breseq  version 0.33.1  revision 8505477f25b3
mutation predictions | marginal predictions | summary statistics | genome diff | command line log

Predicted mutations
evidence seq id position mutation freq annotation gene description
RA CP000731 81 N→G 100% intergenic (–/‑151) – / → repA –/replication protein A
RA CP000731 5,779 C→T 11.0% intergenic (+296/‑1192) cadX → / → USA300HOU_pUSA300HOUMR0010 cadmium efflux regulator/MarR family transcriptional regulator
RA CP000731 5,784 A→G 10.7% intergenic (+301/‑1187) cadX → / → USA300HOU_pUSA300HOUMR0010 cadmium efflux regulator/MarR family transcriptional regulator
JC CP000731 6,552 +28 bp 100% intergenic (+1069/‑419) cadX → / → USA300HOU_pUSA300HOUMR0010 cadmium efflux regulator/MarR family transcriptional regulator
RA CP000731 12,012 A→G 12.0% intergenic (+175/+48) USA300HOU_pUSA300HOUMR0014 → / ← USA300HOU_pUSA300HOUMR0015 recombinase/hypothetical protein
RA CP000731 12,017 C→T 12.5% intergenic (+180/+43) USA300HOU_pUSA300HOUMR0014 → / ← USA300HOU_pUSA300HOUMR0015 recombinase/hypothetical protein
RA CP000731 25,663 Δ1 bp 100% coding (316/333 nt) USA300HOU_pUSA300HOUMR0031 → hypothetical protein
RA USA300TCH1516_ALE 3,344 A→T 9.3% intergenic (+28/‑362) dnaN → / → USA300HOU_RS00015 DNA polymerase III subunit beta/hypothetical protein
RA USA300TCH1516_ALE 9,710 T→C 19.1% intergenic (+15/+72) gyrA → / ← nnrD DNA gyrase subunit A/ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase
RA USA300TCH1516_ALE 9,716 T→C 23.4% intergenic (+21/+66) gyrA → / ← nnrD DNA gyrase subunit A/ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase
RA USA300TCH1516_ALE 9,719 G→A 22.7% intergenic (+24/+63) gyrA → / ← nnrD DNA gyrase subunit A/ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase
RA USA300TCH1516_ALE 9,725 G→A 17.1% intergenic (+30/+57) gyrA → / ← nnrD DNA gyrase subunit A/ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase
RA USA300TCH1516_ALE 24,137 G→A 7.2% intergenic (+389/‑41) purA → / → USA300TCH1516_00018 Adenylosuccinate synthetase/tRNA‑Glu
RA USA300TCH1516_ALE 41,166 G→A 16.8% intergenic (‑33/‑67) pbp ← / → mecR1 Beta‑lactam‑inducible penicillin‑binding protein/Methicillin resistance mecR1 protein
RA USA300TCH1516_ALE 41,171 T→C 14.1% intergenic (‑38/‑62) pbp ← / → mecR1 Beta‑lactam‑inducible penicillin‑binding protein/Methicillin resistance mecR1 protein
RA USA300TCH1516_ALE 77,984 T→C 7.8% intergenic (+93/‑334) USA300HOU_RS00350 → / → USA300HOU_RS00355 Monoacylglycerol lipase/hypothetical protein
RA USA300TCH1516_ALE 79,619 T→A 6.9% intergenic (+228/‑32) USA300HOU_RS00355 → / → cmoB hypothetical protein/tRNA U34 carboxymethyltransferase
RA USA300TCH1516_ALE 99,276 G→C 14.7% intergenic (+70/+2) USA300HOU_RS00465 → / ← tetA_1 hypothetical protein/Tetracycline resistance protein, class C
RA USA300TCH1516_ALE 110,660 T→A 8.3% I173I (ATT→ATA)  USA300HOU_RS00515 → putative lipoprotein
RA USA300TCH1516_ALE 111,512 A→G 25.0% S194S (TCA→TCG)  USA300HOU_RS00520 → putative lipoprotein
RA USA300TCH1516_ALE 111,516 C→A 24.8% Q196K (CAA→AAA)  USA300HOU_RS00520 → putative lipoprotein
RA USA300TCH1516_ALE 115,755 T→A 6.1% intergenic (+22/‑129) btr → / → yxeP_1 HTH‑type transcriptional activator Btr/putative hydrolase YxeP
RA USA300TCH1516_ALE 115,758 Δ1 bp 6.1% intergenic (+25/‑126) btr → / → yxeP_1 HTH‑type transcriptional activator Btr/putative hydrolase YxeP
RA USA300TCH1516_ALE 115,762:1 +T 6.1% intergenic (+29/‑122) btr → / → yxeP_1 HTH‑type transcriptional activator Btr/putative hydrolase YxeP
RA USA300TCH1516_ALE 115,765 T→A 5.3% intergenic (+32/‑119) btr → / → yxeP_1 HTH‑type transcriptional activator Btr/putative hydrolase YxeP
RA USA300TCH1516_ALE 168,350 A→T 14.6% intergenic (+317/+31) yfkN_1 → / ← USA300TCH1516_00148 Trifunctional nucleotide phosphoesterase protein YfkN/hypothetical protein
RA USA300TCH1516_ALE 168,354 C→G 12.5% intergenic (+321/+27) yfkN_1 → / ← USA300TCH1516_00148 Trifunctional nucleotide phosphoesterase protein YfkN/hypothetical protein
RA USA300TCH1516_ALE 168,358 A→T 7.7% intergenic (+325/+23) yfkN_1 → / ← USA300TCH1516_00148 Trifunctional nucleotide phosphoesterase protein YfkN/hypothetical protein
RA USA300TCH1516_ALE 217,036 T→A 14.6% intergenic (‑230/+23) rocD2_1 ← / ← brnQ_1 Ornithine aminotransferase 2/Branched‑chain amino acid transport system 2 carrier protein
RA USA300TCH1516_ALE 217,045 A→C 7.7% intergenic (‑239/+14) rocD2_1 ← / ← brnQ_1 Ornithine aminotransferase 2/Branched‑chain amino acid transport system 2 carrier protein
RA USA300TCH1516_ALE 217,046 C→T 7.9% intergenic (‑240/+13) rocD2_1 ← / ← brnQ_1 Ornithine aminotransferase 2/Branched‑chain amino acid transport system 2 carrier protein
RA USA300TCH1516_ALE 228,312 T→C 12.3% intergenic (+158/+36) ybbH_1 → / ← USA300TCH1516_00200 putative HTH‑type transcriptional regulator YbbH/hypothetical protein
RA USA300TCH1516_ALE 228,316 G→A 11.3% intergenic (+162/+32) ybbH_1 → / ← USA300TCH1516_00200 putative HTH‑type transcriptional regulator YbbH/hypothetical protein
RA USA300TCH1516_ALE 228,319 T→C 11.7% intergenic (+165/+29) ybbH_1 → / ← USA300TCH1516_00200 putative HTH‑type transcriptional regulator YbbH/hypothetical protein
RA USA300TCH1516_ALE 253,973 C→T 5.8% intergenic (+186/+176) asbF → / ← USA300HOU_RS01125 3‑dehydroshikimate dehydratase/hypothetical protein
RA USA300TCH1516_ALE 253,983 A→G 9.5% intergenic (+196/+166) asbF → / ← USA300HOU_RS01125 3‑dehydroshikimate dehydratase/hypothetical protein
RA USA300TCH1516_ALE 253,984 G→T 9.5% intergenic (+197/+165) asbF → / ← USA300HOU_RS01125 3‑dehydroshikimate dehydratase/hypothetical protein
RA USA300TCH1516_ALE 253,991 A→C 6.9% intergenic (+204/+158) asbF → / ← USA300HOU_RS01125 3‑dehydroshikimate dehydratase/hypothetical protein
RA USA300TCH1516_ALE 253,992 C→T 7.2% intergenic (+205/+157) asbF → / ← USA300HOU_RS01125 3‑dehydroshikimate dehydratase/hypothetical protein
RA USA300TCH1516_ALE 290,156 A→T 7.1% intergenic (+47/‑180) gatB_1 → / → gatC_1 PTS system galactitol‑specific EIIB component/PTS system galactitol‑specific EIIC component
RA USA300TCH1516_ALE 299,457 G→T 6.6% *390L (TGA→TTA)  tarF_1 → Teichoic acid glycerol‑phosphate transferase
RA USA300TCH1516_ALE 333,049 G→C 28.1% A753P (GCA→CCA)  esaA → ESAT‑6 secretion accessory factor EsaA
RA USA300TCH1516_ALE 341,450 G→C 10.2% D134H (GAT→CAT)  USA300HOU_RS01525 → hypothetical protein
RA USA300TCH1516_ALE 367,644 G→T 5.6% intergenic (‑96/‑62) nanA ← / → bglK N‑acetylneuraminate lyase/Beta‑glucoside kinase
RA USA300TCH1516_ALE 372,106 T→A 7.2% intergenic (‑166/‑204) ylbJ ← / → lip2 Sporulation integral membrane protein YlbJ/Lipase 2
RA USA300TCH1516_ALE 401,399 A→C 7.0% intergenic (‑184/‑57) USA300HOU_RS01845 ← / → sutR hypothetical protein/HTH‑type transcriptional regulator SutR
RA USA300TCH1516_ALE 401,404 G→T 9.1% intergenic (‑189/‑52) USA300HOU_RS01845 ← / → sutR hypothetical protein/HTH‑type transcriptional regulator SutR
RA USA300TCH1516_ALE 410,464 A→T 5.2% I522I (ATT→ATA)  yitJ ← Bifunctional homocysteine S‑methyltransferase/5,10‑methylenetetrahydrofolate reductase
RA USA300TCH1516_ALE 418,825 A→T 7.2% N53I (AAT→ATT)  rpsF → 30S ribosomal protein S6
RA USA300TCH1516_ALE 419,965 A→T 7.1% intergenic (+183/+83) rpsR → / ← USA300HOU_RS01950 30S ribosomal protein S18/hypothetical protein
RA USA300TCH1516_ALE 462,826 T→A 7.4% intergenic (+85/+18) USA300HOU_RS02185 → / ← USA300HOU_RS02190 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 482,712 C→A 38.9% intergenic (+509/‑174) USA300HOU_RS02285 → / → USA300HOU_RS02295 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 512,643 A→G 16.5% intergenic (+711/‑6052) recR → / → speA_2 Recombination protein RecR/Arginine decarboxylase
RA USA300TCH1516_ALE 536,863 T→A 8.5% intergenic (+56/‑255) rplY → / → pth 50S ribosomal protein L25/Peptidyl‑tRNA hydrolase
RA USA300TCH1516_ALE 536,868 T→A 9.9% intergenic (+61/‑250) rplY → / → pth 50S ribosomal protein L25/Peptidyl‑tRNA hydrolase
RA USA300TCH1516_ALE 536,920 T→A 5.2% intergenic (+113/‑198) rplY → / → pth 50S ribosomal protein L25/Peptidyl‑tRNA hydrolase
RA USA300TCH1516_ALE 536,926 C→A 5.1% intergenic (+119/‑192) rplY → / → pth 50S ribosomal protein L25/Peptidyl‑tRNA hydrolase
RA USA300TCH1516_ALE 576,908 Δ1 bp 10.1% intergenic (+331/‑59) gltX → / → cysE Glutamate‑‑tRNA ligase/Serine acetyltransferase
RA USA300TCH1516_ALE 576,915 C→G 9.7% intergenic (+338/‑52) gltX → / → cysE Glutamate‑‑tRNA ligase/Serine acetyltransferase
RA USA300TCH1516_ALE 576,920:1 +T 5.9% intergenic (+343/‑47) gltX → / → cysE Glutamate‑‑tRNA ligase/Serine acetyltransferase
RA USA300TCH1516_ALE 581,901 G→C 6.4% V13L (GTG→CTG)  nusG_2 → Transcription termination/antitermination protein NusG
RA USA300TCH1516_ALE 582,522 C→G 7.2% intergenic (+109/‑72) nusG_2 → / → rplK Transcription termination/antitermination protein NusG/50S ribosomal protein L11
RA USA300TCH1516_ALE 583,948 A→T 5.7% intergenic (+32/‑240) rplA → / → rplJ 50S ribosomal protein L1/50S ribosomal protein L10
RA USA300TCH1516_ALE 583,951 A→T 6.4% intergenic (+35/‑237) rplA → / → rplJ 50S ribosomal protein L1/50S ribosomal protein L10
RA USA300TCH1516_ALE 593,430 T→A 8.4% intergenic (+22/‑115) rpoC → / → rplGB DNA‑directed RNA polymerase subunit beta'/Ribosome‑associated protein L7Ae‑like protein
RA USA300TCH1516_ALE 593,433 T→A 8.2% intergenic (+25/‑112) rpoC → / → rplGB DNA‑directed RNA polymerase subunit beta'/Ribosome‑associated protein L7Ae‑like protein
RA USA300TCH1516_ALE 598,492 A→G 10.8% intergenic (+41/+241) tuf → / ← yxeP_2 Elongation factor Tu/putative hydrolase YxeP
RA USA300TCH1516_ALE 598,495 C→T 11.3% intergenic (+44/+238) tuf → / ← yxeP_2 Elongation factor Tu/putative hydrolase YxeP
RA USA300TCH1516_ALE 598,501 G→A 8.9% intergenic (+50/+232) tuf → / ← yxeP_2 Elongation factor Tu/putative hydrolase YxeP
RA USA300TCH1516_ALE 631,535 G→A 9.4% intergenic (+161/‑341) gph_1 → / → proP Phosphoglycolate phosphatase/Proline/betaine transporter
RA USA300TCH1516_ALE 631,536 T→C 9.2% intergenic (+162/‑340) gph_1 → / → proP Phosphoglycolate phosphatase/Proline/betaine transporter
RA USA300TCH1516_ALE 638,614 G→T 5.1% T14K (ACA→AAA)  pdxK ← Pyridoxine kinase
RA USA300TCH1516_ALE 639,592 C→G 5.3% A33G (GCC→GGC)  USA300HOU_RS03045 → hypothetical protein
RA USA300TCH1516_ALE 659,371 T→A 5.8% intergenic (+177/‑735) USA300TCH1516_00590 → / → USA300HOU_RS03165 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 667,064 T→G 9.0% D18E (GAT→GAG)  USA300TCH1516_00600 → hypothetical protein
RA USA300TCH1516_ALE 682,085 Δ1 bp 5.9% coding (74/504 nt) USA300TCH1516_00616 ← hypothetical protein
RA USA300TCH1516_ALE 690,093 A→G 8.8% intergenic (‑22/+13) USA300HOU_RS03320 ← / ← USA300HOU_RS03325 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 690,098 A→T 10.8% intergenic (‑27/+8) USA300HOU_RS03320 ← / ← USA300HOU_RS03325 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 690,101 A→T 10.5% intergenic (‑30/+5) USA300HOU_RS03320 ← / ← USA300HOU_RS03325 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 690,106 C→T 5.2% *128* (TAG→TAA)  USA300HOU_RS03325 ← hypothetical protein
RA USA300TCH1516_ALE 702,560 T→A 7.4% I118N (ATT→AAT)  nhaK_1 → Sodium, potassium, lithium and rubidium/H(+) antiporter
RA USA300TCH1516_ALE 707,879 A→T 6.4% L11I (TTA→ATA)  znuC_1 ← High‑affinity zinc uptake system ATP‑binding protein ZnuC
RA USA300TCH1516_ALE 707,911 C→T 55.4% intergenic (‑2/‑120) znuC_1 ← / → ideR High‑affinity zinc uptake system ATP‑binding protein ZnuC/Iron‑dependent repressor IdeR
RA USA300TCH1516_ALE 722,987 C→T 12.4% T42I (ACA→ATA)  feuB → Iron‑uptake system permease protein FeuB
RA USA300TCH1516_ALE 722,992 A→G 12.0% I44V (ATA→GTA)  feuB → Iron‑uptake system permease protein FeuB
RA USA300TCH1516_ALE 739,247 T→A 5.0% V161D (GTT→GAT)  pitA_1 → Low‑affinity inorganic phosphate transporter 1
RA USA300TCH1516_ALE 740,315 Δ1 bp 16.0% intergenic (+542/+46) pitA_1 → / ← sle1_2 Low‑affinity inorganic phosphate transporter 1/N‑acetylmuramoyl‑L‑alanine amidase sle1
RA USA300TCH1516_ALE 740,322 G→C 21.4% intergenic (+549/+39) pitA_1 → / ← sle1_2 Low‑affinity inorganic phosphate transporter 1/N‑acetylmuramoyl‑L‑alanine amidase sle1
RA USA300TCH1516_ALE 740,328:1 +G 15.2% intergenic (+555/+33) pitA_1 → / ← sle1_2 Low‑affinity inorganic phosphate transporter 1/N‑acetylmuramoyl‑L‑alanine amidase sle1
RA USA300TCH1516_ALE 770,855 A→G 5.8% intergenic (+41/‑209) ybaK → / → glcR Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR
RA USA300TCH1516_ALE 770,860 G→A 7.3% intergenic (+46/‑204) ybaK → / → glcR Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR
RA USA300TCH1516_ALE 770,866 A→T 7.6% intergenic (+52/‑198) ybaK → / → glcR Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR
RA USA300TCH1516_ALE 770,870 T→A 7.9% intergenic (+56/‑194) ybaK → / → glcR Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR
RA USA300TCH1516_ALE 770,877 A→T 8.4% intergenic (+63/‑187) ybaK → / → glcR Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR
RA USA300TCH1516_ALE 770,883 T→C 7.5% intergenic (+69/‑181) ybaK → / → glcR Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR
RA USA300TCH1516_ALE 770,888 C→T 5.5% intergenic (+74/‑176) ybaK → / → glcR Cys‑tRNA(Pro)/Cys‑tRNA(Cys) deacylase YbaK/HTH‑type transcriptional repressor GlcR
RA USA300TCH1516_ALE 779,970 G→A 6.6% intergenic (+26/+46) csbB → / ← saeS Putative glycosyltransferase CsbB/Histidine protein kinase SaeS
RA USA300TCH1516_ALE 790,778 G→A 92.2% intergenic (+277/‑197) kipA_1 → / → ltaS KipI antagonist/Lipoteichoic acid synthase
RA USA300TCH1516_ALE 803,528 C→T 20.7% intergenic (‑228/+42) USA300HOU_RS03920 ← / ← dtpT Putative lipid kinase/Di‑/tripeptide transporter
RA USA300TCH1516_ALE 803,539 A→G 21.7% intergenic (‑239/+31) USA300HOU_RS03920 ← / ← dtpT Putative lipid kinase/Di‑/tripeptide transporter
RA USA300TCH1516_ALE 837,540:1 +T 7.7% intergenic (+34/‑235) USA300HOU_RS04100 → / → uvrB hypothetical protein/UvrABC system protein B
RA USA300TCH1516_ALE 890,542 T→C 10.2% intergenic (+17/‑47) gcvH → / → USA300TCH1516_00820 Glycine cleavage system H protein/hypothetical protein
RA USA300TCH1516_ALE 890,548 A→T 10.9% intergenic (+23/‑41) gcvH → / → USA300TCH1516_00820 Glycine cleavage system H protein/hypothetical protein
RA USA300TCH1516_ALE 895,932 G→A 9.0% intergenic (+131/+12) metQ_2 → / ← Int‑Tn_1 Methionine‑binding lipoprotein MetQ/Transposase from transposon Tn916
RA USA300TCH1516_ALE 895,935 T→C 9.3% intergenic (+134/+9) metQ_2 → / ← Int‑Tn_1 Methionine‑binding lipoprotein MetQ/Transposase from transposon Tn916
RA USA300TCH1516_ALE 897,208 Δ1 bp 5.3% intergenic (‑44/+44) Int‑Tn_1 ← / ← entA_1 Transposase from transposon Tn916/Enterotoxin type A
RA USA300TCH1516_ALE 917,327 T→G 5.1% intergenic (+86/+244) sufB_2 → / ← USA300HOU_RS04545 FeS cluster assembly protein SufB/hypothetical protein
RA USA300TCH1516_ALE 937,148 T→C 11.7% intergenic (+55/‑76) USA300HOU_RS04665 → / → pepA_1 NADH dehydrogenase‑like protein/Cytosol aminopeptidase
RA USA300TCH1516_ALE 937,158 T→A 16.1% intergenic (+65/‑66) USA300HOU_RS04665 → / → pepA_1 NADH dehydrogenase‑like protein/Cytosol aminopeptidase
RA USA300TCH1516_ALE 937,168 G→A 10.4% intergenic (+75/‑56) USA300HOU_RS04665 → / → pepA_1 NADH dehydrogenase‑like protein/Cytosol aminopeptidase
RA USA300TCH1516_ALE 942,207 A→G 8.9% intergenic (‑178/+71) ptlE ← / ← mnhG1 Neopentalenolactone D synthase/Na(+)/H(+) antiporter subunit G1
RA USA300TCH1516_ALE 942,210 C→G 8.8% intergenic (‑181/+68) ptlE ← / ← mnhG1 Neopentalenolactone D synthase/Na(+)/H(+) antiporter subunit G1
RA USA300TCH1516_ALE 942,216 T→A 10.4% intergenic (‑187/+62) ptlE ← / ← mnhG1 Neopentalenolactone D synthase/Na(+)/H(+) antiporter subunit G1
RA USA300TCH1516_ALE 942,221 T→A 9.9% intergenic (‑192/+57) ptlE ← / ← mnhG1 Neopentalenolactone D synthase/Na(+)/H(+) antiporter subunit G1
RA USA300TCH1516_ALE 942,227 C→G 9.2% intergenic (‑198/+51) ptlE ← / ← mnhG1 Neopentalenolactone D synthase/Na(+)/H(+) antiporter subunit G1
RA USA300TCH1516_ALE 942,230 C→T 9.1% intergenic (‑201/+48) ptlE ← / ← mnhG1 Neopentalenolactone D synthase/Na(+)/H(+) antiporter subunit G1
RA USA300TCH1516_ALE 950,088 T→A 16.1% intergenic (+82/‑280) yugI_2 → / → USA300HOU_RS04740 General stress protein 13/putative oxidoreductase
RA USA300TCH1516_ALE 950,093 T→A 17.0% intergenic (+87/‑275) yugI_2 → / → USA300HOU_RS04740 General stress protein 13/putative oxidoreductase
RA USA300TCH1516_ALE 950,098 T→A 17.1% intergenic (+92/‑270) yugI_2 → / → USA300HOU_RS04740 General stress protein 13/putative oxidoreductase
RA USA300TCH1516_ALE 954,763 G→A 7.8% intergenic (+417/+86) gluD → / ← glpQ_1 NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase
RA USA300TCH1516_ALE 954,768 A→T 7.9% intergenic (+422/+81) gluD → / ← glpQ_1 NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase
RA USA300TCH1516_ALE 954,771 T→C 7.8% intergenic (+425/+78) gluD → / ← glpQ_1 NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase
RA USA300TCH1516_ALE 954,775 T→A 7.9% intergenic (+429/+74) gluD → / ← glpQ_1 NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase
RA USA300TCH1516_ALE 954,779 G→A 7.8% intergenic (+433/+70) gluD → / ← glpQ_1 NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase
RA USA300TCH1516_ALE 954,782 A→T 7.9% intergenic (+436/+67) gluD → / ← glpQ_1 NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase
RA USA300TCH1516_ALE 954,787 T→C 7.2% intergenic (+441/+62) gluD → / ← glpQ_1 NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase
RA USA300TCH1516_ALE 970,677 G→A 11.2% intergenic (+23/‑306) USA300HOU_RS04805 → / → USA300HOU_RS04810 Ureidoglycolate lyase/hypothetical protein
RA USA300TCH1516_ALE 970,681 T→A 11.0% intergenic (+27/‑302) USA300HOU_RS04805 → / → USA300HOU_RS04810 Ureidoglycolate lyase/hypothetical protein
RA USA300TCH1516_ALE 970,686 T→A 10.5% intergenic (+32/‑297) USA300HOU_RS04805 → / → USA300HOU_RS04810 Ureidoglycolate lyase/hypothetical protein
RA USA300TCH1516_ALE 970,690 T→C 10.7% intergenic (+36/‑293) USA300HOU_RS04805 → / → USA300HOU_RS04810 Ureidoglycolate lyase/hypothetical protein
RA USA300TCH1516_ALE 993,825 A→G 5.4% intergenic (+29/‑183) dppE → / → appA Dipeptide‑binding protein DppE/Oligopeptide‑binding protein AppA
RA USA300TCH1516_ALE 1,019,742 G→A 5.3% intergenic (+64/+49) USA300HOU_RS05030 → / ← ltaA Putative phosphoesterase/putative glycolipid permease LtaA
RA USA300TCH1516_ALE 1,019,747 T→C 5.2% intergenic (+69/+44) USA300HOU_RS05030 → / ← ltaA Putative phosphoesterase/putative glycolipid permease LtaA
RA USA300TCH1516_ALE 1,042,789 T→C 14.8% intergenic (+19/+70) tagE_3 → / ← catD Poly(glycerol‑phosphate) alpha‑glucosyltransferase/Putative oxidoreductase CatD
RA USA300TCH1516_ALE 1,042,796 G→A 18.8% intergenic (+26/+63) tagE_3 → / ← catD Poly(glycerol‑phosphate) alpha‑glucosyltransferase/Putative oxidoreductase CatD
RA USA300TCH1516_ALE 1,049,713 G→T 5.3% Q457H (CAG→CAT)  menD → 2‑succinyl‑5‑enolpyruvyl‑6‑hydroxy‑3‑ cyclohexene‑1‑carboxylate synthase
RA USA300TCH1516_ALE 1,049,714 A→C 5.4% M458L (ATG→CTG)  menD → 2‑succinyl‑5‑enolpyruvyl‑6‑hydroxy‑3‑ cyclohexene‑1‑carboxylate synthase
RA USA300TCH1516_ALE 1,055,119 C→A 5.2% G355C (GGT→TGT)  patA_2 ← Putative N‑acetyl‑LL‑diaminopimelate aminotransferase
RA USA300TCH1516_ALE 1,055,126 T→G 9.7% T352T (ACA→ACC)  patA_2 ← Putative N‑acetyl‑LL‑diaminopimelate aminotransferase
RA USA300TCH1516_ALE 1,076,529 G→C 7.9% M190I (ATG→ATC)  purQ → Phosphoribosylformylglycinamidine synthase subunit PurQ
RA USA300TCH1516_ALE 1,078,152 A→T 13.7% Q510L (CAG→CTG)  purL → Phosphoribosylformylglycinamidine synthase subunit PurL
RA USA300TCH1516_ALE 1,089,908 T→G 5.2% intergenic (+61/‑364) USA300HOU_RS05380 → / → rlmI hypothetical protein/Ribosomal RNA large subunit methyltransferase I
RA USA300TCH1516_ALE 1,096,997 T→C 5.4% V264A (GTA→GCA)  ythB → Putative cytochrome bd menaquinol oxidase subunit II
RA USA300TCH1516_ALE 1,107,402 T→C 11.0% intergenic (+37/‑131) pdhD → / → USA300HOU_RS05475 Dihydrolipoyl dehydrogenase/hypothetical protein
RA USA300TCH1516_ALE 1,128,680 T→A 9.3% Y286N (TAT→AAT)  ctaB2 → Protoheme IX farnesyltransferase 2
RA USA300TCH1516_ALE 1,158,427 G→A 9.6% intergenic (+11/‑313) uvrC → / → sdhC UvrABC system protein C/Succinate dehydrogenase cytochrome b558 subunit
RA USA300TCH1516_ALE 1,158,435 C→G 9.6% intergenic (+19/‑305) uvrC → / → sdhC UvrABC system protein C/Succinate dehydrogenase cytochrome b558 subunit
RA USA300TCH1516_ALE 1,158,443 T→C 7.7% intergenic (+27/‑297) uvrC → / → sdhC UvrABC system protein C/Succinate dehydrogenase cytochrome b558 subunit
RA USA300TCH1516_ALE 1,205,880 A→T 5.5% T65S (ACA→TCA)  lspA → Lipoprotein signal peptidase
RA USA300TCH1516_ALE 1,218,719 Δ1 bp 9.3% intergenic (+210/+53) USA300HOU_RS06065 → / ← USA300HOU_RS06070 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 1,218,722 T→A 9.3% intergenic (+213/+50) USA300HOU_RS06065 → / ← USA300HOU_RS06070 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 1,218,730 G→T 11.9% intergenic (+221/+42) USA300HOU_RS06065 → / ← USA300HOU_RS06070 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 1,218,732 C→G 11.9% intergenic (+223/+40) USA300HOU_RS06065 → / ← USA300HOU_RS06070 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 1,218,734 A→C 11.7% intergenic (+225/+38) USA300HOU_RS06065 → / ← USA300HOU_RS06070 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 1,218,741:1 +A 5.6% intergenic (+232/+31) USA300HOU_RS06065 → / ← USA300HOU_RS06070 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 1,218,743 T→G 5.1% intergenic (+234/+29) USA300HOU_RS06065 → / ← USA300HOU_RS06070 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 1,219,574 T→A 5.1% Q299L (CAG→CTG)  USA300HOU_RS06070 ← hypothetical protein
RA USA300TCH1516_ALE 1,221,653 G→A 10.5% intergenic (+68/‑148) rpoZ → / → coaBC DNA‑directed RNA polymerase subunit omega/Coenzyme A biosynthesis bifunctional protein CoaBC
RA USA300TCH1516_ALE 1,221,660 T→C 8.7% intergenic (+75/‑141) rpoZ → / → coaBC DNA‑directed RNA polymerase subunit omega/Coenzyme A biosynthesis bifunctional protein CoaBC
RA USA300TCH1516_ALE 1,221,661 G→A 8.8% intergenic (+76/‑140) rpoZ → / → coaBC DNA‑directed RNA polymerase subunit omega/Coenzyme A biosynthesis bifunctional protein CoaBC
RA USA300TCH1516_ALE 1,232,465 G→C 91.8% A124P (GCG→CCG)  prkC → Serine/threonine‑protein kinase PrkC
RA USA300TCH1516_ALE 1,245,330 A→T 6.8% intergenic (+135/‑108) fabG → / → acpP 3‑oxoacyl‑[acyl‑carrier‑protein] reductase FabG/Acyl carrier protein
RA USA300TCH1516_ALE 1,245,337 A→T 7.4% intergenic (+142/‑101) fabG → / → acpP 3‑oxoacyl‑[acyl‑carrier‑protein] reductase FabG/Acyl carrier protein
RA USA300TCH1516_ALE 1,245,338 A→T 8.0% intergenic (+143/‑100) fabG → / → acpP 3‑oxoacyl‑[acyl‑carrier‑protein] reductase FabG/Acyl carrier protein
RA USA300TCH1516_ALE 1,245,345 A→T 6.4% intergenic (+150/‑93) fabG → / → acpP 3‑oxoacyl‑[acyl‑carrier‑protein] reductase FabG/Acyl carrier protein
RA USA300TCH1516_ALE 1,255,820 C→T 5.4% intergenic (+36/+208) rplS → / ← USA300HOU_RS06250 50S ribosomal protein L19/hypothetical protein
RA USA300TCH1516_ALE 1,313,113 A→T 10.7% intergenic (+17/+280) rny_1 → / ← USA300HOU_RS06485 Ribonuclease Y/hypothetical protein
RA USA300TCH1516_ALE 1,331,236 T→A 7.1% S189T (TCT→ACT)  USA300HOU_RS06555 → Monoacylglycerol lipase
RA USA300TCH1516_ALE 1,331,241 T→A 7.9% S190R (AGT→AGA)  USA300HOU_RS06555 → Monoacylglycerol lipase
RA USA300TCH1516_ALE 1,343,619 A→C 14.5% intergenic (+32/‑98) USA300HOU_RS06640 → / → USA300TCH1516_01248 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 1,343,622 G→T 13.4% intergenic (+35/‑95) USA300HOU_RS06640 → / → USA300TCH1516_01248 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 1,366,121 A→T 6.2% intergenic (+420/‑34) rpmG2_1 → / → rpsN2 50S ribosomal protein L33 2/Alternate 30S ribosomal protein S14
RA USA300TCH1516_ALE 1,405,986 C→A 8.4% A77D (GCT→GAT)  trpG_2 → Anthranilate synthase component 2
RA USA300TCH1516_ALE 1,416,458 A→T 100% I216N (ATT→AAT)  oppD_4 ← Oligopeptide transport ATP‑binding protein OppD
RA USA300TCH1516_ALE 1,421,606 T→C 9.3% intergenic (+42/+98) pepF1_2 → / ← phoU Oligoendopeptidase F, plasmid/Phosphate‑specific transport system accessory protein PhoU
RA USA300TCH1516_ALE 1,421,610:1 +A 8.3% intergenic (+46/+94) pepF1_2 → / ← phoU Oligoendopeptidase F, plasmid/Phosphate‑specific transport system accessory protein PhoU
RA USA300TCH1516_ALE 1,421,615 C→G 7.7% intergenic (+51/+89) pepF1_2 → / ← phoU Oligoendopeptidase F, plasmid/Phosphate‑specific transport system accessory protein PhoU
RA USA300TCH1516_ALE 1,421,619 Δ1 bp 7.2% intergenic (+55/+85) pepF1_2 → / ← phoU Oligoendopeptidase F, plasmid/Phosphate‑specific transport system accessory protein PhoU
RA USA300TCH1516_ALE 1,421,625 G→A 7.5% intergenic (+61/+79) pepF1_2 → / ← phoU Oligoendopeptidase F, plasmid/Phosphate‑specific transport system accessory protein PhoU
RA USA300TCH1516_ALE 1,430,691 C→G 7.1% intergenic (+800/‑60) ybiT → / → lysC putative ABC transporter ATP‑binding protein YbiT/Aspartokinase
RA USA300TCH1516_ALE 1,430,693 T→A 7.3% intergenic (+802/‑58) ybiT → / → lysC putative ABC transporter ATP‑binding protein YbiT/Aspartokinase
RA USA300TCH1516_ALE 1,430,695 C→G 6.9% intergenic (+804/‑56) ybiT → / → lysC putative ABC transporter ATP‑binding protein YbiT/Aspartokinase
RA USA300TCH1516_ALE 1,435,065 C→G 19.9% A141G (GCT→GGT)  dapH → 2,3,4,5‑tetrahydropyridine‑2,6‑dicarboxylate N‑acetyltransferase
RA USA300TCH1516_ALE 1,440,007 Δ1 bp 84.7% coding (34/201 nt) cspA_2 ← Cold shock protein CspA
RA USA300TCH1516_ALE 1,447,045 T→A 6.3% I64F (ATC→TTC)  cobT ← Aerobic cobaltochelatase subunit CobT
RA USA300TCH1516_ALE 1,474,639 C→G 91.9% A9129P (GCA→CCA)  ebh_1 ← Extracellular matrix‑binding protein ebh
RA USA300TCH1516_ALE 1,476,685 T→A 5.7% M8447L (ATG→TTG)  ebh_1 ← Extracellular matrix‑binding protein ebh
RA USA300TCH1516_ALE 1,481,355 G→T 88.8% A6890E (GCA→GAA)  ebh_1 ← Extracellular matrix‑binding protein ebh
RA USA300TCH1516_ALE 1,487,340 T→A 5.6% H4895L (CAT→CTT)  ebh_1 ← Extracellular matrix‑binding protein ebh
RA USA300TCH1516_ALE 1,487,343 T→A 5.1% K4894M (AAG→ATG)  ebh_1 ← Extracellular matrix‑binding protein ebh
RA USA300TCH1516_ALE 1,502,422 C→G 6.5% *464S (TGA→TCA)  norB_4 ← Quinolone resistance protein NorB
RA USA300TCH1516_ALE 1,513,930 A→T 100% L413F (TTA→TTT)  USA300HOU_RS07375 → hypothetical protein
RA USA300TCH1516_ALE 1,526,532 T→A 7.2% K471* (AAA→TAA)  dinG_1 ← putative ATP‑dependent helicase DinG
RA USA300TCH1516_ALE 1,540,018 T→A 6.1% E43V (GAA→GTA)  ndk ← Nucleoside diphosphate kinase
RA USA300TCH1516_ALE 1,542,906 T→G 5.3% intergenic (‑408/+23) USA300HOU_RS07525 ← / ← hup hypothetical protein/DNA‑binding protein HU
RA USA300TCH1516_ALE 1,542,910 C→A 5.4% intergenic (‑412/+19) USA300HOU_RS07525 ← / ← hup hypothetical protein/DNA‑binding protein HU
RA USA300TCH1516_ALE 1,615,301 T→A 6.8% intergenic (‑31/+18) xerD_3 ← / ← fur Tyrosine recombinase XerD/Ferric uptake regulation protein
RA USA300TCH1516_ALE 1,615,309 A→T 5.6% intergenic (‑39/+10) xerD_3 ← / ← fur Tyrosine recombinase XerD/Ferric uptake regulation protein
RA USA300TCH1516_ALE 1,622,775 A→T 5.3% K43* (AAA→TAA)  marA → Multiple antibiotic resistance protein MarA
RA USA300TCH1516_ALE 1,646,189 G→C 100% A155G (GCA→GGA)  ypdF ← Aminopeptidase YpdF
RA USA300TCH1516_ALE 1,653,327 A→G 11.2% intergenic (‑32/+127) gcvT ← / ← aroK Aminomethyltransferase/Shikimate kinase
RA USA300TCH1516_ALE 1,653,332 A→G 13.2% intergenic (‑37/+122) gcvT ← / ← aroK Aminomethyltransferase/Shikimate kinase
RA USA300TCH1516_ALE 1,653,335 C→T 12.4% intergenic (‑40/+119) gcvT ← / ← aroK Aminomethyltransferase/Shikimate kinase
RA USA300TCH1516_ALE 1,653,340 C→T 12.4% intergenic (‑45/+114) gcvT ← / ← aroK Aminomethyltransferase/Shikimate kinase
RA USA300TCH1516_ALE 1,667,524 G→T 6.1% intergenic (‑35/+91) znuC_2 ← / ← nfo High‑affinity zinc uptake system ATP‑binding protein ZnuC/putative endonuclease 4
RA USA300TCH1516_ALE 1,685,139 A→T 7.5% intergenic (‑151/+69) USA300HOU_RS08395 ← / ← rpsU hypothetical protein/30S ribosomal protein S21
RA USA300TCH1516_ALE 1,685,148 C→T 5.4% intergenic (‑160/+60) USA300HOU_RS08395 ← / ← rpsU hypothetical protein/30S ribosomal protein S21
RA USA300TCH1516_ALE 1,685,149 T→A 6.8% intergenic (‑161/+59) USA300HOU_RS08395 ← / ← rpsU hypothetical protein/30S ribosomal protein S21
RA USA300TCH1516_ALE 1,744,362 G→A 8.1% H104Y (CAC→TAC)  apt ← Adenine phosphoribosyltransferase
RA USA300TCH1516_ALE 1,744,454 C→T 87.7% G73D (GGC→GAC)  apt ← Adenine phosphoribosyltransferase
RA USA300TCH1516_ALE 1,776,622 A→G 5.1% intergenic (‑99/+52) clpX ← / ← tig ATP‑dependent Clp protease ATP‑binding subunit ClpX/Trigger factor
RA USA300TCH1516_ALE 1,776,634 C→T 6.1% intergenic (‑111/+40) clpX ← / ← tig ATP‑dependent Clp protease ATP‑binding subunit ClpX/Trigger factor
RA USA300TCH1516_ALE 1,779,807 A→G 8.3% intergenic (‑113/+29) USA300TCH1516_01664 ← / ← rplT hypothetical protein/50S ribosomal protein L20
RA USA300TCH1516_ALE 1,779,810 A→T 8.0% intergenic (‑116/+26) USA300TCH1516_01664 ← / ← rplT hypothetical protein/50S ribosomal protein L20
RA USA300TCH1516_ALE 1,779,813 C→T 7.6% intergenic (‑119/+23) USA300TCH1516_01664 ← / ← rplT hypothetical protein/50S ribosomal protein L20
RA USA300TCH1516_ALE 1,794,352 A→T 8.6% Y426N (TAT→AAT)  USA300HOU_RS08960 ← hypothetical protein
RA USA300TCH1516_ALE 1,797,772 G→C 11.1% R7G (CGC→GGC)  phoR ← Alkaline phosphatase synthesis sensor protein PhoR
RA USA300TCH1516_ALE 1,845,292 C→T 7.9% M734I (ATG→ATA)  isdH ← Iron‑regulated surface determinant protein H
RA USA300TCH1516_ALE 1,845,295 A→G 8.7% D733D (GAT→GAC)  isdH ← Iron‑regulated surface determinant protein H
RA USA300TCH1516_ALE 1,850,932 T→A 7.1% H224L (CAT→CTT)  acsA_1 ← Acetyl‑coenzyme A synthetase
RA USA300TCH1516_ALE 1,857,971 C→T 15.7% A135T (GCA→ACA)  USA300HOU_RS09235 ← hypothetical protein
RA USA300TCH1516_ALE 1,909,134 T→A 5.4% intergenic (‑200/‑60) tal ← / → USA300HOU_RS09460 Transaldolase/hypothetical protein
RA USA300TCH1516_ALE 1,909,137 T→A 5.2% intergenic (‑203/‑57) tal ← / → USA300HOU_RS09460 Transaldolase/hypothetical protein
RA USA300TCH1516_ALE 1,929,570 T→G 6.1% E32A (GAG→GCG)  USA300TCH1516_01793 ← hypothetical protein
RA USA300TCH1516_ALE 1,929,573 C→A 5.9% R31L (CGC→CTC)  USA300TCH1516_01793 ← hypothetical protein
RA USA300TCH1516_ALE 1,931,599 A→T 16.4% L1217I (TTA→ATA)  USA300HOU_RS09605 ← hypothetical protein
RA USA300TCH1516_ALE 1,934,780 A→T 5.9% N156K (AAT→AAA)  USA300HOU_RS09605 ← hypothetical protein
RA USA300TCH1516_ALE 1,972,372 G→A 12.8% A23T (GCT→ACT)  prsA → Foldase protein PrsA
RA USA300TCH1516_ALE 2,010,363 C→T 100% C146Y (TGT→TAT)  USA300HOU_RS10125 ← Putative multidrug export ATP‑binding/permease protein
RA USA300TCH1516_ALE 2,042,100 T→A 5.3% K338N (AAA→AAT)  gatB_2 ← Aspartyl/glutamyl‑tRNA(Asn/Gln) amidotransferase subunit B
RA USA300TCH1516_ALE 2,123,779 T→A 5.5% intergenic (‑39/‑94) USA300HOU_RS10825 ← / → lexA_2 hypothetical protein/LexA repressor
RA USA300TCH1516_ALE 2,126,293 A→C 5.1% intergenic (+26/‑52) USA300HOU_RS10850 → / → USA300HOU_RS10855 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 2,129,368 A→G 8.1% intergenic (+201/+37) hlb_2 → / ← USA300HOU_RS10870 Phospholipase C/putative leukocidin‑like protein 1
RA USA300TCH1516_ALE 2,129,372 A→G 7.5% intergenic (+205/+33) hlb_2 → / ← USA300HOU_RS10870 Phospholipase C/putative leukocidin‑like protein 1
RA USA300TCH1516_ALE 2,129,379 T→A 7.0% intergenic (+212/+26) hlb_2 → / ← USA300HOU_RS10870 Phospholipase C/putative leukocidin‑like protein 1
RA USA300TCH1516_ALE 2,129,380 C→G 7.1% intergenic (+213/+25) hlb_2 → / ← USA300HOU_RS10870 Phospholipase C/putative leukocidin‑like protein 1
RA USA300TCH1516_ALE 2,129,381 T→A 7.0% intergenic (+214/+24) hlb_2 → / ← USA300HOU_RS10870 Phospholipase C/putative leukocidin‑like protein 1
RA USA300TCH1516_ALE 2,129,388 C→T 8.5% intergenic (+221/+17) hlb_2 → / ← USA300HOU_RS10870 Phospholipase C/putative leukocidin‑like protein 1
RA USA300TCH1516_ALE 2,129,392 C→T 8.2% intergenic (+225/+13) hlb_2 → / ← USA300HOU_RS10870 Phospholipase C/putative leukocidin‑like protein 1
RA USA300TCH1516_ALE 2,133,490 A→T 5.6% intergenic (+334/+38) dapE → / ← USA300HOU_RS10885 putative succinyl‑diaminopimelate desuccinylase/hypothetical protein
RA USA300TCH1516_ALE 2,165,416 A→T 5.4% intergenic (‑384/‑94) tsaE ← / → ilvD tRNA threonylcarbamoyladenosine biosynthesis protein TsaE/Dihydroxy‑acid dehydratase
RA USA300TCH1516_ALE 2,172,067:1 +G 9.2% coding (116/1047 nt) leuB → 3‑isopropylmalate dehydrogenase
RA USA300TCH1516_ALE 2,172,075 G→C 11.0% E42Q (GAA→CAA)  leuB → 3‑isopropylmalate dehydrogenase
RA USA300TCH1516_ALE 2,172,078 T→A 11.5% F43I (TTT→ATT)  leuB → 3‑isopropylmalate dehydrogenase
RA USA300TCH1516_ALE 2,172,081 G→C 11.6% G44R (GGT→CGT)  leuB → 3‑isopropylmalate dehydrogenase
RA USA300TCH1516_ALE 2,172,088 Δ1 bp 8.7% coding (137/1047 nt) leuB → 3‑isopropylmalate dehydrogenase
RA USA300TCH1516_ALE 2,192,759:1 +G 5.1% coding (378/480 nt) USA300HOU_RS11200 ← hypothetical protein
RA USA300TCH1516_ALE 2,211,658 G→A 6.5% intergenic (+651/+162) USA300HOU_RS11275 → / ← yidC hypothetical protein/Membrane protein insertase YidC
RA USA300TCH1516_ALE 2,211,664 Δ1 bp 6.8% intergenic (+657/+156) USA300HOU_RS11275 → / ← yidC hypothetical protein/Membrane protein insertase YidC
RA USA300TCH1516_ALE 2,211,670 C→A 7.9% intergenic (+663/+150) USA300HOU_RS11275 → / ← yidC hypothetical protein/Membrane protein insertase YidC
RA USA300TCH1516_ALE 2,211,673 T→G 8.2% intergenic (+666/+147) USA300HOU_RS11275 → / ← yidC hypothetical protein/Membrane protein insertase YidC
RA USA300TCH1516_ALE 2,211,678:1 +G 8.3% intergenic (+671/+142) USA300HOU_RS11275 → / ← yidC hypothetical protein/Membrane protein insertase YidC
RA USA300TCH1516_ALE 2,211,684 T→C 6.1% intergenic (+677/+136) USA300HOU_RS11275 → / ← yidC hypothetical protein/Membrane protein insertase YidC
RA USA300TCH1516_ALE 2,216,257 G→A 38.5% S178L (TCA→TTA)  sceD ← putative transglycosylase SceD
RA USA300TCH1516_ALE 2,243,499 T→A 17.4% intergenic (+77/+32) USA300HOU_RS11475 → / ← pyrG hypothetical protein/CTP synthase
RA USA300TCH1516_ALE 2,243,504 A→T 11.3% intergenic (+82/+27) USA300HOU_RS11475 → / ← pyrG hypothetical protein/CTP synthase
RA USA300TCH1516_ALE 2,268,572 A→T 8.6% intergenic (‑1008/+78) USA300HOU_RS11605 ← / ← ywpJ_2 hypothetical protein/Phosphatase YwpJ
RA USA300TCH1516_ALE 2,279,705 G→A 100% A943V (GCA→GTA)  ebh_3 ← Extracellular matrix‑binding protein ebh
RA USA300TCH1516_ALE 2,286,337 C→T 5.9% intergenic (‑250/+27) ebh_4 ← / ← glmM Extracellular matrix‑binding protein ebh/Phosphoglucosamine mutase
RA USA300TCH1516_ALE 2,309,787:1 +C 12.7% coding (82/1032 nt) yfiZ_2 ← putative siderophore transport system permease protein YfiZ
RA USA300TCH1516_ALE 2,309,793:1 +G 14.7% coding (76/1032 nt) yfiZ_2 ← putative siderophore transport system permease protein YfiZ
RA USA300TCH1516_ALE 2,309,800 Δ1 bp 15.2% coding (69/1032 nt) yfiZ_2 ← putative siderophore transport system permease protein YfiZ
RA USA300TCH1516_ALE 2,309,807 Δ1 bp 10.4% coding (62/1032 nt) yfiZ_2 ← putative siderophore transport system permease protein YfiZ
RA USA300TCH1516_ALE 2,328,872 G→C 6.0% F264L (TTC→TTG)  lacE ← PTS system lactose‑specific EIICB component
RA USA300TCH1516_ALE 2,372,407 A→G 18.2% intergenic (+158/+34) USA300TCH1516_02262 → / ← pbuG hypothetical protein/Guanine/hypoxanthine permease PbuG
RA USA300TCH1516_ALE 2,372,413 C→G 22.1% intergenic (+164/+28) USA300TCH1516_02262 → / ← pbuG hypothetical protein/Guanine/hypoxanthine permease PbuG
RA USA300TCH1516_ALE 2,372,419 C→T 19.8% intergenic (+170/+22) USA300TCH1516_02262 → / ← pbuG hypothetical protein/Guanine/hypoxanthine permease PbuG
RA USA300TCH1516_ALE 2,398,086 A→T 5.2% intergenic (‑247/‑43) modA ← / → fdhD Molybdate‑binding periplasmic protein/Sulfurtransferase FdhD
RA USA300TCH1516_ALE 2,424,608 A→G 6.2% intergenic (‑166/+62) USA300HOU_RS12490 ← / ← USA300HOU_RS12495 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 2,424,609 C→T 7.9% intergenic (‑167/+61) USA300HOU_RS12490 ← / ← USA300HOU_RS12495 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 2,428,877 T→A 5.6% D257V (GAT→GTT)  lytR_2 ← Transcriptional regulator LytR
RA USA300TCH1516_ALE 2,428,879 T→A 5.9% T256T (ACA→ACT) ‡ lytR_2 ← Transcriptional regulator LytR
RA USA300TCH1516_ALE 2,428,881 T→A 5.7% T256S (ACA→TCA) ‡ lytR_2 ← Transcriptional regulator LytR
RA USA300TCH1516_ALE 2,430,685 Δ1 bp 11.6% intergenic (‑109/‑276) suhB_2 ← / → birA_2 Inositol‑1‑monophosphatase/Bifunctional ligase/repressor BirA
RA USA300TCH1516_ALE 2,430,691:1 +A 8.2% intergenic (‑115/‑270) suhB_2 ← / → birA_2 Inositol‑1‑monophosphatase/Bifunctional ligase/repressor BirA
RA USA300TCH1516_ALE 2,448,479 A→G 6.4% intergenic (‑238/+39) yxeP_4 ← / ← hutI putative hydrolase YxeP/Imidazolonepropionase
RA USA300TCH1516_ALE 2,448,484 A→G 9.7% intergenic (‑243/+34) yxeP_4 ← / ← hutI putative hydrolase YxeP/Imidazolonepropionase
RA USA300TCH1516_ALE 2,448,493 C→T 12.4% intergenic (‑252/+25) yxeP_4 ← / ← hutI putative hydrolase YxeP/Imidazolonepropionase
RA USA300TCH1516_ALE 2,448,498 C→T 11.9% intergenic (‑257/+20) yxeP_4 ← / ← hutI putative hydrolase YxeP/Imidazolonepropionase
RA USA300TCH1516_ALE 2,449,468 A→T 9.5% S97T (TCT→ACT)  hutI ← Imidazolonepropionase
RA USA300TCH1516_ALE 2,476,196 T→A 6.8% Q20H (CAA→CAT)  tcaA ← Membrane‑associated protein TcaA
RA USA300TCH1516_ALE 2,476,201 T→G 11.4% T19P (ACA→CCA)  tcaA ← Membrane‑associated protein TcaA
RA USA300TCH1516_ALE 2,497,391 C→G 11.2% N147K (AAC→AAG)  USA300HOU_RS12865 → hypothetical protein
RA USA300TCH1516_ALE 2,509,782 T→A 5.1% intergenic (‑94/‑276) narT ← / → USA300HOU_RS12920 putative nitrate transporter NarT/hypothetical protein
RA USA300TCH1516_ALE 2,514,671 G→A 43.6% H54H (CAC→CAT)  narX ← Nitrate reductase‑like protein NarX
RA USA300TCH1516_ALE 2,517,770 A→T 6.9% S954S (TCT→TCA)  narG ← Respiratory nitrate reductase 1 alpha chain
RA USA300TCH1516_ALE 2,517,775 A→C 12.0% S953A (TCA→GCA)  narG ← Respiratory nitrate reductase 1 alpha chain
RA USA300TCH1516_ALE 2,517,782 T→A 12.1% L950L (CTA→CTT)  narG ← Respiratory nitrate reductase 1 alpha chain
RA USA300TCH1516_ALE 2,517,789 G→T 8.1% A948E (GCA→GAA)  narG ← Respiratory nitrate reductase 1 alpha chain
RA USA300TCH1516_ALE 2,519,951 T→G 8.2% P227P (CCA→CCC)  narG ← Respiratory nitrate reductase 1 alpha chain
RA USA300TCH1516_ALE 2,530,786 A→G 10.6% intergenic (‑37/+236) yefM ← / ← bdbD Antitoxin YefM/Disulfide bond formation protein D
RA USA300TCH1516_ALE 2,530,791 C→T 5.9% intergenic (‑42/+231) yefM ← / ← bdbD Antitoxin YefM/Disulfide bond formation protein D
RA USA300TCH1516_ALE 2,532,298 A→T 100% T15T (ACA→ACT)  femA_3 → Aminoacyltransferase FemA
RA USA300TCH1516_ALE 2,538,743 A→T 11.3% intergenic (‑257/+70) gpmA_2 ← / ← fieF 2,3‑bisphosphoglycerate‑dependent phosphoglycerate mutase/Ferrous‑iron efflux pump FieF
RA USA300TCH1516_ALE 2,538,744 A→T 11.6% intergenic (‑258/+69) gpmA_2 ← / ← fieF 2,3‑bisphosphoglycerate‑dependent phosphoglycerate mutase/Ferrous‑iron efflux pump FieF
RA USA300TCH1516_ALE 2,559,830 A→G 11.1% intergenic (+24/+99) bcr_2 → / ← USA300HOU_RS13190 Bicyclomycin resistance protein/hypothetical protein
RA USA300TCH1516_ALE 2,559,831 G→A 11.5% intergenic (+25/+98) bcr_2 → / ← USA300HOU_RS13190 Bicyclomycin resistance protein/hypothetical protein
RA USA300TCH1516_ALE 2,559,840 T→G 16.5% intergenic (+34/+89) bcr_2 → / ← USA300HOU_RS13190 Bicyclomycin resistance protein/hypothetical protein
RA USA300TCH1516_ALE 2,559,841 C→A 15.4% intergenic (+35/+88) bcr_2 → / ← USA300HOU_RS13190 Bicyclomycin resistance protein/hypothetical protein
RA USA300TCH1516_ALE 2,559,850 T→C 7.2% intergenic (+44/+79) bcr_2 → / ← USA300HOU_RS13190 Bicyclomycin resistance protein/hypothetical protein
RA USA300TCH1516_ALE 2,559,851 C→T 6.7% intergenic (+45/+78) bcr_2 → / ← USA300HOU_RS13190 Bicyclomycin resistance protein/hypothetical protein
RA USA300TCH1516_ALE 2,561,495 Δ1 bp 5.7% coding (546/807 nt) cpdA ← 3',5'‑cyclic adenosine monophosphate phosphodiesterase CpdA
RA USA300TCH1516_ALE 2,563,759 A→G 9.0% intergenic (+24/‑114) cycA_2 → / → nhaK_2 D‑serine/D‑alanine/glycine transporter/Sodium, potassium, lithium and rubidium/H(+) antiporter
RA USA300TCH1516_ALE 2,563,763 C→G 10.1% intergenic (+28/‑110) cycA_2 → / → nhaK_2 D‑serine/D‑alanine/glycine transporter/Sodium, potassium, lithium and rubidium/H(+) antiporter
RA USA300TCH1516_ALE 2,582,141 Δ1 bp 5.2% coding (1169/1353 nt) pnbA → Para‑nitrobenzyl esterase
RA USA300TCH1516_ALE 2,608,816 A→G 8.6% intergenic (+97/+163) USA300TCH1516_02485 → / ← USA300HOU_RS13450 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 2,608,820 A→T 9.4% intergenic (+101/+159) USA300TCH1516_02485 → / ← USA300HOU_RS13450 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 2,608,825 A→T 15.0% intergenic (+106/+154) USA300TCH1516_02485 → / ← USA300HOU_RS13450 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 2,608,829 C→T 11.1% intergenic (+110/+150) USA300TCH1516_02485 → / ← USA300HOU_RS13450 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 2,611,882 T→G 5.5% intergenic (‑205/+7) USA300HOU_RS13465 ← / ← USA300TCH1516_02490 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 2,611,883 C→A 5.1% intergenic (‑206/+6) USA300HOU_RS13465 ← / ← USA300TCH1516_02490 hypothetical protein/hypothetical protein
RA USA300TCH1516_ALE 2,627,278 Δ1 bp 8.6% intergenic (‑216/‑109) sarT ← / → sarU HTH‑type transcriptional regulator SarT/HTH‑type transcriptional regulator SarU
RA USA300TCH1516_ALE 2,627,280:1 +A 8.4% intergenic (‑218/‑107) sarT ← / → sarU HTH‑type transcriptional regulator SarT/HTH‑type transcriptional regulator SarU
RA USA300TCH1516_ALE 2,636,962 A→T 5.4% Y271* (TAT→TAA)  gntT ← High‑affinity gluconate transporter
RA USA300TCH1516_ALE 2,636,965 A→T 5.1% I270I (ATT→ATA)  gntT ← High‑affinity gluconate transporter
RA USA300TCH1516_ALE 2,679,168 T→C 7.6% intergenic (+40/‑349) USA300HOU_RS13790 → / → ssaA2_4 hypothetical protein/Staphylococcal secretory antigen ssaA2
RA USA300TCH1516_ALE 2,701,267 C→T 5.0% V198M (GTG→ATG)  bacF ← Transaminase BacF
RA USA300TCH1516_ALE 2,725,352 A→T 12.1% intergenic (‑58/+276) USA300HOU_RS14015 ← / ← USA300HOU_RS14020 Baeyer‑Villiger flavin‑containing monooxygenase/hypothetical protein
RA USA300TCH1516_ALE 2,744,200 G→A 9.6% intergenic (+137/+56) fda → / ← mqo2 Fructose‑bisphosphate aldolase class 1/putative malate:quinone oxidoreductase 2
RA USA300TCH1516_ALE 2,744,205 A→G 14.4% intergenic (+142/+51) fda → / ← mqo2 Fructose‑bisphosphate aldolase class 1/putative malate:quinone oxidoreductase 2
RA USA300TCH1516_ALE 2,744,213 T→A 14.9% intergenic (+150/+43) fda → / ← mqo2 Fructose‑bisphosphate aldolase class 1/putative malate:quinone oxidoreductase 2
RA USA300TCH1516_ALE 2,744,226 T→C 12.9% intergenic (+163/+30) fda → / ← mqo2 Fructose‑bisphosphate aldolase class 1/putative malate:quinone oxidoreductase 2
RA USA300TCH1516_ALE 2,780,409 A→C 5.2% Y106* (TAT→TAG)  arcD_2 ← Arginine/ornithine antiporter
RA USA300TCH1516_ALE 2,825,587 C→T 5.2% intergenic (‑402/+446) cap8A_2 ← / ← icaR Capsular polysaccharide type 8 biosynthesis protein cap8A/Biofilm operon icaADBC HTH‑type negative transcriptional regulator IcaR
RA USA300TCH1516_ALE 2,825,599 A→G 8.4% intergenic (‑414/+434) cap8A_2 ← / ← icaR Capsular polysaccharide type 8 biosynthesis protein cap8A/Biofilm operon icaADBC HTH‑type negative transcriptional regulator IcaR
RA USA300TCH1516_ALE 2,833,387 G→C 11.9% intergenic (‑723/+367) lipA_2 ← / ← hisI Lipase 1/Phosphoribosyl‑AMP cyclohydrolase

Unassigned new junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? CP000731 34 =384 (0.420)78 (0.090) 17/146 NT 14.2% intergenic (–/‑198) –/repA –/replication protein A
?CP000731 65 = 593 (0.710)intergenic (–/‑167) –/repA –/replication protein A
* ? CP000731 = 64652 (0.710)83 (0.160)
+33 bp		 14/94 NT 30.4% intergenic (–/‑168) –/repA –/replication protein A
?CP000731 = 27041 0 (0.000)intergenic (‑194/–) USA300HOU_pUSA300HOUMR0033/– partitioning protein/–
* ? CP000731 3772 =705 (0.770)75 (0.090) 18/140 NT 10.8% intergenic (+388/‑96) USA300HOU_pUSA300HOUMR0005/USA300HOU_pUSA300HOUMR0006 hypothetical protein/hypothetical protein
?CP000731 3805 = 628 (0.790)intergenic (+421/‑63) USA300HOU_pUSA300HOUMR0005/USA300HOU_pUSA300HOUMR0006 hypothetical protein/hypothetical protein
* ? CP000731 = 3781672 (0.730)119 (0.150) 18/140 NT 16.4% intergenic (+397/‑87) USA300HOU_pUSA300HOUMR0005/USA300HOU_pUSA300HOUMR0006 hypothetical protein/hypothetical protein
?CP000731 = 3794 628 (0.790)intergenic (+410/‑74) USA300HOU_pUSA300HOUMR0005/USA300HOU_pUSA300HOUMR0006 hypothetical protein/hypothetical protein
* ? CP000731 = 4373180 (0.200)165 (0.120) 15/148 NT 25.8% intergenic (+338/‑127) USA300HOU_pUSA300HOUMR0006/cadR hypothetical protein/cadmium binding protein
?NC_012417 = 1986 785 (0.410)intergenic (+219/+107) USA300HOU_RS14895/USA300HOU_RS14900 hypothetical protein/hypothetical protein
* ? CP000731 7662 =892 (0.970)119 (0.150) 20/138 NT 13.1% intergenic (+272/+254) USA300HOU_pUSA300HOUMR0010/blaZ MarR family transcriptional regulator/beta‑lactamase
?CP000731 7700 = 816 (1.040)intergenic (+310/+216) USA300HOU_pUSA300HOUMR0010/blaZ MarR family transcriptional regulator/beta‑lactamase
* ? CP000731 = 7672883 (0.960)132 (0.170) 19/138 NT 14.3% intergenic (+282/+244) USA300HOU_pUSA300HOUMR0010/blaZ MarR family transcriptional regulator/beta‑lactamase
?CP000731 = 7688 816 (1.040)intergenic (+298/+228) USA300HOU_pUSA300HOUMR0010/blaZ MarR family transcriptional regulator/beta‑lactamase
* ? CP000731 11951 =983 (1.070)61 (0.080) 20/134 NT 7.5% intergenic (+114/+109) USA300HOU_pUSA300HOUMR0014/USA300HOU_pUSA300HOUMR0015 recombinase/hypothetical protein
?CP000731 11987 = 687 (0.900)intergenic (+150/+73) USA300HOU_pUSA300HOUMR0014/USA300HOU_pUSA300HOUMR0015 recombinase/hypothetical protein
* ? CP000731 = 12901NA (NA)6 (0.010) 3/146 NT NA coding (395/675 nt) USA300HOU_pUSA300HOUMR0016 IS257 transposase
?CP000731 = 12938 NA (NA)coding (432/675 nt) USA300HOU_pUSA300HOUMR0016 IS257 transposase
* ? CP000731 17008 =NA (NA)29 (0.030) 13/148 NT 100% coding (54/675 nt) USA300HOU_pUSA300HOUMR0021 IS431 mec transposase
?CP000731 17011 = 0 (0.000)coding (51/675 nt) USA300HOU_pUSA300HOUMR0021 IS431 mec transposase
* ? CP000731 19515 =750 (0.820)38 (0.040) 13/148 NT 5.4% intergenic (‑557/+881) USA300HOU_pUSA300HOUMR0024/USA300HOU_pUSA300HOUMR0027 bacitracin ABC ATP binding cassette transporter, ABC protein/IS431mec transposase
?CP000731 19534 = 651 (0.770)intergenic (‑576/+862) USA300HOU_pUSA300HOUMR0024/USA300HOU_pUSA300HOUMR0027 bacitracin ABC ATP binding cassette transporter, ABC protein/IS431mec transposase
* ? CP000731 20439 =584 (0.640)50 (0.090) 14/154 NT 13.7% coding (632/675 nt) USA300HOU_pUSA300HOUMR0027 IS431mec transposase
?USA300TCH1516_ALE 35944 = 69 (0.350)coding (608/675 nt) USA300HOU_RS00140 hypothetical protein
* ? CP000731 = 21481549 (0.600)136 (0.170) 17/144 NT 20.6% intergenic (‑411/‑63) USA300HOU_pUSA300HOUMR0027/USA300HOU_pUSA300HOUMR0028 IS431mec transposase/macrolide transporter
?CP000731 = 21492 553 (0.670)intergenic (‑422/‑52) USA300HOU_pUSA300HOUMR0027/USA300HOU_pUSA300HOUMR0028 IS431mec transposase/macrolide transporter
* ? CP000731 25265 =593 (0.650)26 (0.040) 12/114 NT 5.3% intergenic (+163/‑83) USA300HOU_pUSA300HOUMR0030/USA300HOU_pUSA300HOUMR0031 Sin recombinase/hypothetical protein
?CP000731 25334 = 508 (0.780)intergenic (+232/‑14) USA300HOU_pUSA300HOUMR0030/USA300HOU_pUSA300HOUMR0031 Sin recombinase/hypothetical protein
* ? CP000731 = 25287559 (0.610)38 (0.060) 12/114 NT 7.8% intergenic (+185/‑61) USA300HOU_pUSA300HOUMR0030/USA300HOU_pUSA300HOUMR0031 Sin recombinase/hypothetical protein
?CP000731 = 25310 508 (0.780)intergenic (+208/‑38) USA300HOU_pUSA300HOUMR0030/USA300HOU_pUSA300HOUMR0031 Sin recombinase/hypothetical protein
* ? CP000731 25306 =509 (0.560)103 (0.130) 20/138 NT 19.7% intergenic (+204/‑42) USA300HOU_pUSA300HOUMR0030/USA300HOU_pUSA300HOUMR0031 Sin recombinase/hypothetical protein
?CP000731 25340 = 401 (0.510)intergenic (+238/‑8) USA300HOU_pUSA300HOUMR0030/USA300HOU_pUSA300HOUMR0031 Sin recombinase/hypothetical protein
* ? NC_012417 1 =0 (0.000)31 (0.020)
+ATAAAAAGAC		 8/140 NT 5.5% intergenic (–/‑279) –/USA300HOU_RS14890 –/replication protein
?NC_012417 3071 = 1228 (0.590)intergenic (‑397/–) USA300HOU_RS14900/– hypothetical protein/–
* ? NC_012417 987 =980 (0.470)192 (0.110) 19/138 NT 19.2% pseudogene (708/709 nt) USA300HOU_RS14890 replication protein
?NC_012417 1013 = 777 (0.430)coding (182/192 nt) USA300HOU_RS15665 hypothetical protein
* ? NC_012417 = 997894 (0.430)152 (0.080) 30/138 NT 16.4% intergenic (+9/+6) USA300HOU_RS14890/USA300HOU_RS15665 replication protein/hypothetical protein
?NC_012417 = 1001 777 (0.430)intergenic (+13/+2) USA300HOU_RS14890/USA300HOU_RS15665 replication protein/hypothetical protein
* ? NC_012417 = 1057604 (0.290)50 (0.030) 16/124 NT 7.9% coding (138/192 nt) USA300HOU_RS15665 hypothetical protein
?NC_012417 = 1071 705 (0.440)coding (124/192 nt) USA300HOU_RS15665 hypothetical protein
* ? NC_012417 = 19741112 (0.530)157 (0.090) 16/138 NT 14.1% intergenic (+207/+119) USA300HOU_RS14895/USA300HOU_RS14900 hypothetical protein/hypothetical protein
?NC_012417 = 2041 NA (NA)intergenic (+274/+52) USA300HOU_RS14895/USA300HOU_RS14900 hypothetical protein/hypothetical protein
* ? NC_012417 1975 =NA (NA)186 (0.100) 20/138 NT 24.8% intergenic (+208/+118) USA300HOU_RS14895/USA300HOU_RS14900 hypothetical protein/hypothetical protein
?NC_012417 2042 = 654 (0.310)intergenic (+275/+51) USA300HOU_RS14895/USA300HOU_RS14900 hypothetical protein/hypothetical protein
* ? NC_012417 1993 =NA (NA)197 (0.100) 16/148 NT 29.5% intergenic (+226/+100) USA300HOU_RS14895/USA300HOU_RS14900 hypothetical protein/hypothetical protein
?NC_012417 2021 = 509 (0.240)intergenic (+254/+72) USA300HOU_RS14895/USA300HOU_RS14900 hypothetical protein/hypothetical protein
* ? NC_012417 = 30771075 (0.510)47 (0.020) 11/146 NT 7.5% intergenic (‑403/–) USA300HOU_RS14900/– hypothetical protein/–
?NC_012417 = 3108 180 (0.090)intergenic (‑434/–) USA300HOU_RS14900/– hypothetical protein/–
* ? USA300TCH1516_ALE = 2161198 (0.970)13 (0.070) 10/152 NT 6.4% intergenic (+256/‑22) dnaA/dnaN Chromosomal replication initiator protein DnaA/DNA polymerase III subunit beta
?USA300TCH1516_ALE = 2172 195 (1.010)intergenic (+267/‑11) dnaA/dnaN Chromosomal replication initiator protein DnaA/DNA polymerase III subunit beta
* ? USA300TCH1516_ALE = 27343204 (1.000)11 (0.060) 5/148 NT 5.4% coding (1678/1827 nt) walK Sensor protein kinase WalK
?USA300TCH1516_ALE = 27364 197 (1.050)coding (1699/1827 nt) walK Sensor protein kinase WalK
* ? USA300TCH1516_ALE = 29630170 (0.830)12 (0.070) 8/142 NT 7.2% intergenic (+22/‑368) yycI/yycJ Two‑component system WalR/WalK regulatory protein YycI/Putative metallo‑hydrolase YycJ
?USA300TCH1516_ALE = 29658 158 (0.880)intergenic (+50/‑340) yycI/yycJ Two‑component system WalR/WalK regulatory protein YycI/Putative metallo‑hydrolase YycJ
* ? USA300TCH1516_ALE = 34819169 (0.830)17 (0.100) 10/136 NT 10.4% coding (307/1257 nt) USA300HOU_RS00135 hypothetical protein
?USA300TCH1516_ALE = 34830 150 (0.870)coding (318/1257 nt) USA300HOU_RS00135 hypothetical protein
* ? USA300TCH1516_ALE = 37045144 (0.710)20 (0.120) 9/128 NT 13.9% intergenic (+69/‑768) USA300HOU_RS14915/ugpQ_1 hypothetical protein/Glycerophosphodiester phosphodiesterase, cytoplasmic
?USA300TCH1516_ALE = 37067 133 (0.820)intergenic (+91/‑746) USA300HOU_RS14915/ugpQ_1 hypothetical protein/Glycerophosphodiester phosphodiesterase, cytoplasmic
* ? USA300TCH1516_ALE 42499 =235 (1.150)19 (0.120)
+ATAAATTTTTTGATTATTTT		 9/120 NT 17.8% coding (1467/1524 nt) USA300TCH1516_00035 hypothetical protein
?USA300TCH1516_ALE = 1912410 0 (0.000)coding (532/609 nt) USA300HOU_RS15290 hypothetical protein
* ? USA300TCH1516_ALE 42564 =225 (1.100)80 (0.530)
+TACATTATAAAATACATATC		 13/120 NT 32.3% coding (1402/1524 nt) USA300TCH1516_00035 hypothetical protein
?USA300TCH1516_ALE 1803072 = NA (NA)coding (796/807 nt) USA300HOU_RS12765 hypothetical protein
* ? USA300TCH1516_ALE = 54568227 (1.110)16 (0.080) 9/156 NT 6.7% intergenic (+15/+609) USA300HOU_RS00220/gloC_1 hypothetical protein/Hydroxyacylglutathione hydrolase GloC
?USA300TCH1516_ALE = 54603 221 (1.110)intergenic (+50/+574) USA300HOU_RS00220/gloC_1 hypothetical protein/Hydroxyacylglutathione hydrolase GloC
* ? USA300TCH1516_ALE = 57559247 (1.210)43 (0.230) 14/148 NT 15.2% intergenic (+5/+912) USA300HOU_RS00240/USA300TCH1516_00049 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 57591 251 (1.330)intergenic (+37/+880) USA300HOU_RS00240/USA300TCH1516_00049 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 62785 =241 (1.180)13 (0.070) 8/142 NT 6.6% intergenic (‑252/+261) USA300TCH1516_00053/speG hypothetical protein/Spermidine N(1)‑acetyltransferase
?USA300TCH1516_ALE 62819 = 153 (0.850)intergenic (‑286/+227) USA300TCH1516_00053/speG hypothetical protein/Spermidine N(1)‑acetyltransferase
* ? USA300TCH1516_ALE 68500 =NA (NA)7 (0.040) 4/154 NT 5.0% coding (616/852 nt) USA300TCH1516_00061 hypothetical protein
?USA300TCH1516_ALE 68542 = 138 (0.680)coding (658/852 nt) USA300TCH1516_00061 hypothetical protein
* ? USA300TCH1516_ALE 75971 =184 (0.900)18 (0.110) 12/128 NT 10.8% intergenic (+29/‑244) USA300HOU_RS00335/USA300HOU_RS00140 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 76020 = 151 (0.930)intergenic (+78/‑195) USA300HOU_RS00335/USA300HOU_RS00140 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 75986174 (0.850)28 (0.170) 14/128 NT 16.2% intergenic (+44/‑229) USA300HOU_RS00335/USA300HOU_RS00140 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 76003 151 (0.930)intergenic (+61/‑212) USA300HOU_RS00335/USA300HOU_RS00140 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 82395 =176 (0.860)9 (0.050) 5/152 NT 5.3% coding (500/957 nt) nikB_1 Nickel transport system permease protein NikB
?USA300TCH1516_ALE 82432 = 152 (0.790)coding (537/957 nt) nikB_1 Nickel transport system permease protein NikB
* ? USA300TCH1516_ALE 88662 =245 (1.200)19 (0.120) 9/126 NT 9.7% intergenic (+35/‑730) nusG_1/USA300TCH1516_00080 Transcription termination/antitermination protein NusG/hypothetical protein
?USA300TCH1516_ALE 88722 = 163 (1.020)intergenic (+95/‑670) nusG_1/USA300TCH1516_00080 Transcription termination/antitermination protein NusG/hypothetical protein
* ? USA300TCH1516_ALE 127837 =148 (0.730)8 (0.050) 6/138 NT 5.7% intergenic (+57/+272) lctP_1/spa L‑lactate permease/Immunoglobulin G‑binding protein A
?USA300TCH1516_ALE 127883 = 138 (0.790)intergenic (+103/+226) lctP_1/spa L‑lactate permease/Immunoglobulin G‑binding protein A
* ? USA300TCH1516_ALE = 127847160 (0.790)8 (0.050) 4/138 NT 5.5% intergenic (+67/+262) lctP_1/spa L‑lactate permease/Immunoglobulin G‑binding protein A
?USA300TCH1516_ALE = 127871 138 (0.790)intergenic (+91/+238) lctP_1/spa L‑lactate permease/Immunoglobulin G‑binding protein A
* ? USA300TCH1516_ALE 145649 =193 (0.950)13 (0.070) 6/140 NT 7.2% intergenic (+74/‑122) noc_1/USA300HOU_RS00655 Nucleoid occlusion protein/hypothetical protein
?USA300TCH1516_ALE 145689 = 168 (0.940)intergenic (+114/‑82) noc_1/USA300HOU_RS00655 Nucleoid occlusion protein/hypothetical protein
* ? USA300TCH1516_ALE 161003 =188 (0.920)22 (0.140) 8/124 NT 15.1% intergenic (+17/+114) deoB/phnE_1 Phosphopentomutase/Phosphate‑import permease protein PhnE
?USA300TCH1516_ALE 161059 = 102 (0.650)intergenic (+73/+58) deoB/phnE_1 Phosphopentomutase/Phosphate‑import permease protein PhnE
* ? USA300TCH1516_ALE 194938 =206 (1.010)16 (0.090) 8/146 NT 8.1% intergenic (+14/+48) czcD_1/USA300HOU_RS00900 Cadmium, cobalt and zinc/H(+)‑K(+) antiporter/hypothetical protein
?USA300TCH1516_ALE 194970 = 174 (0.940)intergenic (+46/+16) czcD_1/USA300HOU_RS00900 Cadmium, cobalt and zinc/H(+)‑K(+) antiporter/hypothetical protein
* ? USA300TCH1516_ALE 211704 =157 (0.770)9 (0.050) 7/142 NT 5.6% intergenic (+262/+66) sfp/yagU 4'‑phosphopantetheinyl transferase sfp/Inner membrane protein YagU
?USA300TCH1516_ALE 211755 = 162 (0.900)intergenic (+313/+15) sfp/yagU 4'‑phosphopantetheinyl transferase sfp/Inner membrane protein YagU
* ? USA300TCH1516_ALE 221178 =144 (0.710)31 (0.170) 11/146 NT 17.9% intergenic (‑224/+50) ipdC/ptsG_1 Indole‑3‑pyruvate decarboxylase/PTS system glucose‑specific EIICBA component
?USA300TCH1516_ALE 221218 = 153 (0.820)intergenic (‑264/+10) ipdC/ptsG_1 Indole‑3‑pyruvate decarboxylase/PTS system glucose‑specific EIICBA component
* ? USA300TCH1516_ALE = 221184145 (0.710)11 (0.060) 8/146 NT 7.2% intergenic (‑230/+44) ipdC/ptsG_1 Indole‑3‑pyruvate decarboxylase/PTS system glucose‑specific EIICBA component
?USA300TCH1516_ALE = 221210 153 (0.820)intergenic (‑256/+18) ipdC/ptsG_1 Indole‑3‑pyruvate decarboxylase/PTS system glucose‑specific EIICBA component
* ? USA300TCH1516_ALE 231639 =201 (0.990)22 (0.120) 13/146 NT 10.8% intergenic (+8/‑197) hsdR/USA300HOU_RS01035 Type‑1 restriction enzyme R protein/hypothetical protein
?USA300TCH1516_ALE 231667 = 179 (0.960)intergenic (+36/‑169) hsdR/USA300HOU_RS01035 Type‑1 restriction enzyme R protein/hypothetical protein
* ? USA300TCH1516_ALE = 256315166 (0.810)9 (0.050) 7/142 NT 5.6% intergenic (+60/+299) uhpT/USA300HOU_RS01135 Hexose‑6‑phosphate:phosphate antiporter/putative response regulatory protein
?USA300TCH1516_ALE = 256379 158 (0.880)intergenic (+124/+235) uhpT/USA300HOU_RS01135 Hexose‑6‑phosphate:phosphate antiporter/putative response regulatory protein
* ? USA300TCH1516_ALE = 256532170 (0.830)30 (0.180) 14/132 NT 16.4% intergenic (+277/+82) uhpT/USA300HOU_RS01135 Hexose‑6‑phosphate:phosphate antiporter/putative response regulatory protein
?USA300TCH1516_ALE = 256554 167 (1.000)intergenic (+299/+60) uhpT/USA300HOU_RS01135 Hexose‑6‑phosphate:phosphate antiporter/putative response regulatory protein
* ? USA300TCH1516_ALE 260284 =152 (0.750)14 (0.080) 8/138 NT 9.7% intergenic (‑398/‑190) potD_1/pflB Spermidine/putrescine‑binding periplasmic protein/Formate acetyltransferase
?USA300TCH1516_ALE 260324 = 131 (0.750)intergenic (‑438/‑150) potD_1/pflB Spermidine/putrescine‑binding periplasmic protein/Formate acetyltransferase
* ? USA300TCH1516_ALE = 260294153 (0.750)11 (0.060) 5/138 NT 7.7% intergenic (‑408/‑180) potD_1/pflB Spermidine/putrescine‑binding periplasmic protein/Formate acetyltransferase
?USA300TCH1516_ALE = 260312 131 (0.750)intergenic (‑426/‑162) potD_1/pflB Spermidine/putrescine‑binding periplasmic protein/Formate acetyltransferase
* ? USA300TCH1516_ALE 263517 =156 (0.770)24 (0.130) 8/146 NT 13.5% intergenic (+16/‑320) pflA/ugpQ_2 Pyruvate formate‑lyase‑activating enzyme/Glycerophosphodiester phosphodiesterase, cytoplasmic
?USA300TCH1516_ALE 263566 = 166 (0.890)intergenic (+65/‑271) pflA/ugpQ_2 Pyruvate formate‑lyase‑activating enzyme/Glycerophosphodiester phosphodiesterase, cytoplasmic
* ? USA300TCH1516_ALE = 263532162 (0.800)21 (0.120) 12/140 NT 12.4% intergenic (+31/‑305) pflA/ugpQ_2 Pyruvate formate‑lyase‑activating enzyme/Glycerophosphodiester phosphodiesterase, cytoplasmic
?USA300TCH1516_ALE = 263550 155 (0.870)intergenic (+49/‑287) pflA/ugpQ_2 Pyruvate formate‑lyase‑activating enzyme/Glycerophosphodiester phosphodiesterase, cytoplasmic
* ? USA300TCH1516_ALE 278631 =186 (0.910)19 (0.110) 6/140 NT 10.5% intergenic (+226/+88) USA300HOU_RS01215/gsiB hypothetical protein/Glutathione‑binding protein GsiB
?USA300TCH1516_ALE 278672 = 161 (0.900)intergenic (+267/+47) USA300HOU_RS01215/gsiB hypothetical protein/Glutathione‑binding protein GsiB
* ? USA300TCH1516_ALE = 278640178 (0.870)24 (0.130) 8/140 NT 13.2% intergenic (+235/+79) USA300HOU_RS01215/gsiB hypothetical protein/Glutathione‑binding protein GsiB
?USA300TCH1516_ALE = 278661 161 (0.900)intergenic (+256/+58) USA300HOU_RS01215/gsiB hypothetical protein/Glutathione‑binding protein GsiB
* ? USA300TCH1516_ALE = 280894206 (1.010)15 (0.090)
+TTAATTGGGAGTA		 5/134 NT 8.8% intergenic (‑146/+11) USA300HOU_RS01225/USA300HOU_RS01230 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 855632 = 165 (0.810)intergenic (+163/‑597) zipA_1/cggR Cell division protein ZipA/Central glycolytic genes regulator
* ? USA300TCH1516_ALE = 284040167 (0.820)10 (0.060) 6/140 NT 6.0% intergenic (+265/+55) ldh1/ptsG_2 L‑lactate dehydrogenase 1/PTS system glucose‑specific EIICBA component
?USA300TCH1516_ALE = 284055 165 (0.930)intergenic (+280/+40) ldh1/ptsG_2 L‑lactate dehydrogenase 1/PTS system glucose‑specific EIICBA component
* ? USA300TCH1516_ALE = 313030173 (0.850)10 (0.050) 6/146 NT 6.2% intergenic (+83/+351) bglA/rebM Aryl‑phospho‑beta‑D‑glucosidase BglA/Demethylrebeccamycin‑D‑glucose O‑methyltransferase
?USA300TCH1516_ALE = 313078 146 (0.790)intergenic (+131/+303) bglA/rebM Aryl‑phospho‑beta‑D‑glucosidase BglA/Demethylrebeccamycin‑D‑glucose O‑methyltransferase
* ? USA300TCH1516_ALE = 319232206 (1.010)24 (0.160)
+TCATAATAAAATGCATATC		 11/122 NT 12.9% coding (368/405 nt) USA300TCH1516_00272 hypothetical protein
?USA300TCH1516_ALE = 2432264 219 (1.080)intergenic (+611/+36) birA_2/USA300HOU_RS12525 Bifunctional ligase/repressor BirA/hypothetical protein
* ? USA300TCH1516_ALE 326015 =192 (0.940)25 (0.140) 13/142 NT 12.5% intergenic (‑19/+49) USA300HOU_RS01460/USA300HOU_RS01465 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 326051 = 181 (1.000)intergenic (‑55/+13) USA300HOU_RS01460/USA300HOU_RS01465 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 326023194 (0.950)22 (0.120) 11/142 NT 11.1% intergenic (‑27/+41) USA300HOU_RS01460/USA300HOU_RS01465 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 326041 181 (1.000)intergenic (‑45/+23) USA300HOU_RS01460/USA300HOU_RS01465 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 329202 =185 (0.910)26 (0.150) 12/140 NT 14.1% intergenic (+70/+73) USA300HOU_RS01475/ssaA2_1 hypothetical protein/Staphylococcal secretory antigen ssaA2
?USA300TCH1516_ALE 329255 = 156 (0.880)intergenic (+123/+20) USA300HOU_RS01475/ssaA2_1 hypothetical protein/Staphylococcal secretory antigen ssaA2
* ? USA300TCH1516_ALE = 329211178 (0.870)18 (0.100) 8/140 NT 10.4% intergenic (+79/+64) USA300HOU_RS01475/ssaA2_1 hypothetical protein/Staphylococcal secretory antigen ssaA2
?USA300TCH1516_ALE = 329244 156 (0.880)intergenic (+112/+31) USA300HOU_RS01475/ssaA2_1 hypothetical protein/Staphylococcal secretory antigen ssaA2
* ? USA300TCH1516_ALE 330724 =227 (1.110)18 (0.100) 14/148 NT 8.5% intergenic (+15/‑69) esxA/esaA ESAT‑6 secretion system extracellular protein A/ESAT‑6 secretion accessory factor EsaA
?USA300TCH1516_ALE 330754 = 178 (0.950)intergenic (+45/‑39) esxA/esaA ESAT‑6 secretion system extracellular protein A/ESAT‑6 secretion accessory factor EsaA
* ? USA300TCH1516_ALE 337678 =183 (0.900)11 (0.060) 5/146 NT 6.2% coding (1816/4440 nt) essC ESAT‑6 secretion machinery protein EssC
?USA300TCH1516_ALE 337710 = 167 (0.900)coding (1848/4440 nt) essC ESAT‑6 secretion machinery protein EssC
* ? USA300TCH1516_ALE = 344426177 (0.870)48 (0.280) 14/136 NT 23.1% intergenic (+25/‑183) yezG_1/USA300HOU_RS01545 putative antitoxin YezG/hypothetical protein
?USA300TCH1516_ALE = 344433 170 (0.980)intergenic (+32/‑176) yezG_1/USA300HOU_RS01545 putative antitoxin YezG/hypothetical protein
* ? USA300TCH1516_ALE 349720 =256 (1.260)15 (0.080) 9/142 NT 7.0% intergenic (+272/‑314) USA300HOU_RS01580/yezG_6 hypothetical protein/putative antitoxin YezG
?USA300TCH1516_ALE 349754 = 172 (0.950)intergenic (+306/‑280) USA300HOU_RS01580/yezG_6 hypothetical protein/putative antitoxin YezG
* ? USA300TCH1516_ALE = 351315NA (NA)13 (0.070) 6/146 NT 5.7% coding (259/501 nt) yezG_8 putative antitoxin YezG
?USA300TCH1516_ALE = 352313 238 (1.170)coding (235/489 nt) yezG_10 putative antitoxin YezG
* ? USA300TCH1516_ALE 365029 =120 (0.590)17 (0.100) 6/136 NT 12.4% intergenic (+39/+66) nupC_1/sglT Nucleoside permease NupC/Sodium/glucose cotransporter
?USA300TCH1516_ALE 365083 = 138 (0.800)intergenic (+93/+12) nupC_1/sglT Nucleoside permease NupC/Sodium/glucose cotransporter
* ? USA300TCH1516_ALE = 365040123 (0.600)23 (0.130) 10/136 NT 16.0% intergenic (+50/+55) nupC_1/sglT Nucleoside permease NupC/Sodium/glucose cotransporter
?USA300TCH1516_ALE = 365070 138 (0.800)intergenic (+80/+25) nupC_1/sglT Nucleoside permease NupC/Sodium/glucose cotransporter
* ? USA300TCH1516_ALE = 368778157 (0.770)11 (0.060) 7/150 NT 6.8% intergenic (+212/+66) bglK/ybbH_2 Beta‑glucoside kinase/putative HTH‑type transcriptional regulator YbbH
?USA300TCH1516_ALE = 368819 156 (0.820)intergenic (+253/+25) bglK/ybbH_2 Beta‑glucoside kinase/putative HTH‑type transcriptional regulator YbbH
* ? USA300TCH1516_ALE 374491 =163 (0.800)12 (0.070) 6/144 NT 7.2% intergenic (+109/+133) lip2/USA300HOU_RS01705 Lipase 2/hypothetical protein
?USA300TCH1516_ALE 374527 = 162 (0.880)intergenic (+145/+97) lip2/USA300HOU_RS01705 Lipase 2/hypothetical protein
* ? USA300TCH1516_ALE = 374498170 (0.830)15 (0.080) 9/144 NT 8.7% intergenic (+116/+126) lip2/USA300HOU_RS01705 Lipase 2/hypothetical protein
?USA300TCH1516_ALE = 374518 162 (0.880)intergenic (+136/+106) lip2/USA300HOU_RS01705 Lipase 2/hypothetical protein
* ? USA300TCH1516_ALE 389251 =206 (1.010)10 (0.060) 8/132 NT 6.5% intergenic (+4/+79) USA300HOU_RS01780/glpT hypothetical protein/Glycerol‑3‑phosphate transporter
?USA300TCH1516_ALE 389318 = 120 (0.720)intergenic (+71/+12) USA300HOU_RS01780/glpT hypothetical protein/Glycerol‑3‑phosphate transporter
* ? USA300TCH1516_ALE 393589 =127 (0.620)14 (0.080) 9/142 NT 10.7% intergenic (+12/+48) USA300HOU_RS01800/USA300HOU_RS01805 NAD(P)H‑dependent FAD/FMN reductase/hypothetical protein
?USA300TCH1516_ALE 393631 = 121 (0.670)intergenic (+54/+6) USA300HOU_RS01800/USA300HOU_RS01805 NAD(P)H‑dependent FAD/FMN reductase/hypothetical protein
* ? USA300TCH1516_ALE = 393597127 (0.620)11 (0.060) 7/142 NT 8.6% intergenic (+20/+40) USA300HOU_RS01800/USA300HOU_RS01805 NAD(P)H‑dependent FAD/FMN reductase/hypothetical protein
?USA300TCH1516_ALE = 393621 121 (0.670)intergenic (+44/+16) USA300HOU_RS01800/USA300HOU_RS01805 NAD(P)H‑dependent FAD/FMN reductase/hypothetical protein
* ? USA300TCH1516_ALE 407090 =121 (0.590)9 (0.050) 7/136 NT 7.4% intergenic (+5/+78) USA300HOU_RS01880/kynB putative acetyl‑CoA acyltransferase/Kynurenine formamidase
?USA300TCH1516_ALE 407140 = 123 (0.710)intergenic (+55/+28) USA300HOU_RS01880/kynB putative acetyl‑CoA acyltransferase/Kynurenine formamidase
* ? USA300TCH1516_ALE = 407101132 (0.650)8 (0.050) 7/136 NT 6.4% intergenic (+16/+67) USA300HOU_RS01880/kynB putative acetyl‑CoA acyltransferase/Kynurenine formamidase
?USA300TCH1516_ALE = 407127 123 (0.710)intergenic (+42/+41) USA300HOU_RS01880/kynB putative acetyl‑CoA acyltransferase/Kynurenine formamidase
* ? USA300TCH1516_ALE 412131 =178 (0.870)9 (0.050) 6/144 NT 5.7% coding (1028/1161 nt) metC Cystathionine beta‑lyase MetC
?USA300TCH1516_ALE 412165 = 140 (0.760)coding (994/1161 nt) metC Cystathionine beta‑lyase MetC
* ? USA300TCH1516_ALE 414290 =187 (0.920)15 (0.080) 9/148 NT 8.6% intergenic (‑32/‑632) metI/spo0C Cystathionine gamma‑synthase/O‑acetylhomoserine (thiol)‑lyase/Chromosome‑partitioning protein Spo0J
?USA300TCH1516_ALE 414341 = 148 (0.790)intergenic (‑83/‑581) metI/spo0C Cystathionine gamma‑synthase/O‑acetylhomoserine (thiol)‑lyase/Chromosome‑partitioning protein Spo0J
* ? USA300TCH1516_ALE = 422512250 (1.230)14 (0.080) 8/136 NT 6.1% coding (581/612 nt) USA300HOU_RS01965 hypothetical protein
?USA300TCH1516_ALE = 422533 216 (1.250)coding (602/612 nt) USA300HOU_RS01965 hypothetical protein
* ? USA300TCH1516_ALE = 425019196 (0.960)13 (0.070) 10/146 NT 6.8% intergenic (+34/‑392) USA300HOU_RS01985/gpmA_1 hypothetical protein/2,3‑bisphosphoglycerate‑dependent phosphoglycerate mutase
?USA300TCH1516_ALE = 425031 176 (0.950)intergenic (+46/‑380) USA300HOU_RS01985/gpmA_1 hypothetical protein/2,3‑bisphosphoglycerate‑dependent phosphoglycerate mutase
* ? USA300TCH1516_ALE = 441303155 (0.760)24 (0.130) 12/142 NT 13.8% intergenic (+20/+93) guaA/USA300HOU_RS02075 GMP synthase [glutamine‑hydrolyzing]/hypothetical protein
?USA300TCH1516_ALE = 441313 163 (0.900)intergenic (+30/+83) guaA/USA300HOU_RS02075 GMP synthase [glutamine‑hydrolyzing]/hypothetical protein
* ? USA300TCH1516_ALE = 447070195 (0.960)34 (0.180) 13/152 NT 15.2% intergenic (+58/‑228) tst_1/speC_1 Toxic shock syndrome toxin‑1/Exotoxin type C
?USA300TCH1516_ALE = 447093 193 (1.000)intergenic (+81/‑205) tst_1/speC_1 Toxic shock syndrome toxin‑1/Exotoxin type C
* ? USA300TCH1516_ALE 458360 =NA (NA)5 (0.030) 4/148 NT NA coding (970/1557 nt) hsdM_1 Type I restriction enzyme EcoKI M protein
?USA300TCH1516_ALE 458396 = NA (NA)coding (1006/1557 nt) hsdM_1 Type I restriction enzyme EcoKI M protein
* ? USA300TCH1516_ALE = 458414NA (NA)5 (0.030) 4/144 NT NA coding (1024/1557 nt) hsdM_1 Type I restriction enzyme EcoKI M protein
?USA300TCH1516_ALE = 458432 NA (NA)coding (1042/1557 nt) hsdM_1 Type I restriction enzyme EcoKI M protein
* ? USA300TCH1516_ALE = 459477222 (1.090)11 (0.060) 7/144 NT 5.2% coding (538/1212 nt) USA300HOU_RS02175 hypothetical protein
?USA300TCH1516_ALE 1937075 = 203 (1.110)coding (518/1200 nt) hsdS Type‑1 restriction enzyme EcoKI specificity protein
* ? USA300TCH1516_ALE 492708 =109 (0.540)17 (0.100) 9/128 NT 14.9% intergenic (+130/+55) sle1_1/USA300HOU_RS02345 N‑acetylmuramoyl‑L‑alanine amidase sle1/hypothetical protein
?USA300TCH1516_ALE 492758 = 108 (0.660)intergenic (+180/+5) sle1_1/USA300HOU_RS02345 N‑acetylmuramoyl‑L‑alanine amidase sle1/hypothetical protein
* ? USA300TCH1516_ALE = 492723112 (0.550)28 (0.170) 10/128 NT 22.1% intergenic (+145/+40) sle1_1/USA300HOU_RS02345 N‑acetylmuramoyl‑L‑alanine amidase sle1/hypothetical protein
?USA300TCH1516_ALE = 492741 108 (0.660)intergenic (+163/+22) sle1_1/USA300HOU_RS02345 N‑acetylmuramoyl‑L‑alanine amidase sle1/hypothetical protein
* ? USA300TCH1516_ALE 494152 =141 (0.690)12 (0.070) 6/142 NT 8.9% intergenic (+101/+68) bltD_1/USA300HOU_RS02360 Spermine/spermidine acetyltransferase/hypothetical protein
?USA300TCH1516_ALE 494194 = 120 (0.660)intergenic (+143/+26) bltD_1/USA300HOU_RS02360 Spermine/spermidine acetyltransferase/hypothetical protein
* ? USA300TCH1516_ALE = 494160135 (0.660)8 (0.040) 4/142 NT 6.3% intergenic (+109/+60) bltD_1/USA300HOU_RS02360 Spermine/spermidine acetyltransferase/hypothetical protein
?USA300TCH1516_ALE = 494184 120 (0.660)intergenic (+133/+36) bltD_1/USA300HOU_RS02360 Spermine/spermidine acetyltransferase/hypothetical protein
* ? USA300TCH1516_ALE 511386 =175 (0.860)11 (0.060) 7/150 NT 6.6% coding (51/597 nt) recR Recombination protein RecR
?USA300TCH1516_ALE 511422 = 146 (0.770)coding (87/597 nt) recR Recombination protein RecR
* ? USA300TCH1516_ALE = 511972199 (0.980)12 (0.060) 10/154 NT 6.2% intergenic (+40/‑6723) recR/speA_2 Recombination protein RecR/Arginine decarboxylase
?USA300TCH1516_ALE = 512004 174 (0.890)intergenic (+72/‑6691) recR/speA_2 Recombination protein RecR/Arginine decarboxylase
* ? USA300TCH1516_ALE 523897 =126 (0.620)11 (0.070) 8/130 NT 9.1% coding (308/726 nt) yfiC tRNA1(Val) (adenine(37)‑N6)‑methyltransferase
?USA300TCH1516_ALE 523942 = 117 (0.710)coding (353/726 nt) yfiC tRNA1(Val) (adenine(37)‑N6)‑methyltransferase
* ? USA300TCH1516_ALE = 523911133 (0.650)7 (0.040) 5/130 NT 5.9% coding (322/726 nt) yfiC tRNA1(Val) (adenine(37)‑N6)‑methyltransferase
?USA300TCH1516_ALE = 523926 117 (0.710)coding (337/726 nt) yfiC tRNA1(Val) (adenine(37)‑N6)‑methyltransferase
* ? USA300TCH1516_ALE 549463 =215 (1.060)21 (0.130) 10/130 NT 12.1% intergenic (+13/‑216) ftsH/hslO ATP‑dependent zinc metalloprotease FtsH/33 kDa chaperonin
?USA300TCH1516_ALE 549502 = 130 (0.790)intergenic (+52/‑177) ftsH/hslO ATP‑dependent zinc metalloprotease FtsH/33 kDa chaperonin
* ? USA300TCH1516_ALE 553211 =204 (1.000)14 (0.080) 6/138 NT 8.4% coding (182/477 nt) folK 2‑amino‑4‑hydroxy‑6‑ hydroxymethyldihydropteridine pyrophosphokinase
?USA300TCH1516_ALE 553257 = 130 (0.740)coding (228/477 nt) folK 2‑amino‑4‑hydroxy‑6‑ hydroxymethyldihydropteridine pyrophosphokinase
* ? USA300TCH1516_ALE = 557240NA (NA)12 (0.060) 4/152 NT NA intergenic (+298/‑1471) USA300TCH1516_00504/USA300TCH1516_00505 tRNA‑Ala/tRNA‑Ile
?USA300TCH1516_ALE = 557277 NA (NA)intergenic (+335/‑1434) USA300TCH1516_00504/USA300TCH1516_00505 tRNA‑Ala/tRNA‑Ile
* ? USA300TCH1516_ALE 562451 =170 (0.830)7 (0.040) 6/134 NT 5.3% intergenic (+3664/+138) USA300TCH1516_00505/gabR tRNA‑Ile/HTH‑type transcriptional regulatory protein GabR
?USA300TCH1516_ALE 562497 = 110 (0.650)intergenic (+3710/+92) USA300TCH1516_00505/gabR tRNA‑Ile/HTH‑type transcriptional regulatory protein GabR
* ? USA300TCH1516_ALE 580739 =140 (0.690)16 (0.100) 8/130 NT 11.7% intergenic (+33/‑48) USA300HOU_RS02805/sigH hypothetical protein/RNA polymerase sigma‑H factor
?USA300TCH1516_ALE 580788 = 129 (0.780)coding (2/570 nt) sigH RNA polymerase sigma‑H factor
* ? USA300TCH1516_ALE = 580753144 (0.710)13 (0.080) 7/130 NT 9.6% intergenic (+47/‑34) USA300HOU_RS02805/sigH hypothetical protein/RNA polymerase sigma‑H factor
?USA300TCH1516_ALE = 580772 129 (0.780)intergenic (+66/‑15) USA300HOU_RS02805/sigH hypothetical protein/RNA polymerase sigma‑H factor
* ? USA300TCH1516_ALE 587580 =155 (0.760)7 (0.040) 5/144 NT 5.1% coding (1484/3552 nt) rpoB DNA‑directed RNA polymerase subunit beta
?USA300TCH1516_ALE 587615 = 123 (0.670)coding (1519/3552 nt) rpoB DNA‑directed RNA polymerase subunit beta
* ? USA300TCH1516_ALE 598632 =108 (0.530)10 (0.060) 5/124 NT 9.3% intergenic (+181/+101) tuf/yxeP_2 Elongation factor Tu/putative hydrolase YxeP
?USA300TCH1516_ALE 598687 = 112 (0.710)intergenic (+236/+46) tuf/yxeP_2 Elongation factor Tu/putative hydrolase YxeP
* ? USA300TCH1516_ALE = 598649110 (0.540)7 (0.040) 4/124 NT 6.6% intergenic (+198/+84) tuf/yxeP_2 Elongation factor Tu/putative hydrolase YxeP
?USA300TCH1516_ALE = 598668 112 (0.710)intergenic (+217/+65) tuf/yxeP_2 Elongation factor Tu/putative hydrolase YxeP
* ? USA300TCH1516_ALE = 630624231 (1.130)20 (0.100) 10/154 NT 7.9% intergenic (+10/‑103) hxlB/gph_1 3‑hexulose‑6‑phosphate isomerase/Phosphoglycolate phosphatase
?USA300TCH1516_ALE = 630661 245 (1.250)intergenic (+47/‑66) hxlB/gph_1 3‑hexulose‑6‑phosphate isomerase/Phosphoglycolate phosphatase
* ? USA300TCH1516_ALE = 634596178 (0.870)18 (0.100) 13/146 NT 9.6% coding (777/1377 nt) yhfT putative acyl‑‑CoA ligase YhfT
?USA300TCH1516_ALE = 634622 177 (0.950)coding (803/1377 nt) yhfT putative acyl‑‑CoA ligase YhfT
* ? USA300TCH1516_ALE = 637748191 (0.940)15 (0.080) 11/150 NT 7.9% intergenic (‑431/+76) USA300HOU_RS03030/pdxK hypothetical protein/Pyridoxine kinase
?USA300TCH1516_ALE = 637782 169 (0.890)intergenic (‑465/+42) USA300HOU_RS03030/pdxK hypothetical protein/Pyridoxine kinase
* ? USA300TCH1516_ALE 646656 =172 (0.840)28 (0.160) 12/140 NT 15.4% intergenic (+10/‑577) lipL/galK Octanoyl‑[GcvH]:protein N‑octanoyltransferase/Galactokinase
?USA300TCH1516_ALE 646692 = 158 (0.890)intergenic (+46/‑541) lipL/galK Octanoyl‑[GcvH]:protein N‑octanoyltransferase/Galactokinase
* ? USA300TCH1516_ALE = 646665171 (0.840)17 (0.100) 9/140 NT 10.0% intergenic (+19/‑568) lipL/galK Octanoyl‑[GcvH]:protein N‑octanoyltransferase/Galactokinase
?USA300TCH1516_ALE = 646681 158 (0.890)intergenic (+35/‑552) lipL/galK Octanoyl‑[GcvH]:protein N‑octanoyltransferase/Galactokinase
* ? USA300TCH1516_ALE = 650749185 (0.910)18 (0.090) 9/154 NT 9.3% intergenic (+1/+51) USA300HOU_RS03100/rclA hypothetical protein/putative pyridine nucleotide‑disulfide oxidoreductase RclA
?USA300TCH1516_ALE = 650786 173 (0.880)intergenic (+38/+14) USA300HOU_RS03100/rclA hypothetical protein/putative pyridine nucleotide‑disulfide oxidoreductase RclA
* ? USA300TCH1516_ALE 671388 =198 (0.970)9 (0.050) 6/140 NT 5.4% intergenic (+13/‑375) argS/nth_1 Arginine‑‑tRNA ligase/Endonuclease III
?USA300TCH1516_ALE 671434 = 142 (0.800)intergenic (+59/‑329) argS/nth_1 Arginine‑‑tRNA ligase/Endonuclease III
* ? USA300TCH1516_ALE 671622 =115 (0.560)26 (0.140) 8/146 NT 17.8% intergenic (+247/‑141) argS/nth_1 Arginine‑‑tRNA ligase/Endonuclease III
?USA300TCH1516_ALE = 2866877 136 (0.730)intergenic (‑276/+177) USA300HOU_RS14695/noc_2 hypothetical protein/Nucleoid occlusion protein
* ? USA300TCH1516_ALE 672540 =204 (1.000)19 (0.100) 12/150 NT 8.9% intergenic (+142/‑237) nth_1/btuF Endonuclease III/Vitamin B12‑binding protein
?USA300TCH1516_ALE 672565 = 198 (1.040)intergenic (+167/‑212) nth_1/btuF Endonuclease III/Vitamin B12‑binding protein
* ? USA300TCH1516_ALE 676982 =195 (0.960)44 (0.250) 12/136 NT 21.8% intergenic (+20/‑142) USA300HOU_RS03260/USA300HOU_RS03265 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 677017 = 150 (0.870)intergenic (+55/‑107) USA300HOU_RS03260/USA300HOU_RS03265 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 681130 =223 (1.090)20 (0.120) 9/136 NT 10.4% intergenic (‑200/+8) USA300HOU_RS03280/USA300TCH1516_00615 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 681182 = 155 (0.900)coding (310/354 nt) USA300TCH1516_00615 hypothetical protein
* ? USA300TCH1516_ALE 682222 =235 (1.150)36 (0.200) 16/140 NT 15.8% intergenic (‑64/+45) USA300TCH1516_00616/rcsF_2 hypothetical protein/Outer membrane lipoprotein RcsF
?USA300TCH1516_ALE 682264 = 178 (1.000)intergenic (‑106/+3) USA300TCH1516_00616/rcsF_2 hypothetical protein/Outer membrane lipoprotein RcsF
* ? USA300TCH1516_ALE 705182 =212 (1.040)11 (0.060) 8/142 NT 6.3% intergenic (+932/+228) nhaK_1/mntA Sodium, potassium, lithium and rubidium/H(+) antiporter/Manganese‑binding lipoprotein MntA
?USA300TCH1516_ALE 705222 = 142 (0.790)intergenic (+972/+188) nhaK_1/mntA Sodium, potassium, lithium and rubidium/H(+) antiporter/Manganese‑binding lipoprotein MntA
* ? USA300TCH1516_ALE 705321 =156 (0.770)10 (0.060) 7/142 NT 6.0% intergenic (+1071/+89) nhaK_1/mntA Sodium, potassium, lithium and rubidium/H(+) antiporter/Manganese‑binding lipoprotein MntA
?USA300TCH1516_ALE 705378 = 175 (0.970)intergenic (+1128/+32) nhaK_1/mntA Sodium, potassium, lithium and rubidium/H(+) antiporter/Manganese‑binding lipoprotein MntA
* ? USA300TCH1516_ALE = 705329167 (0.820)17 (0.090) 10/142 NT 9.5% intergenic (+1079/+81) nhaK_1/mntA Sodium, potassium, lithium and rubidium/H(+) antiporter/Manganese‑binding lipoprotein MntA
?USA300TCH1516_ALE = 705368 175 (0.970)intergenic (+1118/+42) nhaK_1/mntA Sodium, potassium, lithium and rubidium/H(+) antiporter/Manganese‑binding lipoprotein MntA
* ? USA300TCH1516_ALE = 710532237 (1.160)22 (0.120) 12/142 NT 8.8% intergenic (+25/+36) tarA/tagH_1 N‑acetylglucosaminyldiphosphoundecaprenol N‑acetyl‑beta‑D‑mannosaminyltransferase/Teichoic acids export ATP‑binding protein TagH
?USA300TCH1516_ALE = 710552 244 (1.350)intergenic (+45/+16) tarA/tagH_1 N‑acetylglucosaminyldiphosphoundecaprenol N‑acetyl‑beta‑D‑mannosaminyltransferase/Teichoic acids export ATP‑binding protein TagH
* ? USA300TCH1516_ALE = 712543173 (0.850)14 (0.070) 4/148 NT 8.0% intergenic (+22/‑77) tagG/tarB Teichoic acid translocation permease protein TagG/Teichoic acid glycerol‑phosphate primase
?USA300TCH1516_ALE = 712566 163 (0.870)intergenic (+45/‑54) tagG/tarB Teichoic acid translocation permease protein TagG/Teichoic acid glycerol‑phosphate primase
* ? USA300TCH1516_ALE 715303 =160 (0.790)14 (0.080) 9/132 NT 9.0% intergenic (+61/+56) tarD/dacA Glycerol‑3‑phosphate cytidylyltransferase/D‑alanyl‑D‑alanine carboxypeptidase DacA
?USA300TCH1516_ALE 715350 = 151 (0.900)intergenic (+108/+9) tarD/dacA Glycerol‑3‑phosphate cytidylyltransferase/D‑alanyl‑D‑alanine carboxypeptidase DacA
* ? USA300TCH1516_ALE = 715316168 (0.820)13 (0.080) 7/132 NT 8.2% intergenic (+74/+43) tarD/dacA Glycerol‑3‑phosphate cytidylyltransferase/D‑alanyl‑D‑alanine carboxypeptidase DacA
?USA300TCH1516_ALE = 715335 151 (0.900)intergenic (+93/+24) tarD/dacA Glycerol‑3‑phosphate cytidylyltransferase/D‑alanyl‑D‑alanine carboxypeptidase DacA
* ? USA300TCH1516_ALE = 724910172 (0.840)26 (0.150) 11/140 NT 13.4% intergenic (+30/‑204) feuC_1/dhaK Iron‑uptake system permease protein FeuC/PTS‑dependent dihydroxyacetone kinase, dihydroxyacetone‑binding subunit DhaK
?USA300TCH1516_ALE = 724929 186 (1.050)intergenic (+49/‑185) feuC_1/dhaK Iron‑uptake system permease protein FeuC/PTS‑dependent dihydroxyacetone kinase, dihydroxyacetone‑binding subunit DhaK
* ? USA300TCH1516_ALE 729254 =166 (0.810)22 (0.130) 11/136 NT 13.3% intergenic (+55/‑96) USA300HOU_RS03535/aes hypothetical protein/Acetyl esterase
?USA300TCH1516_ALE 729295 = 147 (0.850)intergenic (+96/‑55) USA300HOU_RS03535/aes hypothetical protein/Acetyl esterase
* ? USA300TCH1516_ALE = 729265170 (0.830)23 (0.130) 8/136 NT 13.6% intergenic (+66/‑85) USA300HOU_RS03535/aes hypothetical protein/Acetyl esterase
?USA300TCH1516_ALE = 729282 147 (0.850)intergenic (+83/‑68) USA300HOU_RS03535/aes hypothetical protein/Acetyl esterase
* ? USA300TCH1516_ALE = 745527220 (1.080)20 (0.100) 12/154 NT 8.0% intergenic (+13/‑177) sarX/USA300HOU_RS03615 HTH‑type transcriptional regulator SarX/putative transcriptional regulatory protein
?USA300TCH1516_ALE = 745553 251 (1.280)intergenic (+39/‑151) sarX/USA300HOU_RS03615 HTH‑type transcriptional regulator SarX/putative transcriptional regulatory protein
* ? USA300TCH1516_ALE = 753691133 (0.650)13 (0.080) 8/130 NT 9.2% intergenic (+34/+62) USA300HOU_RS03675/yvdD hypothetical protein/LOG family protein YvdD
?USA300TCH1516_ALE = 753716 148 (0.900)intergenic (+59/+37) USA300HOU_RS03675/yvdD hypothetical protein/LOG family protein YvdD
* ? USA300TCH1516_ALE = 754401164 (0.810)22 (0.120) 12/146 NT 12.6% coding (379/459 nt) USA300HOU_RS03685 hypothetical protein
?USA300TCH1516_ALE = 754417 155 (0.830)coding (363/459 nt) USA300HOU_RS03685 hypothetical protein
* ? USA300TCH1516_ALE 760026 =226 (1.110)21 (0.130) 12/132 NT 11.3% coding (1674/1674 nt) USA300HOU_RS03705 Putative multidrug export ATP‑binding/permease protein
?USA300TCH1516_ALE 760070 = 145 (0.870)intergenic (+44/+83) USA300HOU_RS03705/mgrA Putative multidrug export ATP‑binding/permease protein/HTH‑type transcriptional regulator MgrA
* ? USA300TCH1516_ALE = 761262217 (1.070)13 (0.070) 6/148 NT 5.9% coding (440/927 nt) yciC_2 Putative metal chaperone YciC
?USA300TCH1516_ALE = 761280 215 (1.140)coding (458/927 nt) yciC_2 Putative metal chaperone YciC
* ? USA300TCH1516_ALE 763745 =173 (0.850)26 (0.140) 10/148 NT 14.5% coding (381/1554 nt) ybhI Inner membrane protein YbhI
?USA300TCH1516_ALE 763773 = 146 (0.780)coding (409/1554 nt) ybhI Inner membrane protein YbhI
* ? USA300TCH1516_ALE = 769784200 (0.980)11 (0.060) 7/146 NT 5.4% coding (91/465 nt) USA300HOU_RS03760 hypothetical protein
?USA300TCH1516_ALE = 769799 201 (1.080)coding (106/465 nt) USA300HOU_RS03760 hypothetical protein
* ? USA300TCH1516_ALE 782414 =191 (0.940)13 (0.070) 7/140 NT 6.6% intergenic (‑209/+133) USA300HOU_RS03820/USA300HOU_RS03825 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 782453 = 202 (1.140)intergenic (‑248/+94) USA300HOU_RS03820/USA300HOU_RS03825 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 799573 =210 (1.030)10 (0.060) 6/128 NT 6.3% intergenic (+5/‑235) opuBB/hisC_1 Choline transport system permease protein OpuBB/Histidinol‑phosphate aminotransferase
?USA300TCH1516_ALE 799622 = 132 (0.810)intergenic (+54/‑186) opuBB/hisC_1 Choline transport system permease protein OpuBB/Histidinol‑phosphate aminotransferase
* ? USA300TCH1516_ALE = 802141148 (0.730)17 (0.100) 10/138 NT 10.3% intergenic (+382/+242) USA300HOU_RS03915/USA300HOU_RS03920 Putative 5'(3')‑deoxyribonucleotidase/Putative lipid kinase
?USA300TCH1516_ALE = 802168 169 (0.960)intergenic (+409/+215) USA300HOU_RS03915/USA300HOU_RS03920 Putative 5'(3')‑deoxyribonucleotidase/Putative lipid kinase
* ? USA300TCH1516_ALE 815690 =214 (1.050)20 (0.110) 11/138 NT 11.5% intergenic (+5/+312) yclQ/USA300HOU_RS03990 putative ABC transporter solute‑binding protein YclQ/hypothetical protein
?USA300TCH1516_ALE 815739 = 125 (0.710)intergenic (+54/+263) yclQ/USA300HOU_RS03990 putative ABC transporter solute‑binding protein YclQ/hypothetical protein
* ? USA300TCH1516_ALE 823754 =152 (0.750)11 (0.060) 9/134 NT 7.5% intergenic (‑129/+67) yjjP_2/dosC Inner membrane protein YjjP/Diguanylate cyclase DosC
?USA300TCH1516_ALE 823814 = 144 (0.850)intergenic (‑189/+7) yjjP_2/dosC Inner membrane protein YjjP/Diguanylate cyclase DosC
* ? USA300TCH1516_ALE = 823766154 (0.760)21 (0.120) 13/134 NT 13.3% intergenic (‑141/+55) yjjP_2/dosC Inner membrane protein YjjP/Diguanylate cyclase DosC
?USA300TCH1516_ALE = 823800 144 (0.850)intergenic (‑175/+21) yjjP_2/dosC Inner membrane protein YjjP/Diguanylate cyclase DosC
* ? USA300TCH1516_ALE 828546 =188 (0.920)10 (0.050) 5/154 NT 5.5% coding (98/1083 nt) comFA ComF operon protein 1
?USA300TCH1516_ALE 828574 = 163 (0.830)coding (126/1083 nt) comFA ComF operon protein 1
* ? USA300TCH1516_ALE 842619 =194 (0.950)10 (0.050) 8/144 NT 5.4% intergenic (+5/‑657) uvrA/hprK UvrABC system protein A/HPr kinase/phosphorylase
?USA300TCH1516_ALE 842662 = 175 (0.960)intergenic (+48/‑614) uvrA/hprK UvrABC system protein A/HPr kinase/phosphorylase
* ? USA300TCH1516_ALE = 842626186 (0.910)17 (0.090) 7/144 NT 9.0% intergenic (+12/‑650) uvrA/hprK UvrABC system protein A/HPr kinase/phosphorylase
?USA300TCH1516_ALE = 842653 175 (0.960)intergenic (+39/‑623) uvrA/hprK UvrABC system protein A/HPr kinase/phosphorylase
* ? USA300TCH1516_ALE = 853007177 (0.870)21 (0.110) 9/148 NT 11.3% intergenic (+14/+229) clpP_1/USA300HOU_RS04170 ATP‑dependent Clp protease proteolytic subunit/Epimerase family protein
?USA300TCH1516_ALE = 853023 166 (0.880)intergenic (+30/+213) clpP_1/USA300HOU_RS04170 ATP‑dependent Clp protease proteolytic subunit/Epimerase family protein
* ? USA300TCH1516_ALE 858374 =181 (0.890)11 (0.060) 6/146 NT 6.5% intergenic (+69/‑70) gapA1/pgk Glyceraldehyde‑3‑phosphate dehydrogenase 1/Phosphoglycerate kinase
?USA300TCH1516_ALE 858405 = 151 (0.810)intergenic (+100/‑39) gapA1/pgk Glyceraldehyde‑3‑phosphate dehydrogenase 1/Phosphoglycerate kinase
* ? USA300TCH1516_ALE = 868310146 (0.720)19 (0.100) 8/148 NT 11.7% coding (458/465 nt) smpB SsrA‑binding protein
?USA300TCH1516_ALE = 868335 153 (0.810)intergenic (+18/+1304) smpB/USA300HOU_RS04240 SsrA‑binding protein/hypothetical protein
* ? USA300TCH1516_ALE 869579 =278 (1.360)25 (0.140) 12/140 NT 9.3% intergenic (+1262/+60) smpB/USA300HOU_RS04240 SsrA‑binding protein/hypothetical protein
?USA300TCH1516_ALE 869621 = 247 (1.390)intergenic (+1304/+18) smpB/USA300HOU_RS04240 SsrA‑binding protein/hypothetical protein
* ? USA300TCH1516_ALE 872094 =203 (1.000)11 (0.060) 8/144 NT 5.8% intergenic (+8/‑209) USA300HOU_RS04260/USA300HOU_RS04265 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 872124 = 177 (0.970)intergenic (+38/‑179) USA300HOU_RS04260/USA300HOU_RS04265 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 885377 =157 (0.770)15 (0.090) 12/134 NT 10.1% intergenic (+6/+67) pspB/argO Putative phosphoserine phosphatase 2/Arginine exporter protein ArgO
?USA300TCH1516_ALE 885422 = 137 (0.800)intergenic (+51/+22) pspB/argO Putative phosphoserine phosphatase 2/Arginine exporter protein ArgO
* ? USA300TCH1516_ALE = 885389157 (0.770)20 (0.120) 10/134 NT 13.0% intergenic (+18/+55) pspB/argO Putative phosphoserine phosphatase 2/Arginine exporter protein ArgO
?USA300TCH1516_ALE = 885408 137 (0.800)intergenic (+37/+36) pspB/argO Putative phosphoserine phosphatase 2/Arginine exporter protein ArgO
* ? USA300TCH1516_ALE 893176 =178 (0.870)15 (0.090) 9/136 NT 8.9% intergenic (+177/‑73) trxA_1/metN2 Thioredoxin/Methionine import ATP‑binding protein MetN 2
?USA300TCH1516_ALE 893212 = 155 (0.900)intergenic (+213/‑37) trxA_1/metN2 Thioredoxin/Methionine import ATP‑binding protein MetN 2
* ? USA300TCH1516_ALE = 893187176 (0.860)13 (0.080) 9/136 NT 7.9% intergenic (+188/‑62) trxA_1/metN2 Thioredoxin/Methionine import ATP‑binding protein MetN 2
?USA300TCH1516_ALE = 893199 155 (0.900)intergenic (+200/‑50) trxA_1/metN2 Thioredoxin/Methionine import ATP‑binding protein MetN 2
* ? USA300TCH1516_ALE 906243 =220 (1.080)17 (0.090) 7/148 NT 7.9% intergenic (+27/‑157) USA300HOU_RS04485/USA300HOU_RS04490 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 906294 = 191 (1.010)intergenic (+78/‑106) USA300HOU_RS04485/USA300HOU_RS04490 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 908480 =248 (1.220)23 (0.120) 10/146 NT 9.7% intergenic (+192/+43) USA300HOU_RS04495/USA300HOU_RS04500 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 908515 = 200 (1.080)intergenic (+227/+8) USA300HOU_RS04495/USA300HOU_RS04500 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 909579200 (0.980)25 (0.140) 10/144 NT 12.4% intergenic (‑502/‑532) USA300HOU_RS04500/csbD_1 hypothetical protein/Stress response protein CsbD
?USA300TCH1516_ALE = 909596 172 (0.940)intergenic (‑519/‑515) USA300HOU_RS04500/csbD_1 hypothetical protein/Stress response protein CsbD
* ? USA300TCH1516_ALE 920377 =124 (0.610)12 (0.070) 7/132 NT 9.7% intergenic (+6/‑207) USA300HOU_RS04555/USA300HOU_RS04565 Putative monooxygenase/hypothetical protein
?USA300TCH1516_ALE 920443 = 121 (0.720)intergenic (+72/‑141) USA300HOU_RS04555/USA300HOU_RS04565 Putative monooxygenase/hypothetical protein
* ? USA300TCH1516_ALE = 924496197 (0.970)20 (0.110) 11/144 NT 10.0% coding (795/918 nt) lipA_1 Lipoyl synthase
?USA300TCH1516_ALE = 924511 183 (1.000)coding (810/918 nt) lipA_1 Lipoyl synthase
* ? USA300TCH1516_ALE 932460 =150 (0.740)11 (0.060) 11/136 NT 7.7% intergenic (+6/+257) USA300HOU_RS04635/nfuA hypothetical protein/Fe/S biogenesis protein NfuA
?USA300TCH1516_ALE 932506 = 135 (0.780)intergenic (+52/+211) USA300HOU_RS04635/nfuA hypothetical protein/Fe/S biogenesis protein NfuA
* ? USA300TCH1516_ALE = 932471148 (0.730)8 (0.050) 6/136 NT 5.8% intergenic (+17/+246) USA300HOU_RS04635/nfuA hypothetical protein/Fe/S biogenesis protein NfuA
?USA300TCH1516_ALE = 932493 135 (0.780)intergenic (+39/+224) USA300HOU_RS04635/nfuA hypothetical protein/Fe/S biogenesis protein NfuA
* ? USA300TCH1516_ALE = 940821193 (0.950)13 (0.070) 6/148 NT 7.2% intergenic (+2/+54) USA300HOU_RS04680/ptlE Putative esterase/Neopentalenolactone D synthase
?USA300TCH1516_ALE = 940872 156 (0.830)intergenic (+53/+3) USA300HOU_RS04680/ptlE Putative esterase/Neopentalenolactone D synthase
* ? USA300TCH1516_ALE 940823 =193 (0.950)11 (0.060) 8/140 NT 6.4% intergenic (+4/+52) USA300HOU_RS04680/ptlE Putative esterase/Neopentalenolactone D synthase
?USA300TCH1516_ALE 940872 = 153 (0.860)intergenic (+53/+3) USA300HOU_RS04680/ptlE Putative esterase/Neopentalenolactone D synthase
* ? USA300TCH1516_ALE 954365 =155 (0.760)9 (0.050) 6/138 NT 5.8% intergenic (+19/+484) gluD/glpQ_1 NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase
?USA300TCH1516_ALE 954407 = 159 (0.910)intergenic (+61/+442) gluD/glpQ_1 NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase
* ? USA300TCH1516_ALE 954695 =166 (0.810)32 (0.170)
+GGCAAG		 12/148 NT 15.5% intergenic (+349/+154) gluD/glpQ_1 NAD‑specific glutamate dehydrogenase/Glycerophosphodiester phosphodiesterase
?USA300TCH1516_ALE 1873938 = 213 (1.050)intergenic (‑614/+136) USA300HOU_RS09300/USA300HOU_RS09305 Putative dipeptidase/hypothetical protein
* ? USA300TCH1516_ALE 971394 =213 (1.050)23 (0.130) 11/142 NT 11.4% intergenic (+22/+149) USA300HOU_RS04810/cdr hypothetical protein/Coenzyme A disulfide reductase
?USA300TCH1516_ALE 971435 = 170 (0.940)intergenic (+63/+108) USA300HOU_RS04810/cdr hypothetical protein/Coenzyme A disulfide reductase
* ? USA300TCH1516_ALE 971887 =174 (0.850)8 (0.040) 5/140 NT 5.0% coding (973/1317 nt) cdr Coenzyme A disulfide reductase
?USA300TCH1516_ALE 971952 = 149 (0.840)coding (908/1317 nt) cdr Coenzyme A disulfide reductase
* ? USA300TCH1516_ALE = 974266195 (0.960)17 (0.100) 8/136 NT 8.4% intergenic (+109/‑438) mrp/oatA_1 Iron‑sulfur cluster carrier protein/O‑acetyltransferase OatA
?USA300TCH1516_ALE = 974288 205 (1.190)intergenic (+131/‑416) mrp/oatA_1 Iron‑sulfur cluster carrier protein/O‑acetyltransferase OatA
* ? USA300TCH1516_ALE = 979665216 (1.060)11 (0.060) 8/144 NT 5.0% coding (594/870 nt) ampR HTH‑type transcriptional activator AmpR
?USA300TCH1516_ALE = 979685 220 (1.200)coding (574/870 nt) ampR HTH‑type transcriptional activator AmpR
* ? USA300TCH1516_ALE = 987447185 (0.910)25 (0.150) 12/128 NT 13.9% intergenic (+20/+35) fabF/USA300HOU_RS04885 3‑oxoacyl‑[acyl‑carrier‑protein] synthase 2/hypothetical protein
?USA300TCH1516_ALE = 987456 162 (1.000)intergenic (+29/+26) fabF/USA300HOU_RS04885 3‑oxoacyl‑[acyl‑carrier‑protein] synthase 2/hypothetical protein
* ? USA300TCH1516_ALE 1005781 =188 (0.920)30 (0.170) 14/138 NT 15.8% intergenic (+417/+43) pepF1_1/USA300HOU_RS04965 Oligoendopeptidase F, plasmid/hypothetical protein
?USA300TCH1516_ALE 1005817 = 157 (0.900)intergenic (+453/+7) pepF1_1/USA300HOU_RS04965 Oligoendopeptidase F, plasmid/hypothetical protein
* ? USA300TCH1516_ALE 1015009 =207 (1.020)19 (0.100) 11/150 NT 9.2% intergenic (+124/+71) fabI/USA300HOU_RS05015 Enoyl‑[acyl‑carrier‑protein] reductase [NADPH] FabI/hypothetical protein
?USA300TCH1516_ALE 1015047 = 180 (0.940)intergenic (+162/+33) fabI/USA300HOU_RS05015 Enoyl‑[acyl‑carrier‑protein] reductase [NADPH] FabI/hypothetical protein
* ? USA300TCH1516_ALE = 1030896178 (0.870)10 (0.060) 8/134 NT 5.7% intergenic (+19/‑117) ktrB_1/yfkN_2 Ktr system potassium uptake protein B/Trifunctional nucleotide phosphoesterase protein YfkN
?USA300TCH1516_ALE = 1030919 181 (1.060)intergenic (+42/‑94) ktrB_1/yfkN_2 Ktr system potassium uptake protein B/Trifunctional nucleotide phosphoesterase protein YfkN
* ? USA300TCH1516_ALE = 1032068207 (1.020)11 (0.060) 10/146 NT 5.4% coding (1056/1515 nt) yfkN_2 Trifunctional nucleotide phosphoesterase protein YfkN
?USA300TCH1516_ALE = 1032096 197 (1.060)coding (1084/1515 nt) yfkN_2 Trifunctional nucleotide phosphoesterase protein YfkN
* ? USA300TCH1516_ALE 1034042 =130 (0.640)19 (0.120) 10/130 NT 14.5% intergenic (+31/+50) USA300TCH1516_00960/USA300TCH1516_00961 hypothetical protein/Lipoate‑‑protein ligase 1
?USA300TCH1516_ALE 1034086 = 119 (0.720)intergenic (+75/+6) USA300TCH1516_00960/USA300TCH1516_00961 hypothetical protein/Lipoate‑‑protein ligase 1
* ? USA300TCH1516_ALE = 1034056120 (0.590)16 (0.100) 8/130 NT 12.9% intergenic (+45/+36) USA300TCH1516_00960/USA300TCH1516_00961 hypothetical protein/Lipoate‑‑protein ligase 1
?USA300TCH1516_ALE = 1034070 119 (0.720)intergenic (+59/+22) USA300TCH1516_00960/USA300TCH1516_00961 hypothetical protein/Lipoate‑‑protein ligase 1
* ? USA300TCH1516_ALE = 1036086164 (0.810)32 (0.190) 15/132 NT 17.5% intergenic (+16/‑1328) USA300TCH1516_00963/USA300TCH1516_00964 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 1036095 167 (1.000)intergenic (+25/‑1319) USA300TCH1516_00963/USA300TCH1516_00964 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 1036825238 (1.170)11 (0.060) 5/140 NT 5.0% intergenic (+755/‑589) USA300TCH1516_00963/USA300TCH1516_00964 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 1036842 210 (1.180)intergenic (+772/‑572) USA300TCH1516_00963/USA300TCH1516_00964 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 1040357 =197 (0.970)19 (0.110) 9/132 NT 10.5% intergenic (+18/+70) USA300TCH1516_00966/USA300TCH1516_00967 putative ABC transporter ATP‑binding protein/hypothetical protein
?USA300TCH1516_ALE 1040412 = 161 (0.960)intergenic (+73/+15) USA300TCH1516_00966/USA300TCH1516_00967 putative ABC transporter ATP‑binding protein/hypothetical protein
* ? USA300TCH1516_ALE = 1040370198 (0.970)9 (0.050) 7/132 NT 5.3% intergenic (+31/+57) USA300TCH1516_00966/USA300TCH1516_00967 putative ABC transporter ATP‑binding protein/hypothetical protein
?USA300TCH1516_ALE = 1040397 161 (0.960)intergenic (+58/+30) USA300TCH1516_00966/USA300TCH1516_00967 putative ABC transporter ATP‑binding protein/hypothetical protein
* ? USA300TCH1516_ALE 1044649 =217 (1.070)23 (0.140) 12/132 NT 12.1% coding (958/960 nt) yfmC_1 Fe(3+)‑citrate‑binding protein YfmC
?USA300TCH1516_ALE 1044700 = 156 (0.930)coding (114/117 nt) USA300HOU_RS05165 hypothetical protein
* ? USA300TCH1516_ALE = 1046337153 (0.750)10 (0.050) 6/148 NT 6.6% coding (477/939 nt) menA 1,4‑dihydroxy‑2‑naphthoate octaprenyltransferase
?USA300TCH1516_ALE = 1046354 143 (0.760)coding (460/939 nt) menA 1,4‑dihydroxy‑2‑naphthoate octaprenyltransferase
* ? USA300TCH1516_ALE 1072018 =176 (0.860)12 (0.080) 5/126 NT 8.9% intergenic (‑490/+315) USA300HOU_RS05290/folD Pesticidal crystal protein Cry22Aa/Bifunctional protein FolD protein
?USA300TCH1516_ALE 1072073 = 108 (0.680)intergenic (‑545/+260) USA300HOU_RS05290/folD Pesticidal crystal protein Cry22Aa/Bifunctional protein FolD protein
* ? USA300TCH1516_ALE 1084754 =153 (0.750)13 (0.070) 6/140 NT 8.1% intergenic (+126/+139) purD/ykoC_1 Phosphoribosylamine‑‑glycine ligase/Putative HMP/thiamine permease protein YkoC
?USA300TCH1516_ALE 1084817 = 161 (0.900)intergenic (+189/+76) purD/ykoC_1 Phosphoribosylamine‑‑glycine ligase/Putative HMP/thiamine permease protein YkoC
* ? USA300TCH1516_ALE = 1084763158 (0.780)10 (0.060) 7/140 NT 6.3% intergenic (+135/+130) purD/ykoC_1 Phosphoribosylamine‑‑glycine ligase/Putative HMP/thiamine permease protein YkoC
?USA300TCH1516_ALE = 1084806 161 (0.900)intergenic (+178/+87) purD/ykoC_1 Phosphoribosylamine‑‑glycine ligase/Putative HMP/thiamine permease protein YkoC
* ? USA300TCH1516_ALE 1086962 =217 (1.070)13 (0.070) 7/140 NT 7.0% coding (131/1401 nt) ykoD_1 Putative HMP/thiamine import ATP‑binding protein YkoD
?USA300TCH1516_ALE 1087000 = 156 (0.880)coding (93/1401 nt) ykoD_1 Putative HMP/thiamine import ATP‑binding protein YkoD
* ? USA300TCH1516_ALE = 1115642189 (0.930)22 (0.120) 9/146 NT 10.9% intergenic (‑137/+47) mntH_1/USA300TCH1516_01038 Divalent metal cation transporter MntH/hypothetical protein
?USA300TCH1516_ALE = 1115662 188 (1.010)intergenic (‑157/+27) mntH_1/USA300TCH1516_01038 Divalent metal cation transporter MntH/hypothetical protein
* ? USA300TCH1516_ALE 1117293 =242 (1.190)14 (0.080) 7/130 NT 7.3% intergenic (+6/+148) suhB_1/USA300TCH1516_01040 Inositol‑1‑monophosphatase/hypothetical protein
?USA300TCH1516_ALE 1117341 = 159 (0.960)intergenic (+54/+100) suhB_1/USA300TCH1516_01040 Inositol‑1‑monophosphatase/hypothetical protein
* ? USA300TCH1516_ALE 1119593 =186 (0.910)16 (0.090) 6/136 NT 10.1% intergenic (+12/+297) typA/USA300HOU_RS05545 GTP‑binding protein TypA/BipA/hypothetical protein
?USA300TCH1516_ALE 1119635 = 126 (0.730)intergenic (+54/+255) typA/USA300HOU_RS05545 GTP‑binding protein TypA/BipA/hypothetical protein
* ? USA300TCH1516_ALE = 1131052155 (0.760)13 (0.080) 5/126 NT 8.7% intergenic (+16/+47) USA300HOU_RS05590/glpQ1 hypothetical protein/putative glycerophosphodiester phosphodiesterase 1
?USA300TCH1516_ALE = 1131083 151 (0.940)intergenic (+47/+16) USA300HOU_RS05590/glpQ1 hypothetical protein/putative glycerophosphodiester phosphodiesterase 1
* ? USA300TCH1516_ALE 1134014 =170 (0.830)9 (0.050) 6/132 NT 5.8% intergenic (+8/+54) coaD/USA300HOU_RS05620 Phosphopantetheine adenylyltransferase/Nicotinamide‑nucleotide adenylyltransferase
?USA300TCH1516_ALE 1134060 = 154 (0.920)intergenic (+54/+8) coaD/USA300HOU_RS05620 Phosphopantetheine adenylyltransferase/Nicotinamide‑nucleotide adenylyltransferase
* ? USA300TCH1516_ALE = 1134027174 (0.850)9 (0.050) 6/132 NT 5.7% intergenic (+21/+41) coaD/USA300HOU_RS05620 Phosphopantetheine adenylyltransferase/Nicotinamide‑nucleotide adenylyltransferase
?USA300TCH1516_ALE = 1134045 154 (0.920)intergenic (+39/+23) coaD/USA300HOU_RS05620 Phosphopantetheine adenylyltransferase/Nicotinamide‑nucleotide adenylyltransferase
* ? USA300TCH1516_ALE = 1136225195 (0.960)12 (0.070) 9/142 NT 6.2% intergenic (+81/+73) rpmF/isdB 50S ribosomal protein L32/Iron‑regulated surface determinant protein B
?USA300TCH1516_ALE = 1136249 192 (1.060)intergenic (+105/+49) rpmF/isdB 50S ribosomal protein L32/Iron‑regulated surface determinant protein B
* ? USA300TCH1516_ALE = 1138356199 (0.980)13 (0.070) 9/140 NT 6.8% intergenic (‑121/+82) isdB/isdA Iron‑regulated surface determinant protein B/Iron‑regulated surface determinant protein A
?USA300TCH1516_ALE = 1138378 181 (1.020)intergenic (‑143/+60) isdB/isdA Iron‑regulated surface determinant protein B/Iron‑regulated surface determinant protein A
* ? USA300TCH1516_ALE 1144506 =212 (1.040)24 (0.130) 10/142 NT 11.5% intergenic (+57/‑327) isdG/USA300HOU_RS05685 Heme oxygenase (staphylobilin‑producing) 1/Putative TrmH family tRNA/rRNA methyltransferase
?USA300TCH1516_ALE 1144538 = 182 (1.010)intergenic (+89/‑295) isdG/USA300HOU_RS05685 Heme oxygenase (staphylobilin‑producing) 1/Putative TrmH family tRNA/rRNA methyltransferase
* ? USA300TCH1516_ALE 1149421 =217 (1.070)11 (0.060) 5/138 NT 5.7% intergenic (+7/+164) pheT_1/rnhC Phenylalanine‑‑tRNA ligase beta subunit/Ribonuclease HIII
?USA300TCH1516_ALE 1149475 = 179 (1.020)intergenic (+61/+110) pheT_1/rnhC Phenylalanine‑‑tRNA ligase beta subunit/Ribonuclease HIII
* ? USA300TCH1516_ALE 1149564 =173 (0.850)21 (0.120) 11/142 NT 11.4% intergenic (+150/+21) pheT_1/rnhC Phenylalanine‑‑tRNA ligase beta subunit/Ribonuclease HIII
?USA300TCH1516_ALE 1149598 = 174 (0.960)coding (926/939 nt) rnhC Ribonuclease HIII
* ? USA300TCH1516_ALE = 1149572183 (0.900)19 (0.110) 9/142 NT 10.2% intergenic (+158/+13) pheT_1/rnhC Phenylalanine‑‑tRNA ligase beta subunit/Ribonuclease HIII
?USA300TCH1516_ALE = 1149588 174 (0.960)coding (936/939 nt) rnhC Ribonuclease HIII
* ? USA300TCH1516_ALE = 1168159209 (1.030)20 (0.110) 9/140 NT 8.7% intergenic (+15/+638) scn_2/USA300HOU_RS05810 Staphylococcal complement inhibitor/hypothetical protein
?USA300TCH1516_ALE = 1168177 235 (1.320)intergenic (+33/+620) scn_2/USA300HOU_RS05810 Staphylococcal complement inhibitor/hypothetical protein
* ? USA300TCH1516_ALE = 1168782286 (1.400)17 (0.090)
+AGCTGT		 7/148 NT 7.3% intergenic (+638/+15) scn_2/USA300HOU_RS05810 Staphylococcal complement inhibitor/hypothetical protein
?USA300TCH1516_ALE 2664923 = 181 (0.890)intergenic (+158/+280) pitA_2/USA300TCH1516_02535 L‑methionine sulfoximine/L‑methionine sulfone acetyltransferase/hypothetical protein
* ? USA300TCH1516_ALE = 1172339162 (0.800)28 (0.170) 9/130 NT 16.3% coding (248/282 nt) USA300HOU_RS05840 hypothetical protein
?USA300TCH1516_ALE = 1172348 156 (0.950)coding (239/282 nt) USA300HOU_RS05840 hypothetical protein
* ? USA300TCH1516_ALE = 1177547166 (0.810)10 (0.060) 7/142 NT 6.1% intergenic (+66/‑106) arcC1_2/USA300HOU_RS05870 Carbamate kinase 1/hypothetical protein
?USA300TCH1516_ALE = 1177574 162 (0.900)intergenic (+93/‑79) arcC1_2/USA300HOU_RS05870 Carbamate kinase 1/hypothetical protein
* ? USA300TCH1516_ALE 1181842 =186 (0.910)34 (0.190) 12/144 NT 17.4% intergenic (+409/+65) USA300HOU_RS05885/USA300TCH1516_01103 hypothetical protein/tRNA‑Arg
?USA300TCH1516_ALE 1181881 = 156 (0.850)intergenic (+448/+26) USA300HOU_RS05885/USA300TCH1516_01103 hypothetical protein/tRNA‑Arg
* ? USA300TCH1516_ALE = 1182701194 (0.950)14 (0.080) 4/136 NT 7.9% intergenic (+31/‑102) USA300HOU_RS05900/yfnB Antibacterial protein 3/Putative HAD‑hydrolase YfnB
?USA300TCH1516_ALE = 1182728 163 (0.940)intergenic (+58/‑75) USA300HOU_RS05900/yfnB Antibacterial protein 3/Putative HAD‑hydrolase YfnB
* ? USA300TCH1516_ALE 1183547 =215 (1.060)16 (0.090) 6/140 NT 8.0% intergenic (+58/+51) yfnB/USA300HOU_RS05910 Putative HAD‑hydrolase YfnB/putative N‑acetyltransferase
?USA300TCH1516_ALE 1183585 = 181 (1.020)intergenic (+96/+13) yfnB/USA300HOU_RS05910 Putative HAD‑hydrolase YfnB/putative N‑acetyltransferase
* ? USA300TCH1516_ALE = 1183556208 (1.020)18 (0.100) 11/140 NT 9.0% intergenic (+67/+42) yfnB/USA300HOU_RS05910 Putative HAD‑hydrolase YfnB/putative N‑acetyltransferase
?USA300TCH1516_ALE = 1183574 181 (1.020)intergenic (+85/+24) yfnB/USA300HOU_RS05910 Putative HAD‑hydrolase YfnB/putative N‑acetyltransferase
* ? USA300TCH1516_ALE = 1199293163 (0.800)18 (0.100) 7/144 NT 9.7% intergenic (+20/‑63) USA300HOU_RS05980/USA300HOU_RS05985 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 1199312 189 (1.030)intergenic (+39/‑44) USA300HOU_RS05980/USA300HOU_RS05985 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 1205323NA (NA)41 (0.220)
+AGCGAA		 10/148 NT 30.1% intergenic (‑204/‑365) USA300HOU_RS15290/lspA hypothetical protein/Lipoprotein signal peptidase
?USA300TCH1516_ALE 2478509 = 103 (0.510)intergenic (+396/‑179) USA300HOU_RS12760/USA300HOU_RS12765 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 1217678 =142 (0.700)10 (0.060) 6/128 NT 7.2% intergenic (+7/‑430) USA300HOU_RS06060/USA300HOU_RS06065 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 1217746 = 145 (0.890)intergenic (+75/‑362) USA300HOU_RS06060/USA300HOU_RS06065 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 1225501222 (1.090)12 (0.070) 8/142 NT 5.5% intergenic (+93/‑413) priA/USA300HOU_RS06095 Primosomal protein N'/hypothetical protein
?USA300TCH1516_ALE = 1225529 215 (1.190)intergenic (+121/‑385) priA/USA300HOU_RS06095 Primosomal protein N'/hypothetical protein
* ? USA300TCH1516_ALE = 1227656179 (0.880)12 (0.060) 8/148 NT 6.4% coding (125/489 nt) def1 Peptide deformylase 1
?USA300TCH1516_ALE = 1227672 183 (0.970)coding (141/489 nt) def1 Peptide deformylase 1
* ? USA300TCH1516_ALE = 1239557163 (0.800)24 (0.150) 18/124 NT 13.8% intergenic (+24/‑166) USA300HOU_RS06160/recG hypothetical protein/ATP‑dependent DNA helicase RecG
?USA300TCH1516_ALE = 1239571 175 (1.110)intergenic (+38/‑152) USA300HOU_RS06160/recG hypothetical protein/ATP‑dependent DNA helicase RecG
* ? USA300TCH1516_ALE 1245227 =205 (1.010)14 (0.080) 9/146 NT 7.3% intergenic (+32/‑211) fabG/acpP 3‑oxoacyl‑[acyl‑carrier‑protein] reductase FabG/Acyl carrier protein
?USA300TCH1516_ALE 1245269 = 169 (0.910)intergenic (+74/‑169) fabG/acpP 3‑oxoacyl‑[acyl‑carrier‑protein] reductase FabG/Acyl carrier protein
* ? USA300TCH1516_ALE = 1253236155 (0.760)10 (0.050) 6/152 NT 6.0% intergenic (+43/‑392) ffh/rpsP Signal recognition particle protein/30S ribosomal protein S16
?USA300TCH1516_ALE = 1253273 168 (0.870)intergenic (+80/‑355) ffh/rpsP Signal recognition particle protein/30S ribosomal protein S16
* ? USA300TCH1516_ALE = 1255979165 (0.810)27 (0.160) 12/134 NT 15.5% intergenic (+195/+49) rplS/USA300HOU_RS06250 50S ribosomal protein L19/hypothetical protein
?USA300TCH1516_ALE = 1255992 157 (0.920)intergenic (+208/+36) rplS/USA300HOU_RS06250 50S ribosomal protein L19/hypothetical protein
* ? USA300TCH1516_ALE 1262900 =158 (0.780)23 (0.130) 8/140 NT 13.3% intergenic (+25/‑202) sucD/lytN_1 Succinate‑‑CoA ligase [ADP‑forming] subunit alpha/putative cell wall hydrolase LytN
?USA300TCH1516_ALE 1262943 = 162 (0.910)intergenic (+68/‑159) sucD/lytN_1 Succinate‑‑CoA ligase [ADP‑forming] subunit alpha/putative cell wall hydrolase LytN
* ? USA300TCH1516_ALE = 1262909166 (0.810)30 (0.170) 13/140 NT 16.3% intergenic (+34/‑193) sucD/lytN_1 Succinate‑‑CoA ligase [ADP‑forming] subunit alpha/putative cell wall hydrolase LytN
?USA300TCH1516_ALE = 1262932 162 (0.910)intergenic (+57/‑170) sucD/lytN_1 Succinate‑‑CoA ligase [ADP‑forming] subunit alpha/putative cell wall hydrolase LytN
* ? USA300TCH1516_ALE = 1265511227 (1.110)11 (0.070) 7/130 NT 5.4% intergenic (+19/‑154) femA_1/dprA Aminoacyltransferase FemA/DNA processing protein DprA
?USA300TCH1516_ALE = 1265527 198 (1.200)intergenic (+35/‑138) femA_1/dprA Aminoacyltransferase FemA/DNA processing protein DprA
* ? USA300TCH1516_ALE = 1279942194 (0.950)16 (0.090) 10/146 NT 8.0% intergenic (+35/‑227) cdsA/USA300HOU_RS06360 Phosphatidate cytidylyltransferase/Putative zinc metalloprotease
?USA300TCH1516_ALE = 1279967 193 (1.040)intergenic (+60/‑202) cdsA/USA300HOU_RS06360 Phosphatidate cytidylyltransferase/Putative zinc metalloprotease
* ? USA300TCH1516_ALE 1292484 =149 (0.730)13 (0.080) 6/128 NT 9.3% intergenic (+38/‑348) infB/rbfA Translation initiation factor IF‑2/Ribosome‑binding factor A
?USA300TCH1516_ALE 1292539 = 134 (0.820)intergenic (+93/‑293) infB/rbfA Translation initiation factor IF‑2/Ribosome‑binding factor A
* ? USA300TCH1516_ALE = 1292499158 (0.780)18 (0.110) 7/128 NT 12.2% intergenic (+53/‑333) infB/rbfA Translation initiation factor IF‑2/Ribosome‑binding factor A
?USA300TCH1516_ALE = 1292522 134 (0.820)intergenic (+76/‑310) infB/rbfA Translation initiation factor IF‑2/Ribosome‑binding factor A
* ? USA300TCH1516_ALE 1332932 =122 (0.600)14 (0.090) 5/124 NT 11.7% intergenic (+142/+80) hfq/bsaA_1 RNA‑binding protein Hfq/Glutathione peroxidase BsaA
?USA300TCH1516_ALE 1332990 = 117 (0.740)intergenic (+200/+22) hfq/bsaA_1 RNA‑binding protein Hfq/Glutathione peroxidase BsaA
* ? USA300TCH1516_ALE = 1332949116 (0.570)11 (0.070) 8/124 NT 9.6% intergenic (+159/+63) hfq/bsaA_1 RNA‑binding protein Hfq/Glutathione peroxidase BsaA
?USA300TCH1516_ALE = 1332971 117 (0.740)intergenic (+181/+41) hfq/bsaA_1 RNA‑binding protein Hfq/Glutathione peroxidase BsaA
* ? USA300TCH1516_ALE = 1336112140 (0.690)13 (0.070) 8/138 NT 8.5% intergenic (+17/‑226) mgl/glnR L‑methionine gamma‑lyase/HTH‑type transcriptional regulator GlnR
?USA300TCH1516_ALE = 1336130 160 (0.910)intergenic (+35/‑208) mgl/glnR L‑methionine gamma‑lyase/HTH‑type transcriptional regulator GlnR
* ? USA300TCH1516_ALE 1341822 =276 (1.350)13 (0.070) 9/148 NT 5.6% intergenic (+230/‑282) USA300HOU_RS06615/USA300TCH1516_01244 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 1341877 = 183 (0.970)intergenic (+285/‑227) USA300HOU_RS06615/USA300TCH1516_01244 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 1353894 =179 (0.880)9 (0.050) 5/134 NT 5.6% intergenic (+87/+56) nucH/USA300HOU_RS06735 Thermonuclease/hypothetical protein
?USA300TCH1516_ALE 1353946 = 154 (0.900)intergenic (+139/+4) nucH/USA300HOU_RS06735 Thermonuclease/hypothetical protein
* ? USA300TCH1516_ALE = 1353906177 (0.870)9 (0.050) 7/134 NT 5.6% intergenic (+99/+44) nucH/USA300HOU_RS06735 Thermonuclease/hypothetical protein
?USA300TCH1516_ALE = 1353932 154 (0.900)intergenic (+125/+18) nucH/USA300HOU_RS06735 Thermonuclease/hypothetical protein
* ? USA300TCH1516_ALE 1361472 =162 (0.800)14 (0.080) 8/140 NT 8.7% intergenic (+11/+282) USA300HOU_RS06765/USA300TCH1516_01271 Putative phosphatase/hypothetical protein
?USA300TCH1516_ALE 1361520 = 153 (0.860)intergenic (+59/+234) USA300HOU_RS06765/USA300TCH1516_01271 Putative phosphatase/hypothetical protein
* ? USA300TCH1516_ALE = 1361481174 (0.850)11 (0.060) 7/140 NT 6.7% intergenic (+20/+273) USA300HOU_RS06765/USA300TCH1516_01271 Putative phosphatase/hypothetical protein
?USA300TCH1516_ALE = 1361509 153 (0.860)intergenic (+48/+245) USA300HOU_RS06765/USA300TCH1516_01271 Putative phosphatase/hypothetical protein
* ? USA300TCH1516_ALE = 1364100155 (0.760)9 (0.050) 4/144 NT 5.8% coding (157/1518 nt) katA Catalase
?USA300TCH1516_ALE = 1364118 154 (0.840)coding (175/1518 nt) katA Catalase
* ? USA300TCH1516_ALE 1371838 =163 (0.800)7 (0.040) 5/142 NT 5.1% coding (1368/1989 nt) tkt Transketolase
?USA300TCH1516_ALE 1371876 = 115 (0.640)coding (1406/1989 nt) tkt Transketolase
* ? USA300TCH1516_ALE 1392266 =231 (1.130)13 (0.070) 9/140 NT 6.7% intergenic (+40/‑460) alsT/glcT Amino‑acid carrier protein AlsT/GlcA/glcB genes antiterminator
?USA300TCH1516_ALE 1392308 = 162 (0.910)intergenic (+82/‑418) alsT/glcT Amino‑acid carrier protein AlsT/GlcA/glcB genes antiterminator
* ? USA300TCH1516_ALE 1394924 =166 (0.810)14 (0.080) 5/132 NT 9.1% intergenic (+4/‑477) tqsA/mprF AI‑2 transport protein TqsA/Phosphatidylglycerol lysyltransferase
?USA300TCH1516_ALE 1394966 = 144 (0.860)intergenic (+46/‑435) tqsA/mprF AI‑2 transport protein TqsA/Phosphatidylglycerol lysyltransferase
* ? USA300TCH1516_ALE = 1394937158 (0.780)15 (0.090) 9/132 NT 9.9% intergenic (+17/‑464) tqsA/mprF AI‑2 transport protein TqsA/Phosphatidylglycerol lysyltransferase
?USA300TCH1516_ALE = 1394951 144 (0.860)intergenic (+31/‑450) tqsA/mprF AI‑2 transport protein TqsA/Phosphatidylglycerol lysyltransferase
* ? USA300TCH1516_ALE 1417767 =194 (0.950)9 (0.050) 5/136 NT 5.9% coding (152/831 nt) gsiD_3 Glutathione transport system permease protein GsiD
?USA300TCH1516_ALE 1417824 = 121 (0.700)coding (95/831 nt) gsiD_3 Glutathione transport system permease protein GsiD
* ? USA300TCH1516_ALE 1435387 =198 (0.970)19 (0.110) 11/140 NT 11.2% intergenic (+24/‑119) dapH/yxeP_3 2,3,4,5‑tetrahydropyridine‑2,6‑dicarboxylate N‑acetyltransferase/putative hydrolase YxeP
?USA300TCH1516_ALE 1435417 = 129 (0.730)intergenic (+54/‑89) dapH/yxeP_3 2,3,4,5‑tetrahydropyridine‑2,6‑dicarboxylate N‑acetyltransferase/putative hydrolase YxeP
* ? USA300TCH1516_ALE 1439018 =188 (0.920)21 (0.110) 12/146 NT 11.0% intergenic (+16/+224) lysA/USA300HOU_RS07135 Diaminopimelate decarboxylase/hypothetical protein
?USA300TCH1516_ALE 1439055 = 170 (0.920)intergenic (+53/+187) lysA/USA300HOU_RS07135 Diaminopimelate decarboxylase/hypothetical protein
* ? USA300TCH1516_ALE = 1439024187 (0.920)22 (0.120) 11/146 NT 11.4% intergenic (+22/+218) lysA/USA300HOU_RS07135 Diaminopimelate decarboxylase/hypothetical protein
?USA300TCH1516_ALE = 1439047 170 (0.920)intergenic (+45/+195) lysA/USA300HOU_RS07135 Diaminopimelate decarboxylase/hypothetical protein
* ? USA300TCH1516_ALE 1443204 =222 (1.090)31 (0.250)
+30 bp		 10/100 NT 18.4% coding (224/393 nt) USA300TCH1516_01342 hypothetical protein
?USA300TCH1516_ALE 1803072 = NA (NA)coding (796/807 nt) USA300HOU_RS12765 hypothetical protein
* ? USA300TCH1516_ALE 1456948 =224 (1.100)43 (0.230)
+GTTTT		 13/150 NT 18.5% intergenic (‑62/‑182) USA300HOU_RS07230/USA300HOU_RS07235 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 1918540 180 (0.880)intergenic (‑258/+240) USA300HOU_RS07235/USA300HOU_RS09510 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 1494261164 (0.810)8 (0.040) 5/150 NT 5.4% coding (7763/31266 nt) ebh_1 Extracellular matrix‑binding protein ebh
?USA300TCH1516_ALE = 1494291 124 (0.650)coding (7733/31266 nt) ebh_1 Extracellular matrix‑binding protein ebh
* ? USA300TCH1516_ALE 1507967 =201 (0.990)20 (0.120) 12/128 NT 12.6% intergenic (‑392/+83) ald1/ypcP Alanine dehydrogenase 1/5'‑3' exonuclease
?USA300TCH1516_ALE 1508010 = 116 (0.710)intergenic (‑435/+40) ald1/ypcP Alanine dehydrogenase 1/5'‑3' exonuclease
* ? USA300TCH1516_ALE 1523558 =198 (0.970)26 (0.140) 14/150 NT 12.5% intergenic (‑251/+77) dnaD/asnS DNA replication protein DnaD/Asparagine‑‑tRNA ligase
?USA300TCH1516_ALE 1523591 = 180 (0.940)intergenic (‑284/+44) dnaD/asnS DNA replication protein DnaD/Asparagine‑‑tRNA ligase
* ? USA300TCH1516_ALE 1594137 =205 (1.010)11 (0.060) 7/146 NT 6.2% coding (135/243 nt) USA300HOU_RS07845 hypothetical protein
?USA300TCH1516_ALE 1594171 = 144 (0.780)coding (101/243 nt) USA300HOU_RS07845 hypothetical protein
* ? USA300TCH1516_ALE = 1601454NA (NA)11 (0.060) 8/146 NT 100% coding (139/177 nt) USA300TCH1516_01480 hypothetical protein
?USA300TCH1516_ALE = 1601498 0 (0.000)coding (95/177 nt) USA300TCH1516_01480 hypothetical protein
* ? USA300TCH1516_ALE = 1608653150 (0.740)7 (0.040) 5/142 NT 5.0% coding (224/930 nt) USA300HOU_RS07970 hypothetical protein
?USA300TCH1516_ALE = 1608670 NA (NA)coding (207/930 nt) USA300HOU_RS07970 hypothetical protein
* ? USA300TCH1516_ALE 1614319 =217 (1.070)17 (0.090) 8/150 NT 8.1% intergenic (+14/+64) USA300HOU_RS08000/xerD_3 hypothetical protein/Tyrosine recombinase XerD
?USA300TCH1516_ALE 1614368 = 181 (0.950)intergenic (+63/+15) USA300HOU_RS08000/xerD_3 hypothetical protein/Tyrosine recombinase XerD
* ? USA300TCH1516_ALE = 1616458169 (0.830)10 (0.050) 9/144 NT 5.6% intergenic (‑43/‑39) nudF/yhdN_2 ADP‑ribose pyrophosphatase/General stress protein 69
?USA300TCH1516_ALE = 1616473 184 (1.000)intergenic (‑58/‑24) nudF/yhdN_2 ADP‑ribose pyrophosphatase/General stress protein 69
* ? USA300TCH1516_ALE = 1619608153 (0.750)9 (0.050) 6/148 NT 5.3% intergenic (+11/+94) proC/rnz Pyrroline‑5‑carboxylate reductase/Ribonuclease Z
?USA300TCH1516_ALE = 1619646 181 (0.960)intergenic (+49/+56) proC/rnz Pyrroline‑5‑carboxylate reductase/Ribonuclease Z
* ? USA300TCH1516_ALE = 1627039173 (0.850)20 (0.110) 12/140 NT 10.9% intergenic (‑192/+27) USA300HOU_RS08070/gnd hypothetical protein/6‑phosphogluconate dehydrogenase, decarboxylating
?USA300TCH1516_ALE = 1627047 176 (0.990)intergenic (‑200/+19) USA300HOU_RS08070/gnd hypothetical protein/6‑phosphogluconate dehydrogenase, decarboxylating
* ? USA300TCH1516_ALE 1647574 =234 (1.150)28 (0.150) 8/148 NT 12.9% intergenic (+4/+60) USA300HOU_RS08180/lipM hypothetical protein/Octanoyltransferase LipM
?USA300TCH1516_ALE 1647624 = 161 (0.860)intergenic (+54/+10) USA300HOU_RS08180/lipM hypothetical protein/Octanoyltransferase LipM
* ? USA300TCH1516_ALE 1660020 =232 (1.140)25 (0.140) 9/138 NT 11.9% coding (1289/1464 nt) gluP Rhomboid protease GluP
?USA300TCH1516_ALE 1660066 = 172 (0.980)coding (1243/1464 nt) gluP Rhomboid protease GluP
* ? USA300TCH1516_ALE 1662000 =282 (1.380)28 (0.160) 18/136 NT 11.9% intergenic (‑87/+68) USA300HOU_RS08275/rpmG2_2 5‑formyltetrahydrofolate cyclo‑ligase/50S ribosomal protein L33 2
?USA300TCH1516_ALE 1662039 = 177 (1.020)intergenic (‑126/+29) USA300HOU_RS08275/rpmG2_2 5‑formyltetrahydrofolate cyclo‑ligase/50S ribosomal protein L33 2
* ? USA300TCH1516_ALE 1665337 =88 (0.430)28 (0.200) 9/108 NT 32.7% intergenic (‑212/+65) sodA/zur Superoxide dismutase [Mn] 1/Zinc‑specific metallo‑regulatory protein
?USA300TCH1516_ALE 1665405 = 56 (0.410)coding (408/411 nt) zur Zinc‑specific metallo‑regulatory protein
* ? USA300TCH1516_ALE = 166536283 (0.410)20 (0.150) 9/108 NT 26.4% intergenic (‑237/+40) sodA/zur Superoxide dismutase [Mn] 1/Zinc‑specific metallo‑regulatory protein
?USA300TCH1516_ALE = 1665378 56 (0.410)intergenic (‑253/+24) sodA/zur Superoxide dismutase [Mn] 1/Zinc‑specific metallo‑regulatory protein
* ? USA300TCH1516_ALE 1671778 =204 (1.000)24 (0.130) 11/146 NT 12.8% intergenic (‑23/+108) trmK/sigA tRNA (adenine(22)‑N(1))‑methyltransferase/RNA polymerase sigma factor SigA
?USA300TCH1516_ALE 1671809 = 142 (0.760)intergenic (‑54/+77) trmK/sigA tRNA (adenine(22)‑N(1))‑methyltransferase/RNA polymerase sigma factor SigA
* ? USA300TCH1516_ALE = 1676788167 (0.820)15 (0.080) 8/156 NT 8.7% intergenic (‑344/‑75) ccpN/glyQS Transcriptional repressor CcpN/Glycine‑‑tRNA ligase
?USA300TCH1516_ALE = 1676835 154 (0.780)intergenic (‑391/‑28) ccpN/glyQS Transcriptional repressor CcpN/Glycine‑‑tRNA ligase
* ? USA300TCH1516_ALE = 1678311179 (0.880)18 (0.110) 9/132 NT 9.9% intergenic (+57/+93) glyQS/recO Glycine‑‑tRNA ligase/DNA repair protein RecO
?USA300TCH1516_ALE = 1678323 179 (1.070)intergenic (+69/+81) glyQS/recO Glycine‑‑tRNA ligase/DNA repair protein RecO
* ? USA300TCH1516_ALE 1682514 =188 (0.920)21 (0.120) 11/140 NT 11.3% intergenic (‑259/+45) USA300HOU_RS08380/USA300HOU_RS08385 PhoH‑like protein/hypothetical protein
?USA300TCH1516_ALE 1682550 = 164 (0.920)intergenic (‑295/+9) USA300HOU_RS08380/USA300HOU_RS08385 PhoH‑like protein/hypothetical protein
* ? USA300TCH1516_ALE = 1682523194 (0.950)24 (0.130) 13/140 NT 12.6% intergenic (‑268/+36) USA300HOU_RS08380/USA300HOU_RS08385 PhoH‑like protein/hypothetical protein
?USA300TCH1516_ALE = 1682539 164 (0.920)intergenic (‑284/+20) USA300HOU_RS08380/USA300HOU_RS08385 PhoH‑like protein/hypothetical protein
* ? USA300TCH1516_ALE = 1689934183 (0.900)11 (0.060) 9/150 NT 5.5% intergenic (‑69/+67) dnaJ/dnaK Chaperone protein DnaJ/Chaperone protein DnaK
?USA300TCH1516_ALE = 1689961 205 (1.070)intergenic (‑96/+40) dnaJ/dnaK Chaperone protein DnaJ/Chaperone protein DnaK
* ? USA300TCH1516_ALE = 1695186204 (1.000)12 (0.070) 4/142 NT 6.5% intergenic (‑392/+138) hemN_1/lepA Oxygen‑independent coproporphyrinogen‑III oxidase‑like protein YqeR/Elongation factor 4
?USA300TCH1516_ALE 1873591 = 163 (0.900)intergenic (‑267/+483) USA300HOU_RS09300/USA300HOU_RS09305 Putative dipeptidase/hypothetical protein
* ? USA300TCH1516_ALE 1702257 =169 (0.830)17 (0.100) 10/138 NT 10.4% intergenic (‑1/+48) comEA/tylM1 ComE operon protein 1/dTDP‑3‑amino‑3,6‑dideoxy‑alpha‑D‑glucopyranose N,N‑dimethyltransferase
?USA300TCH1516_ALE 1702302 = 148 (0.840)intergenic (‑46/+3) comEA/tylM1 ComE operon protein 1/dTDP‑3‑amino‑3,6‑dideoxy‑alpha‑D‑glucopyranose N,N‑dimethyltransferase
* ? USA300TCH1516_ALE = 1702267173 (0.850)11 (0.060) 6/138 NT 6.9% intergenic (‑11/+38) comEA/tylM1 ComE operon protein 1/dTDP‑3‑amino‑3,6‑dideoxy‑alpha‑D‑glucopyranose N,N‑dimethyltransferase
?USA300TCH1516_ALE = 1702290 148 (0.840)intergenic (‑34/+15) comEA/tylM1 ComE operon protein 1/dTDP‑3‑amino‑3,6‑dideoxy‑alpha‑D‑glucopyranose N,N‑dimethyltransferase
* ? USA300TCH1516_ALE 1708636 =216 (1.060)21 (0.130) 12/132 NT 10.3% intergenic (+81/+121) USA300HOU_RS08530/entA_3 hypothetical protein/Enterotoxin type A
?USA300TCH1516_ALE 1708685 = 189 (1.130)intergenic (+130/+72) USA300HOU_RS08530/entA_3 hypothetical protein/Enterotoxin type A
* ? USA300TCH1516_ALE = 1708649214 (1.050)12 (0.070) 6/132 NT 6.2% intergenic (+94/+108) USA300HOU_RS08530/entA_3 hypothetical protein/Enterotoxin type A
?USA300TCH1516_ALE = 1708670 189 (1.130)intergenic (+115/+87) USA300HOU_RS08530/entA_3 hypothetical protein/Enterotoxin type A
* ? USA300TCH1516_ALE 1728897 =221 (1.080)13 (0.070) 8/138 NT 7.0% intergenic (‑131/+331) yrrB/mnmA TPR repeat‑containing protein YrrB/tRNA‑specific 2‑thiouridylase MnmA
?USA300TCH1516_ALE 1728932 = 153 (0.870)intergenic (‑166/+296) yrrB/mnmA TPR repeat‑containing protein YrrB/tRNA‑specific 2‑thiouridylase MnmA
* ? USA300TCH1516_ALE = 1731936179 (0.880)10 (0.060) 4/142 NT 5.5% coding (136/1014 nt) limB_2 Limonene 1,2‑monooxygenase
?USA300TCH1516_ALE = 1731960 185 (1.020)coding (160/1014 nt) limB_2 Limonene 1,2‑monooxygenase
* ? USA300TCH1516_ALE 1732959 =151 (0.740)13 (0.080) 7/136 NT 8.8% intergenic (+145/+92) limB_2/USA300HOU_RS08645 Limonene 1,2‑monooxygenase/hypothetical protein
?USA300TCH1516_ALE 1733016 = 141 (0.820)intergenic (+202/+35) limB_2/USA300HOU_RS08645 Limonene 1,2‑monooxygenase/hypothetical protein
* ? USA300TCH1516_ALE = 1732970145 (0.710)10 (0.060) 6/136 NT 7.0% intergenic (+156/+81) limB_2/USA300HOU_RS08645 Limonene 1,2‑monooxygenase/hypothetical protein
?USA300TCH1516_ALE = 1733003 141 (0.820)intergenic (+189/+48) limB_2/USA300HOU_RS08645 Limonene 1,2‑monooxygenase/hypothetical protein
* ? USA300TCH1516_ALE = 1747135174 (0.850)24 (0.140) 12/132 NT 13.7% intergenic (‑169/+34) recJ/USA300HOU_RS08710 Single‑stranded‑DNA‑specific exonuclease RecJ/Heme uptake protein MmpL11
?USA300TCH1516_ALE = 1747146 159 (0.950)intergenic (‑180/+23) recJ/USA300HOU_RS08710 Single‑stranded‑DNA‑specific exonuclease RecJ/Heme uptake protein MmpL11
* ? USA300TCH1516_ALE 1755658 =146 (0.720)18 (0.100) 11/142 NT 11.8% intergenic (‑55/+300) obg/rpmA GTPase Obg/50S ribosomal protein L27
?USA300TCH1516_ALE 1755694 = 140 (0.780)intergenic (‑91/+264) obg/rpmA GTPase Obg/50S ribosomal protein L27
* ? USA300TCH1516_ALE = 1755666150 (0.740)17 (0.090) 9/142 NT 11.1% intergenic (‑63/+292) obg/rpmA GTPase Obg/50S ribosomal protein L27
?USA300TCH1516_ALE = 1755684 140 (0.780)intergenic (‑81/+274) obg/rpmA GTPase Obg/50S ribosomal protein L27
* ? USA300TCH1516_ALE = 1759680163 (0.800)16 (0.100) 11/132 NT 10.6% intergenic (‑387/+87) USA300HOU_RS08780/USA300HOU_RS08785 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 1759708 136 (0.810)intergenic (‑415/+59) USA300HOU_RS08780/USA300HOU_RS08785 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 1772785176 (0.860)19 (0.110) 13/142 NT 10.4% coding (148/816 nt) USA300HOU_RS08850 hypothetical protein
?USA300TCH1516_ALE = 1772792 172 (0.950)coding (141/816 nt) USA300HOU_RS08850 hypothetical protein
* ? USA300TCH1516_ALE 1775185 =146 (0.720)16 (0.090) 7/142 NT 10.4% intergenic (‑78/+76) engB/clpX putative GTP‑binding protein EngB/ATP‑dependent Clp protease ATP‑binding subunit ClpX
?USA300TCH1516_ALE 1775239 = 146 (0.810)intergenic (‑132/+22) engB/clpX putative GTP‑binding protein EngB/ATP‑dependent Clp protease ATP‑binding subunit ClpX
* ? USA300TCH1516_ALE = 1775193141 (0.690)13 (0.070) 9/142 NT 8.8% intergenic (‑86/+68) engB/clpX putative GTP‑binding protein EngB/ATP‑dependent Clp protease ATP‑binding subunit ClpX
?USA300TCH1516_ALE = 1775229 146 (0.810)intergenic (‑122/+32) engB/clpX putative GTP‑binding protein EngB/ATP‑dependent Clp protease ATP‑binding subunit ClpX
* ? USA300TCH1516_ALE 1782814 =186 (0.910)9 (0.050) 7/146 NT 5.5% intergenic (‑97/+329) lysP_2/thrS Lysine‑specific permease/Threonine‑‑tRNA ligase
?USA300TCH1516_ALE 1782851 = 142 (0.760)intergenic (‑134/+292) lysP_2/thrS Lysine‑specific permease/Threonine‑‑tRNA ligase
* ? USA300TCH1516_ALE 1789630 =223 (1.090)12 (0.070) 8/138 NT 6.6% intergenic (‑111/+59) gapA2/coaE Glyceraldehyde‑3‑phosphate dehydrogenase 2/Dephospho‑CoA kinase
?USA300TCH1516_ALE 1789673 = 149 (0.850)intergenic (‑154/+16) gapA2/coaE Glyceraldehyde‑3‑phosphate dehydrogenase 2/Dephospho‑CoA kinase
* ? USA300TCH1516_ALE = 1822873144 (0.710)15 (0.080) 8/142 NT 9.6% intergenic (+194/+52) USA300HOU_RS09070/ackA Putative universal stress protein/Acetate kinase
?USA300TCH1516_ALE = 1822899 154 (0.850)intergenic (+220/+26) USA300HOU_RS09070/ackA Putative universal stress protein/Acetate kinase
* ? USA300TCH1516_ALE 1834059 =150 (0.740)17 (0.100) 7/138 NT 11.6% intergenic (+8/‑106) osmC/USA300HOU_RS09140 Peroxiredoxin OsmC/Soluble hydrogenase 42 kDa subunit
?USA300TCH1516_ALE 1834098 = 130 (0.740)intergenic (+47/‑67) osmC/USA300HOU_RS09140 Peroxiredoxin OsmC/Soluble hydrogenase 42 kDa subunit
* ? USA300TCH1516_ALE = 1834069142 (0.700)8 (0.050) 5/138 NT 6.0% intergenic (+18/‑96) osmC/USA300HOU_RS09140 Peroxiredoxin OsmC/Soluble hydrogenase 42 kDa subunit
?USA300TCH1516_ALE = 1834086 130 (0.740)intergenic (+35/‑79) osmC/USA300HOU_RS09140 Peroxiredoxin OsmC/Soluble hydrogenase 42 kDa subunit
* ? USA300TCH1516_ALE 1836934 =134 (0.660)22 (0.130) 10/132 NT 16.5% intergenic (+18/+132) serA/gph_2 D‑3‑phosphoglycerate dehydrogenase/Phosphoglycolate phosphatase
?USA300TCH1516_ALE 1836982 = 112 (0.670)intergenic (+66/+84) serA/gph_2 D‑3‑phosphoglycerate dehydrogenase/Phosphoglycolate phosphatase
* ? USA300TCH1516_ALE = 1836947134 (0.660)22 (0.130) 12/132 NT 16.5% intergenic (+31/+119) serA/gph_2 D‑3‑phosphoglycerate dehydrogenase/Phosphoglycolate phosphatase
?USA300TCH1516_ALE = 1836967 112 (0.670)intergenic (+51/+99) serA/gph_2 D‑3‑phosphoglycerate dehydrogenase/Phosphoglycolate phosphatase
* ? USA300TCH1516_ALE 1838254 =172 (0.840)21 (0.120) 10/140 NT 12.4% intergenic (‑58/+49) gph_2/nagE Phosphoglycolate phosphatase/PTS system N‑acetylglucosamine‑specific EIICBA component
?USA300TCH1516_ALE 1838290 = 147 (0.830)intergenic (‑94/+13) gph_2/nagE Phosphoglycolate phosphatase/PTS system N‑acetylglucosamine‑specific EIICBA component
* ? USA300TCH1516_ALE = 1838263164 (0.810)26 (0.150) 10/140 NT 15.2% intergenic (‑67/+40) gph_2/nagE Phosphoglycolate phosphatase/PTS system N‑acetylglucosamine‑specific EIICBA component
?USA300TCH1516_ALE = 1838279 147 (0.830)intergenic (‑83/+24) gph_2/nagE Phosphoglycolate phosphatase/PTS system N‑acetylglucosamine‑specific EIICBA component
* ? USA300TCH1516_ALE 1841984 =128 (0.630)22 (0.130) 6/134 NT 17.9% intergenic (+24/+70) htrA/tyrS Serine protease Do‑like HtrA/Tyrosine‑‑tRNA ligase
?USA300TCH1516_ALE 1842029 = 95 (0.560)intergenic (+69/+25) htrA/tyrS Serine protease Do‑like HtrA/Tyrosine‑‑tRNA ligase
* ? USA300TCH1516_ALE = 1841996129 (0.630)23 (0.140) 7/134 NT 18.5% intergenic (+36/+58) htrA/tyrS Serine protease Do‑like HtrA/Tyrosine‑‑tRNA ligase
?USA300TCH1516_ALE = 1842015 95 (0.560)intergenic (+55/+39) htrA/tyrS Serine protease Do‑like HtrA/Tyrosine‑‑tRNA ligase
* ? USA300TCH1516_ALE 1844653 =249 (1.220)12 (0.070) 9/142 NT 5.7% intergenic (+50/+153) mrcA/isdH Penicillin‑binding protein 1A/Iron‑regulated surface determinant protein H
?USA300TCH1516_ALE 1844699 = 176 (0.980)intergenic (+96/+107) mrcA/isdH Penicillin‑binding protein 1A/Iron‑regulated surface determinant protein H
* ? USA300TCH1516_ALE 1856910 =248 (1.220)23 (0.130) 11/144 NT 9.8% intergenic (‑595/+105) aroF/USA300HOU_RS09235 Phospho‑2‑dehydro‑3‑deoxyheptonate aldolase/hypothetical protein
?USA300TCH1516_ALE 1856940 = 199 (1.090)intergenic (‑625/+75) aroF/USA300HOU_RS09235 Phospho‑2‑dehydro‑3‑deoxyheptonate aldolase/hypothetical protein
* ? USA300TCH1516_ALE 1858390 =114 (0.560)19 (0.120) 10/126 NT 15.3% intergenic (‑17/+57) USA300HOU_RS09235/USA300HOU_RS09240 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 1858437 = 121 (0.760)intergenic (‑64/+10) USA300HOU_RS09235/USA300HOU_RS09240 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 1858406122 (0.600)17 (0.110) 8/126 NT 13.6% intergenic (‑33/+41) USA300HOU_RS09235/USA300HOU_RS09240 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 1858419 121 (0.760)intergenic (‑46/+28) USA300HOU_RS09235/USA300HOU_RS09240 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 1867671 =166 (0.810)17 (0.090) 10/142 NT 9.7% intergenic (+45/+80) USA300HOU_RS09275/ytnP hypothetical protein/putative quorum‑quenching lactonase YtnP
?USA300TCH1516_ALE 1867709 = 170 (0.940)intergenic (+83/+42) USA300HOU_RS09275/ytnP hypothetical protein/putative quorum‑quenching lactonase YtnP
* ? USA300TCH1516_ALE = 1867679174 (0.850)16 (0.090) 10/142 NT 9.0% intergenic (+53/+72) USA300HOU_RS09275/ytnP hypothetical protein/putative quorum‑quenching lactonase YtnP
?USA300TCH1516_ALE = 1867699 170 (0.940)intergenic (+73/+52) USA300HOU_RS09275/ytnP hypothetical protein/putative quorum‑quenching lactonase YtnP
* ? USA300TCH1516_ALE 1868935 =198 (0.970)16 (0.090) 7/142 NT 8.3% intergenic (‑342/+128) ytnP/trmB putative quorum‑quenching lactonase YtnP/tRNA (guanine‑N(7)‑)‑methyltransferase
?USA300TCH1516_ALE 1868982 = 180 (1.000)intergenic (‑389/+81) ytnP/trmB putative quorum‑quenching lactonase YtnP/tRNA (guanine‑N(7)‑)‑methyltransferase
* ? USA300TCH1516_ALE = 1868943198 (0.970)16 (0.090) 7/142 NT 8.3% intergenic (‑350/+120) ytnP/trmB putative quorum‑quenching lactonase YtnP/tRNA (guanine‑N(7)‑)‑methyltransferase
?USA300TCH1516_ALE = 1868972 180 (1.000)intergenic (‑379/+91) ytnP/trmB putative quorum‑quenching lactonase YtnP/tRNA (guanine‑N(7)‑)‑methyltransferase
* ? USA300TCH1516_ALE 1870541 =223 (1.090)24 (0.130) 15/144 NT 10.4% intergenic (‑28/+522) srkA/dat Stress response kinase A/D‑alanine aminotransferase
?USA300TCH1516_ALE 1870573 = 213 (1.160)intergenic (‑60/+490) srkA/dat Stress response kinase A/D‑alanine aminotransferase
* ? USA300TCH1516_ALE 1878597 =148 (0.730)12 (0.080) 8/124 NT 9.8% intergenic (+56/+61) USA300HOU_RS09320/ebh_2 Ferredoxin‑‑NADP reductase/Extracellular matrix‑binding protein ebh
?USA300TCH1516_ALE 1878652 = 106 (0.670)intergenic (+111/+6) USA300HOU_RS09320/ebh_2 Ferredoxin‑‑NADP reductase/Extracellular matrix‑binding protein ebh
* ? USA300TCH1516_ALE = 1895575168 (0.820)16 (0.090) 9/142 NT 9.0% intergenic (+27/+95) putB/ribH Proline dehydrogenase 2/6,7‑dimethyl‑8‑ribityllumazine synthase
?USA300TCH1516_ALE = 1895601 174 (0.960)intergenic (+53/+69) putB/ribH Proline dehydrogenase 2/6,7‑dimethyl‑8‑ribityllumazine synthase
* ? USA300TCH1516_ALE 1901310 =177 (0.870)18 (0.100) 9/142 NT 10.3% intergenic (‑306/‑217) USA300HOU_RS09405/sdpR hypothetical protein/Transcriptional repressor SdpR
?USA300TCH1516_ALE 1901351 = 157 (0.870)intergenic (‑347/‑176) USA300HOU_RS09405/sdpR hypothetical protein/Transcriptional repressor SdpR
* ? USA300TCH1516_ALE = 1901318173 (0.850)45 (0.250) 14/142 NT 22.5% intergenic (‑314/‑209) USA300HOU_RS09405/sdpR hypothetical protein/Transcriptional repressor SdpR
?USA300TCH1516_ALE = 1901341 157 (0.870)intergenic (‑337/‑186) USA300HOU_RS09405/sdpR hypothetical protein/Transcriptional repressor SdpR
* ? USA300TCH1516_ALE 1904457 =247 (1.210)24 (0.130) 15/146 NT 9.8% coding (239/855 nt) atl_2 Bifunctional autolysin
?USA300TCH1516_ALE 1904477 = 217 (1.170)coding (219/855 nt) atl_2 Bifunctional autolysin
* ? USA300TCH1516_ALE 1908173 =237 (1.160)27 (0.140) 16/148 NT 11.3% intergenic (+392/+48) USA300HOU_RS09450/tal hypothetical protein/Transaldolase
?USA300TCH1516_ALE 1908206 = 206 (1.090)intergenic (+425/+15) USA300HOU_RS09450/tal hypothetical protein/Transaldolase
* ? USA300TCH1516_ALE 1911750 =135 (0.660)14 (0.070) 5/148 NT 10.1% coding (729/825 nt) USA300TCH1516_01771 hypothetical protein
?USA300TCH1516_ALE 2318662 = NA (NA)coding (42/300 nt) USA300HOU_RS12765 hypothetical protein
* ? USA300TCH1516_ALE 1911930 =183 (0.900)8 (0.040) 3/142 NT 6.4% coding (52/609 nt) USA300HOU_RS15290 hypothetical protein
?USA300TCH1516_ALE 2318846 = 73 (0.400)coding (226/300 nt) USA300HOU_RS12765 hypothetical protein
* ? USA300TCH1516_ALE = 1928296216 (1.060)12 (0.070) 9/140 NT 5.4% intergenic (‑250/+51) USA300HOU_RS09565/USA300HOU_RS09575 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 1928318 228 (1.280)intergenic (‑272/+29) USA300HOU_RS09565/USA300HOU_RS09575 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 1939382168 (0.820)18 (0.100) 11/142 NT 10.7% intergenic (‑241/+122) hsdM_2/splF Type I restriction enzyme EcoKI M protein/Serine protease SplF
?USA300TCH1516_ALE = 1939405 151 (0.840)intergenic (‑264/+99) hsdM_2/splF Type I restriction enzyme EcoKI M protein/Serine protease SplF
* ? USA300TCH1516_ALE 1946068 =207 (1.020)12 (0.070) 5/142 NT 6.4% intergenic (+119/+355) USA300HOU_RS09665/USA300HOU_RS15380 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 1946105 = 165 (0.910)intergenic (+156/+318) USA300HOU_RS09665/USA300HOU_RS15380 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 1967716 =182 (0.890)13 (0.070) 6/146 NT 7.3% intergenic (+48/+76) traP/USA300HOU_RS09810 Signal transduction protein TRAP/hypothetical protein
?USA300TCH1516_ALE 1967758 = 165 (0.890)intergenic (+90/+34) traP/USA300HOU_RS09810 Signal transduction protein TRAP/hypothetical protein
* ? USA300TCH1516_ALE 1970888 =209 (1.030)25 (0.140) 13/142 NT 11.6% intergenic (+77/‑656) USA300HOU_RS09825/USA300HOU_RS09830 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 1970925 = 197 (1.090)intergenic (+114/‑619) USA300HOU_RS09825/USA300HOU_RS09830 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 1970896206 (1.010)14 (0.080) 9/142 NT 6.9% intergenic (+85/‑648) USA300HOU_RS09825/USA300HOU_RS09830 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 1970915 197 (1.090)intergenic (+104/‑629) USA300HOU_RS09825/USA300HOU_RS09830 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 1980867 =172 (0.840)16 (0.090) 8/140 NT 9.4% intergenic (‑109/+70) USA300HOU_RS09865/USA300HOU_RS09870 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 1980913 = 158 (0.890)intergenic (‑155/+24) USA300HOU_RS09865/USA300HOU_RS09870 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 1980876169 (0.830)17 (0.100) 6/140 NT 10.0% intergenic (‑118/+61) USA300HOU_RS09865/USA300HOU_RS09870 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 1980902 158 (0.890)intergenic (‑144/+35) USA300HOU_RS09865/USA300HOU_RS09870 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 1990341 =192 (0.940)13 (0.080) 7/124 NT 9.5% intergenic (‑90/+61) queG/tcyC_1 Epoxyqueuosine reductase/L‑cystine import ATP‑binding protein TcyC
?USA300TCH1516_ALE 1990392 = 98 (0.620)intergenic (‑141/+10) queG/tcyC_1 Epoxyqueuosine reductase/L‑cystine import ATP‑binding protein TcyC
* ? USA300TCH1516_ALE 2008942 =157 (0.770)16 (0.100) 7/132 NT 10.5% intergenic (+70/+121) USA300HOU_RS10115/USA300HOU_RS10125 hypothetical protein/Putative multidrug export ATP‑binding/permease protein
?USA300TCH1516_ALE 2008991 = 145 (0.870)intergenic (+119/+72) USA300HOU_RS10115/USA300HOU_RS10125 hypothetical protein/Putative multidrug export ATP‑binding/permease protein
* ? USA300TCH1516_ALE 2021453 =159 (0.780)12 (0.070) 6/140 NT 7.1% intergenic (+12/+248) queE_2/USA300HOU_RS10190 7‑carboxy‑7‑deazaguanine synthase/putative acyl‑CoA thioester hydrolase
?USA300TCH1516_ALE 2021493 = 174 (0.980)intergenic (+52/+208) queE_2/USA300HOU_RS10190 7‑carboxy‑7‑deazaguanine synthase/putative acyl‑CoA thioester hydrolase
* ? USA300TCH1516_ALE = 2021462164 (0.810)13 (0.070) 8/140 NT 7.6% intergenic (+21/+239) queE_2/USA300HOU_RS10190 7‑carboxy‑7‑deazaguanine synthase/putative acyl‑CoA thioester hydrolase
?USA300TCH1516_ALE = 2021482 174 (0.980)intergenic (+41/+219) queE_2/USA300HOU_RS10190 7‑carboxy‑7‑deazaguanine synthase/putative acyl‑CoA thioester hydrolase
* ? USA300TCH1516_ALE = 2041621207 (1.020)17 (0.100) 9/138 NT 7.7% intergenic (‑704/+65) dagK/gatB_2 Diacylglycerol kinase/Aspartyl/glutamyl‑tRNA(Asn/Gln) amidotransferase subunit B
?USA300TCH1516_ALE = 2041645 230 (1.310)intergenic (‑728/+41) dagK/gatB_2 Diacylglycerol kinase/Aspartyl/glutamyl‑tRNA(Asn/Gln) amidotransferase subunit B
* ? USA300TCH1516_ALE 2053744 =215 (1.060)37 (0.190) 16/150 NT 15.9% coding (1116/1296 nt) purB Adenylosuccinate lyase
?USA300TCH1516_ALE 2053767 = 189 (0.990)coding (1093/1296 nt) purB Adenylosuccinate lyase
* ? USA300TCH1516_ALE 2057377 =198 (0.970)27 (0.150) 13/138 NT 16.3% intergenic (+134/+158) USA300HOU_RS10370/USA300HOU_RS10375 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 2057415 = 106 (0.600)intergenic (+172/+120) USA300HOU_RS10370/USA300HOU_RS10375 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 2057471172 (0.840)14 (0.080) 7/132 NT 7.7% intergenic (+228/+64) USA300HOU_RS10370/USA300HOU_RS10375 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 2057483 196 (1.170)intergenic (+240/+52) USA300HOU_RS10370/USA300HOU_RS10375 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 2067939221 (1.080)14 (0.080) 8/138 NT 6.1% intergenic (+52/‑368) ppaC/mdlD putative manganese‑dependent inorganic pyrophosphatase/NAD(P)‑dependent benzaldehyde dehydrogenase
?USA300TCH1516_ALE = 2067962 239 (1.360)intergenic (+75/‑345) ppaC/mdlD putative manganese‑dependent inorganic pyrophosphatase/NAD(P)‑dependent benzaldehyde dehydrogenase
* ? USA300TCH1516_ALE 2082368 =234 (1.150)16 (0.090) 9/138 NT 8.0% intergenic (+9/+315) aspC/USA300HOU_RS10520 Aspartate aminotransferase/65 kDa membrane protein
?USA300TCH1516_ALE 2082406 = 167 (0.950)intergenic (+47/+277) aspC/USA300HOU_RS10520 Aspartate aminotransferase/65 kDa membrane protein
* ? USA300TCH1516_ALE 2082519 =234 (1.150)11 (0.060) 7/142 NT 5.3% intergenic (+160/+164) aspC/USA300HOU_RS10520 Aspartate aminotransferase/65 kDa membrane protein
?USA300TCH1516_ALE 2082566 = 187 (1.040)intergenic (+207/+117) aspC/USA300HOU_RS10520 Aspartate aminotransferase/65 kDa membrane protein
* ? USA300TCH1516_ALE 2082639 =204 (1.000)29 (0.150) 12/148 NT 12.8% intergenic (+280/+44) aspC/USA300HOU_RS10520 Aspartate aminotransferase/65 kDa membrane protein
?USA300TCH1516_ALE 2082667 = 207 (1.100)intergenic (+308/+16) aspC/USA300HOU_RS10520 Aspartate aminotransferase/65 kDa membrane protein
* ? USA300TCH1516_ALE = 2088038191 (0.940)22 (0.140) 13/126 NT 11.6% intergenic (+55/+40) chp/USA300HOU_RS10560 Chemotaxis inhibitory protein/Glycyl‑glycine endopeptidase ALE‑1
?USA300TCH1516_ALE = 2088052 185 (1.160)intergenic (+69/+26) chp/USA300HOU_RS10560 Chemotaxis inhibitory protein/Glycyl‑glycine endopeptidase ALE‑1
* ? USA300TCH1516_ALE = 2090954191 (0.940)15 (0.080) 6/142 NT 8.0% intergenic (‑188/+350) USA300HOU_RS10575/USA300HOU_RS10590 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 2090971 177 (0.980)intergenic (‑205/+333) USA300HOU_RS10575/USA300HOU_RS10590 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 2141638 =203 (1.000)13 (0.070) 7/148 NT 6.8% coding (450/1617 nt) groL 60 kDa chaperonin
?USA300TCH1516_ALE 2141666 = 168 (0.890)coding (422/1617 nt) groL 60 kDa chaperonin
* ? USA300TCH1516_ALE 2141814 =179 (0.880)17 (0.090) 11/152 NT 8.7% coding (274/1617 nt) groL 60 kDa chaperonin
?USA300TCH1516_ALE 2141841 = 187 (0.970)coding (247/1617 nt) groL 60 kDa chaperonin
* ? USA300TCH1516_ALE 2142773 =195 (0.960)18 (0.100) 10/148 NT 9.4% coding (152/744 nt) USA300HOU_RS10935 hypothetical protein
?USA300TCH1516_ALE 2142794 = 167 (0.890)coding (173/744 nt) USA300HOU_RS10935 hypothetical protein
* ? USA300TCH1516_ALE 2143370 =137 (0.670)11 (0.070) 8/132 NT 9.0% intergenic (+5/+20) USA300HOU_RS10935/USA300HOU_RS10940 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 2143414 = 109 (0.650)coding (1230/1254 nt) USA300HOU_RS10940 hypothetical protein
* ? USA300TCH1516_ALE = 2143383129 (0.630)22 (0.130) 11/132 NT 17.0% intergenic (+18/+7) USA300HOU_RS10935/USA300HOU_RS10940 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 2143399 109 (0.650)coding (1245/1254 nt) USA300HOU_RS10940 hypothetical protein
* ? USA300TCH1516_ALE 2150647 =177 (0.870)19 (0.110) 11/136 NT 10.9% intergenic (+310/+57) agrA/scrK Accessory gene regulator A/Fructokinase
?USA300TCH1516_ALE 2150691 = 161 (0.930)intergenic (+354/+13) agrA/scrK Accessory gene regulator A/Fructokinase
* ? USA300TCH1516_ALE 2160376 =178 (0.870)14 (0.080) 7/136 NT 8.2% intergenic (+9/‑352) yheS/mutS_2 putative ABC transporter ATP‑binding protein YheS/DNA mismatch repair protein MutS
?USA300TCH1516_ALE 2160413 = 163 (0.940)intergenic (+46/‑315) yheS/mutS_2 putative ABC transporter ATP‑binding protein YheS/DNA mismatch repair protein MutS
* ? USA300TCH1516_ALE = 2160387177 (0.870)13 (0.080) 10/136 NT 7.7% intergenic (+20/‑341) yheS/mutS_2 putative ABC transporter ATP‑binding protein YheS/DNA mismatch repair protein MutS
?USA300TCH1516_ALE = 2160400 163 (0.940)intergenic (+33/‑328) yheS/mutS_2 putative ABC transporter ATP‑binding protein YheS/DNA mismatch repair protein MutS
* ? USA300TCH1516_ALE 2201275 =169 (0.830)13 (0.080) 10/136 NT 8.5% intergenic (+5/+364) kdpE/cshA KDP operon transcriptional regulatory protein KdpE/DEAD‑box ATP‑dependent RNA helicase CshA
?USA300TCH1516_ALE 2201326 = 135 (0.780)intergenic (+56/+313) kdpE/cshA KDP operon transcriptional regulatory protein KdpE/DEAD‑box ATP‑dependent RNA helicase CshA
* ? USA300TCH1516_ALE = 2201286162 (0.800)12 (0.070) 10/136 NT 8.1% intergenic (+16/+353) kdpE/cshA KDP operon transcriptional regulatory protein KdpE/DEAD‑box ATP‑dependent RNA helicase CshA
?USA300TCH1516_ALE = 2201313 135 (0.780)intergenic (+43/+326) kdpE/cshA KDP operon transcriptional regulatory protein KdpE/DEAD‑box ATP‑dependent RNA helicase CshA
* ? USA300TCH1516_ALE 2218211 =156 (0.770)13 (0.080) 8/124 NT 9.2% intergenic (+4/+55) USA300HOU_RS11330/fabZ hypothetical protein/3‑hydroxyacyl‑[acyl‑carrier‑protein] dehydratase FabZ
?USA300TCH1516_ALE 2218261 = 135 (0.860)intergenic (+54/+5) USA300HOU_RS11330/fabZ hypothetical protein/3‑hydroxyacyl‑[acyl‑carrier‑protein] dehydratase FabZ
* ? USA300TCH1516_ALE = 2218228156 (0.770)14 (0.090) 10/124 NT 9.9% intergenic (+21/+38) USA300HOU_RS11330/fabZ hypothetical protein/3‑hydroxyacyl‑[acyl‑carrier‑protein] dehydratase FabZ
?USA300TCH1516_ALE = 2218242 135 (0.860)intergenic (+35/+24) USA300HOU_RS11330/fabZ hypothetical protein/3‑hydroxyacyl‑[acyl‑carrier‑protein] dehydratase FabZ
* ? USA300TCH1516_ALE 2236023 =136 (0.670)12 (0.070) 7/142 NT 8.5% intergenic (‑296/+51) tdk/rpmE2 Thymidine kinase/50S ribosomal protein L31 type B
?USA300TCH1516_ALE 2236061 = 138 (0.760)intergenic (‑334/+13) tdk/rpmE2 Thymidine kinase/50S ribosomal protein L31 type B
* ? USA300TCH1516_ALE = 2236031141 (0.690)10 (0.060) 6/142 NT 7.1% intergenic (‑304/+43) tdk/rpmE2 Thymidine kinase/50S ribosomal protein L31 type B
?USA300TCH1516_ALE = 2236051 138 (0.760)intergenic (‑324/+23) tdk/rpmE2 Thymidine kinase/50S ribosomal protein L31 type B
* ? USA300TCH1516_ALE 2241742 =215 (1.060)32 (0.180) 14/140 NT 15.3% intergenic (‑385/+81) murA2/fba UDP‑N‑acetylglucosamine 1‑carboxyvinyltransferase 2/Fructose‑bisphosphate aldolase
?USA300TCH1516_ALE 2241776 = 166 (0.930)intergenic (‑419/+47) murA2/fba UDP‑N‑acetylglucosamine 1‑carboxyvinyltransferase 2/Fructose‑bisphosphate aldolase
* ? USA300TCH1516_ALE 2245364 =180 (0.880)19 (0.100) 10/144 NT 10.7% intergenic (‑223/+113) pyrG/rpoE CTP synthase/putative DNA‑directed RNA polymerase subunit delta
?USA300TCH1516_ALE 2245398 = 154 (0.840)intergenic (‑257/+79) pyrG/rpoE CTP synthase/putative DNA‑directed RNA polymerase subunit delta
* ? USA300TCH1516_ALE = 2245371168 (0.820)11 (0.060) 6/144 NT 6.7% intergenic (‑230/+106) pyrG/rpoE CTP synthase/putative DNA‑directed RNA polymerase subunit delta
?USA300TCH1516_ALE = 2245389 154 (0.840)intergenic (‑248/+88) pyrG/rpoE CTP synthase/putative DNA‑directed RNA polymerase subunit delta
* ? USA300TCH1516_ALE 2248208 =209 (1.030)23 (0.120) 10/150 NT 10.9% intergenic (+2/+128) coaW/USA300HOU_RS11505 Type II pantothenate kinase/hypothetical protein
?USA300TCH1516_ALE 2248263 = 182 (0.950)intergenic (+57/+73) coaW/USA300HOU_RS11505 Type II pantothenate kinase/hypothetical protein
* ? USA300TCH1516_ALE 2256396 =157 (0.770)23 (0.140) 8/132 NT 13.7% intergenic (+49/+72) deoD1/dps Purine nucleoside phosphorylase DeoD‑type 1/General stress protein 20U
?USA300TCH1516_ALE 2256443 = 161 (0.960)intergenic (+96/+25) deoD1/dps Purine nucleoside phosphorylase DeoD‑type 1/General stress protein 20U
* ? USA300TCH1516_ALE = 2256409157 (0.770)18 (0.110) 9/132 NT 11.0% intergenic (+62/+59) deoD1/dps Purine nucleoside phosphorylase DeoD‑type 1/General stress protein 20U
?USA300TCH1516_ALE = 2256428 161 (0.960)intergenic (+81/+40) deoD1/dps Purine nucleoside phosphorylase DeoD‑type 1/General stress protein 20U
* ? USA300TCH1516_ALE 2259385 =215 (1.060)19 (0.110) 9/140 NT 9.8% intergenic (‑30/+642) USA300HOU_RS11560/USA300HOU_RS11565 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 2259420 = 162 (0.910)intergenic (‑65/+607) USA300HOU_RS11560/USA300HOU_RS11565 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 2263788 =241 (1.180)24 (0.150) 10/130 NT 11.5% intergenic (+8/‑258) czcD_2/USA300HOU_RS11590 Cadmium, cobalt and zinc/H(+)‑K(+) antiporter/hypothetical protein
?USA300TCH1516_ALE 2263834 = 174 (1.050)intergenic (+54/‑212) czcD_2/USA300HOU_RS11590 Cadmium, cobalt and zinc/H(+)‑K(+) antiporter/hypothetical protein
* ? USA300TCH1516_ALE 2306141 =187 (0.920)22 (0.140) 12/126 NT 14.2% intergenic (+7/+125) USA300HOU_RS11765/USA300HOU_RS11770 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 2306185 = 120 (0.750)intergenic (+51/+81) USA300HOU_RS11765/USA300HOU_RS11770 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 2307807 =151 (0.740)20 (0.120) 11/128 NT 13.7% intergenic (‑171/+65) USA300HOU_RS11770/fecD_2 hypothetical protein/Fe(3+) dicitrate transport system permease protein FecD
?USA300TCH1516_ALE 2307852 = 131 (0.810)intergenic (‑216/+20) USA300HOU_RS11770/fecD_2 hypothetical protein/Fe(3+) dicitrate transport system permease protein FecD
* ? USA300TCH1516_ALE = 2307822153 (0.750)16 (0.100) 9/128 NT 11.2% intergenic (‑186/+50) USA300HOU_RS11770/fecD_2 hypothetical protein/Fe(3+) dicitrate transport system permease protein FecD
?USA300TCH1516_ALE = 2307835 131 (0.810)intergenic (‑199/+37) USA300HOU_RS11770/fecD_2 hypothetical protein/Fe(3+) dicitrate transport system permease protein FecD
* ? USA300TCH1516_ALE 2317588 =NA (NA)57 (0.300) 12/150 NT 64.8% intergenic (+241/‑215) iucC_3/USA300TCH1516_02193 Aerobactin synthase/hypothetical protein
?USA300TCH1516_ALE 2317610 = 33 (0.160)intergenic (+263/‑193) iucC_3/USA300TCH1516_02193 Aerobactin synthase/hypothetical protein
* ? USA300TCH1516_ALE 2322819 =156 (0.770)11 (0.060) 7/142 NT 7.5% intergenic (‑259/+48) opuD_2/USA300HOU_RS11850 Glycine betaine transporter OpuD/Zinc‑type alcohol dehydrogenase‑like protein
?USA300TCH1516_ALE 2322856 = 132 (0.730)intergenic (‑296/+11) opuD_2/USA300HOU_RS11850 Glycine betaine transporter OpuD/Zinc‑type alcohol dehydrogenase‑like protein
* ? USA300TCH1516_ALE = 2322827144 (0.710)11 (0.060) 6/142 NT 7.8% intergenic (‑267/+40) opuD_2/USA300HOU_RS11850 Glycine betaine transporter OpuD/Zinc‑type alcohol dehydrogenase‑like protein
?USA300TCH1516_ALE = 2322846 132 (0.730)intergenic (‑286/+21) opuD_2/USA300HOU_RS11850 Glycine betaine transporter OpuD/Zinc‑type alcohol dehydrogenase‑like protein
* ? USA300TCH1516_ALE 2326404 =167 (0.820)14 (0.080) 9/146 NT 8.8% intergenic (‑149/+117) USA300HOU_RS11860/lacG hypothetical protein/6‑phospho‑beta‑galactosidase
?USA300TCH1516_ALE 2326426 = 139 (0.750)intergenic (‑171/+95) USA300HOU_RS11860/lacG hypothetical protein/6‑phospho‑beta‑galactosidase
* ? USA300TCH1516_ALE 2336425 =231 (1.130)17 (0.100) 9/138 NT 8.5% intergenic (‑145/+75) USA300HOU_RS11920/USA300HOU_RS11925 hypothetical protein/putative oxidoreductase/MSMEI_2347
?USA300TCH1516_ALE 2336465 = 166 (0.950)intergenic (‑185/+35) USA300HOU_RS11920/USA300HOU_RS11925 hypothetical protein/putative oxidoreductase/MSMEI_2347
* ? USA300TCH1516_ALE 2357381 =157 (0.770)13 (0.070) 8/140 NT 8.3% intergenic (‑331/+207) ecfA1/rplQ Energy‑coupling factor transporter ATP‑binding protein EcfA1/50S ribosomal protein L17
?USA300TCH1516_ALE 2357417 = 152 (0.850)intergenic (‑367/+171) ecfA1/rplQ Energy‑coupling factor transporter ATP‑binding protein EcfA1/50S ribosomal protein L17
* ? USA300TCH1516_ALE = 2357390155 (0.760)10 (0.060) 9/140 NT 6.5% intergenic (‑340/+198) ecfA1/rplQ Energy‑coupling factor transporter ATP‑binding protein EcfA1/50S ribosomal protein L17
?USA300TCH1516_ALE = 2357406 152 (0.850)intergenic (‑356/+182) ecfA1/rplQ Energy‑coupling factor transporter ATP‑binding protein EcfA1/50S ribosomal protein L17
* ? USA300TCH1516_ALE 2371393 =188 (0.920)9 (0.050) 6/146 NT 5.1% coding (111/309 nt) rpsJ 30S ribosomal protein S10
?USA300TCH1516_ALE 2371427 = 162 (0.870)coding (77/309 nt) rpsJ 30S ribosomal protein S10
* ? USA300TCH1516_ALE 2378465 =234 (1.150)13 (0.070) 7/140 NT 6.9% intergenic (+324/+95) glcU_2/USA300HOU_RS12220 putative glucose uptake protein GlcU/hypothetical protein
?USA300TCH1516_ALE 2378512 = 149 (0.840)intergenic (+371/+48) glcU_2/USA300HOU_RS12220 putative glucose uptake protein GlcU/hypothetical protein
* ? USA300TCH1516_ALE 2380461 =146 (0.720)20 (0.120) 10/132 NT 13.3% intergenic (+134/+53) USA300HOU_RS12230/swrC hypothetical protein/Swarming motility protein SwrC
?USA300TCH1516_ALE 2380507 = 140 (0.840)intergenic (+180/+7) USA300HOU_RS12230/swrC hypothetical protein/Swarming motility protein SwrC
* ? USA300TCH1516_ALE = 2380474153 (0.750)24 (0.140) 9/132 NT 15.3% intergenic (+147/+40) USA300HOU_RS12230/swrC hypothetical protein/Swarming motility protein SwrC
?USA300TCH1516_ALE = 2380492 140 (0.840)intergenic (+165/+22) USA300HOU_RS12230/swrC hypothetical protein/Swarming motility protein SwrC
* ? USA300TCH1516_ALE = 2383757162 (0.800)13 (0.080) 7/136 NT 8.1% intergenic (‑76/+41) swrC/femX Swarming motility protein SwrC/Lipid II:glycine glycyltransferase
?USA300TCH1516_ALE = 2383774 159 (0.920)intergenic (‑93/+24) swrC/femX Swarming motility protein SwrC/Lipid II:glycine glycyltransferase
* ? USA300TCH1516_ALE 2388283 =137 (0.670)17 (0.110) 9/126 NT 13.0% intergenic (+18/+84) ribZ_1/sarV Riboflavin transporter RibZ/HTH‑type transcriptional regulator SarV
?USA300TCH1516_ALE 2388362 = 121 (0.760)intergenic (+97/+5) ribZ_1/sarV Riboflavin transporter RibZ/HTH‑type transcriptional regulator SarV
* ? USA300TCH1516_ALE = 2388299138 (0.680)20 (0.130) 11/126 NT 14.9% intergenic (+34/+68) ribZ_1/sarV Riboflavin transporter RibZ/HTH‑type transcriptional regulator SarV
?USA300TCH1516_ALE = 2388344 121 (0.760)intergenic (+79/+23) ribZ_1/sarV Riboflavin transporter RibZ/HTH‑type transcriptional regulator SarV
* ? USA300TCH1516_ALE 2399023 =212 (1.040)23 (0.140) 11/134 NT 12.8% intergenic (+97/+75) fdhD/USA300HOU_RS12350 Sulfurtransferase FdhD/hypothetical protein
?USA300TCH1516_ALE 2399070 = 137 (0.800)intergenic (+144/+28) fdhD/USA300HOU_RS12350 Sulfurtransferase FdhD/hypothetical protein
* ? USA300TCH1516_ALE = 2421927160 (0.790)31 (0.170) 17/146 NT 17.3% intergenic (+43/+49) USA300HOU_RS12475/hpxO Putative 2‑hydroxyacid dehydrogenase/FAD‑dependent urate hydroxylase
?USA300TCH1516_ALE = 2421954 151 (0.810)intergenic (+70/+22) USA300HOU_RS12475/hpxO Putative 2‑hydroxyacid dehydrogenase/FAD‑dependent urate hydroxylase
* ? USA300TCH1516_ALE 2434868 =183 (0.900)11 (0.060) 8/140 NT 6.4% intergenic (+136/+251) ybbH_3/yifK putative HTH‑type transcriptional regulator YbbH/putative transport protein YifK
?USA300TCH1516_ALE 2434919 = 162 (0.910)intergenic (+187/+200) ybbH_3/yifK putative HTH‑type transcriptional regulator YbbH/putative transport protein YifK
* ? USA300TCH1516_ALE = 2434877172 (0.840)14 (0.080) 8/140 NT 8.2% intergenic (+145/+242) ybbH_3/yifK putative HTH‑type transcriptional regulator YbbH/putative transport protein YifK
?USA300TCH1516_ALE = 2434908 162 (0.910)intergenic (+176/+211) ybbH_3/yifK putative HTH‑type transcriptional regulator YbbH/putative transport protein YifK
* ? USA300TCH1516_ALE 2440041 =155 (0.760)8 (0.050) 6/136 NT 5.6% intergenic (+2/+64) USA300HOU_RS12570/malP hypothetical protein/PTS system maltose‑specific EIICB component
?USA300TCH1516_ALE 2440099 = 136 (0.790)intergenic (+60/+6) USA300HOU_RS12570/malP hypothetical protein/PTS system maltose‑specific EIICB component
* ? USA300TCH1516_ALE = 2440052151 (0.740)12 (0.070) 8/136 NT 8.3% intergenic (+13/+53) USA300HOU_RS12570/malP hypothetical protein/PTS system maltose‑specific EIICB component
?USA300TCH1516_ALE = 2440086 136 (0.790)intergenic (+47/+19) USA300HOU_RS12570/malP hypothetical protein/PTS system maltose‑specific EIICB component
* ? USA300TCH1516_ALE 2442806 =119 (0.580)17 (0.100) 12/128 NT 14.2% intergenic (+3/+55) glvR/USA300HOU_RS12585 HTH‑type transcriptional regulator GlvR/hypothetical protein
?USA300TCH1516_ALE 2442855 = 111 (0.680)intergenic (+52/+6) glvR/USA300HOU_RS12585 HTH‑type transcriptional regulator GlvR/hypothetical protein
* ? USA300TCH1516_ALE = 2442821122 (0.600)33 (0.200) 12/128 NT 24.1% intergenic (+18/+40) glvR/USA300HOU_RS12585 HTH‑type transcriptional regulator GlvR/hypothetical protein
?USA300TCH1516_ALE = 2442838 111 (0.680)intergenic (+35/+23) glvR/USA300HOU_RS12585 HTH‑type transcriptional regulator GlvR/hypothetical protein
* ? USA300TCH1516_ALE = 2444885165 (0.810)20 (0.110) 10/140 NT 11.4% intergenic (‑38/+187) mleN_2/USA300HOU_RS12595 Malate‑2H(+)/Na(+)‑lactate antiporter/hypothetical protein
?USA300TCH1516_ALE = 2444897 167 (0.940)intergenic (‑50/+175) mleN_2/USA300HOU_RS12595 Malate‑2H(+)/Na(+)‑lactate antiporter/hypothetical protein
* ? USA300TCH1516_ALE 2455747 =108 (0.530)13 (0.080) 5/132 NT 10.7% intergenic (+5/+61) lyrA/rpiA Lysostaphin resistance protein A/Ribose‑5‑phosphate isomerase A
?USA300TCH1516_ALE 2455795 = 127 (0.760)intergenic (+53/+13) lyrA/rpiA Lysostaphin resistance protein A/Ribose‑5‑phosphate isomerase A
* ? USA300TCH1516_ALE = 2455760122 (0.600)21 (0.130) 11/132 NT 15.6% intergenic (+18/+48) lyrA/rpiA Lysostaphin resistance protein A/Ribose‑5‑phosphate isomerase A
?USA300TCH1516_ALE = 2455780 127 (0.760)intergenic (+38/+28) lyrA/rpiA Lysostaphin resistance protein A/Ribose‑5‑phosphate isomerase A
* ? USA300TCH1516_ALE 2461467 =159 (0.780)20 (0.110) 9/146 NT 12.1% intergenic (‑193/+38) natA_2/yhaI ABC transporter ATP‑binding protein NatA/Inner membrane protein YhaI
?USA300TCH1516_ALE 2461499 = 147 (0.790)intergenic (‑225/+6) natA_2/yhaI ABC transporter ATP‑binding protein NatA/Inner membrane protein YhaI
* ? USA300TCH1516_ALE 2473265 =218 (1.070)31 (0.190) 13/126 NT 17.8% intergenic (+99/+131) USA300HOU_RS12730/bcr_1 hypothetical protein/Bicyclomycin resistance protein
?USA300TCH1516_ALE 2473309 = 116 (0.730)intergenic (+143/+87) USA300HOU_RS12730/bcr_1 hypothetical protein/Bicyclomycin resistance protein
* ? USA300TCH1516_ALE = 24784247 (0.030)6 (0.030) 4/146 NT 48.5% intergenic (+311/‑264) USA300HOU_RS12760/USA300HOU_RS12765 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 2478463 NA (NA)intergenic (+350/‑225) USA300HOU_RS12760/USA300HOU_RS12765 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 2483085 =206 (1.010)29 (0.170) 16/136 NT 15.4% intergenic (+5/‑158) hssS/USA300HOU_RS12790 Heme sensor protein HssS/putative HTH‑type transcriptional regulator
?USA300TCH1516_ALE 2483126 = 143 (0.830)intergenic (+46/‑117) hssS/USA300HOU_RS12790 Heme sensor protein HssS/putative HTH‑type transcriptional regulator
* ? USA300TCH1516_ALE 2489730 =230 (1.130)24 (0.140) 14/136 NT 11.6% intergenic (+79/+74) tarF_2/USA300HOU_RS12815 Teichoic acid glycerol‑phosphate transferase/putative lipoprotein
?USA300TCH1516_ALE 2489772 = 172 (1.000)intergenic (+121/+32) tarF_2/USA300HOU_RS12815 Teichoic acid glycerol‑phosphate transferase/putative lipoprotein
* ? USA300TCH1516_ALE 2492466 =142 (0.700)25 (0.140) 13/138 NT 18.6% intergenic (+9/+37) yhfP/rimI_4 Putative quinone oxidoreductase YhfP/Ribosomal‑protein‑alanine acetyltransferase
?USA300TCH1516_ALE 2492499 = 96 (0.550)intergenic (+42/+4) yhfP/rimI_4 Putative quinone oxidoreductase YhfP/Ribosomal‑protein‑alanine acetyltransferase
* ? USA300TCH1516_ALE 2499443 =168 (0.820)9 (0.050) 5/142 NT 5.6% intergenic (‑20/‑163) treP_2/USA300HOU_RS12875 PTS system trehalose‑specific EIIBC component/hypothetical protein
?USA300TCH1516_ALE 2499482 = 153 (0.850)intergenic (‑59/‑124) treP_2/USA300HOU_RS12875 PTS system trehalose‑specific EIIBC component/hypothetical protein
* ? USA300TCH1516_ALE = 2525589163 (0.800)8 (0.050) 6/130 NT 5.4% intergenic (‑161/+69) sirB/ytmI Sirohydrochlorin ferrochelatase/putative N‑acetyltransferase YtmI
?USA300TCH1516_ALE = 2525624 148 (0.900)intergenic (‑196/+34) sirB/ytmI Sirohydrochlorin ferrochelatase/putative N‑acetyltransferase YtmI
* ? USA300TCH1516_ALE 2533537 =140 (0.690)21 (0.120) 8/142 NT 13.3% intergenic (+33/+64) femA_3/tcyC_2 Aminoacyltransferase FemA/L‑cystine import ATP‑binding protein TcyC
?USA300TCH1516_ALE 2533595 = 150 (0.830)intergenic (+91/+6) femA_3/tcyC_2 Aminoacyltransferase FemA/L‑cystine import ATP‑binding protein TcyC
* ? USA300TCH1516_ALE = 2533545142 (0.700)9 (0.050) 6/142 NT 6.1% intergenic (+41/+56) femA_3/tcyC_2 Aminoacyltransferase FemA/L‑cystine import ATP‑binding protein TcyC
?USA300TCH1516_ALE = 2533585 150 (0.830)intergenic (+81/+16) femA_3/tcyC_2 Aminoacyltransferase FemA/L‑cystine import ATP‑binding protein TcyC
* ? USA300TCH1516_ALE 2537754 =219 (1.080)24 (0.140) 10/138 NT 12.3% intergenic (+108/+46) USA300TCH1516_02423/gpmA_2 hypothetical protein/2,3‑bisphosphoglycerate‑dependent phosphoglycerate mutase
?USA300TCH1516_ALE 2537797 = 154 (0.880)intergenic (+151/+3) USA300TCH1516_02423/gpmA_2 hypothetical protein/2,3‑bisphosphoglycerate‑dependent phosphoglycerate mutase
* ? USA300TCH1516_ALE = 2552502185 (0.910)11 (0.060) 8/140 NT 6.0% coding (740/1734 nt) USA300HOU_RS13150 putative ABC transporter ATP‑binding protein
?USA300TCH1516_ALE = 2552516 183 (1.030)coding (726/1734 nt) USA300HOU_RS13150 putative ABC transporter ATP‑binding protein
* ? USA300TCH1516_ALE 2569653 =207 (1.020)9 (0.050) 6/142 NT 5.3% intergenic (+5/+87) pbpX_2/USA300HOU_RS13235 Putative penicillin‑binding protein PbpX/UDP‑glucose 4‑epimerase
?USA300TCH1516_ALE 2569712 = 137 (0.760)intergenic (+64/+28) pbpX_2/USA300HOU_RS13235 Putative penicillin‑binding protein PbpX/UDP‑glucose 4‑epimerase
* ? USA300TCH1516_ALE 2573677 =229 (1.120)15 (0.090) 9/138 NT 8.0% intergenic (‑203/+91) norB_5/opuCD Quinolone resistance protein NorB/Carnitine transport permease protein OpuCD
?USA300TCH1516_ALE 2573715 = 146 (0.830)intergenic (‑241/+53) norB_5/opuCD Quinolone resistance protein NorB/Carnitine transport permease protein OpuCD
* ? USA300TCH1516_ALE = 2577878153 (0.750)26 (0.150) 11/140 NT 15.5% intergenic (‑599/+71) opuCA/USA300HOU_RS13285 Carnitine transport ATP‑binding protein OpuCA/hypothetical protein
?USA300TCH1516_ALE = 2577890 149 (0.840)intergenic (‑611/+59) opuCA/USA300HOU_RS13285 Carnitine transport ATP‑binding protein OpuCA/hypothetical protein
* ? USA300TCH1516_ALE 2580557 =168 (0.820)85 (0.450) 13/148 NT 37.1% intergenic (+192/‑416) yveA/pnbA Aspartate‑proton symporter/Para‑nitrobenzyl esterase
?USA300TCH1516_ALE 2580587 = 133 (0.710)intergenic (+222/‑386) yveA/pnbA Aspartate‑proton symporter/Para‑nitrobenzyl esterase
* ? USA300TCH1516_ALE 2588434 =177 (0.870)8 (0.040) 7/142 NT 5.2% intergenic (+17/+151) yehR/gltB_2 putative lipoprotein YehR/Glutamate synthase [NADPH] large chain
?USA300TCH1516_ALE 2588483 = 137 (0.760)intergenic (+66/+102) yehR/gltB_2 putative lipoprotein YehR/Glutamate synthase [NADPH] large chain
* ? USA300TCH1516_ALE = 2588442167 (0.820)9 (0.050) 6/142 NT 5.9% intergenic (+25/+143) yehR/gltB_2 putative lipoprotein YehR/Glutamate synthase [NADPH] large chain
?USA300TCH1516_ALE = 2588473 137 (0.760)intergenic (+56/+112) yehR/gltB_2 putative lipoprotein YehR/Glutamate synthase [NADPH] large chain
* ? USA300TCH1516_ALE 2591149 =197 (0.970)15 (0.080) 13/154 NT 7.7% intergenic (+43/+181) USA300HOU_RS13345/ttuB hypothetical protein/Putative tartrate transporter
?USA300TCH1516_ALE 2591189 = 168 (0.860)intergenic (+83/+141) USA300HOU_RS13345/ttuB hypothetical protein/Putative tartrate transporter
* ? USA300TCH1516_ALE 2605648 =229 (1.120)31 (0.170) 15/146 NT 13.7% intergenic (‑442/+10) ahpD/USA300HOU_RS13415 Alkyl hydroperoxide reductase AhpD/hypothetical protein
?USA300TCH1516_ALE 2605673 = 183 (0.990)coding (405/420 nt) USA300HOU_RS13415 hypothetical protein
* ? USA300TCH1516_ALE 2622923 =176 (0.860)14 (0.080) 8/142 NT 8.7% intergenic (‑253/+131) USA300HOU_RS13520/USA300TCH1516_02501 hypothetical protein/Putative surface protein
?USA300TCH1516_ALE 2622970 = 137 (0.760)intergenic (‑300/+84) USA300HOU_RS13520/USA300TCH1516_02501 hypothetical protein/Putative surface protein
* ? USA300TCH1516_ALE = 2626762305 (1.500)16 (0.090) 11/144 NT 5.4% coding (301/357 nt) sarT HTH‑type transcriptional regulator SarT
?USA300TCH1516_ALE = 2626767 289 (1.580)coding (296/357 nt) sarT HTH‑type transcriptional regulator SarT
* ? USA300TCH1516_ALE 2636356 =210 (1.030)9 (0.050) 7/138 NT 5.5% intergenic (‑409/+60) fnbA_2/gntT Fibronectin‑binding protein A/High‑affinity gluconate transporter
?USA300TCH1516_ALE 2636404 = 127 (0.720)intergenic (‑457/+12) fnbA_2/gntT Fibronectin‑binding protein A/High‑affinity gluconate transporter
* ? USA300TCH1516_ALE 2651119 =183 (0.900)10 (0.050) 5/146 NT 5.5% intergenic (+62/‑311) USA300HOU_RS13635/fbp hypothetical protein/Fructose‑1,6‑bisphosphatase class 3
?USA300TCH1516_ALE 2651153 = 176 (0.950)intergenic (+96/‑277) USA300HOU_RS13635/fbp hypothetical protein/Fructose‑1,6‑bisphosphatase class 3
* ? USA300TCH1516_ALE = 2651125182 (0.890)10 (0.050) 8/146 NT 5.5% intergenic (+68/‑305) USA300HOU_RS13635/fbp hypothetical protein/Fructose‑1,6‑bisphosphatase class 3
?USA300TCH1516_ALE = 2651145 176 (0.950)intergenic (+88/‑285) USA300HOU_RS13635/fbp hypothetical protein/Fructose‑1,6‑bisphosphatase class 3
* ? USA300TCH1516_ALE 2661788 =150 (0.740)30 (0.180) 13/128 NT 18.4% intergenic (‑181/‑140) ybiV/yydI Sugar phosphatase YbiV/putative peptide export ATP‑binding protein YydI
?USA300TCH1516_ALE 2661832 = 146 (0.900)intergenic (‑225/‑96) ybiV/yydI Sugar phosphatase YbiV/putative peptide export ATP‑binding protein YydI
* ? USA300TCH1516_ALE = 2661803156 (0.770)12 (0.070) 7/128 NT 8.2% intergenic (‑196/‑125) ybiV/yydI Sugar phosphatase YbiV/putative peptide export ATP‑binding protein YydI
?USA300TCH1516_ALE = 2661815 146 (0.900)intergenic (‑208/‑113) ybiV/yydI Sugar phosphatase YbiV/putative peptide export ATP‑binding protein YydI
* ? USA300TCH1516_ALE 2665481 =139 (0.680)21 (0.120) 10/138 NT 14.7% intergenic (‑108/+71) USA300TCH1516_02535/sdhA hypothetical protein/L‑serine dehydratase, alpha chain
?USA300TCH1516_ALE 2665525 = 125 (0.710)intergenic (‑152/+27) USA300TCH1516_02535/sdhA hypothetical protein/L‑serine dehydratase, alpha chain
* ? USA300TCH1516_ALE = 2665491149 (0.730)19 (0.110) 11/138 NT 13.0% intergenic (‑118/+61) USA300TCH1516_02535/sdhA hypothetical protein/L‑serine dehydratase, alpha chain
?USA300TCH1516_ALE = 2665513 125 (0.710)intergenic (‑140/+39) USA300TCH1516_02535/sdhA hypothetical protein/L‑serine dehydratase, alpha chain
* ? USA300TCH1516_ALE 2674533 =142 (0.700)7 (0.040) 5/140 NT 5.8% intergenic (‑45/+256) glcB/ydaP PTS system glucoside‑specific EIICBA component/Putative thiamine pyrophosphate‑containing protein YdaP
?USA300TCH1516_ALE 2674588 = 105 (0.590)intergenic (‑100/+201) glcB/ydaP PTS system glucoside‑specific EIICBA component/Putative thiamine pyrophosphate‑containing protein YdaP
* ? USA300TCH1516_ALE = 2674542140 (0.690)11 (0.060) 7/140 NT 8.8% intergenic (‑54/+247) glcB/ydaP PTS system glucoside‑specific EIICBA component/Putative thiamine pyrophosphate‑containing protein YdaP
?USA300TCH1516_ALE = 2674577 105 (0.590)intergenic (‑89/+212) glcB/ydaP PTS system glucoside‑specific EIICBA component/Putative thiamine pyrophosphate‑containing protein YdaP
* ? USA300TCH1516_ALE = 2679966193 (0.950)15 (0.090) 6/130 NT 7.9% intergenic (+18/+742) ssaA2_4/USA300HOU_RS13810 Staphylococcal secretory antigen ssaA2/hypothetical protein
?USA300TCH1516_ALE = 2679991 194 (1.180)intergenic (+43/+717) ssaA2_4/USA300HOU_RS13810 Staphylococcal secretory antigen ssaA2/hypothetical protein
* ? USA300TCH1516_ALE 2679992 =218 (1.070)21 (0.130) 8/130 NT 10.2% intergenic (+44/+716) ssaA2_4/USA300HOU_RS13810 Staphylococcal secretory antigen ssaA2/hypothetical protein
?USA300TCH1516_ALE 2681425 = 193 (1.170)intergenic (‑460/+119) USA300HOU_RS13810/mvaA hypothetical protein/3‑hydroxy‑3‑methylglutaryl‑coenzyme A reductase
* ? USA300TCH1516_ALE = 2680006213 (1.050)21 (0.130) 8/130 NT 10.3% intergenic (+58/+702) ssaA2_4/USA300HOU_RS13810 Staphylococcal secretory antigen ssaA2/hypothetical protein
?USA300TCH1516_ALE = 2681409 193 (1.170)intergenic (‑444/+135) USA300HOU_RS13810/mvaA hypothetical protein/3‑hydroxy‑3‑methylglutaryl‑coenzyme A reductase
* ? USA300TCH1516_ALE 2681410 =206 (1.010)9 (0.050) 5/130 NT 5.6% intergenic (‑445/+134) USA300HOU_RS13810/mvaA hypothetical protein/3‑hydroxy‑3‑methylglutaryl‑coenzyme A reductase
?USA300TCH1516_ALE 2681465 = 136 (0.820)intergenic (‑500/+79) USA300HOU_RS13810/mvaA hypothetical protein/3‑hydroxy‑3‑methylglutaryl‑coenzyme A reductase
* ? USA300TCH1516_ALE 2681949 =134 (0.660)10 (0.050) 7/150 NT 7.0% coding (873/1278 nt) mvaA 3‑hydroxy‑3‑methylglutaryl‑coenzyme A reductase
?USA300TCH1516_ALE 2681984 = 142 (0.740)coding (838/1278 nt) mvaA 3‑hydroxy‑3‑methylglutaryl‑coenzyme A reductase
* ? USA300TCH1516_ALE 2684279 =151 (0.740)12 (0.070) 9/136 NT 8.3% intergenic (+38/+132) mvaS/ogt Hydroxymethylglutaryl‑CoA synthase/Methylated‑DNA‑‑protein‑cysteine methyltransferase
?USA300TCH1516_ALE 2684320 = 138 (0.800)intergenic (+79/+91) mvaS/ogt Hydroxymethylglutaryl‑CoA synthase/Methylated‑DNA‑‑protein‑cysteine methyltransferase
* ? USA300TCH1516_ALE = 2684290146 (0.720)17 (0.100) 9/136 NT 11.5% intergenic (+49/+121) mvaS/ogt Hydroxymethylglutaryl‑CoA synthase/Methylated‑DNA‑‑protein‑cysteine methyltransferase
?USA300TCH1516_ALE = 2684307 138 (0.800)intergenic (+66/+104) mvaS/ogt Hydroxymethylglutaryl‑CoA synthase/Methylated‑DNA‑‑protein‑cysteine methyltransferase
* ? USA300TCH1516_ALE 2687471 =160 (0.790)29 (0.170) 12/138 NT 19.4% intergenic (+25/+44) clpL/USA300HOU_RS13835 ATP‑dependent Clp protease ATP‑binding subunit ClpL/hypothetical protein
?USA300TCH1516_ALE 2687511 = 104 (0.590)intergenic (+65/+4) clpL/USA300HOU_RS13835 ATP‑dependent Clp protease ATP‑binding subunit ClpL/hypothetical protein
* ? USA300TCH1516_ALE 2693368 =148 (0.730)33 (0.190) 13/136 NT 20.3% intergenic (+39/+317) mtrR/rocA HTH‑type transcriptional regulator MtrR/1‑pyrroline‑5‑carboxylate dehydrogenase
?USA300TCH1516_ALE 2693417 = 134 (0.780)intergenic (+88/+268) mtrR/rocA HTH‑type transcriptional regulator MtrR/1‑pyrroline‑5‑carboxylate dehydrogenase
* ? USA300TCH1516_ALE = 2693379154 (0.760)20 (0.120) 13/136 NT 13.1% intergenic (+50/+306) mtrR/rocA HTH‑type transcriptional regulator MtrR/1‑pyrroline‑5‑carboxylate dehydrogenase
?USA300TCH1516_ALE = 2693404 134 (0.780)intergenic (+75/+281) mtrR/rocA HTH‑type transcriptional regulator MtrR/1‑pyrroline‑5‑carboxylate dehydrogenase
* ? USA300TCH1516_ALE 2696548 =156 (0.770)16 (0.090) 11/140 NT 11.2% intergenic (+100/‑140) USA300HOU_RS13875/copA hypothetical protein/Copper‑exporting P‑type ATPase A
?USA300TCH1516_ALE 2696587 = 117 (0.660)intergenic (+139/‑101) USA300HOU_RS13875/copA hypothetical protein/Copper‑exporting P‑type ATPase A
* ? USA300TCH1516_ALE 2699622 =78 (0.380)12 (0.070) 6/140 NT 12.4% intergenic (+29/+61) copZ/ldhD_2 Copper chaperone CopZ/D‑lactate dehydrogenase
?USA300TCH1516_ALE 2699690 = 101 (0.570)coding (992/999 nt) ldhD_2 D‑lactate dehydrogenase
* ? USA300TCH1516_ALE = 269964693 (0.460)18 (0.120) 11/122 NT 18.3% intergenic (+53/+37) copZ/ldhD_2 Copper chaperone CopZ/D‑lactate dehydrogenase
?USA300TCH1516_ALE = 2699665 90 (0.580)intergenic (+72/+18) copZ/ldhD_2 Copper chaperone CopZ/D‑lactate dehydrogenase
* ? USA300TCH1516_ALE 2716742 =130 (0.640)7 (0.040) 6/138 NT 5.4% intergenic (+50/+100) USA300HOU_RS13965/USA300HOU_RS13970 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 2716816 = 132 (0.750)intergenic (+124/+26) USA300HOU_RS13965/USA300HOU_RS13970 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 2716752129 (0.630)10 (0.060) 6/138 NT 7.6% intergenic (+60/+90) USA300HOU_RS13965/USA300HOU_RS13970 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 2716804 132 (0.750)intergenic (+112/+38) USA300HOU_RS13965/USA300HOU_RS13970 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 2719380168 (0.820)9 (0.050) 6/136 NT 5.3% coding (324/705 nt) cpnA Cyclopentanol dehydrogenase
?USA300TCH1516_ALE = 2719397 178 (1.030)coding (341/705 nt) cpnA Cyclopentanol dehydrogenase
* ? USA300TCH1516_ALE 2731249 =175 (0.860)27 (0.150) 8/138 NT 16.3% intergenic (+45/+36) USA300HOU_RS14055/USA300HOU_RS14060 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 2731282 = 126 (0.720)intergenic (+78/+3) USA300HOU_RS14055/USA300HOU_RS14060 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE 2740966 =122 (0.600)33 (0.200) 16/132 NT 23.6% intergenic (+8/+73) yhdG_2/USA300HOU_RS14115 putative amino acid permease YhdG/Isoleucine 2‑epimerase
?USA300TCH1516_ALE 2741016 = 113 (0.670)intergenic (+58/+23) yhdG_2/USA300HOU_RS14115 putative amino acid permease YhdG/Isoleucine 2‑epimerase
* ? USA300TCH1516_ALE = 2740979120 (0.590)30 (0.180) 15/132 NT 22.1% intergenic (+21/+60) yhdG_2/USA300HOU_RS14115 putative amino acid permease YhdG/Isoleucine 2‑epimerase
?USA300TCH1516_ALE = 2741001 113 (0.670)intergenic (+43/+38) yhdG_2/USA300HOU_RS14115 putative amino acid permease YhdG/Isoleucine 2‑epimerase
* ? USA300TCH1516_ALE 2744105 =172 (0.840)10 (0.060) 7/140 NT 6.8% intergenic (+42/+151) fda/mqo2 Fructose‑bisphosphate aldolase class 1/putative malate:quinone oxidoreductase 2
?USA300TCH1516_ALE 2744143 = 124 (0.700)intergenic (+80/+113) fda/mqo2 Fructose‑bisphosphate aldolase class 1/putative malate:quinone oxidoreductase 2
* ? USA300TCH1516_ALE = 2751374149 (0.730)14 (0.080) 7/146 NT 9.4% intergenic (‑222/+39) betA/gbsA Oxygen‑dependent choline dehydrogenase/Betaine aldehyde dehydrogenase
?USA300TCH1516_ALE = 2751393 134 (0.720)intergenic (‑241/+20) betA/gbsA Oxygen‑dependent choline dehydrogenase/Betaine aldehyde dehydrogenase
* ? USA300TCH1516_ALE = 2772627176 (0.860)19 (0.100) 13/152 NT 11.7% intergenic (+1/+59) phoB/USA300TCH1516_02632 Alkaline phosphatase 3/hypothetical protein
?USA300TCH1516_ALE = 2772679 120 (0.620)intergenic (+53/+7) phoB/USA300TCH1516_02632 Alkaline phosphatase 3/hypothetical protein
* ? USA300TCH1516_ALE 2772633 =174 (0.850)32 (0.190) 10/134 NT 20.5% intergenic (+7/+53) phoB/USA300TCH1516_02632 Alkaline phosphatase 3/hypothetical protein
?USA300TCH1516_ALE 2772676 = 103 (0.610)intergenic (+50/+10) phoB/USA300TCH1516_02632 Alkaline phosphatase 3/hypothetical protein
* ? USA300TCH1516_ALE 2787502 =224 (1.100)18 (0.100) 10/142 NT 9.5% intergenic (+48/‑192) zipA_3/manR_2 Cell division protein ZipA/Transcriptional regulator ManR
?USA300TCH1516_ALE 2787547 = 146 (0.810)intergenic (+93/‑147) zipA_3/manR_2 Cell division protein ZipA/Transcriptional regulator ManR
* ? USA300TCH1516_ALE 2830190 =176 (0.860)15 (0.090) 10/138 NT 9.4% intergenic (+18/+429) icaC/lipA_2 putative poly‑beta‑1,6‑N‑acetyl‑D‑glucosamine export protein/Lipase 1
?USA300TCH1516_ALE 2830247 = 137 (0.780)intergenic (+75/+372) icaC/lipA_2 putative poly‑beta‑1,6‑N‑acetyl‑D‑glucosamine export protein/Lipase 1
* ? USA300TCH1516_ALE 2850817 =144 (0.710)22 (0.130) 12/132 NT 15.7% intergenic (+16/+103) pcp/USA300HOU_RS14605 Pyrrolidone‑carboxylate peptidase/hypothetical protein
?USA300TCH1516_ALE 2850866 = 117 (0.700)intergenic (+65/+54) pcp/USA300HOU_RS14605 Pyrrolidone‑carboxylate peptidase/hypothetical protein
* ? USA300TCH1516_ALE = 2850830142 (0.700)17 (0.100) 8/132 NT 12.7% intergenic (+29/+90) pcp/USA300HOU_RS14605 Pyrrolidone‑carboxylate peptidase/hypothetical protein
?USA300TCH1516_ALE = 2850851 117 (0.700)intergenic (+50/+69) pcp/USA300HOU_RS14605 Pyrrolidone‑carboxylate peptidase/hypothetical protein
* ? USA300TCH1516_ALE = 2854319183 (0.900)28 (0.150) 12/150 NT 13.7% intergenic (+17/+396) yflS/USA300HOU_RS14625 Putative malate transporter YflS/hypothetical protein
?USA300TCH1516_ALE = 2854338 181 (0.950)intergenic (+36/+377) yflS/USA300HOU_RS14625 Putative malate transporter YflS/hypothetical protein
* ? USA300TCH1516_ALE 2863041 =188 (0.920)25 (0.140) 11/142 NT 13.0% intergenic (+11/+49) USA300TCH1516_02707/USA300HOU_RS14670 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE 2863075 = 168 (0.930)intergenic (+45/+15) USA300TCH1516_02707/USA300HOU_RS14670 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 2863074186 (0.910)22 (0.120) 11/150 NT 11.2% intergenic (+44/+16) USA300TCH1516_02707/USA300HOU_RS14670 hypothetical protein/hypothetical protein
?USA300TCH1516_ALE = 2864026 NA (NA)intergenic (‑439/‑19) USA300HOU_RS14670/USA300HOU_RS14675 hypothetical protein/hypothetical protein
* ? USA300TCH1516_ALE = 2866995150 (0.740)23 (0.140) 13/134 NT 14.6% intergenic (‑394/+59) USA300HOU_RS14695/noc_2 hypothetical protein/Nucleoid occlusion protein
?USA300TCH1516_ALE = 2867006 144 (0.850)intergenic (‑405/+48) USA300HOU_RS14695/noc_2 hypothetical protein/Nucleoid occlusion protein