * | ? | USA300TCH1516_ALE | = 2588442 | 167 (0.820) | 9 (0.050) | 6/142 | NT | 5.9% | intergenic (+25/+143) | yehR/gltB_2 | putative lipoprotein YehR/Glutamate synthase [NADPH] large chain |
| ? | USA300TCH1516_ALE | = 2588473 | 137 (0.760) | intergenic (+56/+112) | yehR/gltB_2 | putative lipoprotein YehR/Glutamate synthase [NADPH] large chain | |||||
| * | ? | USA300TCH1516_ALE | 2591149 = | 197 (0.970) | 15 (0.080) | 13/154 | NT | 7.7% | intergenic (+43/+181) | USA300HOU_RS13345/ttuB | hypothetical protein/Putative tartrate transporter |
| ? | USA300TCH1516_ALE | 2591189 = | 168 (0.860) | intergenic (+83/+141) | USA300HOU_RS13345/ttuB | hypothetical protein/Putative tartrate transporter | |||||
| * | ? | USA300TCH1516_ALE | 2605648 = | 229 (1.120) | 31 (0.170) | 15/146 | NT | 13.7% | intergenic (‑442/+10) | ahpD/USA300HOU_RS13415 | Alkyl hydroperoxide reductase AhpD/hypothetical protein |
| ? | USA300TCH1516_ALE | 2605673 = | 183 (0.990) | coding (405/420 nt) | USA300HOU_RS13415 | hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2622923 = | 176 (0.860) | 14 (0.080) | 8/142 | NT | 8.7% | intergenic (‑253/+131) | USA300HOU_RS13520/USA300TCH1516_02501 | hypothetical protein/Putative surface protein |
| ? | USA300TCH1516_ALE | 2622970 = | 137 (0.760) | intergenic (‑300/+84) | USA300HOU_RS13520/USA300TCH1516_02501 | hypothetical protein/Putative surface protein | |||||
| * | ? | USA300TCH1516_ALE | = 2626762 | 305 (1.500) | 16 (0.090) | 11/144 | NT | 5.4% | coding (301/357 nt) | sarT | HTH‑type transcriptional regulator SarT |
| ? | USA300TCH1516_ALE | = 2626767 | 289 (1.580) | coding (296/357 nt) | sarT | HTH‑type transcriptional regulator SarT | |||||
| * | ? | USA300TCH1516_ALE | 2636356 = | 210 (1.030) | 9 (0.050) | 7/138 | NT | 5.5% | intergenic (‑409/+60) | fnbA_2/gntT | Fibronectin‑binding protein A/High‑affinity gluconate transporter |
| ? | USA300TCH1516_ALE | 2636404 = | 127 (0.720) | intergenic (‑457/+12) | fnbA_2/gntT | Fibronectin‑binding protein A/High‑affinity gluconate transporter | |||||
| * | ? | USA300TCH1516_ALE | 2651119 = | 183 (0.900) | 10 (0.050) | 5/146 | NT | 5.5% | intergenic (+62/‑311) | USA300HOU_RS13635/fbp | hypothetical protein/Fructose‑1,6‑bisphosphatase class 3 |
| ? | USA300TCH1516_ALE | 2651153 = | 176 (0.950) | intergenic (+96/‑277) | USA300HOU_RS13635/fbp | hypothetical protein/Fructose‑1,6‑bisphosphatase class 3 | |||||
| * | ? | USA300TCH1516_ALE | = 2651125 | 182 (0.890) | 10 (0.050) | 8/146 | NT | 5.5% | intergenic (+68/‑305) | USA300HOU_RS13635/fbp | hypothetical protein/Fructose‑1,6‑bisphosphatase class 3 |
| ? | USA300TCH1516_ALE | = 2651145 | 176 (0.950) | intergenic (+88/‑285) | USA300HOU_RS13635/fbp | hypothetical protein/Fructose‑1,6‑bisphosphatase class 3 | |||||
| * | ? | USA300TCH1516_ALE | 2661788 = | 150 (0.740) | 30 (0.180) | 13/128 | NT | 18.4% | intergenic (‑181/‑140) | ybiV/yydI | Sugar phosphatase YbiV/putative peptide export ATP‑binding protein YydI |
| ? | USA300TCH1516_ALE | 2661832 = | 146 (0.900) | intergenic (‑225/‑96) | ybiV/yydI | Sugar phosphatase YbiV/putative peptide export ATP‑binding protein YydI | |||||
| * | ? | USA300TCH1516_ALE | = 2661803 | 156 (0.770) | 12 (0.070) | 7/128 | NT | 8.2% | intergenic (‑196/‑125) | ybiV/yydI | Sugar phosphatase YbiV/putative peptide export ATP‑binding protein YydI |
| ? | USA300TCH1516_ALE | = 2661815 | 146 (0.900) | intergenic (‑208/‑113) | ybiV/yydI | Sugar phosphatase YbiV/putative peptide export ATP‑binding protein YydI | |||||
| * | ? | USA300TCH1516_ALE | 2665481 = | 139 (0.680) | 21 (0.120) | 10/138 | NT | 14.7% | intergenic (‑108/+71) | USA300TCH1516_02535/sdhA | hypothetical protein/L‑serine dehydratase, alpha chain |
| ? | USA300TCH1516_ALE | 2665525 = | 125 (0.710) | intergenic (‑152/+27) | USA300TCH1516_02535/sdhA | hypothetical protein/L‑serine dehydratase, alpha chain | |||||
| * | ? | USA300TCH1516_ALE | = 2665491 | 149 (0.730) | 19 (0.110) | 11/138 | NT | 13.0% | intergenic (‑118/+61) | USA300TCH1516_02535/sdhA | hypothetical protein/L‑serine dehydratase, alpha chain |
| ? | USA300TCH1516_ALE | = 2665513 | 125 (0.710) | intergenic (‑140/+39) | USA300TCH1516_02535/sdhA | hypothetical protein/L‑serine dehydratase, alpha chain | |||||
| * | ? | USA300TCH1516_ALE | 2674533 = | 142 (0.700) | 7 (0.040) | 5/140 | NT | 5.8% | intergenic (‑45/+256) | glcB/ydaP | PTS system glucoside‑specific EIICBA component/Putative thiamine pyrophosphate‑containing protein YdaP |
| ? | USA300TCH1516_ALE | 2674588 = | 105 (0.590) | intergenic (‑100/+201) | glcB/ydaP | PTS system glucoside‑specific EIICBA component/Putative thiamine pyrophosphate‑containing protein YdaP | |||||
| * | ? | USA300TCH1516_ALE | = 2674542 | 140 (0.690) | 11 (0.060) | 7/140 | NT | 8.8% | intergenic (‑54/+247) | glcB/ydaP | PTS system glucoside‑specific EIICBA component/Putative thiamine pyrophosphate‑containing protein YdaP |
| ? | USA300TCH1516_ALE | = 2674577 | 105 (0.590) | intergenic (‑89/+212) | glcB/ydaP | PTS system glucoside‑specific EIICBA component/Putative thiamine pyrophosphate‑containing protein YdaP | |||||
| * | ? | USA300TCH1516_ALE | = 2679966 | 193 (0.950) | 15 (0.090) | 6/130 | NT | 7.9% | intergenic (+18/+742) | ssaA2_4/USA300HOU_RS13810 | Staphylococcal secretory antigen ssaA2/hypothetical protein |
| ? | USA300TCH1516_ALE | = 2679991 | 194 (1.180) | intergenic (+43/+717) | ssaA2_4/USA300HOU_RS13810 | Staphylococcal secretory antigen ssaA2/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2679992 = | 218 (1.070) | 21 (0.130) | 8/130 | NT | 10.2% | intergenic (+44/+716) | ssaA2_4/USA300HOU_RS13810 | Staphylococcal secretory antigen ssaA2/hypothetical protein |
| ? | USA300TCH1516_ALE | 2681425 = | 193 (1.170) | intergenic (‑460/+119) | USA300HOU_RS13810/mvaA | hypothetical protein/3‑hydroxy‑3‑methylglutaryl‑coenzyme A reductase | |||||
| * | ? | USA300TCH1516_ALE | = 2680006 | 213 (1.050) | 21 (0.130) | 8/130 | NT | 10.3% | intergenic (+58/+702) | ssaA2_4/USA300HOU_RS13810 | Staphylococcal secretory antigen ssaA2/hypothetical protein |
| ? | USA300TCH1516_ALE | = 2681409 | 193 (1.170) | intergenic (‑444/+135) | USA300HOU_RS13810/mvaA | hypothetical protein/3‑hydroxy‑3‑methylglutaryl‑coenzyme A reductase | |||||
| * | ? | USA300TCH1516_ALE | 2681410 = | 206 (1.010) | 9 (0.050) | 5/130 | NT | 5.6% | intergenic (‑445/+134) | USA300HOU_RS13810/mvaA | hypothetical protein/3‑hydroxy‑3‑methylglutaryl‑coenzyme A reductase |
| ? | USA300TCH1516_ALE | 2681465 = | 136 (0.820) | intergenic (‑500/+79) | USA300HOU_RS13810/mvaA | hypothetical protein/3‑hydroxy‑3‑methylglutaryl‑coenzyme A reductase | |||||
| * | ? | USA300TCH1516_ALE | 2681949 = | 134 (0.660) | 10 (0.050) | 7/150 | NT | 7.0% | coding (873/1278 nt) | mvaA | 3‑hydroxy‑3‑methylglutaryl‑coenzyme A reductase |
| ? | USA300TCH1516_ALE | 2681984 = | 142 (0.740) | coding (838/1278 nt) | mvaA | 3‑hydroxy‑3‑methylglutaryl‑coenzyme A reductase | |||||
| * | ? | USA300TCH1516_ALE | 2684279 = | 151 (0.740) | 12 (0.070) | 9/136 | NT | 8.3% | intergenic (+38/+132) | mvaS/ogt | Hydroxymethylglutaryl‑CoA synthase/Methylated‑DNA‑‑protein‑cysteine methyltransferase |
| ? | USA300TCH1516_ALE | 2684320 = | 138 (0.800) | intergenic (+79/+91) | mvaS/ogt | Hydroxymethylglutaryl‑CoA synthase/Methylated‑DNA‑‑protein‑cysteine methyltransferase | |||||
| * | ? | USA300TCH1516_ALE | = 2684290 | 146 (0.720) | 17 (0.100) | 9/136 | NT | 11.5% | intergenic (+49/+121) | mvaS/ogt | Hydroxymethylglutaryl‑CoA synthase/Methylated‑DNA‑‑protein‑cysteine methyltransferase |
| ? | USA300TCH1516_ALE | = 2684307 | 138 (0.800) | intergenic (+66/+104) | mvaS/ogt | Hydroxymethylglutaryl‑CoA synthase/Methylated‑DNA‑‑protein‑cysteine methyltransferase | |||||
| * | ? | USA300TCH1516_ALE | 2687471 = | 160 (0.790) | 29 (0.170) | 12/138 | NT | 19.4% | intergenic (+25/+44) | clpL/USA300HOU_RS13835 | ATP‑dependent Clp protease ATP‑binding subunit ClpL/hypothetical protein |
| ? | USA300TCH1516_ALE | 2687511 = | 104 (0.590) | intergenic (+65/+4) | clpL/USA300HOU_RS13835 | ATP‑dependent Clp protease ATP‑binding subunit ClpL/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2693368 = | 148 (0.730) | 33 (0.190) | 13/136 | NT | 20.3% | intergenic (+39/+317) | mtrR/rocA | HTH‑type transcriptional regulator MtrR/1‑pyrroline‑5‑carboxylate dehydrogenase |
| ? | USA300TCH1516_ALE | 2693417 = | 134 (0.780) | intergenic (+88/+268) | mtrR/rocA | HTH‑type transcriptional regulator MtrR/1‑pyrroline‑5‑carboxylate dehydrogenase | |||||
| * | ? | USA300TCH1516_ALE | = 2693379 | 154 (0.760) | 20 (0.120) | 13/136 | NT | 13.1% | intergenic (+50/+306) | mtrR/rocA | HTH‑type transcriptional regulator MtrR/1‑pyrroline‑5‑carboxylate dehydrogenase |
| ? | USA300TCH1516_ALE | = 2693404 | 134 (0.780) | intergenic (+75/+281) | mtrR/rocA | HTH‑type transcriptional regulator MtrR/1‑pyrroline‑5‑carboxylate dehydrogenase | |||||
| * | ? | USA300TCH1516_ALE | 2696548 = | 156 (0.770) | 16 (0.090) | 11/140 | NT | 11.2% | intergenic (+100/‑140) | USA300HOU_RS13875/copA | hypothetical protein/Copper‑exporting P‑type ATPase A |
| ? | USA300TCH1516_ALE | 2696587 = | 117 (0.660) | intergenic (+139/‑101) | USA300HOU_RS13875/copA | hypothetical protein/Copper‑exporting P‑type ATPase A | |||||
| * | ? | USA300TCH1516_ALE | 2699622 = | 78 (0.380) | 12 (0.070) | 6/140 | NT | 12.4% | intergenic (+29/+61) | copZ/ldhD_2 | Copper chaperone CopZ/D‑lactate dehydrogenase |
| ? | USA300TCH1516_ALE | 2699690 = | 101 (0.570) | coding (992/999 nt) | ldhD_2 | D‑lactate dehydrogenase | |||||
| * | ? | USA300TCH1516_ALE | = 2699646 | 93 (0.460) | 18 (0.120) | 11/122 | NT | 18.3% | intergenic (+53/+37) | copZ/ldhD_2 | Copper chaperone CopZ/D‑lactate dehydrogenase |
| ? | USA300TCH1516_ALE | = 2699665 | 90 (0.580) | intergenic (+72/+18) | copZ/ldhD_2 | Copper chaperone CopZ/D‑lactate dehydrogenase | |||||
| * | ? | USA300TCH1516_ALE | 2716742 = | 130 (0.640) | 7 (0.040) | 6/138 | NT | 5.4% | intergenic (+50/+100) | USA300HOU_RS13965/USA300HOU_RS13970 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 2716816 = | 132 (0.750) | intergenic (+124/+26) | USA300HOU_RS13965/USA300HOU_RS13970 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 2716752 | 129 (0.630) | 10 (0.060) | 6/138 | NT | 7.6% | intergenic (+60/+90) | USA300HOU_RS13965/USA300HOU_RS13970 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 2716804 | 132 (0.750) | intergenic (+112/+38) | USA300HOU_RS13965/USA300HOU_RS13970 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 2719380 | 168 (0.820) | 9 (0.050) | 6/136 | NT | 5.3% | coding (324/705 nt) | cpnA | Cyclopentanol dehydrogenase |
| ? | USA300TCH1516_ALE | = 2719397 | 178 (1.030) | coding (341/705 nt) | cpnA | Cyclopentanol dehydrogenase | |||||
| * | ? | USA300TCH1516_ALE | 2731249 = | 175 (0.860) | 27 (0.150) | 8/138 | NT | 16.3% | intergenic (+45/+36) | USA300HOU_RS14055/USA300HOU_RS14060 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 2731282 = | 126 (0.720) | intergenic (+78/+3) | USA300HOU_RS14055/USA300HOU_RS14060 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2740966 = | 122 (0.600) | 33 (0.200) | 16/132 | NT | 23.6% | intergenic (+8/+73) | yhdG_2/USA300HOU_RS14115 | putative amino acid permease YhdG/Isoleucine 2‑epimerase |
| ? | USA300TCH1516_ALE | 2741016 = | 113 (0.670) | intergenic (+58/+23) | yhdG_2/USA300HOU_RS14115 | putative amino acid permease YhdG/Isoleucine 2‑epimerase | |||||
| * | ? | USA300TCH1516_ALE | = 2740979 | 120 (0.590) | 30 (0.180) | 15/132 | NT | 22.1% | intergenic (+21/+60) | yhdG_2/USA300HOU_RS14115 | putative amino acid permease YhdG/Isoleucine 2‑epimerase |
| ? | USA300TCH1516_ALE | = 2741001 | 113 (0.670) | intergenic (+43/+38) | yhdG_2/USA300HOU_RS14115 | putative amino acid permease YhdG/Isoleucine 2‑epimerase | |||||
| * | ? | USA300TCH1516_ALE | 2744105 = | 172 (0.840) | 10 (0.060) | 7/140 | NT | 6.8% | intergenic (+42/+151) | fda/mqo2 | Fructose‑bisphosphate aldolase class 1/putative malate:quinone oxidoreductase 2 |
| ? | USA300TCH1516_ALE | 2744143 = | 124 (0.700) | intergenic (+80/+113) | fda/mqo2 | Fructose‑bisphosphate aldolase class 1/putative malate:quinone oxidoreductase 2 | |||||
| * | ? | USA300TCH1516_ALE | = 2751374 | 149 (0.730) | 14 (0.080) | 7/146 | NT | 9.4% | intergenic (‑222/+39) | betA/gbsA | Oxygen‑dependent choline dehydrogenase/Betaine aldehyde dehydrogenase |
| ? | USA300TCH1516_ALE | = 2751393 | 134 (0.720) | intergenic (‑241/+20) | betA/gbsA | Oxygen‑dependent choline dehydrogenase/Betaine aldehyde dehydrogenase | |||||
| * | ? | USA300TCH1516_ALE | = 2772627 | 176 (0.860) | 19 (0.100) | 13/152 | NT | 11.7% | intergenic (+1/+59) | phoB/USA300TCH1516_02632 | Alkaline phosphatase 3/hypothetical protein |
| ? | USA300TCH1516_ALE | = 2772679 | 120 (0.620) | intergenic (+53/+7) | phoB/USA300TCH1516_02632 | Alkaline phosphatase 3/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2772633 = | 174 (0.850) | 32 (0.190) | 10/134 | NT | 20.5% | intergenic (+7/+53) | phoB/USA300TCH1516_02632 | Alkaline phosphatase 3/hypothetical protein |
| ? | USA300TCH1516_ALE | 2772676 = | 103 (0.610) | intergenic (+50/+10) | phoB/USA300TCH1516_02632 | Alkaline phosphatase 3/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2787502 = | 224 (1.100) | 18 (0.100) | 10/142 | NT | 9.5% | intergenic (+48/‑192) | zipA_3/manR_2 | Cell division protein ZipA/Transcriptional regulator ManR |
| ? | USA300TCH1516_ALE | 2787547 = | 146 (0.810) | intergenic (+93/‑147) | zipA_3/manR_2 | Cell division protein ZipA/Transcriptional regulator ManR | |||||
| * | ? | USA300TCH1516_ALE | 2830190 = | 176 (0.860) | 15 (0.090) | 10/138 | NT | 9.4% | intergenic (+18/+429) | icaC/lipA_2 | putative poly‑beta‑1,6‑N‑acetyl‑D‑glucosamine export protein/Lipase 1 |
| ? | USA300TCH1516_ALE | 2830247 = | 137 (0.780) | intergenic (+75/+372) | icaC/lipA_2 | putative poly‑beta‑1,6‑N‑acetyl‑D‑glucosamine export protein/Lipase 1 | |||||
| * | ? | USA300TCH1516_ALE | 2850817 = | 144 (0.710) | 22 (0.130) | 12/132 | NT | 15.7% | intergenic (+16/+103) | pcp/USA300HOU_RS14605 | Pyrrolidone‑carboxylate peptidase/hypothetical protein |
| ? | USA300TCH1516_ALE | 2850866 = | 117 (0.700) | intergenic (+65/+54) | pcp/USA300HOU_RS14605 | Pyrrolidone‑carboxylate peptidase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 2850830 | 142 (0.700) | 17 (0.100) | 8/132 | NT | 12.7% | intergenic (+29/+90) | pcp/USA300HOU_RS14605 | Pyrrolidone‑carboxylate peptidase/hypothetical protein |
| ? | USA300TCH1516_ALE | = 2850851 | 117 (0.700) | intergenic (+50/+69) | pcp/USA300HOU_RS14605 | Pyrrolidone‑carboxylate peptidase/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 2854319 | 183 (0.900) | 28 (0.150) | 12/150 | NT | 13.7% | intergenic (+17/+396) | yflS/USA300HOU_RS14625 | Putative malate transporter YflS/hypothetical protein |
| ? | USA300TCH1516_ALE | = 2854338 | 181 (0.950) | intergenic (+36/+377) | yflS/USA300HOU_RS14625 | Putative malate transporter YflS/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | 2863041 = | 188 (0.920) | 25 (0.140) | 11/142 | NT | 13.0% | intergenic (+11/+49) | USA300TCH1516_02707/USA300HOU_RS14670 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | 2863075 = | 168 (0.930) | intergenic (+45/+15) | USA300TCH1516_02707/USA300HOU_RS14670 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 2863074 | 186 (0.910) | 22 (0.120) | 11/150 | NT | 11.2% | intergenic (+44/+16) | USA300TCH1516_02707/USA300HOU_RS14670 | hypothetical protein/hypothetical protein |
| ? | USA300TCH1516_ALE | = 2864026 | NA (NA) | intergenic (‑439/‑19) | USA300HOU_RS14670/USA300HOU_RS14675 | hypothetical protein/hypothetical protein | |||||
| * | ? | USA300TCH1516_ALE | = 2866995 | 150 (0.740) | 23 (0.140) | 13/134 | NT | 14.6% | intergenic (‑394/+59) | USA300HOU_RS14695/noc_2 | hypothetical protein/Nucleoid occlusion protein |
| ? | USA300TCH1516_ALE | = 2867006 | 144 (0.850) | intergenic (‑405/+48) | USA300HOU_RS14695/noc_2 | hypothetical protein/Nucleoid occlusion protein | |||||